CN117660501A

CN117660501A - Fusion gene targeting PDL1, gas-producing extracellular vesicles targeting PDL1 and application thereof

Info

Publication number: CN117660501A
Application number: CN202311644435.5A
Authority: CN
Inventors: 袁丽君; 张思妍; 侯广东; 梁媛
Original assignee: Air Force Medical University of PLA
Current assignee: Air Force Medical University of PLA
Priority date: 2023-12-04
Filing date: 2023-12-04
Publication date: 2024-03-08

Abstract

The invention relates to the technical field of genetic engineering, in particular to a fusion gene targeting PDL1, a gas-producing extracellular vesicle targeting PDL1 and application thereof. The invention encodes PD1 extracellular segment coding sequence and donor cell transfected membrane Protein (PTGFRN)The fusion gene (tPD 1-PTGFRN) obtained through sequence connection has good targeting performance on PDL1, and extracellular vesicles secreted by the fusion gene expression targeting PDL1 provided by the invention have good targeting performance, stability and biocompatibility, so that technical support is provided for realizing in-vivo real-time monitoring of PDL1. The invention provides a PDL 1-targeted gas-producing extracellular vesicle, which is characterized in that Ca (HCO) is loaded in the extracellular vesicle secreted by the expression of tPD1-PTGFRN fusion gene ₃ ) ₂ Endowing the cell with the characteristic of producing gas in the receptor cell, and realizing the aim of integrating the immune diagnosis and treatment of the tumor by the extracellular vesicles.

Description

Fusion gene targeting PDL1, gas-producing extracellular vesicles targeting PDL1 and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a fusion gene targeting PDL1, a gas-producing extracellular vesicle targeting PDL1 and application thereof.

Background

In recent years, immunotherapy has shown remarkable therapeutic effects in tumor treatment. A plurality of clinical experiments show that the anti-PD 1 or anti-PDL 1 monoclonal antibody can block the combination between PD1 and PDL1 by combining with the PD1 or PDL1 to enhance the immunity of organism anti-tumor, and can obtain unexpected curative effect in various refractory and recurrent tumor patients.

Studies have shown that PDL1 is upregulated in a variety of epithelial tumors. PDL1 can bind to PD1 or CD80 receptors on T cells, B cells, dendritic cells and natural killer cells, and plays roles in inhibiting T cell proliferation, reducing cytokine release and reducing cytolytic activity, thereby affecting tumor treatment effects. PDL1 expression is regulated primarily by the interferon signaling pathway, which includes the kinases JAK1 and JAK2, the transcription factors STAT1, STAT2 and STAT3, and the transcriptional activator IRF1. Interferon gamma may even stimulate expression of PD-L1 on tumor-derived exosomes, which may also mediate inhibition of cd8+ T cells. The PDL1 expression level can better reflect the curative effect of the patient on PD1 or PDL1 antibody treatment; immunohistochemistry (IHC) is the method currently used for detecting PDL1 expression level of tumor and PD1 expression level of tumor infiltrating T cells. Clinical trial results have shown that IHC detection results correlate with patient treatment response.

The existing histological detection depends on a tissue sample, so that dynamic monitoring of the PD1/PDL1 expression level in the treatment process is difficult to realize; while molecular imaging is expected to provide in vivo real-time monitoring. However, the existing nano ultrasonic contrast agent has poor targeting property, stability and biocompatibility, and is difficult to realize in-vivo real-time monitoring of PDL1.

Disclosure of Invention

In order to solve the problems, the invention provides fusion genes targeting PDL1, gas-producing extracellular vesicles targeting PDL1 and application thereof. The extracellular vesicles secreted by the fusion gene expression of the targeting PDL1 have good targeting property, stability and biocompatibility, and provide technical support for realizing in-vivo real-time monitoring of PDL1.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a fusion gene targeting PDL1, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 1.

The invention provides an expression vector of a fusion gene, which comprises the fusion gene and a basic vector.

Preferably, the base vector comprises a pcDNA3.1 (-) vector.

The invention provides a cell line, which comprises the expression vector and the host cell according to the technical scheme.

Preferably, the host cell comprises a HEK293T cell.

The invention provides a PDL 1-targeted extracellular vesicle, which is secreted by the cell line according to the technical scheme.

The invention provides a PDL 1-targeted gas-producing extracellular vesicle, which comprises the extracellular vesicle and Ca (HCO) loaded in the extracellular vesicle ₃ ) ₂ 。

The invention provides a preparation method of the gas-producing extracellular vesicles, which comprises the following steps: electroporation method is used to carry out the Ca (HCO) ₃ ) ₂ Loading into the extracellular vesicles according to the above technical scheme.

The invention provides the fusion gene or the expression vector or the cell line or the extracellular vesicle or the application of the extracellular vesicle or the preparation method in one or more aspects of the following aspects, wherein the application comprises the following steps: preparing a reagent for detecting PDL1 expression, preparing a PDL1 antibody and preparing a medicinal carrier for targeting PDL1.

Preferably, the agent for detecting PDL1 expression comprises an ultrasound contrast agent.

The beneficial effects are that:

the invention provides a fusion gene targeting PDL1, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 1. The invention connects the PD1 extracellular segment coding sequence and the donor cell transfected membrane Protein (PTGFRN) coding sequence, the obtained fusion gene (tPD 1-PTGFRN) has good targeting to PDL1, and the extracellular vesicle which is secreted by the fusion gene expression of the targeting PDL1 and provided by the invention is a natural membranous biological source carrier, has a lipid bilayer membrane structure, has good targeting, stability and biocompatibility, and provides technical support for realizing in-vivo real-time monitoring of PDL1.

Furthermore, the invention provides the PDL 1-targeted gas-producing extracellular vesicles, which are loaded with Ca (HCO) by expressing and secreting extracellular vesicles in the tPD1-PTGFRN fusion gene ₃ ) ₂ Endowing the cell with the characteristic of producing gas in the cell of the receptor, after the PD1 on the surface of the vesicle is combined with the P-L1, the vesicle is endocytosed by the cell, and the extracellular vesicle releases energy and H in an acidic environment due to the reduction of the pH value in the process of forming the lysosome after the endocytosis ⁺ The ions react and release the gaseous substances, thus realizing the intracellular gas production of the target cells. The amount of phagocytizing extracellular vesicles in the tumor parenchyma is closely related to the whole PDL1 expression, so that the cellular gas production in the tumor is determined, the tumor PDL1 expression can be systematically predicted or estimated through the imaging of the gas production in the tumor by ultrasound, and then the tumor immunosuppression state is estimated or the immunotherapy effect is monitored. And because the gas-generating extracellular vesicles have no shell, the bubbles can be mutually fused in cells to form bubbles with larger size, and the image quality of ultrasonic molecular imaging is improved through a 'small-to-large' strategy. In addition, the fusion protein tPD1-PTGFRN is true due to the surface of the gas-producing extracellular vesiclesThe PDL1 is sealed, and the tumor molecule ultrasonic imaging can be carried out while the immune treatment effect is achieved by mediating the endocytosis and degradation of the PDL1, so that the aim of integrating the immune diagnosis and treatment of extracellular vesicles on the tumor is fulfilled.

The fusion gene targeting PDL1 and the extracellular vesicles targeting PDL1 can detect PDL1 expression in real time, and are very significant in predicting curative effect and drug resistance and adjusting treatment schemes.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.

FIG. 1 shows EV ^tPD1 Constructing a flow diagram;

FIG. 2 shows the result of Westernblot analysis of fusion proteins in HEK293T cell-derived EVs;

FIG. 3 is an EV Transmission Electron Microscope (TEM) image; scale = 200nm;

FIG. 4 shows the results of EV particle size analysis;

FIG. 5 is a live imaging and quantification tracking EV distribution and ex vivo imaging and quantification results;

FIG. 6 shows the result of immunofluorescence staining analysis;

FIG. 7 shows Gp-EV ^tPD1 Is constructed and in vitro ultrasonic imaging step schematic diagram;

FIG. 8 is a graph showing the results of Gp-EV in vitro ultrasound imaging and quantification;

FIG. 9 shows Gp-EV ^tPD1 Time-dependent ultrasound imaging changes in 4T1 breast cancer mouse model;

FIG. 10 shows Pdl1 ^Low 、Pdl1 ^Medium 、Pdl1 ^High Group Pdl1 mRNA expression results;

FIG. 11 is Pdl1 ^Low 、Pdl1 ^Medium 、Pdl1 ^High Group PDL1 protein expression results;

FIG. 12 shows Gp-EV in PDL1 gradient overexpression model ^tPD1 Is a lens for imaging;

FIG. 13 is a graph showing tumor tissue growth after different EV treatments and tumors after different EV treatments;

FIG. 14 is a graph showing survival of tumor-bearing mice after various treatments;

FIG. 15 shows the results of HE staining of mouse tumor tissue;

FIG. 16 shows the results of HE staining of the main organs of mice;

FIG. 17 is a result of evaluating PDL1 expression level by flow cytometry analysis of PDL1 expression in tumor tissue, total fluorescence frequency and average fluorescence intensity;

FIG. 18 is a flow cytometry analysis of T cell distribution in tumor tissue;

FIG. 19 shows the results of RT-PCR analysis of the levels of Ifnγ, tnfα and IL6 mRNA expression in tumor tissues.

Detailed Description

The invention provides a fusion gene targeting PDL1, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 1. According to the invention, the PD1 extracellular segment coding sequence is connected with the donor cell transfection membrane Protein (PTGFRN) coding sequence, and the obtained fusion gene (tPD 1-PTGFRN) has good targeting on PDL1.

The invention provides an expression vector of a fusion gene, which comprises the fusion gene and a basic vector. In the present invention, the base vector preferably includes a pcDNA3.1 (-) vector; the fusion gene is preferably located between the EcoRV and HindIII cleavage sites of the pcDNA3.1 (-) plasmid.

The invention provides a cell line, which comprises the expression vector and the host cell according to the technical scheme. In the present invention, the host cell preferably comprises a HEK293T cell. The extracellular vesicles secreted by the cell line have good targeting property, stability and biocompatibility, and provide technical support for realizing in-vivo real-time monitoring of PDL1.

In the present invention, the method for producing an extracellular vesicle preferably comprises:

culturing the cell line according to the technical scheme to obtain a culture supernatant; centrifuging the culture supernatant to obtain a precipitate as the extracellular vesicles. In the present invention, the culture medium for the culture preferably includes 1640 medium.

The invention provides a PDL 1-targeted gas-producing extracellular vesicle, which comprises the extracellular vesicle and Ca (HCO) loaded in the extracellular vesicle ₃ ) ₂ . The invention selects Ca (HCO) ₃ ) ₂ The gas-generating load is easy to obtain and prepare, and compared with metal cations such as sodium ions, potassium ions and the like, the gas-generating load can avoid the change of potential difference inside and outside cell membranes caused by the too high concentration of the ions, and has higher safety.

The invention provides a preparation method of the gas-producing extracellular vesicles, which comprises the following steps:

electroporation method is used to carry out the Ca (HCO) ₃ ) ₂ Loading into the extracellular vesicles according to the above technical scheme. In the present invention, the parameters of electroporation preferably include: 110V,940uf.

The extracellular vesicles provided by the invention have good biocompatibility and good targeting property on PDL1, are used as shells of ultrasonic contrast agents, and are endowed with gas production function by loading calcium bicarbonate, so that the effectiveness and safety of changing the air sac into the extracellular vesicles targeting contrast agents are considered. Meanwhile, the balloon foaming reconstruction extracellular vesicles are used as nano-ultrasonic targeted contrast agents to evaluate the expression of immune checkpoints, so that the operability is high, and the clinical transformation potential is huge.

The invention provides a gas-producing extracellular vesicle which releases Ca (HCO) in a lysosome acidic environment ₃ ) ₂ And with H ⁺ CO release by reaction ₂ Bubbles are formed and ultrasound can image such bubble structures. The bubbles generated in this way have the advantages of stability, large quantity, persistence and the like in the aspect of ultrasonic imaging. And due to the absence of the shell, CO ₂ The bubbles can be mutually fused in cytoplasm to form larger bubbles, so that the resolution of ultrasonic imaging is further improved.

Finally, the fusion protein on the surface of the gas-producing extracellular vesicle targeting vesicle is the PD1 extracellular segment, and can induce PDL1 function loss by combining with PDL1, thereby exerting the effect similar to PDL1 antibody treatment and realizing the integration of ultrasound-mediated molecular diagnosis and treatment.

The invention provides the fusion gene or the expression vector or the cell line or the extracellular vesicle or the application of the extracellular vesicle or the preparation method in one or more aspects of the following aspects, comprising the following steps: preparing a reagent for detecting PDL1 expression, preparing a PDL1 antibody and preparing a medicinal carrier for targeting PDL1. In the present invention, the agent for detecting PDL1 expression preferably includes an ultrasound contrast agent.

The invention uses the extracellular vesicle with biocompatibility superior to that of lipid crust as the crust of contrast agent, realizes intracellular gas production by endocytosis of cells, and visualizes the whole cell expressing specific molecular target, thereby realizing accurate evaluation of single gene expression tumor. By utilizing the characteristic of gas production after the internalization of the modified vesicle with high biocompatibility, the limitation of intravascular imaging is broken through, a novel ultrasonic nano radiography mode is constructed, and a basis is provided for prognosis judgment, scheme formulation and curative effect evaluation of tumor immunotherapy. In addition, the contrast agent is also expected to induce the loss of PDL1 function to realize the integration of ultrasonic diagnosis and treatment, and opens up a new way for ultrasonic treatment of cancer.

For further explanation of the present invention, the fusion gene targeting PDL1, the gas-producing extracellular vesicles targeting PDL1 and the use thereof provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

The invention will be carried out strictly according to the fourth army medical university ethical committee requirements and the protocol approved by the laboratory animal management committee.

(1) Preparation and targeting validation of engineered targeting PDL1 extracellular vesicles

1) Preparation of targeting PDL1 extracellular vesicles

(1) Plasmid transfection of tPD1-PTGFRN fusion protein

The tPD1-PTGFRN fusion protein plasmid is constructed by the entrusted Kirschner biotechnology Co., ltd (GenScript), wherein the basic plasmid is pcDNA3.1 (-), the fusion gene is positioned between EcoRV and HindIII cleavage sites of the pcDNA3.1 (-) plasmid, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO.1, and specifically comprises the following components: the sequence of the elements is as follows: cleavage site (EcoRV) -Kozak-Signal peptide-mPD-1-linker-Delta687 PTGFRN-flag-termination codon-cleavage site (HindIII) 5' end thereofGATATCThe EcoRV restriction enzyme site is adopted, the GCCACC at the 7 th to 12 th positions is Kozak, is a signal peptide, GAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGGAGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTGAGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCCGCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGACAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCAGAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATACCCCAGCCCCTCGCCCAAACCAGAAGGCCGGTTTCAAGGC (SEQ ID NO. 21) is mPD-1, TCTGGTGGCGGTGGCTCGGGCGGGAGGTGGCGGGTGGCGGCGGATCA (SEQ ID NO. 22) is linker, ggtcctatatttaatgcttctgtgcattcagacacaccatcagtaattcggggagatctgatcaaattgttctgtatcatcactgtcgagggagcagcactggatccagatgacatggcctttgatgtgtcctggtttgcggtgcactcttttggcctggacaaggctcctgtgctcctgtcttccctggatcggaagggcatcgtgaccacctcccggagggactggaagagcgacctcagcctggagcgcgtgagtgtgctggaattcttgctgcaagtgcatggctccgaggaccaggactttggcaactactactgttccgtgactccatgggtgaagtcaccaacaggttcctggcagaaggaggcagagatccactccaagcccgtttttataactgtgaagatggatgtgctgaacgccttcaagtatcccttgctgatcggcgtcggtctgtccacggtcatcgggctcctgtcctgtctcatcgggtactgcagctcccactggtgttgtaagaaggaggttcaggagacacggcgcgagcgccgcaggctcatgtcgatggagatggac (SEQ ID NO. 23) is delta 687PTGFRN, GACTACAAGACGATGACGACAAGGACAGGACTAAGACGATGACGACAAGGACAGGACTAAGACGATGACGACAAG (SEQ ID NO. 24) is a flag,3' -endAAGCTTIs a HindIII cleavage site.

The PD1 protein expression plasmid is constructed by the entrusted Kirschner biotechnology Co., ltd (GenScript), wherein the basic plasmid is pcDNA3.1 (-), the target gene is positioned between EcoRV and HindIII cleavage sites of the pcDNA3.1 (-) plasmid, and the nucleotide sequence of the target gene is shown as SEQ ID NO.2, and specifically comprises the following components: 5'-ATGTGGGTCCGGCAGGTACCCTGGTCATTCACTTGGGCTGTGCTGCAGTTGAGCTGGCAATCAGGGTGGCTTCTAGAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGGAGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTGAGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCCGCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGACAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCAGAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATATCCCAGCCCCTCGCCCAAACCAGAAGGCCGGTTTCAAGGCATGGTCATTGGTATCATGAGTGCCCTAGTGGGTATCCCTGTATTGCTGCTGCTGGCCTGGGCCCTAGCTGTCTTCTGCTCAACAAGTATGTCAGAGGCCAGAGGAGCTGGAAGCAAGGACGACACTCTGAAGGAGGAGCCTTCAGCAGCACCTGTCCCTAGTGTGGCCTATGAGGAGCTGGACTTCCAGGGACGAGAGAAGACACCAGAGCTCCCTACCGCCTGTGTGCACACAGAATATGCCACCATTGTCTTCACTGAAGGGCTGGGTGCCTCGGCCATGGGACGTAGGGGCTCAGCTGATGGCCTGCAGGGTCCTCGGCCTCCAAGACATGAGGATGGACATTGTTCTTGGCCTCTTTGA-3';

respectively transfecting the constructed tPD1-PTGFRN fusion protein plasmid or PD1 protein expression plasmid into HEK293T cells, wherein the specific method comprises the following steps of:

HEK293T cells were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (Hyclone) and 1% double antibody (Solaroo) to a density of 60% -70%, and then replaced with serum-free double antibody-free DMEM medium, and allowed to stand in incubator for 6 hours. The ratio of Lipo 2000 to tPD1-PTGFRN fusion protein plasmid or PD1 protein expression plasmid is 2 g/1 ml, respectively adding into two EP tubes with serum-free or serum-free double-antibody DMEM culture medium, incubating at room temperature for 5min, mixing, incubating at room temperature for 20min, adding into a dish, slightly shaking and mixing uniformly, incubating in a incubator for 6h, culturing for 48h again, and collecting supernatant and cells.

(2) Extraction of Extracellular Vesicles (EVs)

The cells collected in step (1) were cultured in 10cm diameter dishes (37 ℃ C., 5% CO) using DMEM medium containing 10% FBS and 1% diabody, respectively ₂ Saturated humidity). When the cell density is 80%, the culture medium is replaced by a serum-free and double-antibody-free DMEM culture medium, the culture is continued for 48 hours, the supernatant is taken out, 1000g is centrifuged for 5min,10,000g is centrifuged for 10min, the supernatant is taken out, and the supernatant is filtered by a 0.22 mu m filter membrane to remove residual cell fragments. Centrifugation at 100,000g for 1h, resuspension of pellet with 1 XPBS, centrifugation at 100,000g for washing, resuspension of 1 XPBS again, storage at-80℃avoiding repeated freeze thawing. The preparation flow is shown in figure 1.

(3) Extracellular vesicle protein extraction and quantification

Protein extraction: directly taking extracellular vesicle sediment in the step (2), adding 30 mu l RIPA protein lysate containing 10% protease inhibitor Cocktail, carrying out ultrasonic vibration for 5s multiplied by 3 times, and placing on ice for 30min. After the BCA protein was quantified, 5×loading buffer was added, and the supernatant was collected by centrifugation at 12,000rpm for 15min at 100℃and stored at-20 ℃.

Western blot: after transfer onto PVDF membrane, 5% milk was blocked for 30min and primary antibodies (PD 1, abcam, ab300425; CD81, abcam, ab109201; GM130, abcam, ab32337; TSG101, abcam, ab133586, dilution ratio 1:1000) were incubated overnight at 4 ℃. TBST was incubated 3 times, 5min each, with secondary antibodies (protein, HRP-conj [ mu ] charged Goat Anti-Rabbit IgG, SA00001-2; HRP-conj [ mu ] gated Affinipure Goat Anti-Mouse IgG, SA00001-1, dilution ratio of 1:2000) for 1 hr at room temperature, TBST was washed 3X 5min, and target protein expression was detected using an Odyssey CLX imaging system. GAPDH served as an internal reference. The results are shown in FIG. 2, wherein None is an unmodified extracellular vesicle, PD1 is a cell transfected with a PD1 protein expression plasmid or an extracted extracellular vesicle, and tPD1-PTGFRN or tPD1 is a cell transfected with a tPD1-PTGFRN fusion protein plasmid or an extracted extracellular vesicle, and the following figures are the same.

The results showed that the tPD1-PTGFRN-Flag protein was enriched in EVs (a in fig. 2), and EVs extracted by this method were good in characteristics (B in fig. 2).

(4) Extracellular vesicles transmission electron microscope observation and particle size analysis

The morphology and integrity of the extracellular vesicles after electroporation were observed and their particle size was analyzed.

Extracellular vesicle suspension was immobilized with 2% (v/v) OsO ₄ 3% (v/v) glutaraldehyde) for 6 hours at 4 ℃, dropwise adding the mixture into a 2nm copper filter screen, and observing vesicle morphology and integrity, wherein the resolution can reach 0.1-0.2 nm. Particle size analysis a Nanosight NTA NS300 nanoparticle tracking analyzer was used.

Results showed EV ^tPD1 Similar to the morphology of the control group (fig. 3), the particle size was not significantly changed (fig. 4).

2) Targeting validation of targeting PDL1 extracellular vesicles

(1) DiI or DiR staining

The vesicles were labeled with the lipophilic dyes DiI (1, 1'-Dioctadecyl-3, 3' -Tetramethylindocarbocyanine Perchlorate) and DiR (1, 1-Dioctadecyl-3, 3-tetramethylindotricarbocyanine iodide), respectively, diR for in vivo tracking of vesicles and DiI for immunofluorescence confocal microscopy imaging experiments. Mu.l of the vesicles were taken and added with 1. Mu.l of dye to give a final concentration of 10. Mu.M, mixed well, incubated at 37℃for 5min, at 4℃for 15min, washed three times with 1 XPBS, and resuspended.

(2) Infection of 4T1-Pdl1 breast cancer cells with PDL1 over-expression lentiviral vector

The gene of proxy Ji Kai was used to construct PDL1 over-expression viral vectors (number: CON 335) and PDL1-GFP over-expression viral vectors (number: CON 254). The basic vector of the PDL1-GFP over-expression viral vector is a GV348 lentiviral vector (Ji Kai gene is provided), the basic vector of the PDL1 over-expression viral vector is a GV513 lentiviral vector (Ji Kai gene is provided), the target gene of the PDL1-GFP over-expression viral vector is positioned between AgeI and EcoRI cleavage sites of the GV348 lentiviral vector, and the nucleotide sequence of the target gene is shown as SEQ ID NO.3, specifically: 5'-CCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCAACTTTGTGCCAACCGGTCGCCACCATGAGGATATTTGCTGGCATTATATTCACAGCCTGCTGTCACTTGCTACGGGCGTTTACTATCACGGCTCCAAAGGACTTGTACGTGGTGGAGTATGGCAGCAACGTCACGATGGAGTGCAGATTCCCTGTAGAACGGGAGCTGGACCTGCTTGCGTTAGTGGTGTACTGGGAAAAGGAAGATGAGCAAGTGATTCAGTTTGTGGCAGGAGAGGAGGACCTTAAGCCTCAGCACAGCAACTTCAGGGGGAGAGCCTCGCTGCCAAAGGACCAGCTTTTGAAGGGAAATGCTGCCCTTCAGATCACAGACGTCAAGCTGCAGGACGCAGGCGTTTACTGCTGCATAATCAGCTACGGTGGTGCGGACTACAAGCGAATCACGCTGAAAGTCAATGCCCCATACCGCAAAATCAACCAGAGAATTTCCGTGGATCCAGCCACTTCTGAGCATGAACTAATATGTCAGGCCGAGGGTTATCCAGAAGCTGAGGTAATCTGGACAAACAGTGACCACCAACCCGTGAGTGGGAAGAGAAGTGTCACCACTTCCCGGACAGAGGGGATGCTTCTCAATGTGACCAGCAGTCTGAGGGTCAACGCCACAGCGAATGATGTTTTCTACTGTACGTTTTGGAGATCACAGCCAGGGCAAAACCACACAGCGGAGCTGATCATCCCAGAACTGCCTGCAACACATCCTCCACAGAACAGGACTCACTGGGTGCTTCTGGGATCCATCCTGTTGTTCCTCATTGTAGTGTCCACGGTCCTCCTCTTCTTGAGAAAACAAGTGAGAATGCTAGATGTGGAGAAATGTGGCGTTGAAGATACAAGCTCAAAAAACCGAAATGATACACAATTCGAGGAGACGTAAAATTCCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCGCCACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC-3' the sequence of elements is Ubi-MCS-SV40-puromycin.

Taking 4T1 cells in logarithmic growth phase, removing the culture medium, washing twice with 1 XPBS, adding 1640 culture medium without serum and double antibody, and culturing for 4-6 hours at 37 ℃. Taking out lentiviral particles frozen at-80 ℃, melting in an ice bath, respectively adding lentiviral particle liquid with Mo1=100 into cells, horizontally placing a culture plate on a workbench, and gently and uniformly mixing in an 8-shaped manner; after 12-16 hours of infection, the culture solution containing lentiviral particles was aspirated, and the culture plate was re-added with the serum-containing medium, followed by further culturing for 12 hours. The lentiviral particle infection efficiency was observed under a fluorescence microscope. Obtaining 4T1-Pdl1-GFP cell strain.

(3) Construction of BALB/c mice 4T1 or 4T1-Pdl1-GFP breast cancer xenograft model

Female BALB/c mice (18-20 g) of 6-8 weeks old were kept in separate cages according to the guidelines for laboratory animal care and use, which were passed by the national institutes of health. Taking 4T1 cell strain or 4T1-Pdl1-GFP cell strain in logarithmic growth phase, preparing into cell suspension, centrifuging at 30deg.C and 500rpm for 15min, washing with 1×PBS, and adjusting cell concentration to 1.0X10 ⁶ Inoculating cell suspension with the volume of about 200 mu L subcutaneously to the right back near axilla of a mouse per ml, constructing a 4T1 breast cancer tumor model, and when the tumor volume reaches 80-120 mm ³ At this time, experiments were performed.

(4) In vivo imaging analysis

DiR fluorescent dye marks the modified vesicle, and is injected into tumor-bearing mice in advance for 12h tail vein. After the abdomen of the observed mice is shaved and placed in an anesthesia box communicated with isoflurane for anesthesia, the abdomen is upwards placed in a living body imaging analyzer, and the mouth and the nose are communicated with an anesthesia vent hole. And adjusting the parameters of the instrument, wherein the emitted laser is about 748 nm. The results are shown in FIG. 5, wherein A-C are in vivo imaging and quantification tracking EV distribution. EV was marked with DiR and was followed by tail vein injection with a small animal in vivo imaging analyzer; C-E show EV distribution in different organs for in-vitro imaging and quantification results; ns, no significant difference; * P is less than 0.05; * P < 0.001.One-way ANOVA.

The results showed that EV ^tPD1 Enrichment in the tumor at 4T1-Pdl1 showed good targeting (FIG. 5).

(5) Frozen section of tumor tissue

DiI dye-labeled vesicles, tail vein injection, 4 hours later mice were anesthetized and 4% paraformaldehyde infused, tumor and major viscera were isolated, and frozen sections were performed after embedding using OCT.

OCT embedding: taking an embedding mould with a proper size, and dripping an OCT frozen section embedding agent into the mould to enable the embedding agent to cover the bottom of the mould. Cleaning viscera or tumor tissue of mice in 1 XPBS, lightly dipping the surface of filter paper, placing into an embedding mould with an OCT embedding agent, covering the surface completely with the embedding agent, and freezing at-80deg.C for more than 4 hr. The tissue slice is prepared by a Leica frozen microtome, the thickness of the slice is adjusted to 8-10 mu m, the serial slice is obtained, and the slice is stored at-20 ℃ in a dark place after the slicing is completed.

(6) Immunofluorescence confocal microscopy imaging

Freezing and slicing, airing at room temperature for 30min in dark, then dripping a proper amount of 4% paraformaldehyde solution prepared by 1 XPBS on sliced tissues, and fixing at room temperature for 20min; and (3) throwing away the fixing solution, rinsing for 5min multiplied by 3 times by 1 multiplied by PBS, dripping the anti-fluorescence quenching agent sealing piece, and observing by a confocal microscope. The sections were stored at-20℃for fluorescence image analysis using NIS-Elements Viewer 4.20 software. The results are shown in FIG. 6, EV is labeled with DiI (red), 4T1-Pdl1 cells are labeled with GFP (green), and nuclei are stained with DAPI (blue).

The results show that DiI-labeled EV ^tPD1 Co-localization with 4T1-Pdl1-GFP cells was significantly more than in the control group, indicating EV ^tPD1 Good ability to target PDL1.

Example 2

Construction of engineering gas-producing extracellular vesicles targeting PDL1 and evaluation of in-vivo imaging effect of engineering gas-producing extracellular vesicles serving as ultrasonic contrast agents

1) Extracellular vesicle gas production engineering targeting PDL1

(1) Electroporation loaded Ca (HCO) ₃ ) ₂

0.001M Ca (HCO) ₃ ) ₂ Solution resuspension of the three extracellular vesicle precipitations in example 1 (EV ^None 、EV ^PD1 、EV ^tPD1 ) Put in 800. Mu.l of electric rotor, 110V,940uf,10 cycles, on ice for 30min. Recovering liquid in electric rotating cup, centrifuging at 100,000g for 1 hr, discarding supernatant, suspending precipitate with 1 XPBS, and preserving at-80deg.C to obtain Gp-EV ^None 、Gp-EV ^PD1 、Gp-EV ^tPD1 . The steps are shown in fig. 7.

2) Ultrasonic observation of vesicle intracellular gas production ability

The vesicles were co-cultured with 4T1-Pdl1 cells (100. Mu.g/1X 10) ⁷ And 2) 0h,2h,4h,6h, 2ml of the extract with the concentration of 8X 10 ⁶ The individual/mL cell suspension was mixed with 1% (m/v) agarose solution and poured into 3% (m/v) agarThe contrast image was observed and acquired using a Vevo Lab small animal ultrasonic diagnostic apparatus in a bore of 5mm in diameter of the saccharide solution phantom. The specific method is conventional ultrasonic operation and will not be described again. The result is shown in fig. 8, ns: no significant differences; * P is less than 0.05.

The results show that Gp-EV ^tPD1 The ultrasonic echo of (2) is gradually enhanced within 0-6 h, reaches the strongest within 4h and is higher than that of the control group.

3) Exploration of engineering gas-generating extracellular vesicles targeting PDL1 as ultrasound contrast agent in-vivo imaging features

(1) Constructing a BALB/c mouse 4T1-Pdl1 breast cancer xenograft model: the procedure is as in example 1.

(2) And (3) ultrasonic image observation: the 4T1-PDL1 model mice were divided into 3 groups (6 mice/group) and each received Gp-EV prepared in 1) ^None 、Gp-EV ^PD1 、Gp-EV ^tPD1 (10. Mu.g/g) tail vein injection. The hyperechoic area size and intensity was observed 0h,2h,4h,6h prior to injection and analyzed using Image J software program. The results are shown in FIG. 9, where P < 0.0001, P < 0.01, two-way ANOVA.

As a result, it was found that Gp-EV ^tPD1 The group ultrasound echo was stronger than the control, echo was enhanced in 0-6 h and reached highest at 4h, consistent with the in vitro imaging results (fig. 9).

4) Verification of PDL1 imaging effect by engineering gas-producing extracellular vesicles targeting PDL1

Construction of PDL1 expression gradient model

(1) Infection of 4T1 breast cancer cells with PDL1-GFP over-expression lentiviral vector

After constructing PDL1-GFP over-expression virus vector to infect 4T1 cells, taking a bottle of cells in logarithmic growth phase for digestion, centrifugation and counting, diluting the cells to about 50 cells per 100 mu l, sucking cell suspension, selecting the cell suspension at a plurality of holes, about 2 mu l per hole, and observing under an inverted microscope, if 1-2 cells per hole are observed, then the plating can be continuously completed. After 4-8 h, 200 μl of culture solution is added to a single cell well for observation under a microscope, and the culture is carried out in an incubator. When a cell clone grows to be close to 20 cells, observing under a fluorescence microscope, respectively selecting High (High), medium (Medium) and Low (Low) fluorescence under the microscope, and re-paving the cell digests into a 24-well plate for normal culture.

(2) RT-PCR: the extracellular vesicles were isolated from the supernatant as described in example 1, and after the cells were gently blown down with 1 XPBS, the supernatant was discarded by centrifugation at 5,000rpm for 2min, and 200. Mu.l of RIPA containing 10% Cocktial was added and mixed for protein extraction or RNA extraction by adding Trizol (Invitrogen Life Technologies).

When RNA is extracted, adding Trizol, incubating on ice for 10min, adding 1/5 volume of chloroform, and centrifuging at 12,000g for 10min; taking the supernatant, adding equal volume of isopropanol, centrifuging for 10min with 12000g, and discarding the supernatant; adding 75% ethanol with the same volume as Trizol, mixing, centrifuging for 10min to extract RNA precipitate 12000g, air drying for 5min, dissolving in DEPC water, and quantifying Nanodrop (Nanodrop 2000 UV-Vis spectrophotometer). A TAKARA cDNA first strand synthesis kit was used. RT-PCR Using 20. Mu.l System, 9. Mu.l SYBR Green, 1. Mu.g primer, 1. Mu.g, H ₂ O completed the volume and sample analysis was performed. The primer sequences are shown in Table 1 as Pdl1.

TABLE 1 RT-PCR primer sequences for different genes

PCR reaction procedure: pre-denaturation at 95℃for 3 min; denaturation at 5℃for 30s, annealing at 55℃for 30s, extension at 72℃for 30-60 kb/s, sufficient extension at 72℃for 10min after 34 cycles, and low-temperature storage at 12℃for 30min.

The results are shown in FIG. 10, where P < 0.05, P < 0.0001, two-way ANOVA.

Pdl1 ^Low 、Pdl1 ^Medium 、Pdl1 ^High The sequentially increased expression of group Pdl1 mRNA indicates successful model construction.

(3) Western blot: the procedure was as described in example 1. The result is shown in FIG. 11, pdl1 ^Low 、Pdl1 ^Medium 、Pdl1 ^High Group PDL1 protein expression is sequentially increased and combined with RT-PCR results were consistent, indicating successful model construction.

(4) Constructing a mouse PDL1 expression gradient breast cancer xenograft model: the procedure is as in example 1.

(5) And (3) ultrasonic image observation: the mice are divided into 4T1,4T1-Pdl1 ^Low ，4T1-Pdl1 ^Medium ，4T1-Pdl1 ^High Model groups (6/group), each group received Gp-EV respectively ^None 、Gp-EV ^PD1 、Gp-EV ^tPD1 (10. Mu.g/g) tail vein injection. The hyperechoic area size and intensity were observed and analyzed using ImageJ software program. The result is shown in fig. 12, ns is no significant difference; * P is less than 0.05; * P < 0.01; * P < 0.001; * P < 0.0001.One-way ANOVA.

The results show that Gp-EV ^tPD1 Group mice had the strongest echo, verifying Gp-EV ^tPD1 Good targeting of the ultrasound imaging function of PDL1 (fig. 12).

Example 3

Gas production extracellular sac diagnosis and treatment integrated evaluation of targeting PDL1

4T1-PDL1 model mice were divided into 3 groups (6 mice/group) and received Gp-EV, respectively ^None 、Gp-EV ^PD1 、Gp-EV ^tPD1 (10. Mu.g/g) treatment.

1) Evaluation of therapeutic Effect

(4) Tumor volume change

The size of the BALB/c tumor-bearing mice to be treated with tumor is 80-120 mm ³ At this time, experiments were started and recorded as 0d, 200. Mu.l Gp-EV were injected every two days into the tail vein, respectively ^None 、Gp-EV ^PD1 、Gp-EV ^tPD1 . The tumor volume calculation formula is: volume v= (width x length ² )/2。

The tumor volume comparison method comprises the following steps: v (actual tumor volume)/V0 (original tumor volume)

Statistical analysis was performed by GraphPad Prism 8. The results are shown in FIG. 13, A is the tumor tissue after different EV treatments; b is the growth curve of tumors after different EV treatments; ns: no significant differences; * P < 0.0001.Two-way ANOVA.

The results show that Gp-EV ^tPD1 Treatment significantly reduced tumor volume (fig. 13).

(5) Survival of mice: survival of mice was recorded with 60d as a boundary. The results show that Gp-EV ^tPD1 Treatment prolonged survival of tumor-bearing mice (fig. 14, ×p < 0.01).

(6) Pathological staining of tumors and major viscera: mice were sacrificed at 14d and tumor tissue and major organs (heart, liver, spleen, lung, kidney) were harvested, 4% multimeric fixed, paraffin embedded. After hematoxylin and eosin (H & E) staining, the tumor and pathological changes of the individual organ tissues were observed under a microscope. The results are shown in FIGS. 15 and 16.

The results showed that increased tumor core fragmentation was seen after HE staining (fig. 15). The remaining organs were not pathologically altered (fig. 16).

2) Immune status study

(1) Detection of PDL1 expression level by flow cytometry

After imaging tumor-bearing mice by tail vein injection of air-producing vesicles, the mice were sacrificed at 14d, tumor tissues were taken and cut into small pieces, ground and homogenized, then 2ml of enzymatic hydrolysate (type I DNase 0.05mg/ml, type II neutral protease 2mg/ml, type A collagenase 1.5 mg/ml) was added, and incubated at 37℃for 45min. Transfer to a new centrifuge tube, add 2ml of pre-ice cold 1 XPBS, shake vigorously for 2min, and filter the suspension through a 200 mesh screen. The filtered cells were centrifuged at 2000rpm at 4℃for 5min, and the resulting pellet was used in subsequent experiments. The tumor cells obtained were centrifuged at 1000rpm at 4℃for 5min, and the cell pellet was resuspended in 1 Xflow buffer and centrifuged at 1000rpm at 4℃for 5min. After discarding the supernatant, 2ml of erythrocyte lysate was added for resuspension, and the mixture was allowed to stand at room temperature for 5min. Then an equal volume of flow buffer was added and the cells were transferred to a flow tube and centrifuged at 1000rpm at 4℃for 5min. The supernatant was discarded and 50. Mu.l of flow buffer remained in the tube, which was used for primary antibody labeling (Biolegend, PE anti-mouse CD274, 124308,0.25. Mu.g/1X 10) ⁶ And (c) a). Cell number reaches 1×10 in flow analysis ⁶ And the experiment needs to be provided with bare cell tubes, and each antibody single-dyeing tube and target primary antibody co-dyeing tube. Primary antibody was added to the cells and incubated at 4℃for 20min in the dark. 1ml of streaming buffer 1000rpm was then added and centrifuged at 4℃for 5min, and the supernatant was discarded. The bare cell tube and the single-stained tube were resuspended in 300. Mu.l of streaming buffer, the remainder were resuspended in 300. Mu.l of 7AAD, and dead cells were labeled. The results are shown in FIG. 17, and A-C are the PDL1 expression in the tumor tissue analyzed by flow cytometry; PDL1 expression level was assessed by total fluorescence frequency (B) and Mean Fluorescence Intensity (MFI) (C); * P is less than 0.05; * P < 0.01; * P < 0.0001.One-way ANOVA.

The results indicate that Gp-EV ^tPD1 Treatment significantly reduced intratumoral PDL1 levels (fig. 17).

(2) Intratumoral T cell detection

This experiment was used to observe the number of cd3+cd4+ T cells and cd3+cd8+ T cells and their percentages. The steps are the same as above. The results are shown in figure 18, A-B are the distribution results of T cells in tumor tissues by flow cytometry, and ns is no significant difference; * P < 0.001; * P < 0.0001.One-way ANOVA.

The results show that Gp-EV ^tPD1 The proportion of cd8+ T cells increased significantly after treatment (fig. 18), demonstrating that the release of intratumoral PDL1 immunosuppression increased infiltration of cd8+ T.

③RT-PCR

The procedure is as in example 2, and the primer sequences are shown in Table 1. The results are shown in fig. 19, P < 0.05; * P < 0.01; * P < 0.001; * P < 0.0001.One-way ANOVA.

The results show that Gp-EV ^tPD1 After treatment, the mRNA levels of the pro-inflammatory cytokines Ifn gamma and Tnf alpha were significantly increased and the IL6 mRNA levels were significantly decreased (FIG. 19).

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. A fusion gene targeting PDL1 is characterized in that the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 1.

2. An expression vector for a fusion gene comprising the fusion gene of claim 1 and a base vector.

3. The expression vector of claim 2, wherein the base vector comprises a pcdna3.1 (-) vector.

4. A cell line comprising the expression vector of claim 2 or 3 and a host cell.

5. The cell line of claim 4, wherein the host cell comprises a HEK293T cell.

6. A PDL 1-targeting extracellular vesicle, characterized in that said extracellular vesicle is secreted by the cell line of claim 4 or 5.

7. A PDL1 targeting gas producing extracellular vesicle, characterized in that the gas producing extracellular vesicle comprises the extracellular vesicle of claim 6 and Ca (HCO) loaded within the extracellular vesicle ₃ ) ₂ 。

8. The method for producing an extracellular vesicle according to claim 7, comprising:

electroporation method is used to carry out the Ca (HCO) ₃ ) ₂ Loading into the extracellular vesicles of claim 6.

9. Use of the fusion gene of claim 1 or the expression vector of claim 2 or 3 or the cell line of claim 4 or 5 or the extracellular vesicle of claim 6 or the gas-producing extracellular vesicle of claim 7 or the gas-producing extracellular vesicle produced by the production method of claim 8 in one or more of the following aspects, comprising: preparing a reagent for detecting PDL1 expression, preparing a PDL1 antibody and preparing a medicinal carrier for targeting PDL1.

10. The use of claim 9, wherein the agent for detecting PDL1 expression comprises an ultrasound contrast agent.