CN117604110A - Biomarker for breast cancer diagnosis and prognosis and application thereof - Google Patents
Biomarker for breast cancer diagnosis and prognosis and application thereof Download PDFInfo
- Publication number
- CN117604110A CN117604110A CN202410089751.9A CN202410089751A CN117604110A CN 117604110 A CN117604110 A CN 117604110A CN 202410089751 A CN202410089751 A CN 202410089751A CN 117604110 A CN117604110 A CN 117604110A
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- shcbp1
- sample
- expression
- her2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 206010006187 Breast cancer Diseases 0.000 title claims abstract description 111
- 208000026310 Breast neoplasm Diseases 0.000 title claims abstract description 111
- 238000004393 prognosis Methods 0.000 title claims abstract description 20
- 238000003745 diagnosis Methods 0.000 title claims abstract description 16
- 239000000090 biomarker Substances 0.000 title claims abstract description 15
- 101000863815 Homo sapiens SHC SH2 domain-binding protein 1 Proteins 0.000 claims abstract description 77
- 102100029989 SHC SH2 domain-binding protein 1 Human genes 0.000 claims abstract description 77
- 101001012157 Homo sapiens Receptor tyrosine-protein kinase erbB-2 Proteins 0.000 claims abstract description 61
- 102100030086 Receptor tyrosine-protein kinase erbB-2 Human genes 0.000 claims abstract description 61
- 239000000523 sample Substances 0.000 claims description 29
- 238000012360 testing method Methods 0.000 claims description 29
- 210000001519 tissue Anatomy 0.000 claims description 26
- 210000004027 cell Anatomy 0.000 claims description 25
- 206010028980 Neoplasm Diseases 0.000 claims description 24
- 208000005443 Circulating Neoplastic Cells Diseases 0.000 claims description 19
- 238000007901 in situ hybridization Methods 0.000 claims description 14
- 238000001514 detection method Methods 0.000 claims description 10
- 238000001574 biopsy Methods 0.000 claims description 9
- 239000013068 control sample Substances 0.000 claims description 9
- 210000002381 plasma Anatomy 0.000 claims description 7
- 210000004369 blood Anatomy 0.000 claims description 5
- 239000008280 blood Substances 0.000 claims description 5
- 229920000742 Cotton Polymers 0.000 claims description 4
- 210000001124 body fluid Anatomy 0.000 claims description 4
- 239000010839 body fluid Substances 0.000 claims description 4
- 239000003795 chemical substances by application Substances 0.000 claims description 4
- 238000004519 manufacturing process Methods 0.000 claims description 4
- 210000000056 organ Anatomy 0.000 claims description 4
- 239000012188 paraffin wax Substances 0.000 claims description 4
- 210000004915 pus Anatomy 0.000 claims description 4
- 230000028327 secretion Effects 0.000 claims description 4
- 210000002966 serum Anatomy 0.000 claims description 4
- 210000002700 urine Anatomy 0.000 claims description 4
- 229940079593 drug Drugs 0.000 abstract description 7
- 239000003814 drug Substances 0.000 abstract description 7
- 230000001419 dependent effect Effects 0.000 abstract description 4
- 239000003550 marker Substances 0.000 abstract description 3
- 238000003364 immunohistochemistry Methods 0.000 description 9
- 238000010186 staining Methods 0.000 description 8
- 206010027476 Metastases Diseases 0.000 description 7
- 230000009401 metastasis Effects 0.000 description 7
- 210000000481 breast Anatomy 0.000 description 6
- 201000011510 cancer Diseases 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 5
- 210000000170 cell membrane Anatomy 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 108020004999 messenger RNA Proteins 0.000 description 5
- 108090000623 proteins and genes Proteins 0.000 description 5
- 102000004169 proteins and genes Human genes 0.000 description 5
- 210000004881 tumor cell Anatomy 0.000 description 5
- 238000011529 RT qPCR Methods 0.000 description 4
- 102220497176 Small vasohibin-binding protein_T47D_mutation Human genes 0.000 description 4
- 229940049595 antibody-drug conjugate Drugs 0.000 description 4
- 230000001575 pathological effect Effects 0.000 description 4
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 4
- 101100314454 Caenorhabditis elegans tra-1 gene Proteins 0.000 description 3
- 208000017891 HER2 positive breast carcinoma Diseases 0.000 description 3
- 230000004083 survival effect Effects 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 238000002965 ELISA Methods 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 239000000611 antibody drug conjugate Substances 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 239000012472 biological sample Substances 0.000 description 2
- 230000000875 corresponding effect Effects 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000010837 poor prognosis Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 241000251468 Actinopterygii Species 0.000 description 1
- 108091033409 CRISPR Proteins 0.000 description 1
- 238000010354 CRISPR gene editing Methods 0.000 description 1
- 208000005623 Carcinogenesis Diseases 0.000 description 1
- 101150054472 HER2 gene Proteins 0.000 description 1
- 101000738771 Homo sapiens Receptor-type tyrosine-protein phosphatase C Proteins 0.000 description 1
- 208000007433 Lymphatic Metastasis Diseases 0.000 description 1
- 241000124008 Mammalia Species 0.000 description 1
- 206010027459 Metastases to lymph nodes Diseases 0.000 description 1
- 108010033276 Peptide Fragments Proteins 0.000 description 1
- 102000007079 Peptide Fragments Human genes 0.000 description 1
- 241000288906 Primates Species 0.000 description 1
- 102100037422 Receptor-type tyrosine-protein phosphatase C Human genes 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000010100 anticoagulation Effects 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 230000036952 cancer formation Effects 0.000 description 1
- 231100000504 carcinogenesis Toxicity 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000010924 continuous production Methods 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 108700020302 erbB-2 Genes Proteins 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 210000002865 immune cell Anatomy 0.000 description 1
- 238000003119 immunoblot Methods 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 206010061289 metastatic neoplasm Diseases 0.000 description 1
- 239000011325 microbead Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 210000004923 pancreatic tissue Anatomy 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000008685 targeting Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 238000001262 western blot Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57415—Specifically defined cancers of breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
Abstract
The invention relates to the technical field of biological medicines, in particular to a biomarker for diagnosing and prognosis judging breast cancer and application thereof. More specifically, the present invention relates to a biomarker for diagnosis and prognosis of breast cancer, in particular HER2low expressing breast cancer, said biomarker being SHCBP1. The inventors have found that SHCBP1 is expressed at significantly higher levels in breast cancer patients than in healthy humans. More particularly, the inventors have found that high level expression of SHCBP1 is dependent on HER2 expression in breast cancer patients, even low level expressed HER2 may cause high level expression of SHCBP1. Thus high level expression of SHCBP1 can be used as a marker of HER2 expression for diagnosis of HER2low expressing breast cancer.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to a biomarker for diagnosing and prognosis judging breast cancer and application thereof.
Background
Improving the accuracy and the high efficiency of breast cancer treatment has become the medical target of the new era. HER2 is an important target for accurate treatment of breast cancer, and recently, with rapid development of targeted drugs and novel Antibody Drug Conjugates (ADCs), HER2low expression and heterogeneity are hot spot problems of current interest.
The expression of HER2 in breast cancer is divided into HER2 negative (HER 2-) and HER2 positive (her2+), with hr+her2-breast cancer being the most common breast cancer subtype, by using Immunohistochemistry (IHC) and Fluorescence In Situ Hybridization (FISH). IHC results from HER2 detection were classified into IHC 0, IHC1+, IHC2+ and IHC3+ according to the 2018 ASCO/CAP guidelines, based on staining intensity and percentage of intact cell membrane staining number; wherein IHC 0 represents an incomplete cell membrane staining without staining or weakly staining and the stained tumor cells are 10% or less; ihc1+ represents weak stained incomplete cell membrane staining and stained tumor cells are greater than 10%; IHC2+ represents weak to moderate intact cell membrane staining, and stained tumor cells are greater than 10%; ihc3+ represents highly intact cell membrane staining, and stained tumor cells are greater than 10%. HER2 positive includes ihc2+ and fish+ and ihc3+, HER2 negative includes IHC 0 or ihc1+ or ihc2+ and FISH negative. Whereas HER2 negative can be further divided into HER2low and HER2-0 based on IHC and FISH detection results. HER2low is defined as: IHC1+ or IHC2+ and FISH negative; HER2-0 is defined as: IHC 0.
Breast cancer HER2 positivity accounts for approximately 15-20% of all breast cancer cases. However, as the intensive research studies have found that HER2 expression levels are a continuous process, even in HER2 ihc3+ patients, the mRNA levels may be quite different. Thus, HER2 alone is positive or negative and does not meet clinical treatment requirements. With the rapid development of ADC drugs, the definition of HER2low expression is proposed, i.e. HER2 ihc1+ or 2+ and no HER2 amplification. If the breast cancers are proportioned, the breast cancers of HER2 are not really detected, and about 30-40% of the total breast cancers are left, and about 45-55% of the breast cancers are left, which is called 'HER 2low expression breast cancers'.
The american pathologist association (CAP) uses a tissue chip tableting method to statistically analyze the results of HER2 expression compartment interstitial control in 2019-2020, which shows that the HER2 positive or negative determination consistency is as high as 90% or more, but the consistency between 0 and 1+ is less than 70%. Subsequently, 18 pathologists with more than 5 years of working experience performed HER2 expression interpretation on 170 scan slices, with 0 and 1+ being only 26% identical, far less than 2+ and 3+58% identical. The results of the study demonstrate that pathologists still have identifying deficiencies in HER2low expression, especially the accurate differentiation of 1+ from 0.
Therefore, although ADC drugs have made significant progress in the field of breast cancer treatment targeting HER2, there is still a worrying hidden danger behind it, and in-study patients, HER2 detection follows a dichotomy of HER2 expression, and no specific detection mode and standard are proposed for HER2low expression. Thus, when the detection method does not exactly match a potentially benefited patient, it may result in some of the patients who would benefit losing medication opportunities (false negatives) or in poor benefited patients taking medication (false positives).
Thus, there is an urgent need in the art for methods and methods for HER2low expression detection that are effective in improving the consistency of HER2low expression interpretation.
Circulating tumor cells are a subset of tumor cells that shed from a primary tumor or metastatic tumor and are released into the blood circulation. Recent studies have found that, on the one hand, circulating tumor cells may appear in the peripheral blood of patients very early in tumorigenesis, which aids in early diagnosis of cancer. On the other hand, these circulating tumor cells can also be used to predict prognosis in cancer patients, and the discovery of circulating tumor cells often predicts recurrence or metastasis of a tumor, which also suggests poor prognosis in patients. How to use circulating tumor cells for diagnosis or prognosis of cancer, especially specific cancers such as breast cancer, is also an important direction in our future in the search of circulating tumor cell lines. A great benefit of using circulating tumor cells for diagnosis or prognosis is that it can effectively replace tumor biopsies, which is a good surrogate indicator for those patients who cannot take a pathological tissue biopsy, and can help clinicians to dynamically monitor and determine the biological characteristics of cancer in real time. However, due to the scarcity of circulating tumor cells, the use thereof as a means of diagnosing cancer, particularly specific cancers such as breast cancer, presents challenges, and not all cancer-related markers can be detected in circulating tumor cells.
Therefore, it is of great clinical value to find biomarkers suitable for diagnosis by means of circulating tumor cells.
Disclosure of Invention
To solve the above problems, the present inventors have found that the expression level of SHCBP1 in breast cancer patients is significantly higher than in healthy people. More particularly, the inventors have found that high level expression of SHCBP1 is dependent on HER2 expression in breast cancer patients, even low level expressed HER2 may cause high level expression of SHCBP1. Thus high level expression of SHCBP1 can be used as a marker of HER2 expression for diagnosis of HER2low expressing breast cancer.
Accordingly, the present invention provides a biomarker for breast cancer diagnosis, wherein the breast cancer is HER2low expressing breast cancer and the biomarker is SHCBP1.
In other aspects, the invention also provides a biomarker for prognosis of breast cancer, wherein the breast cancer is HER2low expressing breast cancer and the biomarker is SHCBP1.
In other aspects, the invention also provides the use of an agent that detects SHCBP1 expression in the manufacture of a tool for diagnosis of breast cancer, wherein the breast cancer is HER2low expressing breast cancer.
In other aspects, the invention also provides the use of an agent that detects SHCBP1 expression in the manufacture of a tool for prognosis determination of breast cancer, wherein the breast cancer is HER2low expressing breast cancer.
Further, the diagnosis of breast cancer comprises the steps of:
(1) Collecting a sample of a test subject, and collecting a control sample;
(2) Detecting and comparing the expression level of SHCBP1 in the sample of the test subject and the control sample;
(3) Detecting the expression level of HER2 in a sample of a test subject by In Situ Hybridization (ISH);
if step (3) ISH detection is negative and the expression level of SHCBP1 in the sample of the test subject is increased compared to the expression level of SHCBP1 in the control sample, diagnosing that the test subject has HER2low expressing breast cancer.
Further, the control sample is derived from healthy tissue of a healthy population or test subject.
Further, the prognosis of breast cancer comprises the following steps:
(1) Collecting samples of a pre-breast cancer patient as a group to be tested, and taking the samples of the pre-breast cancer patient as a control group;
(2) Detecting and comparing the expression level of SHCBP1 in the samples of the test group and the control group;
and if the expression level of SHCBP1 in the sample of the test group is lower than that of SHCBP1 in the sample of the control group, judging that the prognosis of the test group is good.
As used herein, the subject includes a mammal, preferably a primate mammal, more preferably a human.
As used herein, a sample of the test subject includes a clinical biological sample of the subject, including, but not limited to, one or more of serum, plasma, whole blood, secretions, cotton swabs, pus, body fluids, tissues, organs, paraffin sections, tumor tissue, biopsy samples, circulating tumor cells, circulating tumor DNA, or urine shed cells. In a preferred embodiment, the sample of the test subject comprises breast tissue of the test subject, such as a breast biopsy sample, and the control sample is derived from breast tissue of a healthy subject, such as a breast biopsy sample, or healthy tissue of the test subject, such as a paracancerous tissue. In a preferred embodiment, the sample of the test subject is a circulating tumor cell.
As used herein, the samples of the prognostic and pre-breast cancer patients include clinical biological samples of the subject, including, but not limited to, one or more of serum, plasma, whole blood, secretions, cotton swabs, pus, body fluids, tissues, organs, paraffin sections, tumor tissue, biopsy samples, circulating tumor cells, circulating tumor DNA, or urine shed cells. In a preferred embodiment, the sample of the prognostic and pre-breast cancer patient comprises breast tissue of the subject to be tested, such as a breast biopsy sample. In a preferred embodiment, the sample of the prognostic and pre-breast cancer patient is circulating tumor cells.
As used herein, the reagent for detecting the expression of SHCBP1 in a sample of a test subject is not particularly limited, and is a reagent for detecting the expression of SHCBP1 at the mRNA or protein level in a sample of a subject, which is well known and readily available to those skilled in the art. For example, reagents for detecting the expression of SHCBP1 in a subject sample may include corresponding reagents for real-time fluorescent quantitative PCR, enzyme-linked immunosorbent assay (ELISA), protein/peptide fragment chip detection, chemiluminescence, immunoblotting, microbead immunodetection, microfluidic immunodetection.
The beneficial effects of the invention are that
The invention perfectly solves the problem of poor judgment consistency rate of HER2 IHC 0 and 1+ in the prior art by selecting SHCBP1 as a diagnosis and prognosis marker of HER2 low-expression breast cancer. The inventors have found that there is a certain correlation between the increase in SHCBP1 expression level and HER2 expression, and from the results of example 2 of the present invention, it is clear that even in the case where HER2 expression level is low, the expression level of SHCBP1 is significantly increased, and thus the expression level of SHCBP1 is very suitable as a measure of low HER2 expression level. Thus, the present inventors have found that it is possible to determine that a subject is HER 2-low-expressing breast cancer, as long as an increase in SHCBP1 expression level is detected and the ISH detection result of HER2 is negative, which has not been found by the previous studies. In addition, the present invention also finds that diagnosis and prognosis of breast cancer can be performed by harvesting circulating tumor cells from a subject and detecting the expression level of SHCBP1 therein.
Drawings
Fig. 1 shows high expression of SHCBP1 in HER 2-low expressing breast cancer and HER 2-positive breast cancer tissue samples (part a in fig. 1 is at the mRNA level and part B in fig. 1 is at the protein level).
Fig. 2 shows high expression of SHCBP1 in circulating tumor cells of HER 2-low expressing breast cancer and HER 2-positive breast cancer patients.
Figure 3 shows the verification of HER2 expression levels in T47D cells, ZR-75-1 cells and BT474 cells and changes in HER2 expression levels after HER2 knockout.
FIG. 4 shows the change in the expression level of SHCBP1 in T47D cells, ZR-75-1 cells and BT474 cells before and after HER2 knockout.
FIG. 5 shows the results of a test of the expression of SHCBP1 in relation to tumor size.
Fig. 6 shows the test results of the relationship between SHCBP1 high expression and HER2low expression breast cancer patient pathology grading.
Fig. 7 shows the test results of the relationship between SHCBP1 high expression and HER2low expression breast cancer metastasis.
Fig. 8 shows the test results of the relationship between the level of SHCBP1 expression and the overall survival of HER 2-low expressing breast cancer patients.
Detailed Description
The present invention is further illustrated below with reference to specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.
Example 1: SHCBP1 is highly expressed in breast cancer
Clinical 138 breast cancer tissue samples and 24 paracancestral normal tissue samples are collected, tissue chips are made, HER2 expression levels in the breast cancer tissue samples are detected through In Situ Hybridization (ISH), and typing is carried out according to the HER2 expression levels, so that 50 HER2 IHC0+ breast cancer tissue samples, 58 HER2 IHC1+ or IHC2+ and ISH negative breast cancer tissue samples (namely, so-called HER2 low-expression breast cancer) and 30 HER2 positive (namely, IHC2+ and ISH positive and IHC3+) breast cancer tissue samples are obtained.
mRNA and protein levels of SHCBP1 were detected by RT-qPCR and Western Blot methods, respectively, using TRIzol (15596018, invitrogen) to extract mRNA and protein from the above-described breast cancer tissue sample and paracancerous normal tissue sample, respectively. The results are shown in fig. 1, which shows that the expression level of SHCBP1 is significantly increased in both HER2 ihc1+, 2+ and 3+ breast cancer tissue samples, whereas the increase is not significant in HER2 ihc0+ breast cancer tissue samples, suggesting that the expression level of SHCBP1 can be used to distinguish HER2 negative breast cancer from HER2low expressing breast cancer.
Example 2: detection of SHCBP1 expression levels in circulating tumor cells of breast cancer patients
1) Respectively extracting 10mL of venous blood of HER2 IHC0+ breast cancer, HER2 IHC1+ or IHC2+ breast cancer with ISH negative (namely, so-called HER2 low-expression breast cancer) and HER2 positive (namely, IHC2+ breast cancer with ISH positive and IHC3+) breast cancer patients in an ACD anticoagulation tube, and conventionally centrifuging and separating plasma for later use;
2) Enrichment and separation of CTC cells in plasma comprises the following specific steps: extracting single cell layer from blood plasma by adding sample density separating liquid (Cytelligen), and removing CD45 in the extracted single cell layer by adding immunocyte to remove magnetic bead + Immune cells are removed, and CTC in a single cell layer is concentrated and enriched through differential enrichment;
3) The enriched CTC cells were harvested by centrifugation and 1ml of RNA lysate was added to the enzyme-free EP tube; 200ul of chloroform is added into an EP tube, vigorously oscillated for 15 seconds, and kept still at room temperature for 3 minutes, and repeated for 3 times; centrifuging at 12000 Xg and 4 ℃ for 15min; adding the upper water phase into a new enzyme-free EP pipe, adding equal volume of isopropanol into the EP pipe, reversing, mixing uniformly, and standing for 10min; centrifuging at 12000 Xg and 4 ℃ for 15min; the EP tube liquid was discarded, 1ml of 75% ethanol was added, and the EP tube was shaken; centrifuging at 12000 Xg and 4 ℃ for 5min; discarding the supernatant, and standing at room temperature for drying; adding a proper amount of DEPC water to dissolve RNA; the purity and concentration of RNA was measured and the expression of SHCBP1 in CTC cells was measured by RT-qPCR and compared to the expression of SHCBP1 in cells harvested from normal pancreatic tissue, as shown in fig. 2, which demonstrates that abnormally high expression levels of SHCBP1 can be detected in CTC cells of HER2 ihc1+, 2+ and 3+ breast cancer patients.
Example 3: high expression of SHCBP1 in breast cancer is dependent on HER expression
RNA was extracted using T47D cells (HER 2 negative breast cancer cells), ZR-75-1 cells (HER 2 low-expressing breast cancer cells) and BT474 cells (HER 2 positive breast cancer cells), and the amount of HER2 expression was verified by RT-qPCR and the SHCBP1 expression level was detected. The results are shown in FIG. 3, which shows that SHCBP1 expression levels in both BT474 cells and ZR-75-1 cells were increased compared to T47D cells.
The HER2 gene (hHer 2 gRNA_F: CACCGCGGCACAGACAGTGCGCGTC; hHer2 gRNA_R: AAACGACGCGCACTGT CTGTGCCGC) in BT474 cells and ZR-75-1 cells was knocked out by CRISPR editing technique, RNA was extracted, HER2 expression amount was verified by RT-qPCR, and SHCBP1 expression level was detected. The results are shown in fig. 4, which shows that the expression level of SHCBP1 is no longer elevated after HER2 knockout, indicating that high expression of SHCBP1 in breast cancer is dependent on HER expression, and thus the expression level of SHCBP1 can reflect the HER expression level and thus can be used to diagnose HER low-expression breast cancer.
As can be seen from comparison of the results of fig. 3 and fig. 4, the expression level of SHCBP1 is significantly increased even in the case where the expression level of HER2 is low, and thus the expression level of SHCBP1 is very suitable as a measure of the low HER2 expression level.
Example 4: relationship of SHCBP1 to clinical prognosis of breast cancer
Based on the SHCBP1 expression level measured in example 1, the relationship of the SHCBP1 to tumor size, pathological grading and metastasis of patients with HER2 low-expression breast cancer was statistically analyzed, and the results are shown in fig. 5 and 6.
FIG. 5 shows the results of the test of the relationship between the expression of SHCBP1 and the tumor size, and FIG. 6 shows the results of the test of the relationship between the high expression of SHCBP1 and the pathological grading of patients with HER2low expression breast cancer, wherein the higher the expression of SHCBP1, the larger the tumor of the patients; it was also found that: in cases of grade I, grade II and grade III of HER 2-underexpressing breast cancer patients, SHCBP1 expression showed an increasing trend in the corresponding breast cancer patients as grade I, grade II and grade III progression increases, indicating that: SHCBP1 and breast cancer patient tumor size and pathological grading appear to be positively correlated.
The inventors performed statistical analysis based on the presence or absence of metastasis and the number of lymph node metastases in the obtained HER 2-low-expression breast cancer patients, and the results are shown in fig. 7: it can be seen that 78.2% of patients with HER2low expression breast cancer that developed metastasis exhibited high SHCBP1 expression, and 52.4% of patients with HER2low expression breast cancer that did not develop metastasis exhibited high SHCBP1 expression, indicating that SHCBP1 high expression and HER2low expression breast cancer metastasis may exhibit high positive correlation.
Finally, the inventors analyzed the relationship between the level of SHCBP1 expression and the overall survival of patients with HER2 low-expressing breast cancer. As shown in fig. 8, it can be seen that in the group of HER2 Low-expression breast cancer patients with High SHCBP1 expression (SHCBP 1 High), the overall survival rate was significantly lower for five years than that of the group of breast cancer patients with Low SHCBP1 expression (SHCBP 1 Low). This illustrates: high SHCBP1 expression results in poor prognosis for HER2low expressing breast cancer patients.
It should be noted that the description of the present invention and the accompanying drawings illustrate preferred embodiments of the present invention, but the present invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, which are not to be construed as additional limitations of the invention, but are provided for a more thorough understanding of the present invention. The above-described features are further combined with each other to form various embodiments not listed above, and are considered to be the scope of the present invention described in the specification; further, modifications and variations of the present invention may be apparent to those skilled in the art in light of the foregoing teachings, and all such modifications and variations are intended to be included within the scope of this invention as defined in the appended claims.
Claims (8)
1. A biomarker for breast cancer diagnosis, wherein the breast cancer is HER2low expressing breast cancer and the biomarker is SHCBP1.
2. A biomarker for prognosis of breast cancer, wherein the breast cancer is HER 2-low expressing breast cancer and the biomarker is SHCBP1.
3. Use of an agent that detects SHCBP1 expression in the manufacture of a tool for diagnosis of breast cancer, characterized in that the breast cancer is HER2low expressing breast cancer.
4. Use of an agent that detects SHCBP1 expression in the manufacture of a tool for prognosis of breast cancer, characterized in that the breast cancer is HER2low expressing breast cancer.
5. The use according to claim 3, wherein the diagnosis of breast cancer comprises the steps of:
(1) Collecting a sample of a test subject, and collecting a control sample;
(2) Detecting and comparing the expression level of SHCBP1 in the sample of the test subject and the control sample;
(3) Detecting the expression level of HER2 in a sample of a test subject by In Situ Hybridization (ISH);
if step (3) ISH detection is negative and the expression level of SHCBP1 in the sample of the test subject is increased compared to the expression level of SHCBP1 in the control sample, diagnosing that the test subject has HER2low expressing breast cancer.
6. The use according to claim 5, wherein the control sample is derived from healthy tissue of a healthy population or a subject to be tested,
the sample of the subject to be tested is one or more of serum, plasma, whole blood, secretion, cotton swab, pus, body fluid, tissue, organ, paraffin section, tumor tissue, biopsy sample, circulating tumor cells, circulating tumor DNA or urine shed cells.
7. The use according to claim 4, wherein the prognosis of breast cancer comprises the steps of:
(1) Collecting samples of a pre-breast cancer patient as a group to be tested, and taking the samples of the pre-breast cancer patient as a control group;
(2) Detecting and comparing the expression level of SHCBP1 in the samples of the test group and the control group;
and if the expression level of SHCBP1 in the sample of the test group is lower than that of SHCBP1 in the sample of the control group, judging that the prognosis of the test group is good.
8. The use according to claim 7, wherein the sample of the patient with prognosis and pre-breast cancer is one or more of serum, plasma, whole blood, secretions, cotton swabs, pus, body fluids, tissues, organs, paraffin sections, tumor tissue, biopsy samples, circulating tumor cells, circulating tumor DNA or urine shed cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410089751.9A CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410089751.9A CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117604110A true CN117604110A (en) | 2024-02-27 |
| CN117604110B CN117604110B (en) | 2024-04-19 |
Family
ID=89960174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410089751.9A Active CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117604110B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805197A (en) * | 2015-04-09 | 2015-07-29 | 嘉兴市第二医院 | Method for taking molecular marker in diagnosis and prognosis evaluation of breast cancer |
| CN107106687A (en) * | 2014-10-03 | 2017-08-29 | 诺华股份有限公司 | Combined therapy |
| CN110628913A (en) * | 2019-04-15 | 2019-12-31 | 德阳市人民医院 | lncRNA marker related to breast cancer |
| CN114712512A (en) * | 2021-01-06 | 2022-07-08 | 兰州大学第二医院 | Novel combination therapy for treating HER2 positive cancer |
-
2024
- 2024-01-23 CN CN202410089751.9A patent/CN117604110B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107106687A (en) * | 2014-10-03 | 2017-08-29 | 诺华股份有限公司 | Combined therapy |
| CN104805197A (en) * | 2015-04-09 | 2015-07-29 | 嘉兴市第二医院 | Method for taking molecular marker in diagnosis and prognosis evaluation of breast cancer |
| CN110628913A (en) * | 2019-04-15 | 2019-12-31 | 德阳市人民医院 | lncRNA marker related to breast cancer |
| CN114712512A (en) * | 2021-01-06 | 2022-07-08 | 兰州大学第二医院 | Novel combination therapy for treating HER2 positive cancer |
Non-Patent Citations (4)
| Title |
|---|
| JIANXIN WANG 等: "A four-gene signature in the tumor microenvironment that significantly associates with the prognosis of patients with breast cancer", 《GENE》, vol. 761, 10 August 2020 (2020-08-10), pages 1 - 8 * |
| NAN LIU 等: "Eight hub genes as potential biomarkers for breast cancer diagnosis and prognosis: A TCGA-based study", 《WORLD J CLIN ONCOL》, vol. 13, no. 8, 24 August 2022 (2022-08-24), pages 675 - 688 * |
| WEN FENG 等: "SHCBP1 is over-expressed in breast cancer and is important in the proliferation and apoptosis of the human malignant breast cancer cell line", 《GENE》, vol. 587, 26 April 2016 (2016-04-26), pages 91, XP029540263, DOI: 10.1016/j.gene.2016.04.046 * |
| 赵诗哲 等: "SHCBP1: 乳腺癌治疗候选靶点和潜在预后标志物", 《生物信息学》, vol. 18, no. 1, 31 March 2020 (2020-03-31), pages 45 - 55 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117604110B (en) | 2024-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Elhanafi et al. | Comparison of endoscopic ultrasound tissue acquisition methods for genomic analysis of pancreatic cancer | |
| KR20110063753A (en) | Lung cancer biomarkers and uses thereof | |
| KR20130129347A (en) | Lung cancer biomarkers and uses thereof | |
| CN108179134B (en) | EpCAM/PSMA-based double-antibody functionalized microfluidic chip and preparation method and application thereof | |
| US20130196355A1 (en) | Method and a kit to quantify and qualify exosomes for diagnosis of prostate cancer and prostate hyperplasia | |
| CN110541030B (en) | Bladder cancer detection kit and application thereof | |
| Zhu et al. | Six stroma-based RNA markers diagnostic for prostate cancer in European-Americans validated at the RNA and protein levels in patients in China | |
| CN105899673A (en) | Keratins as biomarkers for cervical cancer and survival | |
| CN117604110B (en) | Biomarker for breast cancer diagnosis and prognosis and application thereof | |
| KR102384848B1 (en) | Keratin 17 as a biomarker for bladder cancer | |
| CN106480188B (en) | The application of the molecular probe, kit and the molecular probe of metastatic prostate cancer early prediction | |
| US11448650B2 (en) | Methods for diagnosing high-risk cancer using polysialic acid and one or more tissue-specific biomarkers | |
| CN117625790B (en) | Biomarker for diagnosis and prognosis of prostate cancer and application thereof | |
| CN117604111B (en) | Biomarker for diagnosis and prognosis judgment of small cell lung cancer and application thereof | |
| CN117604109B (en) | Biomarker for bladder cancer diagnosis and prognosis and application thereof | |
| CN117604106B (en) | Biomarker for diagnosis and prognosis judgment of non-small cell lung cancer and application thereof | |
| CN117625791B (en) | Biomarker for colorectal cancer diagnosis and prognosis and application thereof | |
| JP5574522B2 (en) | Cancer marker and cancer cell testing method | |
| CN117604112B (en) | Biomarker for pancreatic cancer diagnosis and prognosis and application thereof | |
| CN117625792B (en) | Biomarker for diagnosis and prognosis of gastric cancer and application thereof | |
| CN117604108B (en) | Biomarker for liver cancer diagnosis and prognosis and application thereof | |
| CN117604107B (en) | Use of FOXO6 and SNX4 in combination for diagnosing breast cancer | |
| US20230176061A1 (en) | Methods for diagnosing high-risk cancer using polysialic acid and one or more tissue-specific biomarkers | |
| US20170029898A1 (en) | Novel method for screening for prostate cancer | |
| Nasir et al. | Correlation of E-Cadherin Expression with Clinicopathological Parameters and Its Outcomes among Prostate Cancer Patients in Hospital Kuala Lumpur. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |