CN117683909A - Molecular marker related to Tibetan sheep immune traits and application thereof - Google Patents
Molecular marker related to Tibetan sheep immune traits and application thereof Download PDFInfo
- Publication number
- CN117683909A CN117683909A CN202410106445.1A CN202410106445A CN117683909A CN 117683909 A CN117683909 A CN 117683909A CN 202410106445 A CN202410106445 A CN 202410106445A CN 117683909 A CN117683909 A CN 117683909A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- tibetan sheep
- tibetan
- base
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001494479 Pecora Species 0.000 title claims abstract description 59
- 239000003147 molecular marker Substances 0.000 title claims abstract description 56
- 238000001514 detection method Methods 0.000 claims abstract description 28
- 208000012936 Sheep disease Diseases 0.000 claims abstract description 14
- 239000002773 nucleotide Substances 0.000 claims abstract description 9
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 9
- 239000008280 blood Substances 0.000 claims description 20
- 210000004369 blood Anatomy 0.000 claims description 20
- 238000009395 breeding Methods 0.000 claims description 14
- 230000001488 breeding effect Effects 0.000 claims description 14
- 238000012408 PCR amplification Methods 0.000 claims description 13
- 239000003795 chemical substances by application Substances 0.000 claims description 12
- 210000000349 chromosome Anatomy 0.000 claims description 12
- 238000012216 screening Methods 0.000 claims description 11
- 238000000338 in vitro Methods 0.000 claims description 9
- 238000011144 upstream manufacturing Methods 0.000 claims description 7
- 238000000034 method Methods 0.000 claims description 6
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 claims description 5
- 239000010931 gold Substances 0.000 claims description 5
- 229910052737 gold Inorganic materials 0.000 claims description 5
- 239000000203 mixture Substances 0.000 claims description 5
- 238000003205 genotyping method Methods 0.000 claims description 4
- 238000003752 polymerase chain reaction Methods 0.000 claims description 4
- 238000000137 annealing Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims 2
- 230000000869 mutational effect Effects 0.000 claims 1
- 230000008901 benefit Effects 0.000 abstract description 6
- 238000011156 evaluation Methods 0.000 abstract description 3
- 230000008621 organismal health Effects 0.000 abstract description 3
- 238000010187 selection method Methods 0.000 abstract description 3
- 239000000047 product Substances 0.000 description 14
- 108060003951 Immunoglobulin Proteins 0.000 description 9
- 102000018358 immunoglobulin Human genes 0.000 description 9
- 238000012163 sequencing technique Methods 0.000 description 8
- 238000005516 engineering process Methods 0.000 description 6
- 108700028369 Alleles Proteins 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 208000035240 Disease Resistance Diseases 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 230000036039 immunity Effects 0.000 description 2
- 230000006872 improvement Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 210000002268 wool Anatomy 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 239000000980 acid dye Substances 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000002759 chromosomal effect Effects 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000000875 corresponding effect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000035558 fertility Effects 0.000 description 1
- 230000008014 freezing Effects 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 239000000446 fuel Substances 0.000 description 1
- 230000008303 genetic mechanism Effects 0.000 description 1
- 229940072221 immunoglobulins Drugs 0.000 description 1
- 239000012535 impurity Substances 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000009304 pastoral farming Methods 0.000 description 1
- 239000003805 procoagulant Substances 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 238000002798 spectrophotometry method Methods 0.000 description 1
- 239000012086 standard solution Substances 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular markers, and provides a molecular marker related to Tibetan sheep immune traits and application thereof, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1. Compared with the traditional detection method, the SNP molecular marker polymorphism detection method has the advantages of high accuracy, high detection speed, low cost, easy judgment of results and the like. SNP locus detection is used for carrying out Tibetan sheep immune trait evaluation, and an early Tibetan sheep disease resistance selection method is established so as to ensure Tibetan sheep organism health and contribute to increasing economic benefit.
Description
Technical Field
The invention relates to the technical field of molecular markers, in particular to a molecular marker related to Tibetan sheep immune traits and application thereof.
Background
The Tibetan sheep has the characteristics of large population quantity, wide distribution, unique biological characteristics, good meat performance, excellent carpet wool quality and the like, provides production and living data of meat, wool, fuel and the like for Tibetan people, is a symbol of wealth, is an important carrier for Tibetan Buddhism and Tibetan language inheritance and development, and is a very precious gene treasury genetically. At present, the problems of insufficient breeding, small group size, difficulty in meeting market demands and the like still exist on production traits such as fertility, disease resistance and the like of Tibetan sheep, and the construction of a breeding technology system is still relatively lagged, and the problems are one of key factors influencing sustainable development of Tibetan sheep industry.
With the rapid development of DNA molecular marker technology, a foundation is laid for people to study the genetic mechanism of Tibetan sheep disease resistance on a molecular level, and the screening to obtain corresponding molecular markers is convenient for more efficient screening assistance for Tibetan sheep disease resistance breeding, which is a technical problem to be solved urgently in the field. Therefore, development and establishment of a modern biological breeding technology system are urgently needed to accelerate the genetic improvement and new variety cultivation of Tibetan sheep. In the prior art, the auxiliary selection of the molecular marker related to the disease resistance of the molecular marker related to the Tibetan sheep immunity is not more, so that the auxiliary selection of the molecular marker related to the disease resistance of the molecular marker related to the Tibetan sheep immunity is particularly important.
Disclosure of Invention
The invention aims to provide a molecular marker related to Tibetan sheep immune traits and application thereof, develop and establish a modern biological breeding technology system, and accelerate Tibetan sheep genetic improvement and new variety cultivation.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a molecular marker related to Tibetan sheep immune traits, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1;
preferably, the molecular marker is located on the 161665855 th base of chromosome 1 of sheep genome oar_v4.0 version GenBank accession No. nc_ 019458.2.
Preferably, the molecular marker comprises an SNP locus, the SNP locus is positioned at the 117 th position of the molecular marker, and the mutation base of the SNP locus is A or G.
Preferably, when the molecular marker base is A, the genotype is AA or AG; when the molecular marker base is G, the genotype is GG.
The invention also provides application of the molecular marker in preparing Tibetan sheep immune trait in-vitro detection or Tibetan sheep disease-resistant breeding screening products.
The invention also provides a specific primer group of the molecular marker, which comprises an upstream primer with a sequence shown as SEQ ID NO.2 and a downstream primer with a sequence shown as SEQ ID NO. 3.
The invention also provides application of the specific primer group in-vitro detection of Tibetan sheep immune traits or in Tibetan sheep disease-resistant breeding screening.
The invention also provides a method for in vitro detection of Tibetan sheep immune traits or screening Tibetan sheep disease-resistant breeding, which comprises the following steps:
(1) Extracting Tibetan sheep blood genome DNA;
(2) Taking Tibetan sheep blood genome DNA as a template, and adopting the specific primer group to carry out PCR amplification to obtain a PCR amplification product;
(3) Purifying the PCR amplification product, and carrying out genotyping detection, wherein when the SNP molecular marker base is A, the genotype is AA or AG; when the SNP molecular marker base is G, the genotype is GG.
Preferably, the PCR amplification system in step (2) is: gold medal Mix (green) 22. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, genomic DNA 1. Mu.L.
Preferably, the PCR amplification procedure in step (2) is: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 57℃for 10s, extension at 72℃for 10s for 40 cycles; final extension at 72℃for 2min.
The invention provides a molecular marker related to Tibetan sheep immune traits and application thereof, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1. Compared with the traditional detection method, the SNP molecular marker polymorphism detection method has the advantages of high accuracy, high detection speed, low cost, easy judgment of results and the like. SNP locus detection is used for carrying out Tibetan sheep immune trait evaluation, and an early Tibetan sheep disease resistance selection method is established so as to ensure Tibetan sheep organism health and contribute to increasing economic benefit.
Drawings
FIG. 1 shows the amplification products of the SNP site of chromosome 1G 161665855A > G of Tibetan sheep;
FIG. 2 shows the peak pattern and sequence obtained after purification and sequencing of PCR products.
Detailed Description
The invention provides a molecular marker related to Tibetan sheep immune traits, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1;
the sequence of SEQ ID NO.1 is: GAAGAGCAGAGTCCTAAACACTGTT CCACCAGGGAAATCCCATACTTTGATTTTTTTCTTAACTCAGTGGTCTTCCGATGTCCTAATGACTTATTTTTAACCAGTCATGGAAAGAAGTAACAAAGGTTTTTTGATTTCGAAAGCTAAGGCAATAACTCTGCTTTCAATGTGTTTTGTTTCTTTTACATTTGAGGTAGAAAAATAAAAAAATCTTATTCTGAACATTGAGAAACCCTTGGCCTTCCTACAGTTTTATAATAATTATAATAAATTAATCAATTCAATAGCAACAGATTCATCTTCAAGTTAAACATCTTTTTTTAGACCACTAGAAGAGAGAGTTTAGAGCTCTCTTCTAAATTCCTCTCTGTGAAAGGGCAGAGTTTTCACTTTTGTTCTCCAATTGAGCTGACAGTGTATTTAGTAAAAAAAAAAAAAAAAAAAAAAAAGAGACAGATATTTATGGCATAATGGTATATGTGAGA.
In the present invention, the molecular marker is located on 161665855 th base of chromosome 1 of sheep genome oar_v4.0 version GenBank accession No. nc_ 019458.2.
In the invention, the molecular marker comprises an SNP locus, the SNP locus is positioned at the 117 th position of the molecular marker, and the mutation base of the SNP locus is A or G.
In the invention, when the molecular marker base is A, the genotype is AA or AG; when the molecular marker base is G, the genotype is GG.
The invention also provides application of the molecular marker in preparing Tibetan sheep immune trait in-vitro detection or Tibetan sheep disease-resistant breeding screening products.
The invention also provides a specific primer group of the molecular marker, which comprises an upstream primer with a sequence shown as SEQ ID NO.2 and a downstream primer with a sequence shown as SEQ ID NO. 3.
The invention also provides application of the specific primer group in-vitro detection of Tibetan sheep immune traits or in Tibetan sheep disease-resistant breeding screening.
The invention also provides a method for in vitro detection of Tibetan sheep immune traits or screening Tibetan sheep disease-resistant breeding, which comprises the following steps:
(1) Extracting Tibetan sheep blood genome DNA;
(2) Taking Tibetan sheep blood genome DNA as a template, and adopting the specific primer group to carry out PCR amplification to obtain a PCR amplification product;
(3) Purifying the PCR amplification product, and carrying out genotyping detection, wherein when the SNP molecular marker base is A, the genotype is AA or AG; when the SNP molecular marker base is G, the genotype is GG.
In the present invention, the PCR amplification system in step (2) is preferably: gold medal Mix (green) 22. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, genomic DNA 1. Mu.L.
In the present invention, the PCR amplification procedure in step (2) is preferably a pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 57℃for 10s, extension at 72℃for 10s for 40 cycles; final extension at 72℃for 2min.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1 sample collection
The sample is from Tibetan sheep group under natural grazing condition, wherein 44 parts of Gannan Tibetan autonomous state in Gansu province, 44 parts of Jade Tree in Qinghai province, 45 parts of Tibetan autonomous region day click market, 5mL of 133 fasting Tibetan sheep blood sample is collected in a clean procoagulant vacuum blood collection tube, kept stand for 30min, centrifuged for 15min at 3500r/min, the supernatant is sucked in a clean PE tube, sealed and stored in a low-temperature refrigerator at-20 ℃; and collecting 5mL of blood sample in a blood collection tube added with EDTA-K2 anticoagulant, quickly and uniformly mixing the blood sample after the blood sample is collected, temporarily storing the blood sample in a sampling box containing an ice bag, and carrying the blood sample back to a laboratory for freezing and preserving the blood sample in a refrigerator at the temperature of minus 20 ℃ for DNA extraction.
2 main reagents and instruments
EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli medical instruments Co., ltd; blood genome extraction kit was purchased from tiangen biochemical technology (beijing) limited; nanoDrop2000 spectrophotometer us Thermo Fisher Scientific company; DL2000 Marker, agarose, nucleic acid dye were all purchased from Beijing Soy Bao technology Co., ltd; gold medal Mix (green) was purchased from beijing engine biotechnology limited; the electrophoresis apparatus is purchased from Beijing Liuyi instrument factory; PCR instrument was purchased from BioRad corporation. IgA (E027-1-1), igG (E026-1-1), igM (E025-1-1) detection kits were purchased from Nanjing's institute of biological engineering.
3 method
3.1 immunoglobulin IgA, igG, igM detection
The detection kit is used for measurement by a spectrophotometry method according to the Nanjing institute of biological engineering IgA, igG, igM. Firstly, establishing a standard curve by using a standard substance; secondly, distilled water, standard solution and 7uL of a sample to be detected are respectively added into a blank tube, a standard tube and a measuring tube, R1 solution is supplemented to 900uL, incubation is carried out for 5min at 37 ℃, and the reading number at the wavelength of 340nm is recorded as A1; then adding 180uL of R2 solution into each tube, incubating for 5min at 37 ℃, and recording the reading number as A2 at the wavelength of 340 nm; finally, calculating DeltaA=A2-A1, and taking DeltaA into a standard curve equation to calculate the concentration of the sample IgA, igG, igM.
3.2 extraction of genomic DNA from blood
Extracting genome DNA from blood sample by adopting a blood genome extraction kit of Tiangen biochemical technology (Beijing) limited company, and placing the extracted DNA under an ultraviolet spectrophotometer to detect the concentration and purity, wherein the concentration is more than 20 ng/mu L, OD260/OD280 and is between 1.7 and 1.9, thus meeting the experimental requirement, and storing at-20 ℃ for standby.
3.3 primer design
Referring to the International sheep genome oar_v4.0 version No.1 chromosomal gene sequence (GenBank accession number: NC_ 019458.2), a pair of specific primers was designed using primepremier 5.0 software, containing the g161665855A > G SNP site.
Primer sequence:
F：5'–GAAGAGCAGAGTCCTAAACA-3'(SEQ ID NO.2)；
R：5'-TCTCACATATACCATTATGCC-3'(SEQ ID NO.3)。
the length of the amplified fragment is 485bp, and the primer is synthesized by Beijing qing biological science and technology Co.
3.4PCR amplification and sequencing
PCR amplification System 25. Mu.L: gold medal Mix (green) 22. Mu.L, 1. Mu.L each of the upstream and downstream primers, and 1. Mu.L of genomic DNA.
PCR amplification procedure: 98 ℃ for 2min;98 ℃ for 10s,57 ℃ for 10s and 72 ℃ for 10s, 40 cycles in total; extending at 72℃for 2min.
And detecting the PCR product by using 1.5% agarose gel electrophoresis, and after the PCR product is qualified by using the agarose gel electrophoresis detection, sequencing by using a direct sequencing method, and completing sequencing by Beijing qingke biotechnology Co. The amplified nucleotide sequence is shown as SEQ ID NO.1, and the SNP marker is positioned at position 117 of the nucleotide sequence shown as SEQ ID NO. 1.
And comparing the sequencing results of the PCR products by using biological analysis software MEGA6.0, and analyzing a sequencing peak diagram to finish typing.
4 statistical analysis
And counting the number of individuals with different genotypes at each site according to the genotyping result. The gene frequency, genotype frequency, effective allele factor (Ne), site heterozygosity (He) and Hardy-Weinberg equilibrium test of g161665855A > G are calculated by using Popgen32 software, and the polymorphism information content is calculated by using PIC (polymorphism information content, PIC for short) calculation software. The correlation of Tibetan sheep different genotypes with immunoglobulin IgA, igG, igM was analyzed using a general linear model in IBM SPSS Statistics software and the results are expressed as "mean ± standard error".
5 results
5.1PCR amplification and sequencing results
The amplified product of the SNP locus of the Tibetan sheep chromosome 1G 161665855A > G (see figure 1) is detected by using 1.5% agarose gel, the band is clear, the band is free from impurity, the specificity is good, the fragment size of the PCR product is 485bp, and the fragment size meets the expected size, and the next experiment can be carried out.
The peak pattern and sequence obtained after the PCR product is purified and sequenced are shown in FIG. 2. As is clear from FIG. 2, the A-G mutation occurred at the G161665855A > G SNP site, and three genotypes of AA, AG and GG were present.
2.2 statistical analysis results
Genotype and allele frequency of the Tibetan sheep chromosome 1G 161665855a > G SNP site were analyzed from a population genetics perspective. As can be seen from Table 1, the GG genotype was most frequently found at the G161665855A > G SNP site, and the G allele frequency was 89.1% for the dominant genotype, which was expressed as the dominant allele. The χ2 fitness test showed that the SNP site was significantly deviated from Hardy-Weinberg equilibrium (P < 0.05) (Table 1). The expected heterozygosity of the locus is 0.194, PIC is 0.175, PIC is less than 0.25, and the locus belongs to low-level polymorphism.
TABLE 1 Tibetan sheep chromosome 1G 161665855A > G SNP site polymorphism
2.3 correlation analysis of different genotypes with immunoglobulin IgA, igG, igM
Analysis of the correlation of Tibetan sheep different genotypes with immunoglobulin IgA, igG, igM content using a general linear model in IBM SPSS Statistics software revealed that immunoglobulin IgA, igG, igM was significantly higher in Tibetan sheep individuals of AA genotype than in AG and GG genotype individuals (P < 0.05), and that the AG and GG genotypes did not show significant differences between individuals (P > 0.05), indicating that the base of the Tibetan sheep chromosome 1G 161665855a > G SNP site was significantly correlated with Tibetan sheep IgA, igG, igM (P < 0.05), being a Tibetan sheep IgA, igG, igM-related SNP marker. The results are shown in Table 2.
TABLE 2 correlation analysis between different genotypes and immunoglobulins IgA, igG, igM
Note that: the same row of data is marked with different lower case letters to indicate that the difference is significant (P < 0.05).
In summary, the SNP molecular marker is positioned at 161665855 bases on chromosome 1 of the international sheep reference genome oar_v4.0 version 1; the mutation type is A/G, named G161665855A > G, three genotypes exist, and when 161665855 th base on the chromosome 1 is A, the genotype is AA or AG; when 161665855 bases on chromosome 1 are G, the genotype is GG; by correlation analysis of different genotypes and immunoglobulin IgA, igG, igM content, it was found that the immunoglobulin IgA, igG, igM of Tibetan sheep individuals of the AA genotype was significantly higher than those of AG and GG genotypes (p < 0.05), and that no significant difference (p > 0.05) was exhibited between AG and GG genotypes individuals. The content of immunoglobulin IgA, igG, igM in Tibetan sheep individuals can be judged by detecting the base of 161665855 nucleotide sites on Tibetan sheep chromosome 1, and the invention provides a novel SNP molecular marker resource for auxiliary selection of Tibetan sheep immune trait markers for non-diagnostic purposes.
As can be seen from the above examples, the present invention provides a molecular marker related to Tibetan sheep immune traits and application thereof, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1. Compared with the traditional detection method, the SNP molecular marker polymorphism detection method has the advantages of high accuracy, high detection speed, low cost, easy judgment of results and the like. SNP locus detection is used for carrying out Tibetan sheep immune trait evaluation, and an early Tibetan sheep disease resistance selection method is established so as to ensure Tibetan sheep organism health and contribute to increasing economic benefit.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Claims (10)
1. A molecular marker related to Tibetan sheep immune traits is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1.
2. The molecular marker of claim 1, wherein the molecular marker is located on the 161665855 th base of chromosome 1 of GenBank accession No. nc_019458.2, version oar_v4.0 of sheep genome.
3. The molecular marker according to claim 2, wherein the molecular marker comprises a SNP site located at position 117 of the molecular marker, and the SNP site mutational base is a or G.
4. The molecular marker according to claim 3, wherein when the molecular marker base is A, the genotype is AA or AG; when the molecular marker base is G, the genotype is GG.
5. Use of the molecular marker according to any one of claims 1 to 4 in the preparation of in vitro detection of Tibetan sheep immune traits or in the preparation of Tibetan sheep disease-resistant breeding screening products.
6. A specific primer group for detecting the molecular marker as set forth in any one of claims 1 to 4, wherein the primer group contains an upstream primer having a sequence shown as SEQ ID NO.2 and a downstream primer having a sequence shown as SEQ ID NO. 3.
7. The use of the specific primer set as defined in claim 6 in Tibetan sheep immune trait in vitro detection or Tibetan sheep disease-resistant breeding screening.
8. The in vitro detection of Tibetan sheep immune traits or the screening method of Tibetan sheep disease-resistant breeding is characterized by comprising the following steps:
(1) Extracting Tibetan sheep blood genome DNA;
(2) Performing PCR amplification by using Tibetan sheep blood genome DNA as a template and adopting the specific primer set of claim 6 to obtain a PCR amplification product;
(3) Purifying the PCR amplification product, and carrying out genotyping detection, wherein when the SNP molecular marker base is A, the genotype is AA or AG; when the SNP molecular marker base is G, the genotype is GG.
9. The method of claim 8, wherein the PCR amplification system of step (2) is: gold medal Mix (green) 22. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, genomic DNA 1. Mu.L.
10. The method of claim 9, wherein the PCR amplification procedure in step (2) is: pre-denaturation at 98℃for 2min; denaturation at 98℃for 10s, annealing at 57℃for 10s, extension at 72℃for 10s for 40 cycles; final extension at 72℃for 2min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410106445.1A CN117683909A (en) | 2024-01-25 | 2024-01-25 | Molecular marker related to Tibetan sheep immune traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410106445.1A CN117683909A (en) | 2024-01-25 | 2024-01-25 | Molecular marker related to Tibetan sheep immune traits and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117683909A true CN117683909A (en) | 2024-03-12 |
Family
ID=90128448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410106445.1A Pending CN117683909A (en) | 2024-01-25 | 2024-01-25 | Molecular marker related to Tibetan sheep immune traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117683909A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118166118A (en) * | 2024-04-11 | 2024-06-11 | 中国农业科学院兰州畜牧与兽药研究所 | ANKRD50 gene as molecular marker of Tibetan sheep immune trait and application thereof |
-
2024
- 2024-01-25 CN CN202410106445.1A patent/CN117683909A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118166118A (en) * | 2024-04-11 | 2024-06-11 | 中国农业科学院兰州畜牧与兽药研究所 | ANKRD50 gene as molecular marker of Tibetan sheep immune trait and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN117721221B (en) | Cloning and application of SNP molecular marker related to Tibetan sheep immune traits | |
| CN117987569B (en) | Molecular marker related to immune traits and used as auxiliary selection of Tibetan sheep marker and application thereof | |
| CN117683909A (en) | Molecular marker related to Tibetan sheep immune traits and application thereof | |
| CN112048562B (en) | SNP molecular marker influencing diameter of alpine merino sheep wool fiber and application thereof | |
| CN114752681B (en) | SNP marker affecting wool length of merino sheep in alpine and application thereof | |
| CN113584183B (en) | SNP molecular marker influencing weaning weight traits of alpine merino sheep and application thereof | |
| CN117904318B (en) | SNP molecular marker related to Tibetan sheep immune traits and application thereof | |
| CN116837112B (en) | SNP molecular marker related to yak growth traits and application thereof | |
| CN117721220A (en) | Molecular marker related to Tibetan sheep immune traits, detection method and application thereof | |
| CN114657265B (en) | SNP marker for identifying weaning weight of alpine merino sheep and application thereof | |
| CN115029445B (en) | SNP marker related to weaning weight of merino sheep in alpine and application thereof | |
| CN114657266B (en) | SNP molecular marker for identifying shearing quantity of merino sheep in the whole year and application thereof | |
| CN117778594B (en) | SNP molecular marker related to Tibetan sheep immune traits, detection method and application thereof | |
| CN113265473B (en) | SNP molecular marker influencing birth weight of alpine merino sheep and application thereof | |
| CN118166120B (en) | SNP molecular marker related to Tibetan sheep immune traits and application thereof | |
| CN118562975A (en) | Molecular marker g8087186 for rapidly identifying Tibetan sheep immunity and application thereof | |
| CN118166118B (en) | ANKRD50 gene as molecular marker of Tibetan sheep immune trait and application thereof | |
| CN118600044A (en) | Detection method of Tibetan sheep METAP1D gene SNP and application thereof in early immune trait screening | |
| CN118638934A (en) | Molecular marker related to Tibetan sheep immune index and application of molecular marker in breeding | |
| CN118581234A (en) | Specific primer of Tibetan sheep immunity related gene ATP8A1 molecular marker and application thereof | |
| CN116121400B (en) | Wool character molecular marker assisted selection method based on alpine merino DLL1 gene CNV marker | |
| CN117051127B (en) | SNP locus related to yak growth traits and application thereof | |
| CN117512127B (en) | SNP locus affecting body length and chest circumference of yaks and application thereof | |
| CN118166119A (en) | Tibetan sheep immune trait identification SNP molecular marker and application thereof | |
| CN109266760B (en) | Method for detecting fertility of alpine merino based on INHA gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |