CN117660430A - Dihydrodaidzein racemase mutant and application thereof - Google Patents

Abstract

The invention discloses a dihydrodaidzein racemase mutant and application thereof, wherein the amino acid sequence of the dihydrodaidzein racemase mutant is shown as SEQ ID NO. 1, the mutant can only be combined with a substrate R-dihydrodaidzein, and then the mutant is catalyzed into S-dihydrodaidzein, but loses the combination activity with the S-dihydrodaidzein, so that the S-dihydrodaidzein can not be converted into R-dihydrodaidzein any more, the characteristic only catalyzes the conversion of the R-dihydrodaidzein into the S-dihydrodaidzein in a unidirectional way, the synthesis rate of the R-dihydrodaidzein is improved, and the yield of S-equol is further improved.

Description

Dihydrodaidzein racemase mutant and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a dihydrodaidzein racemase mutant and application thereof.

Background

S-equol is a kind of estrogen small molecular compound produced by fermenting soybean isoflavone by intestinal microorganisms, has high affinity with estrogen beta receptor, and can exert estrogen antagonism or antagonism. The S-equol has wide biological activity, has the effects of resisting oxidation, aging and stress, improving female climacteric symptoms, relieving emotional anxiety, inhibiting osteoporosis and the like.

Wild-type dihydrodaidzein racemase (dihydrodaidzein racemase, DDRC) can catalyze the interconversion of R-dihydrodaidzein and S-dihydrodaidzein, but only S-dihydrodaidzein can be catalyzed by a hydrodaidzein reductase (dihydrodaidzein reductase, DHDR) to further synthesize 3S, 4R-trans-tetrahydrodaidzein, which is in turn converted to S-equol by a tetrahydrodaidzein reductase (tetrahydrodaidzein reductase, DHDR).

As the DDRC has the characteristic of bidirectional catalysis, the substrate catalysis is incomplete, and the yield of S-equol is low.

Disclosure of Invention

The invention mainly aims to provide a dihydrodaidzein racemase mutant and application thereof, which can only unidirectionally catalyze the conversion of R-dihydrodaidzein into S-dihydrodaidzein and improve the yield of S-equol.

In order to achieve the aim, the invention provides a dihydrodaidzein racemase mutant, and the amino acid sequence of the dihydrodaidzein racemase mutant is shown as SEQ ID NO. 1.

Optionally, the dihydrodaidzein racemase mutant is mutated from a wild-type dihydrodaidzein racemase; the amino acid sequence of the wild-type dihydrodaidzein racemase is shown as SEQ ID NO. 2.

The invention provides a DNA molecule for encoding the dihydrodaidzein racemase mutant.

Alternatively, the nucleotide sequence is shown as SEQ ID NO. 3.

The invention provides a recombinant vector which contains the nucleotide sequence.

Alternatively, the recombinant vector comprises a plasmid vector, a phage vector, or a viral vector.

The invention provides a preparation method of a recombinant vector, which comprises the following steps:

s10, obtaining the DNA molecule;

s20, purifying and carrying out homologous recombination on the DNA molecule and an expression vector pET28 (a) +to obtain the recombinant vector.

The invention provides a host cell which comprises the nucleotide sequence or the recombinant vector.

Alternatively, the host cell is E.coli.

The invention provides an application of the dihydrodaidzein racemase mutant in preparing a catalytic R-dihydrodaidzein preparation.

In the technical scheme provided by the invention, the dihydro soybean aglycone racemase mutant is provided, the amino acid sequence of the dihydro soybean aglycone racemase mutant is shown as SEQ ID NO. 1, the mutant can only be combined with a substrate R-dihydro soybean aglycone, and then the mutant is catalyzed into S-dihydro soybean aglycone, but the combination activity with the S-dihydro soybean aglycone is lost, so that the S-dihydro soybean aglycone can not be converted into R-dihydro soybean aglycone any more, the characteristic only catalyzes the R-dihydro soybean aglycone unidirectionally, the synthesis rate of the R-dihydro soybean aglycone is improved, and the yield of S-equol is further improved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other related drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram of an S-equol biosynthetic enzyme system and intermediates thereof provided by the invention;

FIG. 2 is an SDS-PAGE analysis of the recombinant DDRC mutant containing His-tag and Strep-tag II tags provided in comparative example 1;

FIG. 3 is a liquid chromatogram of wild-type DDRC and DDRC mutant catalyzed conversion of R-dihydrodaidzein to S-dihydrodaidzein provided in example 2 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

S-equol is a kind of estrogen small molecular compound produced by fermenting soybean isoflavone by intestinal microorganisms, has high affinity with estrogen beta receptor, and can exert estrogen antagonism or antagonism. The S-equol has wide biological activity, has the effects of resisting oxidation, aging and stress, improving female climacteric symptoms, relieving emotional anxiety, inhibiting osteoporosis and the like. Wild-type dihydrodaidzein racemase (dihydrodaidzein racemase, DDRC) can catalyze the interconversion of R-dihydrodaidzein and S-dihydrodaidzein, but only S-dihydrodaidzein can be catalyzed by dihydrodaidzein reductase (dihydrodaidzein reductase, DHDR) to synthesize 3S, 4R-trans-tetrahydrodaidzein, which in turn is converted to S-equol by tetrahydrodaidzein reductase (tetrahydrodaidzein reductase, DHDR), and in particular, the synthetic process of S-equol is schematically shown in fig. 1.

In view of the above, the invention provides a dihydrodaidzein racemase mutant and application thereof, which can only catalyze R-dihydrodaidzein in one way and improve the yield of S-equol.

The amino acid sequence of the dihydrodaidzein racemase mutant provided by the invention is shown as SEQ ID NO. 1, and the amino acid sequence is specifically as follows:

MKAQLNRIALRAADADKAVADLHALLGVTFYGPYDDEHMGLRVALPKTGGIEVMAPMHDHDAIGAYQRLQTEGEGVSGIAVRVDDFEEARAAFAAKGLTPISEFWHGKFHEMIFAPCPETHGLRIAVNRFPDANGAAIQVALDMGADWKDVCDVDAELEHHHHHH。

in the technical scheme, the provided dihydrodaidzein racemase mutant has the amino acid sequence shown in SEQ ID NO. 1, and can only be combined with a substrate R-dihydrodaidzein and then be catalyzed into S-dihydrodaidzein, but the combination activity with the S-dihydrodaidzein is lost, so that the S-dihydrodaidzein cannot be converted into R-dihydrodaidzein any more, and the characteristic only catalyzes the R-dihydrodaidzein unidirectionally, so that the synthesis rate of the R-dihydrodaidzein is improved, and the yield of S-equol is further improved.

Further, the dihydrodaidzein racemase mutant is mutated from a wild-type dihydrodaidzein racemase; the amino acid sequence of the wild-type dihydrodaidzein racemase is shown as SEQ ID NO. 2, and specifically comprises the following steps:

MKAQLNRIALRAADADKAVADLHALLGVTFYGPYDDEHMGLRVALPKTGGIEVMAPMHDHDAIGAYQRLQTEGEGVSGIAVRVDDFEEARAAFAAKGLTPISEFWHGKFHEMIFAPCPETHGLRIAVNEFPDANGAAIQVALDMGADWKDVCDVDAE。

in the above technical scheme, wild-type DDRC can catalyze the interconversion of R-dihydrodaidzein and S-dihydrodaidzein, but only S-dihydrodaidzein can be used for further synthesis of 3S, 4R-trans-tetrahydrodaidzein, which is further converted into S-equol by THDR. The binding of the enzyme to the substrate is a prerequisite for the catalytic activity. By site-directed mutagenesis of amino acid sites and then measuring the activity of the enzyme to catalyze the interconversion of R-dihydrodaidzein and S-dihydrodaidzein, the amino acid sites which are critical to the activity of the enzyme can be initially determined. Through a large number of screening verification, the difference of core amino acid sites of DDRC catalyzing the conversion of R-dihydrodaidzein into S-dihydrodaidzein and the conversion of S-dihydrodaidzein into R-dihydrodaidzein can be determined. Through site-directed mutagenesis, the DDRC can lose the activity of catalyzing the conversion of S-dihydrodaidzein into R-dihydrodaidzein, and simultaneously retain the activity of catalyzing the conversion of R-dihydrodaidzein into S-dihydrodaidzein, so that the DDRC mutant can realize unidirectional catalysis of the conversion of R-dihydrodaidzein into S-dihydrodaidzein.

Specifically, the mutation is to mutate glutamic acid (E) in wild-type DDRC (derived from strain Slackia isoflavoniconvertens HE) to one of arginine (R), histidine (H), lysine (K), alanine (a), methionine (M), glycine (G), valine (V), leucine (L), isoleucine (I), phenylalanine (F), tyrosine (Y), tryptophan (W), serine (S), and threonine (T).

The invention provides a DNA molecule for encoding the dihydrodaidzein racemase mutant.

The DNA molecule has all the beneficial effects of the aforementioned dihydrodaidzein racemase mutant, and will not be described in detail herein.

Further, the nucleotide sequence of the DNA molecule is shown as SEQ ID NO. 3, specifically:

atgaaagcacaactgaaccgcattgccctgcgtgctgcggacgccgataaagcggttgcggatctgcacgctctgctgggcgtgaccttttacggtccgtacgacgacgaacacatgggtctgcgtgttgctctgccgaaaacgggtggtattgaagttatggccccgatgcacgaccatgacgcaattggtgcataccagcgtctgcagaccgagggcgaaggtgtgagcggtatcgcggtacgtgtggatgactttgaggaagcacgcgcagcattcgctgcaaagggcctgaccccaatctccgaattctggcacggcaagttccacgaaatgatttttgcgccatgcccaaggactcacggcctggagattgcagtaaacgaatttccggacgcaaacggtgccgctatccaagtggctctggatatgggtgccgactggaaagatgtgtgtgatgtcgacgcagaa。

in some embodiments, in order for the DDRC mutant to be efficiently expressed in genetically engineered escherichia coli, the codon encoding the DDRC mutant gene needs to be optimized. In order to better purify the DDRC mutant, the type and the position of the purification tag are optimized, and the obtained nucleic acid molecule sequence is shown as SEQ ID NO. 3. A preferred purification tag is a histidine tag, located C-terminal to the DDRC mutation. The optimized DDRC mutant can realize high-level soluble expression in genetically engineered escherichia coli, and can obtain high-purity DDRC mutant through metal affinity chromatography for activity verification.

The invention provides a recombinant vector which contains the nucleotide sequence.

The recombinant vector has all the beneficial effects of the nucleotide sequence, and is not described in detail herein.

Further, the recombinant vectors include plasmid vectors, phage or viral vectors, which have high transformation efficiency and are capable of introducing the nucleotide sequences of the carried mutants of the present application into cells.

The invention provides a preparation method of a recombinant vector, which comprises the following steps:

s10, obtaining the DNA molecule;

specifically, the DNA molecule is used for encoding the dihydrodaidzein racemase mutant, and the nucleotide sequence of the DNA molecule is shown as SEQ ID NO. 3.

S20, purifying and carrying out homologous recombination on the DNA molecule and an expression vector pET28 (a) +to obtain the recombinant vector.

Specifically, the recombinant vector can be obtained by carrying out double digestion and purification on the vector through NcoI and XhoI and then carrying out recombination with the DNA molecule, and the recombinant vector can introduce the nucleotide sequence of the carried mutant into cells.

The invention provides a host cell comprising the nucleotide sequence, or comprising the recombinant vector, in some embodiments, the host cell is E.coli.

The invention provides an application of the dihydrodaidzein racemase mutant in preparing a catalytic R-dihydrodaidzein preparation.

The following technical solutions of the present invention will be described in further detail with reference to specific examples and drawings, and it should be understood that the following examples are only for explaining the present invention and are not intended to limit the present invention.

EXAMPLE 1 expression and purification of recombinant DDRC and mutants

(1) Construction of expression vectors

Construction of wild-type DDRC: amplifying a DDRC template synthesized by Beijing qing department biotechnology Co Ltd by using primers D1F and D1R, wherein the DDRC template is subjected to escherichia coli codon preference optimization to obtain a nucleotide sequence shown as SEQ ID NO: 4; the amplification was performed using the DDRC template, and a 50. Mu.L system for amplification was 10. Mu.5 XPCR buffer, 4. Mu.L of dNTP mix (2.5 mM), 1. Mu.L of each of primers D1F and D1R (10. Mu.M), 0.5. Mu.L of high-fidelity DNA polymerase PrimeStar HS, and 0.5. Mu.L of ddH2O, as a 10-fold dilution template. Wherein the sequence of the primer D1F is 5'-taactttaagaaggagatataccatgaaagcacaactgaaccgc-3' (shown as SEQ ID NO: 5); the sequence of the primer D1R is 5'-gtggtggtggtggtggtgctcgagttctgcgtcgacatcacaca-3' (shown as SEQ ID NO: 6). The amplification reaction was performed on an eppendorf PCR instrument, with the following procedure: 95℃for 5min,95℃for 10s,55℃for 30s, and 72℃for 30s, for a total of 35 cycles, 72℃for 10min. The DNA fragment was purified using Omega cycle pure kit after amplification. pET28 (a) +empty vector was digested and purified with NcoI and XhoI, then DNA fragment and vector were recombined using homologous recombinase (seamless cloning kit, biyun) and transformed into BL21 (DE 3) competence to obtain positive transformant, and sequencing of the extracted plasmid confirmed that the constructed sequence was identical to the expected wild-type DDRC.

DDRC mutant construction: the method comprises the steps of using D1F and D2R (the nucleotide sequences of which are shown as SEQ ID NO:7, specifically 5'-tgggcatggcgcaaaaatca-3') as one group of primers, using P2F (the nucleotide sequences of which are shown as SEQ ID NO:8, specifically 5'-tgatttttgcgccatgcccaaggactcacggcctggagatt-3') and D1R as the other group of primers, carrying out PCR (polymerase chain reaction) amplification by using a DDRC sequence before gene synthesis optimization as a template to respectively obtain two different DNA fragments, wherein about 20 bases are the same between the two PCR amplification fragments, and recombining the two PCR amplification fragments by using an overlap extension PCR amplification technology to obtain the complete DNA fragment with a mutation site. The amplification reaction was performed on an eppendorf PCR instrument, procedure 1 was: 95 ℃ for 5min;95 ℃ for 10s; 15s at 55 ℃; 20s at 72 ℃; for a total of 5 cycles at 72℃for 2min. And (3) using the obtained product as a template and using D1F and D1F as primers to amplify the complete DDRC mutant coding DNA sequence. Program 2 is: 3min at 95 ℃;95 ℃ for 10s; 15s at 55 ℃; 35s at 72 ℃; for a total of 35 cycles. The DNA fragment was purified using Omega cycle pure kit to obtain the protein mutant-encoding DNA sequence of the present application, and the remaining construction and expression methods were identical to wild-type DDRC.

Wherein the sequence of SEQ ID NO. 4 is specifically:

Atgaaagcacaactgaaccgcattgccctgcgtgctgcggacgccgataaagcggttgcggatctgcacgctctgctgggcgtgaccttttacggtccgtacgacgacgaacacatgggtctgcgtgttgctctgccgaaaacgggtggtattgaagttatggccccgatgcacgaccatgacgcaattggtgcataccagcgtctgcagaccgagggcgaaggtgtgagcggtatcgcggtacgtgtggatgactttgaggaagcacgcgcagcattcgctgcaaagggcctgaccccaatctccgaattctggcacggcaagttccacgaaatgatttttgcgccatgcccagagactcacggcctggagattgcagtaaacgaatttccggacgcaaacggtgccgctatccaagtggctctggatatgggtgccgactggaaagatgtgtgtgatgtcgacgcagaataa。

(2) Inducible expression of recombinant proteins

Positive transformants after sequencing verification were picked up, inoculated into fresh Luria-Bertani medium (yeast extract 5g/L, tryptone 5g/L, naCL 10 g/L), cultured with shaking at 37℃at 180rpm to an OD600 of about 0.6, induced to express at 16℃with the addition of IPTG at a final concentration of 0.5mM for 16h, and then the bacterial liquid was collected by centrifugation, after ultrasonic disruption, centrifuged to remove the precipitate, and purified by metal affinity chromatography (Ni-IDA resin, genscript) with reference to the reagent specifications.

The SDS-PAGE electrophoresis chart of the expression and purification of the DDRC mutant provided by the embodiment of the invention is shown in figure 2, and the result of figure 2 is analyzed by Image J software, so that the purity of the obtained DDRC mutant is more than 90%.

In FIG. 2, 1 is the supernatant of the expression of a His-tag-containing DDRC mutant; 2 is DDRC mutant purified 100mM imidazole eluent containing His-tag; 3 is purified 200mM imidazole elution of the DDRC mutant containing His-tag; 4 is DDRC mutant purified 300mM imidazole eluent containing His-tag; 5 is purified 500mM imidazole elution of the DDRC mutant containing His-tag; m is a protein marker;6 is a supernatant of DDRC mutant expression containing Strep-tag II; 7 is DDRC mutant flow through containing Strep-tag II; 8 is DDRC mutant purified 1mM desulphation biotin eluent containing Strep-tag II; 9 is a DDRC mutant purified 1.5mM desulphated biotin eluent containing Strep-tag II; 10 is a DDRC mutant purified 2mM desulphated biotin eluent containing Strep-tag II; 11 is a DDRC mutant purified 2.5mM desulphated biotin eluate containing Strep-tag II.

EXAMPLE 2 detection of wild-type DDRC and DDRC mutant catalytic Activity

The purified wild-type DDRC and DDRC mutant were subjected to dialysis to replace the buffer with 20mM phosphate buffer (pH 7.4), and the protein concentration was diluted to 0.1mg/mL. Dissolving R-dihydrodaidzein to 100mM with DMSO, adding 5mM of final concentration of R-dihydrodaidzein into wild DDRC and DDRC mutant protein solution, standing at 30deg.C for 2 hr, sampling, extracting with 1/10 volume of ethyl acetate to obtain R/S-dihydrodaidzein, distilling under reduced pressure, and dissolving with 100% methanol for detection by liquid chromatography.

The S-dihydrodaidzein and R-dihydrodaidzein standard were dissolved in methanol solvent, and the samples were subjected to reduced pressure distillation and then to detection using chiral chromatography (0.46 cm. Times.15 cm. Times.3 μm large xylonite medicine chiral technology (Shanghai Co.) and elution using 100% methanol at a flow rate of 0.8mL/min for a total period of 12min at a detection wavelength of 254nm at 35℃and a loading of 10. Mu.L. As a result, as shown in FIG. 3, FIG. 3A shows the curves of R-dihydrodaidzein and S-dihydrodaidzein standard, FIG. 3B shows that the DDRC mutant catalyzes R-dihydrodaidzein, and it can be seen that in the B curve, there is almost no peak of R-dihydrodaidzein, that is, the DDRC mutant can almost completely convert R-dihydrodaidzein into S-dihydrodaidzein, and FIG. 3C shows that the wild-type DDRC catalyzes R-dihydrodaidzein, and it can be seen that there is also a peak of R-dihydrodaidzein in the C curve, that is, the wild-type DDRC cannot completely catalyze R-dihydrodaidzein, and the catalytic rate is about 60% according to the detection.

Comparative example 1

The DDRC mutant in this comparative example replaced the His-tag with the Strep-tag II tag; the method comprises the following specific steps: primers D1F (nucleotide sequence shown as SEQ ID NO: 5) and D3R (nucleotide sequence:

5'-gtggtggtggtggtggtgctcgagtcatttttcgaattgagggtgagaccattctgcgtcgacatcacaca-3', shown as SEQ ID NO. 9) constructed DNA fragment with DDRC mutant sequence shown as SEQ ID NO. 10; the other steps were the same as in example 1.

As shown in FIG. 2, the SDS-PAGE electrophoresis diagram of the expression and purification of the DDRC mutant containing the Strep-tag II tag in comparative example 1 shows that the DDRC mutant containing the His-tag II tag can be efficiently purified to obtain a large amount of DDRC mutant proteins, and the DDRC mutant containing the Strep-tag II tag can be purified to obtain a small amount of DDRC mutant proteins. Analysis of the results of FIG. 2 using Image J software showed that the expression level and purification yield of the DDRC mutant using Strep-tag II were lower than those of the His-tag-carrying DDRC mutant.

The nucleotide sequence SEQ ID NO 10 specifically comprises:

atgaaagcacaactgaaccgcattgccctgcgtgctgcggacgccgataaagcggttgcggatctgcacgctctgctgggcgtgaccttttacggtccgtacgacgacgaacacatgggtctgcgtgttgctctgccgaaaacgggtggtattgaagttatggccccgatgcacgaccatgacgcaattggtgcataccagcgtctgcagaccgagggcgaaggtgtgagcggtatcgcggtacgtgtggatgactttgaggaagcacgcgcagcattcgctgcaaagggcctgaccccaatctccgaattctggcacggcaagttccacgaaatgatttttgcgccatgcccagagactcacggcctggagattgcagtaaacgaatttccggacgcaaacggtgccgctatccaagtggctctggatatgggtgccgactggaaagatgtgtgtgatgtcgacgcagaatggtctcaccctcaattcgaaaaatga。

the foregoing is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention, but various modifications and variations will be apparent to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the scope of the present invention.

Claims (10)

1. A mutant of dihydrodaidzein racemase is characterized in that the amino acid sequence is shown as SEQ ID NO. 1.

2. The dihydrodaidzein racemase mutant of claim 1, wherein the dihydrodaidzein racemase mutant is mutated from a wild-type dihydrodaidzein racemase;

the amino acid sequence of the wild-type dihydrodaidzein racemase is shown as SEQ ID NO. 2.

3. A DNA molecule encoding the dihydrodaidzein racemase mutant of claim 1.

4. The DNA molecule of claim 3, wherein the nucleotide sequence is set forth in SEQ ID NO. 3.

5. A recombinant vector comprising the nucleotide sequence of claim 4.

6. The recombinant vector according to claim 5, wherein the recombinant vector comprises a plasmid vector, a phage vector, or a viral vector.

7. A method for preparing a recombinant vector, comprising the steps of:

s10, obtaining the DNA molecule according to claim 4;

s20, purifying and carrying out homologous recombination on the DNA molecule according to claim 4 and an expression vector pET28 (a) + to obtain the recombinant vector.

8. A host cell comprising the nucleotide sequence of claim 4 or comprising the recombinant vector of claim 5.

9. The host cell of claim 8, wherein the host cell is e.

10. Use of a dihydrodaidzein racemase mutant as claimed in any one of claims 1 to 2 in the preparation of a catalytic R-dihydrodaidzein formulation.