CN117643594A - Nucleic acid and application thereof in preparation of antitumor drugs - Google Patents

Abstract

The invention relates to the technical field of immunotherapy, in particular to a nucleic acid fragment and application thereof in preparing anti-tumor drugs. The nucleic acid fragment provided by the invention can regulate and control the tumor microenvironment and can simultaneously regulate and control various immune check points in tumor invasive T lymphocytes (TILs). The nucleic acid fragment provided by the invention can up-regulate and express NEAT1, promote proliferation of TILs and promote the TILs to kill bladder cancer cells. Provides a promising immunotherapy strategy for tumor patients, thus having good practical application value.

Description

Nucleic acid and application thereof in preparation of antitumor drugs

Technical Field

The invention relates to the technical field of immunotherapy, in particular to a nucleic acid fragment and application thereof in preparing anti-tumor drugs.

Background

The statements in this section merely provide background information related to the present disclosure and may not necessarily constitute prior art.

T cell depletion (T cell exhaustion) is a major mechanism of tumor immune tolerance and escape and is also a significant cause of the inability of cellular immunotherapy to be widely used. Studies have demonstrated that immune checkpoints that are abnormally high expressed on the surface of immune cells can induce T cell depletion through a variety of mechanisms. Immune checkpoints are a class of molecules expressed on the surface of immune cells. Normally, these immune checkpoints are used to maintain the body's autoimmune tolerance, preventing T cells from attacking its own cells. However, during the course of tumorigenesis, tumor cells can up-regulate the expression level of immune checkpoints in T cells by releasing some cytokines and recruiting suppressive immune cells, and then after the immune checkpoints and corresponding ligands are combined, the depletion of T cells is induced by influencing the ways of cell proliferation, cytokine secretion, metabolism and the like, and finally tumor immune tolerance and escape are caused.

Inhibitors of immune checkpoints such as PD-1, PD-L1 and CTLA-4 are clinically used for treating some cancer patients which do not respond to traditional chemotherapy, radiotherapy and targeted therapy, and certain curative effects are achieved. However, a large number of clinical trials have shown that only a fraction of patients with non-small cell lung cancer and melanoma types of cancer respond well to immune checkpoint therapy, while most types of cancer patients cannot benefit, including bladder cancer.

In addition, there are many cancer patients who exhibit primary or secondary therapeutic tolerance to immune checkpoint therapy and develop different types of autoimmune disease, probably due to: 1. when a single immune checkpoint inhibitor is used, other immune checkpoints are not inhibited, and the immune checkpoints still have immune inhibition function on T cells; 2. off-target effect of immune checkpoint inhibitors. Therefore, the research and development of the preparation capable of simultaneously regulating and controlling the expression of various immune checkpoints has good application prospect.

NEAT1 (nuclear paraspeckle assembly transcript 1), a long non-coding RNA, up-regulates expression in a variety of human tumor cells. Several studies have shown that elevation of NEAT1 in cancer cells promotes cell growth, migration and invasion, and inhibits apoptosis, and several papers have disclosed the feedback role of NEAT 1/miRNA/target networks in various cancer progression. However, the role of the NEAT1 in the tumor microenvironment has not been clarified so far, and in particular, the function of the NEAT1 in different cancers has not been clarified; there are thus very few treatments for cancer.

Disclosure of Invention

In view of the above, the invention provides a nucleic acid fragment which solves the problem that the effect of inhibiting bladder cancer is not obvious for immune checkpoints and solves the problem that the NEAT1 has an ambiguous effect in tumor microenvironment.

To achieve the above object, one or more embodiments of the present invention provide the following technical solutions:

in a first aspect of the invention, there is provided the use of a substance that promotes long-chain non-coding RNA over 1 activity in the preparation of an anti-tumour product;

further, the substance is a substance for promoting the activity of long-chain non-coding RNA NEAT1 in tumor invasive T lymphocyte TILs;

preferably, the agent that promotes long-chain non-coding nucleic acid NEAT1 activity comprises a nucleic acid fragment;

the single-stranded nucleic acid sequence of the nucleic acid fragment is shown as SEQ ID NO.1 or SEQ ID NO.2 respectively.

In specific embodiments, the tumor comprises bladder tumor, oral tumor, lung cancer, stomach cancer, liver cancer, intestinal cancer, uterine tumor or osteosarcoma;

the application is specifically to promote tumor infiltration T lymphocyte TILs to kill tumor cells.

In a second aspect, a nucleic acid fragment is provided, the nucleic acid fragment being a double stranded nucleic acid; the single-stranded sequence of the nucleic acid fragment is shown as SEQ ID NO.1 or SEQ ID NO.2 respectively.

In a third aspect, there is provided a recombinant vector comprising the nucleic acid fragment of the second aspect;

the recombinant vector also includes lentivirus LV and an expression cassette for expressing dsacas 9.

In a fourth aspect, a host is provided, obtained by transfecting tumor-infiltrating T lymphocytes TILs with the recombinant vector of the third aspect.

In a fifth aspect, there is provided the use of a nucleic acid fragment according to the second aspect or a recombinant vector according to the third aspect or a host according to the fourth aspect in any of the following:

i) Promoting NEAT1 activity in TILs or preparing related products for promoting NEAT1 activity in TILs;

II) inhibiting the activity of immune checkpoints in TILs or for the preparation of immune checkpoint inhibition products;

III) promoting proliferation of TILs or preparing a product for promoting proliferation of TILs;

IV) use of a reagent for promoting secretion of cytokines by TILs cells or for preparing a reagent for promoting secretion of cytokines by TILs cells;

v) application in promoting killing tumor cells or preparing products for promoting TILs to kill tumor cells;

preferably, the immune checkpoint comprises PD-1, CTLA-4, TIGIT, and LAG3;

preferably, the tumor comprises bladder tumor, oral tumor, lung cancer, gastric cancer, liver cancer, intestinal cancer, uterine tumor or osteosarcoma;

the product can be a drug or an experimental reagent, so that the product can be used for basic research.

In a sixth aspect, there is provided an antitumor agent produced from the nucleic acid fragment of the second aspect, the recombinant vector of the third aspect or the host of the fourth aspect.

In a specific embodiment of the invention, the medicament further comprises other components with anti-tumor activity;

or, the antitumor drug further comprises a buffer agent for host activity according to the fourth aspect;

or, the antitumor drug further comprises a carrier which is necessary in pharmacy.

In a specific embodiment of the invention, the additional anti-tumor active ingredient comprises paclitaxel, doxorubicin, cisplatin, mitomycin, fluorouracil, gemcitabine, or a tyrosine kinase inhibitor.

In a specific embodiment of the present invention, the antitumor drug comprises an antitumor model drug;

or, the antitumor drug comprises an antitumor preparation against brain tumor, oral tumor, lung cancer, gastric cancer, liver cancer, intestinal cancer, bladder cancer, uterine tumor and/or osteosarcoma.

Preferably, the medicament of the invention may be administered to the body in a known manner. For example, by intravenous systemic delivery or local injection into the tissue of interest. Alternatively via intravenous, transdermal, intranasal, mucosal or other delivery methods. Such administration may be via single or multiple doses. It will be appreciated by those skilled in the art that the actual dosage to be administered in the present invention may vary greatly depending on a variety of factors, such as the target cell, the type of organism or tissue thereof, the general condition of the subject to be treated, the route of administration, the mode of administration, and the like.

Preferably, the subject to be administered with the drug may be human or non-human mammal, such as mouse, rat, guinea pig, rabbit, dog, monkey, gorilla, etc.

The one or more of the above technical solutions have the following beneficial effects:

the nucleic acid fragment provided by the invention can efficiently target NEAT1 and avoid off-target; the expression of NEAT1 and downstream genes thereof is regulated and controlled efficiently; can inhibit a plurality of immune checkpoints of PD-1, CTLA-4, TIGIT and LAG3 at the same time; promoting proliferation of TILs in the microenvironment of bladder cancer tumor; promoting TILs cells to kill bladder cancer cells. Provides a promising immunotherapy strategy for tumor patients, thus having good practical application value.

Additional aspects of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 is a schematic diagram of the target design of the present invention.

FIG. 2 is a schematic diagram of a final vector according to an embodiment of the present invention; 2A: LV-2136, 2B: LV-2137.

FIG. 3 shows the viability of cytokines and TILs in the micro-environment of bladder cancer tissue and tumors in accordance with the second embodiment of the present invention; a: IL-2 content; b: IFN-gamma content; c: TILs cell viability.

FIG. 4 shows the expression levels of NEAT1 in TILs and PBMC in example III of the present invention.

FIG. 5 shows the use of small nucleic acids to increase NEAT1 expression levels in TILs according to example IV of the present invention.

FIG. 6 shows the expression levels of various immune checkpoint molecules in TILs inhibited by small nucleic acids according to embodiment five of the present invention.

FIG. 7 shows the proliferation of TILs at various time points in a sixth embodiment of the present invention.

FIG. 8 is a schematic representation of the small nucleic acid molecules of the seventh embodiment of the invention that promote secretion of cytokines IFN-gamma and IL-2 by TILs; a: IFN-gamma, B: IL-2.

FIG. 9 shows the proliferation of bladder cancer cells according to the eighth embodiment of the present invention.

Detailed Description

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out under conventional conditions or under conditions recommended by the manufacturer.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. The experimental procedures not described in detail in the present invention are performed with reference to the molecular biology experimental guidelines and the cell biology experimental guidelines.

In the present invention, the term "treatment" has its general meaning and in this context means in particular the treatment of a mammalian subject, preferably a human, who has acquired colitis, with a medicament of the invention in order to produce a therapeutic, curative, palliative or the like effect on the disease, obtaining the desired pharmacological and/or physiological effect.

In the present invention, the expression cassette is an independent component of the vector DNA, and consists of the gene expressed by the transfected cells and the regulatory sequences. The expression cassette consists of three parts: promoter sequences, open reading frames and 3' untranslated regions, which in eukaryotes typically contain polyadenylation sites. Different expression cassettes can be transfected into different organisms such as bacteria, yeast, plants and plants. It can also be used for mammalian cells, provided that the correct regulatory sequences are used. Cas9 expression cassettes can be referred to article DOI10.1111/pbi.13559.

"pharmaceutically acceptable carrier" is art recognized and includes pharmaceutically acceptable materials, compositions or carriers suitable for administering the compounds of the invention to a mammal. The carrier includes a liquid or solid filler, diluent, excipient, solvent or encapsulating material that participates in carrying the subject substance or transferring it from one organ or body to another organ or body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient. Some examples of materials that may be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate, powdered tragacanth, malt, gelatin, talc, excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cotton seed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; and other non-toxic compatible substances used in pharmaceutical formulations.

The formulations of the present invention may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. The amount of active ingredient which can be combined with the carrier material to prepare a single dosage form is generally that amount of the compound which produces the therapeutic effect.

The materials used in the invention are as follows:

(1) The kit comprises: CCK8 kit: purchased from Solarbio under the accession number CA1210.ELISA kit: purchased from Qiaoyi, cat No. JEH-03, JEH-17. Reverse transcription kit: available from TOYOBO under the designation FSQ-301. Fluorescent quantitative PCR kit: purchased from TOYOBO under accession number QPK-201.

Primary cell isolation and culture related reagents and materials:

(2) TILs cell isolation and culture-related reagents: recombinant human interleukin 2 (rhIL-2) was purchased from Chiron Corp., emeryville, calif. RPMI 1640 (21875091), HEPES pH 7.2 (15630080), diabody (pentailin-streptomycin) (15140163) and glutamine (25030081) were purchased from Life Technologies. Human serum (H4522) was purchased from Sigma Aldrich.

(3) Tumor primary cell isolation and culture related reagents: DMEM/F-12 (11320033), collagenase type II (17101015), glutaraldehyde (35050038) are purchased from Life Technologies. DNase I (D5025), insulin (I9278), transferrin (T3309), hydrocortisone (H0888), HEPES (PHR 1428) and 40 μm cell filter (CLS 431750-50 EA) were purchased from Sigma-Aldrich. Y-27632 dihydrochloride (M1817) is purchased from AbMole. FBS (10270) was purchased from Gibco. FGF2 (100-18B) and EGF (AF-100-15) were purchased from Peprotech.

The experimental instrument used in the invention comprises:

ultra-micro spectrophotometer: denovix

PCR instrument: bioRad

Real-time quantitative PCR instrument: roche

Enzyme-labeled instrument: tecan

Cell incubator: thermo

The working principle of the plasmid used in the invention is as follows:

CRISPR/Cas9 is one of the most flexible systems in genomic regulatory technology. The system has two main components: guide RNA (gRNA) and endonuclease (Cas 9). The main function of Cas9 is to cleave DNA, depending on the two active regions RuvC1 and HNH in its protein structure. dCas9 (read Cas 9) is a mutant of Cas9 protein, whose cleavage enzyme activity is lost due to simultaneous mutation of both RuvC1 and HNH nuclease active regions of Cas9, retaining only the ability to be guided by gRNA into the genome. At present, the CRISPR-dCAS9 system has been widely applied to aspects of gene regulation, genome imaging, epigenetic regulation and the like. In mammalian cells, fusion of dCas9 with VP64 or p65 activation domain (p 65 AD) can activate both reporter and endogenous genes under conditions of only one sgRNA guide. After fusion of dCas9 with a typical transcriptional activator VP64, the complex is generally capable of recruiting transcription factors that regulate mammalian cell transcription when dCas9-VP64 is targeted to the promoter sequence of a target gene via gRNA. However, the use of multiple sgrnas to achieve significant activation of the source gene remains necessary; the difference of the targeted areas of the sgrnas leads to different degrees of regulation of downstream genes or different amounts of regulation of downstream genes, and further leads to the occurrence of differences in surface expression, so it is important to design a reasonable sgRNA to realize multiple regulation of target genes.

Different immune cells have different activities and physiological characteristics:

TILs are immune cells existing in the tumor microenvironment, mainly comprising cytotoxic T cells, helper T cells, regulatory T cells, B cells and the like, wherein the cells are derived from lymphocyte immune cells, belong to adaptive immune cells and mainly play a role in eliminating tumor cells by secreting cytokines.

Macrophages are derived from myeloid immune cells, which are indigenous immune cells, and have a major role in phagocytizing dead cells and cell debris, immune complexes, bacteria and other waste products.

The invention will now be described in further detail with reference to the following specific examples, which should be construed as illustrative rather than limiting.

Example 1

1. Design of nucleic acid fragments

In the invention, 2 nucleic acid fragments are designed aiming at the NEAT1 gene, and single-stranded nucleotide sequences of the nucleic acid fragments are respectively shown as SEQ ID NO. 1-2.

sgRNA3(SEQ ID NO.1):ATAGCCCTCAGCCGCGTCAC

sgRNA5(SEQ ID NO.2)：GTCATCGGCCGAGCCCGACT

The NEAT1 gene, NCBI gene accession number is: gene ID 283131.

2. And (3) constructing a carrier:

the experimental principle is that 2 single-stranded primers form double chains through annealing reaction, then are assembled through T4 DNAl ligase in a connecting method, small sgRNA fragments are built into a target vector, E.coli Stbl3 competent cells are transformed, colony PCR is used for screening transformants, positive clones are sent to sequence, and positive clones are determined through sequence comparison.

1) Primer annealing

A. Primer 2136-F: caccGTCATCGGCCGAGCCCGACT and primer 2136-R: aaacAGTCGGGCTCGGCCGATGAC anneals to form a double-stranded structure, designated sasgRNA5 (NEAT 1).

B. Primer 2137-F: caccGATAGCCCTCAGCCGCGTCAC and primer 2137-R: aaacGTGACGCGGCTGAGGGCTATC anneals to form a double-stranded structure, designated SasgRNA3 (NEAT 1).

2) Insertion of sgRNA small fragments into linearized expression vectors

BsaI digestion vector LV-CMV-NLS-dSaCas9-NLS-VPR-U6-sgRNA (Wohyotakumi) was recovered and ligated with the annealing primer obtained in step 1) using T4 ligase.

E.coli Stbl3 competent cells were then transformed with U6-F: gagggcctatttcccatgattcc and WPRE-R: CCGCTTCAGCGGTCGC colony PCR was performed, correct colony sequencing was identified, and correctly sequenced colonies were saved. Plasmids were extracted for subsequent experiments.

The obtained plasmid was designated LV-2136 and the sequence of ligation of the elements was as follows: LV-CMV-SV40NLS-dSaCas9-HA-2 XSV-NLS-VPR-nEF. Alpha. -Puro-T2A-EGFP-U6-sasgRNA5 (NEAT 1) -WPRE, all the other element sequences except sasgRNA5 (NEAT 1) are disclosed in the prior art, and the plasmid map is shown in FIG. 2A.

The obtained plasmid was named LV-2137, the sequence of elements was as follows, LV-CMV-SV40NLS-dSaCas9-HA-2 XSV-NLS-VPR-nEF. Alpha. -Puro-T2A-EGFP-U6-SasgRNA 3 (NEAT 1) -WPRE, the sequence of all the elements except SasgRNA3 (NEAT 1) was published in the prior art, and the plasmid map was shown in FIG. 2B.

3. Obtaining a host cell

LV-2136 and LV-2137 were transferred into TILs, respectively, to ensure a multiplicity of infection (multiplicity of infection, MOI) of 1. The subsequent examples refer to this standard.

Example two

TILs and autologous tumor cells were first isolated from bladder cancer tissue (Autologous tumor cells), then incubated in a 37 ℃ cell incubator containing 5% carbon dioxide for 48 hours, the supernatant was assayed for IFN- γ and IL-2 content using an ELISA kit, and the CCK8 kit was used to detect proliferation of tumor cells after 24 and 48 hours of incubation. The results in FIGS. 3A and B show that most of the isolated TILs in bladder cancer tissue are unable to stimulate secretion of IFN-gamma and IL-2 by autologous tumor cells. The results in fig. 3C show that TILs are unable to inhibit proliferation of tumor cells. These results indicate that TILs in bladder cancer tissue are not able to kill autologous tumor cells because they are in a depleted state.

Example III

TILs in bladder cancer tissues and mononuclear lymphocytes in peripheral blood (peripheral blood mononuclear cell, PBMCs) were isolated and expression levels of net 1 in TILs and PBMCs were detected using a real-time fluorescent quantitative PCR experiment. The results in fig. 4 show that in these depleted TILs, long non-coding nucleic acid net 1 is significantly under-expressed.

Example IV

After transfer of LV-2136 and LV-2137 plasmids into TILs for 24 and 48 hours, respectively, the expression level of NEAT1 in TILs was detected using a real-time fluorescent quantitative PCR assay. FIG. 5 shows that NEAT1-gRNA3 and NEAT1-gRNA5 significantly increased the expression level of NEAT1 in TILs. It was demonstrated that NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments successfully targeted NEAT1 and regulated NEAT1 gene expression.

Example five

After transferring LV-2136 and LV-2137 plasmids into TILs for 48 hours, respectively, the expression level of immune checkpoints in TILs was detected by real-time fluorescent quantitative PCR experiments. FIG. 6 shows that NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments significantly reduced the expression levels of immune checkpoints PD-1, CTLA-4, TIGIT, and LAG3 in TILs.

Example six

After transferring LV-2136 and LV-2137 plasmids into TILs for 48 hours, respectively, proliferation of the TILs was detected using CCK8 kit. FIG. 7 shows that NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments can promote proliferation of TILs.

Example seven

After transferring LV-2136 and LV-2137 plasmids into TILs for 48 hours, respectively, the content of IFN-gamma and IL-2 in the supernatant was detected by ELISA kit. FIG. 8 shows that NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments can promote the secretion of cytokines IFN-gamma and IL-2 by TILs.

Example eight

After transferring LV-2136 and LV-2137 plasmids into TILs for 24 hours, respectively, the plasmids were incubated with bladder cancer cells in vitro for 24 and 48 hours, and then proliferation of the bladder cancer cells was detected by using CCK8 kit. FIG. 9 shows that NEAT1-gRNA3 and NEAT1-gRNA5 nucleic acid fragments can promote killing of bladder cancer cells by TILs.

The foregoing description is only a preferred embodiment of the present invention, and the present invention is not limited thereto, but it is to be understood that modifications and equivalents of some of the technical features described in the foregoing embodiments may be made by those skilled in the art, although the present invention has been described in detail with reference to the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. The application of substances for promoting the activity of long-chain non-coding RNANEAT1 in preparing anti-tumor products;

further, the substance is a substance for promoting the activity of long-chain non-coding RNA NEAT1 in tumor invasive T lymphocyte TILs;

preferably, the agent that promotes long-chain non-coding nucleic acid NEAT1 activity comprises a nucleic acid fragment;

the single-stranded nucleic acid sequence of the nucleic acid fragment is shown as SEQ ID NO.1 or SEQ ID NO.2 respectively.

2. The use of claim 1, wherein the tumor comprises a bladder tumor, an oral tumor, lung cancer, stomach cancer, liver cancer, intestinal cancer, uterine tumor, or osteosarcoma;

the application is specifically to promote tumor infiltration T lymphocyte TILs to kill tumor cells.

3. A nucleic acid fragment, characterized in that the nucleic acid fragment is a double-stranded nucleic acid; the single-stranded sequence of the nucleic acid fragment is shown as SEQ ID NO.1 or SEQ ID NO.2 respectively.

4. A recombinant vector, wherein the expression vector comprises the nucleic acid fragment of claim 3;

the recombinant vector also includes lentivirus LV and an expression cassette for expressing dsacas 9.

5. A host obtained by transfecting tumor-infiltrating T-lymphocyte TILs with the recombinant vector of claim 4.

6. Use of the nucleic acid fragment of claim 3 or the recombinant vector of claim 4 or the host of claim 5 in any of the following:

i) Promoting NEAT1 activity in TILs or preparing related products for promoting NEAT1 activity in TILs;

II) inhibiting the activity of immune checkpoints in TILs or for the preparation of immune checkpoint inhibition products;

III) promoting proliferation of TILs or preparing a product for promoting proliferation of TILs;

IV) use of a reagent for promoting secretion of cytokines by TILs cells or for preparing a reagent for promoting secretion of cytokines by TILs cells;

v) application in promoting killing tumor cells or preparing products for promoting TILs to kill tumor cells;

preferably, the immune checkpoint comprises PD-1, CTLA-4, TIGIT, and LAG3;

preferably, the tumor comprises bladder tumor, oral tumor, lung cancer, gastric cancer, liver cancer, intestinal cancer, uterine tumor or osteosarcoma.

7. An antitumor agent prepared from the nucleic acid fragment of claim 3, the recombinant vector of claim 4 or the host of claim 5.

8. The antitumor drug of claim 7, further comprising other ingredients having antitumor activity;

or, in the antitumor drug, a buffer agent for maintaining the host activity of claim 5;

or, the antitumor drug further comprises a carrier which is necessary in pharmacy.

9. The antitumor drug of claim 8, wherein the additional antitumor active ingredient comprises paclitaxel, doxorubicin, cisplatin, mitomycin, fluorouracil, gemcitabine, or a tyrosine kinase inhibitor.

10. The anti-tumor drug according to claim 8, wherein the anti-tumor drug comprises an anti-tumor model drug;

or, the antitumor drug comprises an antitumor preparation against brain tumor, oral tumor, lung cancer, gastric cancer, liver cancer, intestinal cancer, bladder cancer, uterine tumor and/or osteosarcoma.