CN117683083A - B cell continuity linear and conformational epitope, epitope key amino acid site and application thereof for recognizing bovine nodular skin disease virus ORF29 protein - Google Patents

Abstract

The invention relates to the biomedical field, in particular to a linear epitope for recognizing the continuity of a bovine nodular skin disease virus ORF29 protein B cell, a conformational epitope, an epitope key amino acid site and application thereof, wherein the linear epitope for recognizing the continuity of the B cell of the bovine nodular skin disease virus ORF29 protein is INNPIGGVF; recognizing B cell continuous linear epitope key amino acid sites of bovine sarcoidosis skin disease virus ORF29 protein, wherein the key amino acid sites are 199I, 200G, 201G, 202V and 203V; recognizing a B cell continuous conformational epitope of the ORF29 protein of the bovine sarcoidosis skin virus, wherein the conformational epitope has a sequence of INNPIGGVF; recognizing B cell continuous conformational epitope key amino acid sites of bovine sarcoidosis skin disease virus ORF29 protein, wherein the key amino acid sites are 199I, 200G, 201G and 203V; the application of the linear and conformational epitope of the B cell for recognizing the ORF29 protein of the bovine nodular skin disease virus in clinical diagnosis and preparation of reagents or medicaments for inhibiting the bovine nodular skin disease virus.

Description

B cell continuity linear and conformational epitope, epitope key amino acid site and application thereof for recognizing bovine nodular skin disease virus ORF29 protein

Technical Field

The invention relates to the technical field of biomedicine, in particular to a B cell continuity linear and conformational epitope for identifying bovine nodular skin disease virus ORF29 protein, an epitope key amino acid site and application thereof.

Background

Niu Jiejie dermatological disease (Lumpy skin disease, LSD) is an acute, subacute, contagious infectious disease caused by bovine nodular skin disease virus (Lumpy skin disease virus, LSDV) infection. LSDV mainly causes fever, papules or skin nodules in cattle, such as head, neck, shoulders and breasts, and in severe cases presents pustular lesions and necrotic crusting of tissue. Niu Jiejie skin disease (LSD) is an important overseas input animal epidemic disease newly developed in recent years in China, causes great economic loss to cattle raising industry, and seriously affects the healthy development of cattle raising industry in China. LSD was first found in prandial republic in 1929, and then the disease spread rapidly to the middle east, eastern europe, and middle asia. However, LSD has been diagnosed in 14 provinces, municipalities and municipalities nationally since 2019 and has shown a gradual spread trend, increasingly severe prevention and control situations, due to the lack of effective treatments and specific vaccines against the epidemic.

LSDV is very different from Cowpox virus (CPXV) and is similar to Sheep pox virus (SPPV) and Goatpox virus (GTPV), belonging to the genus capripoxvirus (CaPV). Currently, our understanding of the poxvirus genome comes in large part from related studies on vaccinia virus (VacciniaVirus, VACV), and studies specific for LSDV viral genome functionality are extremely poor. At present, little research is done specifically on the biological function of LSDV-encoded proteins. The ORF29 protein is an important structural protein of LSDV, and the specific function of the protein has not been clearly reported. Thus, a deep elucidation of the biological function of the LSDV ORF29 protein will help to enhance understanding of LSDV etiology and pathogenesis. At present, LSDV is pointed out as a poxviridae member, and LSDV ORF29 protein is a membrane protein structure which has a function similar to that of vaccinia virus F15 protein and plays an important role in the packaging process of virus particles.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a linear and conformational epitope for identifying the continuity of bovine nodular skin disease virus ORF29 protein B cells, a key amino acid site and application thereof, and solves the problems in the background art.

In order to achieve the above purpose, the present invention provides the following technical solutions:

a linear B cell continuous epitope recognizing the ORF29 protein of bovine nodular skin disease virus, which linear epitope has the sequence INNPIGGVF.

A B cell continuous linear epitope-critical amino acid site that recognizes the bovine nodular skin disease virus ORF29 protein, which linear epitope-critical amino acid site is 199I, 200G, 201G, 202V and 203V.

A B cell continuous conformational epitope recognizing bovine nodular skin disease virus ORF29 protein, the conformational epitope having the sequence INNPIGGVF.

A B cell continuous conformational epitope-critical amino acid site that recognizes the bovine nodular skin disease virus ORF29 protein, which conformational epitope-critical amino acid site is 199I, 200G, 201G and 203V.

The application of B cell continuous linear and conformational epitope for recognizing bovine nodular skin disease virus ORF29 protein in clinical diagnosis and preparation of reagent or medicament for inhibiting bovine nodular skin disease virus.

An antigenic determinant (Antigenic Determinant) refers to a site of an antigenic molecule capable of specifically binding to an antibody, a structure capable of specifically binding to its corresponding antibody or sensitized lymphocyte, and a specific chemical group having a certain composition and structure. Antigenic determinants whose structure has been determined are called epitopes (epitopes) and can be classified into linear epitopes (Liner epitopes) and conformational epitopes (Conformational Epitope).

Compared with the prior art, the invention has the beneficial effects that:

1. in the invention, aiming at LSDV ORF29 protein, the technical means of peptide scanning is mainly adopted, and the B cell continuity linearity and conformational epitope thereof are determined as ¹⁹⁵ INNPIGGVF ²⁰³ . Meanwhile, by adopting measures such as truncation, deletion, anaplerosis and the like, the linear and conformational epitope of the B cell of the LSDV ORF29 protein is determined, and the epitope has conservation in LSDV, GTPV, SPPV.

2. The invention adopts site-directed mutagenesis technology to identify the epitope ¹⁹⁵ INNPIGGVF ²⁰³ ) Each amino acid is mutated to Alanine (Alanine, a) which has less influence on the protein structure. Key amino acid positions of 199I, 200G, 201G, 202V and 203F which are continuous linear epitopes of LSDV ORF29 protein are determined; indirect immunofluorescence experiments were used to determine the critical amino acid positions for 199I, 200G, 201G and 203F as continuous conformational epitopes of LSDV ORF29 protein.

3. The red fluorescent marked LSDV strain (RFP-LSDV) and the green fluorescent marked LSDV strain (EGFP-LSDV) are utilized to prove that the ORF29 monoclonal antibody has the virus neutralization activity and plays a role in neutralization.

4. The invention identifies and obtains a continuous linear and conformational epitope of LSDV ORF29 protein B cells. The conserved B cell epitope in the capripoxvirus (GTPV, SPPV and LSDV) enriches the immunological and structural biological functions of the ORF29 protein, and provides a reference for the subsequent research of the antigen characteristics of capripoxvirus related proteins. Meanwhile, the monoclonal antibody (3C 4-2E 9) has neutralizing activity and can be applied to development of clinical diagnostic reagents, antiviral drugs, epitope vaccines and the like.

Drawings

FIG. 1 is a screen of LSDV ORF29 hybridoma 3C4-2E9 cell lines as described in example 1 of the invention; wherein: (A) PCR amplification of the LSDV ORF29 gene; (B) inducible expression of pET28a-LSDV ORF29 prokaryotic plasmid; (C) purification of LSDV ORF29 protein; (D) Westernblot analysis of the reaction characteristics and antibody titers of ascites of the 3C4-2E9 hybridomas.

FIG. 2 is an identification of continuous conformational epitopes of LSDV ORF29 protein in example 2 of the invention; wherein: (A, C and E) analyzing LSDV ORF29 epitope truncation position schematic diagrams according to bioinformatics; (B) IFA identification results of the first round of truncated expression of LSDV ORF29 protein; (D) IFA identification results of the second round of truncated expression of LSDV ORF29 protein; (F) In the third round of epitope identification of the LSDV ORF29 protein, an epitope locates the IFA result of the C-terminal amino acid residue position; (G) In the third round of epitope identification of the LSDV ORF29 protein, the epitope locates the IFA result of the N-terminal amino acid residue position.

FIG. 3 is an identification of a continuous linear epitope of the LSDV ORF29 protein in example 3 of the invention; wherein: (A, C and E) analyzing LSDV ORF29 epitope truncation position schematic diagrams according to bioinformatics; (B) Western Blot results of first round epitope identification of LSDV ORF29 protein; (D) Western Blot results of second round epitope identification of LSDV ORF29 protein; (F) In the third round of epitope identification of the LSDV ORF29 protein, the original epitope locates the WesternBlot result of the C-terminal amino acid residue position; (G) In the third round of epitope identification of the LSDV ORF29 protein, the original epitope locates the WesternBlot result of the N-terminal amino acid residue position; (H) LSDV ORF29 amino acid sequence (red dashed box represents a specific position of an epitope).

FIG. 4 is an epitope conservation analysis of LSDV ORF29, GTPVF13L and SPPV GL24 in example 4 of the present invention; wherein: (A) Analyzing the conservation of the epitope among typical strains of LSDV, GTPV and SPPV by using Jalview software; (B and C) Western Blot results after transfection of cell expression with deletion plasmids LSDV ORF29124-247aa (. DELTA.195-203 aa) and LSDV ORF291-370aa (. DELTA.195-203 aa); (D and E) Western Blot analysis results of transfection expression of deletion plasmids GTPV F13L (Δ195-203 aa) and SPPV GL24 (Δ195-203 aa); (F) LSDV ORF29 protein tertiary structure (green labeled against antigen epitope) was simulated using PyMOL software.

FIG. 5 is an identification of amino acid positions of key points of continuous linear and conformational epitopes of LSDV ORF29 protein in example 5 of the invention; wherein: (A) Schematic of site-directed mutagenesis of LSDV ORF29 epitope (green highlighting as epitope, red highlighting as site-directed position); (B) Western Blot results of exogenous transfection expression of LSDV ORF29 epitope mutant plasmid; (C) Gray scanning statistical analysis of Western Blot results of exogenous transfection expression of LSDV ORF29 epitope mutant plasmid; (D) Results of exogenous transfection of the LSDV ORF29 epitope mutant plasmid with IFA.

FIG. 6 shows that the LSDV ORF29 monoclonal antibody (3C 4-2E 9) has neutralizing antibody activity in example 6 of the invention; wherein: (A) Different dilutions of LSDV ORF29 antibody were used to neutralize EGFP-LSDV fluorescence intensity observations; (B) TCID neutralizing extracellular EGFP-LSDV titer at different dilutions of LSDV ORF29 antibody ₅₀ Measuring; (C) Westernblot analysis of different dilutions of LSDV ORF29 antibody to neutralize intracellular EGFP-LSDV; (D) Different dilutions of ORF29 antibody were used to neutralize RFP-LSDV fluorescence intensity observations; (E) TCID neutralizing extracellular RFP-LSDV titer at different dilutions of LSDV ORF29 antibody ₅₀ Measuring; (F) Western blot analysis of different dilutions of LSDV ORF29 antibodies to neutralize intracellular RFP-LSDV.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

EXAMPLE 1 screening of LSDV ORF29 hybridoma cell lines

1. Construction of pET28a-LSDV ORF29 recombinant plasmid

The gene sequence of LSDV ORF29 is amplified by utilizing Snap Gene6.0.2 software design primer, enzyme cutting sites BamHI and EcoRI are introduced,

the upstream primer LSDV ORF29-For:

5 ^- CAGCAAATGGGTCGCGGATCCGCCACCATGTGGTCCTTATTTTTTTCAAAACCTC CATCTG-3, (BamHI cleavage site underlined),

downstream primer LSDV ORF29-Rev:

5-TTGTCGACGGAGCTCGAATTCGTGGTGGTGGTGGTGGTGGCTTCCTCCTCC CAGCACTGTATTTTTTTTGTCTGACCAATCTC-3, (EcoRI cleavage site underlined). The pair of primers was submitted to Jin Weizhi Biotechnology Co. Taking the extracted LSDV/FJ/CHA/2021 strain whole genome DNA as a template, wherein an amplification system is as follows: 2 XPhantaMax Buffer 25 μl, ddH ₂ O18. Mu.l, 2. Mu.l of each of the upstream and downstream primers, 1. Mu.l of dNTP, 1. Mu.l of Phanta Max Super-Fidelity DNA, and 1. Mu.l of template. The reaction procedure was as follows: the temperature is 95 ℃ for 3min, the temperature is 95 ℃ for 15s, the temperature is 58 ℃ for 15s, the temperature is 72 ℃ for 75s, 32 cycles are total, and finally the whole process is thoroughly extended for 5min. The PCR product was subjected to 1% agarose gel electrophoresis to recover the target fragment. By CloneMultiS One Step Cloning Kit the kit is used for cloning and connecting the gel recovery product of the amplified fragment with the digested empty vector, transforming the gel recovery product into competent cells of escherichia coli BL21 (DE 3), coating the competent cells on a kanamycin 2 YT-containing solid culture plate, picking single colony for shaking and extracting plasmids, sending the single colony to a biological engineering (Shanghai) stock company for sequencing, and naming the positive recombinant plasmid with correct sequencing as pET28a-LSDV ORF29 (figure 1).

2. pET28a-LSDV ORF29 recombinant protein induced expression purification

Transforming recombinant plasmid pET28a-LSDV ORF29 into shaking bacteria when the optical density value OD ₆₀₀ When the concentration is 0.8-1.0, 1mmol/L IPTG is added to induce expression for 12h at 37 ℃. The cells were collected by centrifugation, resuspended in PBS, sonicated, and the supernatant and pellet were collected after re-centrifugation. Mixing with 5 Xprotein loading buffer solution, centrifuging, boiling in metal bath at 100deg.C for 10min, cooling, performing SDS-PAGE electrophoresis, and analyzing by coomassie brilliant blue stainingExpression form of the protein. As shown in FIG. 1B, the LSDV ORF29 protein is expressed in a pellet (indicated by red arrows). Then, the ORF29 protein is purified by adopting a conventional inclusion body protein purification mode, nickel column affinity chromatography is adopted, a small amount of purified protein is taken to carry out SDS-PAGE electrophoresis and staining again, and the purity change of the protein is compared. As shown in FIG. 1C, we successfully purified the LSDV ORF29 protein (indicated by red arrow).

3. LSDV ORF29 hybridoma cell strain screening, monoclonal antibody preparation and titer determination

Female SPF-class BALB/c mice of 6-8 weeks old mice were immunized by emulsification with the purified protein antigen and Freund's adjuvant, and were subjected to primary immunization by subcutaneous injection at 50. Mu.g/mouse. At week 3, the second immunization was performed and the antigen was subcutaneously injected in the same dose in combination with Freund's incomplete adjuvant. Three and four immunizations were performed at week 5 and week 7, respectively, with the same dose and manner of immunization. Finally, at week 9, impact immunization was performed, and the antigen was mixed with PBS and injected into the peritoneal cavity of the mice at 50. Mu.g/dose. After the end of the boost immunization for about 15-21d, the spleen cells of the mice are collected aseptically, SP2/0 cells and the spleen cells are fused, positive cell strains are subjected to expansion culture and collection of culture supernatants for Western Blot detection after selective culture and two subcloning by HAT culture medium. The hybridoma cell strain (3C 4-2E 9) with good specificity is injected into the abdominal cavity of a mouse, each of the hybridoma cell strains is about 1ml, and after the abdominal cavity of the 9-12 d mouse is obviously enlarged, ascites is collected aseptically and the titer level of the hybridoma cell strain is detected by a Western Blot method. As shown in FIG. 1D, the LSDV ORF293C42E9 hybridoma cell strain ascites antibody has good reactivity and antigen-antibody reaction titer as high as 1:60000.

EXAMPLE 2 identification of continuous conformational epitopes of the lsdv orf29 protein

The identification of the conformational epitope of the ORF29 protein mainly adopts a peptide scanning technical means, namely, the conformational epitope is gradually determined by truncating or overlapping partial amino acid numbers. We identified the epitope by constructing a series of eukaryotic expression plasmids containing Fag tags using various primer sequences, the primer sequences used being referred to Table 1. In the first round of authenticationCentering ORF29 (1-370 aa) was divided into 3 truncations, 1-123aa, 124-247aa and 248-370aa, respectively (FIG. 2A), the truncate plasmids were transfected into Vero cells and the results of indirect Immunofluorescence (IFA) showed specific fluorescence (FIG. 2B) at the 124-247aa fragment (red border circles) at which position the epitope could be initially determined. In the second round of identification, the IEDB prediction website was also used to divide 124-247aa into 3 truncated fragments, 124-163aa, 158-203aa and 193-247aa, respectively (FIG. 2C), differing from the previous round of identification in that the truncations overlapped 5-10 amino acid residues. Similarly transfected into Vero cells, IFA resulted in the appearance of specific strip fluorescence at 158-203aa (FIG. 2D) (red border circled), which deduced the epitope to be located at 193-203aa. The third round of identification was to accurately locate the specific position of the epitope, first locating the C-terminal of the 158-247aa peptide chain, constructing the truncated plasmids of 158aa-202aa, 158aa-201aa, 158aa-199aa and 158aa-197aa respectively (FIG. 2E), sequentially transfecting Vero cells, collecting IFA samples, and showing no specific fluorescence appearance by IFA detection (FIG. 2F), indicating that the C-terminal amino acid residue at the epitope is 203aa. N-terminal amino acid residues were then positioned to construct 194-247aa, 195-247aa, 196-247aa, 197-247aa, 198-247aa and 200-247aa truncated eukaryotic expression plasmids, respectively, which were also transfected into Vero cells, and IFA results showed specific fluorescence at 194-247aa and 195-247aa (FIG. 2G) (red border circles), indicating that the epitope had an N-terminal amino acid residue position of 195aa. Finally, combining the three rounds of identification results, the overlapping part of the truncated fragment is the position of the epitope, so that the conformational epitope of the continuity of the ORF29 protein can be obtained ¹⁹⁵ INNPIGGVF ²⁰³ 。

The specific experimental process is as follows: first, according to IEDB B cell epitope on-line prediction website, the possible antigen epitope of ORF29 protein is predicted preliminarily. The ORF29 protein-encoded 370aa was then constructed in a gradually truncated form as a eukaryotic expression plasmid containing the Flag tag, the primers being shown in Table 1. The plasmid is transfected into Vero cells (12-well plate) containing the climbing plate, after 24 hours, the cell culture supernatant is sucked off, 600 mu L of paraformaldehyde is added into each space, and after the mixture is fixed for 12 hours at 4 ℃, the IFA test can be carried out. The specific method comprises the following steps: the paraformaldehyde in the plates was blotted dry and washed with PBS. 0.1% Triton X-100 was added and permeabilized for 10min, and blocked with 5% BSA in a 37℃water bath for 1h. The primary antibody (1:1000) was incubated for 3h, using ORF29 ascites and murine Flag antibody. The secondary antibody (1:1000) was incubated with GoatAntiMouse 488AlexaFluor for 1h. Finally, the nuclei were stained with DAPI at a 1:1000 dilution, blocked with anti-quencher, oven dried at 37 ℃, and placed in a refrigerator at 4 ℃ for photographing with a zeiss confocal microscope for fluorescence observation.

TABLE 1PCR primers

Example 3 identification of continuous Linear epitope of lsdv orf29 protein

The identification of the linear epitope of the LSDV ORF29 protein mainly adopts a peptide scanning technology. I.e. by truncating or overlapping part of the amino acid number. ORF29 (1-370 aa) was divided into 3 truncate fragments, 1-123aa, 124-247aa and 248-370aa, respectively (FIG. 3A), in the first round of identification based on the IEDB epitope prediction website, the truncate plasmids were transfected into 293T cells, western Blot results showed that specific bands occurred at the 124-247aa fragment (FIG. 3B), at which position the epitope could be initially determined. In the second round of identification, the IEDB prediction website was also used to divide 124-247aa into 3 truncated fragments, 124-163aa, 158-203aa and 193-247aa, respectively (FIG. 3C), differing from the previous round of identification in that the truncations overlapped 5-10 amino acid residues. Similarly transfected into 293T cells, western Blot resulted in the appearance of specific bands at 158-203aa (FIG. 3D), which deduced that the epitope was located at 193-203aa. The third round of identification was to pinpoint the specific position of the epitope, first locating the C-terminus of the 158-247aa peptide chain, constructing the truncate plasmids of 158aa-202aa, 158aa-201aa, 158aa-199aa and 158aa-197aa, respectively (FIG.3E) The intracellular collection protein samples were transfected sequentially and Western Blot results showed a specific band at positions 158-203aa only (FIG. 3F), indicating that the C-terminal amino acid residue at the epitope was 203aa. N-terminal amino acid residues were then located, and the truncated eukaryotic expression plasmids 194-247aa, 195-247aa, 196-247aa, 197-247aa, 198-247aa and 200-247aa were constructed (FIG. 3E), respectively, and the Western Blot results transfected into cells likewise showed specific binding bands at 194-247aa and 195-247aa (FIG. 3G), indicating that the epitope had an N-terminal amino acid residue position of 195aa. Finally, combining the three rounds of identification results, the overlapping part of the truncated fragment is the position of the epitope, so that the linear epitope of the LSDV ORF29 protein continuity can be obtained ¹⁹⁵ INNPIGGVF ²⁰³ 。

The specific experimental process is as follows: first, according to IEDB B cell epitope on-line prediction website, the possible antigen epitope of ORF29 protein is predicted preliminarily. The ORF29 protein-encoded 370aa was then constructed in a gradually truncated form as a eukaryotic expression plasmid containing the Flag tag, the primers being shown in Table 1. Respectively transfecting the constructed plasmids into HEK-293T cells (12 pore plates), sucking off cell culture supernatant after 24 hours, adding 100 mu L of cell lysate to fully lyse cells, adding 25 mu L of 5 Xprotein loading buffer solution after ultrasonic crushing, boiling for 10 minutes, and cooling to perform Western Blot test. The specific method comprises the following steps: after SDS-PAGE electrophoresis, the protein sample is wet transferred to NC membrane, after transfer printing is finished, 5% skimmed milk powder is used for room temperature sealing for 1h, and primary antibodies are incubated after TBST washing, wherein the primary antibodies are ascites of LSDV ORF29 monoclonal hybridoma antibody, murine beta-actin and Flag antibody respectively. After the end of the overnight incubation of the primary antibody, the secondary antibody (Goat Anti Mouse IgG-HRP) was incubated again with TBST washes at room temperature for 1h. After the secondary antibody is incubated, the secondary antibody is washed by TBST, and the color development result can be carried out on a membrane scanner.

EXAMPLE 4LSDV ORF29 protein conformational and Linear epitope ¹⁹⁵ INNPIGGVF ²⁰³ ) Conservation in capripoxvirus genus

The conservation of the identified epitope among LSDV, GTPV and SPPV was analyzed by using the Jalview2.11.2.7 software, by alignmentThe epitope was found to be highly conserved among the three strains (FIG. 4A), indicating that the epitopes of GTPV (F13L) and SPPV (GL 24) are also ¹⁹⁵ INNPIGGVF ²⁰³ (the arrow indicates the linear epitope). To verify that the identified epitope is reliable, amino acid residues at the epitope were selected for deletion on three strains, and the primers are shown in table 2. Plasmid ORFs 29 (. DELTA.195-203 aa) and LSDV ORF29 (. DELTA.195-203 aa) were constructed after deletion of the epitope from LSDV ORF29 (124-247 aa) and ORF29, transfected into HEK-293T cells, and Western Blot results showed that neither had any specific bands occurred (FIGS. 4B and 4C). Expression plasmids GTPV F13L (Δ195-203 aa) and SPPV GL24 (Δ195-203 aa) were constructed following deletion of the epitopes of GTPV ORF29 (F13L) and SPPV ORF29 (GL 24) in the same manner, protein samples were collected by transfection, and WesternBlot results showed no specific binding to monoclonal antibodies (FIGS. 4D and 4E). The results of the above experiments show that the deletion of the epitope directly affects the specific binding of the antigen and the antibody. Thus, it was further confirmed that the B cell linear epitope of the LSDV ORF29 monoclonal hybridoma antibody ¹⁹⁵ INNPIGGVF ²⁰³ Is a common epitope of the three. Finally, the spatial structure of LSDV ORF29 protein was analyzed using PyMOL software and epitopes were tagged within tertiary structure. As shown in FIG. 4F, B cell linear epitope of 3C4-2E9 hybridoma cell strain ¹⁹⁵ INNPIGGV ²⁰² Amino acid secondary results exhibit beta turns and random coil, F ²⁰³ The amino acids are located at the β -sheet, and their tertiary structure forms a pore-like structure outside the ORF29 protein.

TABLE 2PCR primers

Example 5 identification of Linear and conformational epitope-critical point amino acid loci of LSDV ORF29 protein continuity

The identified epitope is treated by site-directed mutagenesis and the primer sequence in Table 3 ¹⁹⁵ INNPIGGVF ²⁰³ ) Each amino acid is mutated to Alanine (Alanine, a) which has less influence on the protein structure. After sequencing and verification, the method is constructed intoThe functional mutant plasmid is transfected into HEK-293T and Vero cells respectively, and the key amino acid sites of the functional mutant plasmid are analyzed by using Western Blot and IFA experiments.

TABLE 3PCR primers

Ext>exttext>ext>exttext> afterext>exttext>ext>exttext> siteext>exttext>ext>exttext> -ext>exttext>ext>exttext> directedext>exttext>ext>exttext> mutagenesisext>exttext>ext>exttext> ofext>exttext>ext>exttext> theext>exttext>ext>exttext> 9ext>exttext>ext>exttext> aminoext>exttext>ext>exttext> acidext>exttext>ext>exttext> residuesext>exttext>ext>exttext> encodedext>exttext>ext>exttext> byext>exttext>ext>exttext> theext>exttext>ext>exttext> LSDVext>exttext>ext>exttext> ORFext>exttext>ext>exttext> 29ext>exttext>ext>exttext> proteinext>exttext>ext>exttext> Epitopeext>exttext>ext>exttext> wasext>exttext>ext>exttext> performedext>exttext>ext>exttext> usingext>exttext>ext>exttext> alanineext>exttext>ext>exttext> (ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> mutationext>exttext>ext>exttext> scanningext>exttext>ext>exttext> techniqueext>exttext>ext>exttext> (ext>exttext>ext>exttext> fig.ext>exttext>ext>exttext> 5Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> theext>exttext>ext>exttext> constructedext>exttext>ext>exttext> mutantext>exttext>ext>exttext> plasmidsext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 195ext>exttext>ext>exttext> Iext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 196ext>exttext>ext>exttext> Next>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 197ext>exttext>ext>exttext> Next>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 198ext>exttext>ext>exttext> Pext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 199ext>exttext>ext>exttext> Iext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 200ext>exttext>ext>exttext> Gext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 201ext>exttext>ext>exttext> Gext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 202ext>exttext>ext>exttext> vext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> andext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 203ext>exttext>ext>exttext> fext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> wereext>exttext>ext>exttext> transfectedext>exttext>ext>exttext> intoext>exttext>ext>exttext> 293ext>exttext>ext>exttext> text>exttext>ext>exttext> cellsext>exttext>ext>exttext>,ext>exttext>ext>exttext> proteinext>exttext>ext>exttext> samplesext>exttext>ext>exttext> wereext>exttext>ext>exttext> collectedext>exttext>ext>exttext> andext>exttext>ext>exttext> westernext>exttext>ext>exttext> blotext>exttext>ext>exttext>,ext>exttext>ext>exttext> andext>exttext>ext>exttext> theext>exttext>ext>exttext> resultsext>exttext>ext>exttext> showedext>exttext>ext>exttext> thatext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 195ext>exttext>ext>exttext> Iext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 196ext>exttext>ext>exttext> Next>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 197ext>exttext>ext>exttext> Next>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> andext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 198ext>exttext>ext>exttext> Pext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> appearedext>exttext>ext>exttext> toext>exttext>ext>exttext> bindext>exttext>ext>exttext> toext>exttext>ext>exttext> theext>exttext>ext>exttext> monoclonalext>exttext>ext>exttext> antibodiesext>exttext>ext>exttext> specificallyext>exttext>ext>exttext>,ext>exttext>ext>exttext> whereasext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 199ext>exttext>ext>exttext> Iext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 200ext>exttext>ext>exttext> Gext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 201ext>exttext>ext>exttext> Gext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext>,ext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 202ext>exttext>ext>exttext> vext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> andext>exttext>ext>exttext> epiopsext>exttext>ext>exttext> (ext>exttext>ext>exttext> 203ext>exttext>ext>exttext> fext>exttext>ext>exttext> -ext>exttext>ext>exttext> Aext>exttext>ext>exttext>)ext>exttext>ext>exttext> appearedext>exttext>ext>exttext> toext>exttext>ext>exttext> theext>exttext>ext>exttext> monoclonalext>exttext>ext>exttext> antibodiesext>exttext>ext>exttext> thatext>exttext>ext>exttext> wereext>exttext>ext>exttext> notext>exttext>ext>exttext> describedext>exttext>ext>exttext> theext>exttext>ext>exttext> specificext>exttext>ext>exttext> aminoext>exttext>ext>exttext> acidext>exttext>ext>exttext> residuesext>exttext>ext>exttext>.ext>exttext>ext>exttext> The repeated three groups of Western Blot data were subjected to gray-scale scanning analysis by using Image J software, the ratio of which is the relative gray value of each group according to ORF 29/beta-actin, and finally a statistical analysis chart was obtained according to GraphPadprism 8.0.2 (FIG. 5C). To verify if IFA and Western Blot results were consistent, mutant plasmids were also transfected into Vero cells, with primary antibody being Flag and LSDV ORF29 monoclonal antibody and secondary antibody being alexaf flow 488, and after all procedures were completed, were observed under a laser confocal microscope. As shown in FIG. 5D, the IFA results showed that the binding of Epitope (202V-F) and ORF29 antibodies gave specific green fluorescence, which was inconsistent with the Western Blot results (red solid line boxes represent inconsistent results with Western Blot), indicating that this amino acid was not a critical site for conformational epitopes (green solid line boxes).

EXAMPLE 6LSDV ORF29 hybridoma monoclonal antibodies have neutralizing antibody Activity

The present study found that the ORF29 monoclonal antibody (3C 4-2E 9) has a certain ability to neutralize LSDV virus. In vitro neutralization assay of LSDV ORF293C4-2E9 hybridoma cell line monoclonal antibodies: the green fluorescence labeling strain (EGFP-LSDV content 10) is used for purification in the early stage of the laboratory ^-5.5 0.1 mL) and red fluorescent marker strain (RFP-LSDV Virus content 10 ^-6.25 0.1 mL), the ascites is diluted according to different proportions, mixed with the strain for incubation, added into cells for adsorption for a certain time, and washed by PBS, so that viruses which are not adsorbed by the cells can be removed, and interference on subsequent tests can be discharged. By observing fluorescence for 24h, 48h and 72h in the cell plates, EGFP-LSDV and RFP-LSDV (positive control) were found to have the highest fluorescence intensity, and the neutralizing ability against viruses was the strongest at an antibody dilution ratio of 1:25, showing the dependency of antibody titer (FIGS. 6A and 6D). As in fig. 6B and 6e, tcid ₅₀ The results show that the LSDV ORF29 monoclonal antibody inhibits extracellular EGFP-LSDV and RFP-LSDV viral replication in a gradient-dependent manner. Meanwhile, the result of WesternBlot experiment shows that the LSDV ORF29 monoclonal antibody inhibits the replication of EGFP-LSDV and RFP-LSDV viruses in cells in a gradient-dependent manner (FIGS. 6C and 6F). The results show that the LSDV ORF29 monoclonal antibody can inhibit the replication of LSDV in cells and outside cells, and has the capability of neutralizing viruses.

The specific experimental process is as follows: spreading Vero cells in a state of being full of Vero cells in 96-well plates, placing at 37deg.C, 5% CO ₂ Culturing at constant temperature for 12h, and standing after the cells are completely adhered. mu.L of serum-free DMEM and 25. Mu.L of tri-antibodies were added to 6 1.5mL EP tubes, 5 tubes being prepared at 1:25, 1:100, 1: 400. and (3) diluting ascites by 1:1600 and 1:3200, taking the remaining 1 tube without ascites as positive control, and finally, respectively inscribing 1.2 mu l of EGFP-LSDV toxin in each tube, mixing all the two tubes, and placing the mixture into a 37 ℃ incubator for incubation for 3-4h. After the incubation of the antibody and the virus is completed, 100 mu L of the antibody is absorbed and added into a 96-well plate, 4 repeats are respectively arranged on each gradient, and then the antibody and the virus are continuously placed into a cell culture box, so that the virus adsorbs cells for 3-4 hours. After the incubation time is over, the old medium is completely aspirated from the 96-well plate and washed with PBS 2-Adding fresh culture medium containing 10% serum after 3 times, and replacing CO ₂ Culturing in a constant temperature incubator. The fluorescence intensity can be observed and recorded at 24h, 48h and 72h respectively. Finally, cell culture supernatants from 72h well plates were collected and tested for virus half-tissue infection (TCID ₅₀ ) Protein samples were then collected by adding cell lysates for Western Blot. The LSDV ORF29 monoclonal antibody was verified for neutralizing fluorescent marker strain (RFP-LSDV and EGFP-LSDV) activity, and was similarly repeated according to the above-described assay procedure.

The embodiments of the present application have been described above with reference to the accompanying drawings, but the present application is not limited to the above-described embodiments, which are merely illustrative and not restrictive, and many forms may be made by those of ordinary skill in the art without departing from the spirit of the present application and the scope of the claims, which are also within the protection of the present application.

Claims (5)

1. A linear B cell continuous epitope recognizing the ORF29 protein of bovine nodular skin disease virus, which linear epitope has the sequence INNPIGGVF.

2. A B cell continuous linear epitope-critical amino acid site that recognizes the bovine nodular skin disease virus ORF29 protein, which linear epitope-critical amino acid site is 199I, 200G, 201G, 202V and 203V.

3. A B cell continuous conformational epitope recognizing bovine nodular skin disease virus ORF29 protein, the conformational epitope having the sequence INNPIGGVF.

4. A B cell continuous conformational epitope-critical amino acid site that recognizes bovine nodular skin disease virus ORF29 protein, which conformational epitope-critical amino acid site is 199I, 200G, 201G and 203V.

5. The application of B cell continuous linear and conformational epitope for recognizing bovine nodular skin disease virus ORF29 protein in clinical diagnosis and preparation of reagent or medicament for inhibiting bovine nodular skin disease virus.