CN117587115A - SNP locus related to blood fat in IL9 gene and application thereof - Google Patents

SNP locus related to blood fat in IL9 gene and application thereof Download PDF

Info

Publication number
CN117587115A
CN117587115A CN202310631281.XA CN202310631281A CN117587115A CN 117587115 A CN117587115 A CN 117587115A CN 202310631281 A CN202310631281 A CN 202310631281A CN 117587115 A CN117587115 A CN 117587115A
Authority
CN
China
Prior art keywords
gene
density lipoprotein
application
locus
low
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310631281.XA
Other languages
Chinese (zh)
Inventor
程翔
查灵凤
张红松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tongji Medical College of Huazhong University of Science and Technology
Original Assignee
Tongji Medical College of Huazhong University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tongji Medical College of Huazhong University of Science and Technology filed Critical Tongji Medical College of Huazhong University of Science and Technology
Priority to CN202310631281.XA priority Critical patent/CN117587115A/en
Publication of CN117587115A publication Critical patent/CN117587115A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/206—IL-9
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Obesity (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Diabetes (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)

Abstract

The invention belongs to the field of biotechnology research, and discloses SNP loci related to blood fat in an IL9 gene and application thereof. Application of IL9 gene rs31563 site TT gene detection agent in preparing high density lipoprotein high level screening reagent; or, the application of the IL9 gene rs31563 locus CT or CC gene detection agent in preparing a low-level screening agent in high-density lipoprotein. The application of the gene vector in preparing the medicine for preventing and treating the low density lipoprotein level is that the gene vector contains gene segments, wherein the gene segments are that mononucleotide in the rs31563 locus allele in the IL9 gene is mononucleotide T. The invention discovers a new coronary heart disease detection site, discovers different risk grades aiming at different alleles, and provides a new scheme for diagnosing and preventing the subsequent coronary heart disease and the like.

Description

SNP locus related to blood fat in IL9 gene and application thereof
The application is a divisional application of China patent application with application date 2021-08-25, application number 2021109788161 and name of SNP related to blood fat and application thereof.
Technical Field
The invention belongs to the field of gene technology research, and in particular relates to a SNP locus related to blood fat in an IL9 gene and application thereof.
Background
Dyslipidemia is a relatively common disease, and is a metabolic abnormality of lipoproteins in the human body, mainly including total cholesterol (Tch) and low density lipoprotein cholesterol (LDL-c), elevated Triglycerides (TG), and/or lowered high density lipoprotein cholesterol (HDL-c), etc. Dyslipidemia is closely related to cardiovascular disease, one of the important factors leading to Atherosclerosis (AS), an independent risk factor for coronary heart disease (CAD) and ischemic stroke. The incidence rate of dyslipidemia in China is high, and the tendency of gradual rise is also caused, and the incidence rate is closely related to the reasons such as obvious improvement of the living standard of people in China, change of eating habits and the like. The national survey results in 2012 show that the average value of the total serum cholesterol of adults is 4.50mmol/L, and the prevalence rate of hypercholesterolemia is 4.9%; the average value of the triglyceride is 1.38mmol/L, and the prevalence rate of the hypertriglyceridemia is 13.1 percent; the average value of the high density lipoprotein cholesterol is 1.19mmol/L, and the prevalence of the low HDL-C blood is 33.9%. The overall prevalence of dyslipidemia for adults in China is as high as 40.40%.
Regarding the pathogenesis of atherosclerosis, the german pathologist Virchow proposed the lipid infiltration hypothesis in 1863, which suggested that AS lesions were mainly caused by elevated plasma lipid levels. Dyslipidemia characterized by low elevation of LDL-c or Tch is an important risk factor for atherosclerotic cardiovascular disease (ASCVD); the blood lipid level is positively correlated with the morbidity of AS, the LDL-c level is reduced, the morbidity and death risk of ASCVD can be obviously reduced, and the reduction of low-density lipoprotein cholesterol is taken AS a primary target when lipid-regulating treatment is carried out for preventing cardiovascular diseases. Epidemiology and clinical studies at present prove that HDL-c is inversely related to occurrence probability of diseases such AS CAD, AS and the like, HDL-c is mainly synthesized in the liver, can transfer cholesterol from extrahepatic tissues to the liver for metabolism, is discharged from the body by bile, and is an atherosclerosis-resistant lipoprotein. The proposal of dyslipidemia prevention and treatment (2015 edition) in China proposes that HDL-C is improved from 35mg/dL (0.9 mmol/L) to 40mg/dL (1.03 mmol/L), so that more people can be treated prophylactically. Early discovery and early intervention of dyslipidemia is therefore important for reducing cardiovascular events.
Dyslipidemia is mostly primary dyslipidemia due to genetic defects or interactions with environmental factors, except for a few secondary dyslipidemia due to systemic diseases. As medical science has evolved, it has now been found that a significant proportion of dyslipidemia patients have one or more genetic defects. However, the incidence of dyslipidemia is still increasing year by year, which causes great economic burden to society and people. The method has the advantages of effectively controlling the dyslipidemia, having great significance for ASCVD prevention and control, and periodically checking the dyslipidemia is an important measure for preventing and controlling the dyslipidemia and cardiovascular diseases, so that diagnosis and intervention for early initiation of the dyslipidemia are required.
Disclosure of Invention
Aiming at the problems, the invention provides the SNP locus related to blood lipid in the IL9 gene and the application thereof, which mainly make up for the blank of the existing blood lipid index research part and explore and research new detection and treatment schemes.
In order to solve the problems, the invention adopts the following technical scheme:
application of IL9 gene rs31563 locus or locus detection agent in preparing high density lipoprotein level and/or cardiovascular disease risk detection agent;
preferably, the application is the application of the IL9 gene rs31563 site TT gene detection agent in preparing a dyslipidemia and/or cardiovascular disease low risk screening reagent,
the application is the application of an IL9 gene rs31563 locus CC or CT gene detection agent in preparing a dyslipidemia and/or cardiovascular disease high risk screening reagent;
preferably, the IL9 gene rs31563 locus detection agent comprises a locus amplification primer pair and a nucleic acid probe, and the cardiovascular disease wind detection agent is a cardiovascular disease low risk detection agent.
A high density lipoprotein level and/or cardiovascular disease risk detection reagent comprising an IL9 gene rs31563 site detection agent;
preferably, the high-density lipoprotein high-level characterization and/or cardiovascular disease low-risk detection reagent contains an IL9 gene rs31563 locus TT gene detection reagent,
the low-level characterization reagent in the high-density lipoprotein contains CT or CC gene detection agent at the rs31563 locus of the IL9 gene;
preferably, the IL9 gene rs31563 locus detection agent comprises a locus amplification primer pair and a nucleic acid probe.
In some embodiments, the amplification primer is at least para to
Upstream primer sequence: GCTTAGCAAGGGTAAAGGCC the number of the individual pieces of the plastic,
downstream primer sequence: AGGTGCCTCGCTCTTTGATA.
The application of the gene fragment in preparing and preventing and treating high density lipoprotein low level and/or cardiovascular diseases, wherein the gene fragment is a gene fragment with the gene type TT at the locus rs31563 of the IL9 gene.
A gene vector containing a gene fragment capable of replacing and expressing any single nucleotide in an allele of an rs31563 locus of an IL9 gene by a single nucleotide T; preferably, the single nucleotide in the locus rs31563 allele of the IL9 gene is single nucleotide G.
The application of the gene vector in preparing medicines for preventing and treating dyslipidemia and/or cardiovascular diseases.
A medicament for preventing and treating a low high density lipoprotein level and/or a cardiovascular disease, comprising the aforementioned gene vector;
in some aspects, low levels of high density lipoprotein are characterized by dyslipidemia and high levels of high density lipoprotein are characterized by low risk of vascular disease.
The beneficial effects of the invention are as follows:
provides a new detection scheme for the content of some index parameters in blood fat, and also provides a detection scheme for some diseases such as dyslipidemia; and corresponding detection, treatment schemes and products are provided for diseases caused by some pathogenesis.
Drawings
FIG. 1 is a graph of IL9 gene linkage disequilibrium constructed based on Chinese and Japanese population data in the HapMap database;
FIG. 2 is a schematic diagram of an amplification procedure;
FIG. 3 is a comprehensive scoring mechanism for SNPs by a website.
Detailed Description
The invention is further described below:
the first aspect of the present invention provides the following scheme:
application of IL9 gene rs2069870 locus or locus detection agent in preparing low-density lipoprotein level and/or cardiovascular disease screening reagent;
preferably, the application is the application of the IL9 gene rs2069870 site AA gene detection agent in preparing a reagent for screening the high-risk of the cardiovascular diseases and/or the high-level of the low-density lipoprotein,
the application is the application of an IL9 gene rs2069870 locus GG or GA gene detection agent in preparing a low-density lipoprotein level and/or cardiovascular disease low-risk screening agent;
preferably, the IL9 gene rs2069870 locus detection agent comprises a locus amplification primer pair and a nucleic acid probe.
The foregoing embodiments may be described in some detail with reference to the following description, but are not specifically described, i.e., using existing or later-emerging equivalent techniques are within the scope of the invention. When the gene fragment is used as a prevention and treatment drug, the gene fragment can be used as a treatment target point and the like in the preparation process of the drug, or the related gene fragment containing the sites can be used as auxiliary reagents in the preparation process of the coronary heart disease prevention and treatment drug, such as testing, extraction and the like in the preparation process of biological drugs.
Screening reagent for low density lipoprotein level and/or cardiovascular disease, containing IL9 gene rs2069870 site detecting agent;
preferably, in the reagent for screening the high-level low-density lipoprotein and/or high risk in cardiovascular diseases, the IL9 gene rs2069870 locus detection agent is an IL9 gene rs2069870 locus AA genotype detection agent,
in the low-density lipoprotein level and/or cardiovascular disease low-risk screening reagent, the IL9 gene rs2069870 locus detection agent is an IL9 gene rs2069870 locus GG or GA genotype detection agent;
preferably, the IL9 gene rs2069870 locus detection agent comprises an amplification primer pair and a nucleic acid probe.
In some embodiments, the amplification primer pair of the preceding paragraph is at least (but not limited to)
Upstream primer sequence: TGACAAATTACTCCCCACCTCA the number of the individual pieces of the plastic,
downstream primer sequence: GCCTGACCATACTAGCAACA.
The application of the gene fragment in preparing a medicament for preventing and treating high-level low-density lipoprotein and/or cardiovascular diseases, wherein the gene fragment is a gene fragment with at least one single nucleotide G in an rs2069870 locus allele in an IL9 gene.
The foregoing low density lipoprotein level detection should also be equally within the scope of the present invention when applied to other disease agents.
A gene vector containing a gene fragment capable of replacing and expressing any single nucleotide in alleles of the rs2069870 locus of the IL9 gene with a single nucleotide G; that is, any one of the alleles other than the single nucleotide G can be replaced with the single nucleotide G in the replacement process.
Preferably, any single nucleotide in the allele of the rs2069870 locus of the IL9 gene in the previous paragraph is A, namely, only if the allele contains a G; of course, the foregoing is not necessarily limited to two single nucleotides containing alleles in their entirety, and single or double stranded and the like are within the scope of the present invention.
The site mutation is summarized in that the AA genotype is pathogenic, and G in the GG or GA genotype is protective allele.
The application of the gene vector in preparing medicine for preventing and treating low density lipoprotein level and/or cardiovascular diseases.
A medicament for preventing and treating high-level low-density lipoprotein and/or cardiovascular diseases, which comprises the aforementioned gene vector or the aforementioned gene fragment.
One condition in which the low density lipoprotein level is high is characterized by dyslipidemia.
The second aspect of the invention provides the following scheme (both schemes are IL9 gene locus related):
application of IL9 gene rs31563 locus or locus detection agent in preparing high density lipoprotein level and/or cardiovascular disease risk detection agent;
preferably, the application is the application of the IL9 gene rs31563 site TT gene detection agent in preparing a reagent for screening high-density lipoprotein level and/or cardiovascular diseases with low risk,
the application is the application of an IL9 gene rs31563 locus CC or CT gene detection agent in preparing a high-density lipoprotein low-level and/or cardiovascular disease high-risk screening agent;
preferably, the IL9 gene rs31563 locus detection agent comprises a locus amplification primer pair and a nucleic acid probe.
The foregoing embodiments may be described in some detail with reference to the following description, but are not specifically described, i.e., using existing or later-emerging equivalent techniques are within the scope of the invention. When the gene fragment is used as a prevention and treatment drug, the gene fragment can be used as a treatment target point and the like in the preparation process of the drug, or the related gene fragment containing the sites can be used as auxiliary reagents in the preparation process of the coronary heart disease prevention and treatment drug, such as testing, extraction and the like in the preparation process of biological drugs.
A high density lipoprotein level and/or cardiovascular disease risk detection reagent comprising an IL9 gene rs31563 site detection agent;
preferably, the high-density lipoprotein high-level characterization reagent and/or the cardiovascular disease low-risk detection reagent contains an IL9 gene rs31563 site TT gene detection reagent,
a reagent for low-level characterization in high-density lipoprotein and/or high risk detection of cardiovascular diseases, which contains CT or CC gene detection agent at the rs31563 locus of IL9 gene;
preferably, the IL9 gene rs31563 locus detection agent comprises a locus amplification primer pair and a nucleic acid probe.
In some embodiments, the amplification primer pair of the preceding paragraph is at least (but not limited to)
Upstream primer sequence: GCTTAGCAAGGGTAAAGGCC the number of the individual pieces of the plastic,
downstream primer sequence: AGGTGCCTCGCTCTTTGATA.
The application of the gene fragment in preparing and preventing and treating high density lipoprotein low level and/or cardiovascular diseases, wherein the gene fragment is a gene fragment with the gene type TT at the locus rs31563 of the IL9 gene.
A gene vector containing a gene fragment capable of replacing and expressing any single nucleotide in an allele of an rs31563 locus of an IL9 gene by a single nucleotide T; that is, any non-T single nucleotide allele can be replaced with a single nucleotide T during the replacement. In some cases, it is mainly expressed by replacing C or G with T.
Preferably, any single nucleotide in the rs31563 locus allele of the IL9 gene in the previous paragraph is G or C; of course, the foregoing is not necessarily limited to two single nucleotides containing alleles in their entirety, and single or double stranded and the like are within the scope of the present invention.
The site mutation is summarized in that TT genotype is low risk of disease and CT or CC genotype is high risk of disease.
The application of the gene vector in preparing medicine for preventing and treating high density lipoprotein low level and/or cardiovascular diseases.
A medicament for preventing and treating a low high density lipoprotein level and/or a cardiovascular disease, comprising the aforementioned gene vector and/or the aforementioned gene sequence;
in some aspects, low levels of high density lipoprotein are characterized by dyslipidemia and high levels of high density lipoprotein are characterized by low risk of vascular disease.
The third aspect of the invention further introduces a gene locus application method:
taking a genetic locus as an example, in the new application range involving these genetic loci, some specific methods for their application will be described:
a method of screening a biological sample for a low risk of cardiovascular disease:
extracting a nucleic acid sample from a biological sample to be detected;
specifically amplifying IL9 gene by using the extracted nucleic acid sample as a template, recovering and purifying an amplification product, and determining the nucleic acid sequence of the amplification product;
judging whether the rs31563 locus genotype of the determined nucleic acid sequence is TT, if so, determining that the biological sample to be detected is a biological sample with low risk of cardiovascular diseases, and/or
Judging whether G exists in the rs2069870 locus allele of the determined nucleic acid sequence, if so, determining that the biological sample to be detected is a biological sample with low risk of cardiovascular diseases, otherwise, determining that the genotype is AA, and determining that the biological sample is with high risk of cardiovascular diseases.
Some manifestations of gene vectors are plasmids, adenoviral vectors. Such as transcription activator-like effector nucleases, are well proven techniques. The mutant gene or other pathogenic genes are replaced to restore the normal or low pathogenic gene sequence to realize the treatment, thereby achieving the aim of prevention and treatment. Presently, gene vectors are preferably considered to be known and mature, although it is within the scope of the present invention that future occurrences will be recognized; but all are intended to be within the legal limits. Wherein the specific basic detection principle refers to the results obtained by the research data of the subsequent specific project. The nucleic acid probe may be a similar gene detection probe in one mode, and is not particularly limited as long as it is possible. The levels of the substances obtained as described above and the criteria for risk of disease may be referred to in some ways by other detection means.
Low levels of low density lipoproteins are understood to be low risk for cardiovascular disease, which is an independent risk factor for cardiovascular disease, as well as a traditional risk factor, although low density lipoproteins may also be a risk factor for other diseases, including many, coronary heart disease, diabetes, hypercholesterolemia, stroke, heart failure, etc. In contrast, high density lipoproteins are currently considered as protective factors for cardiovascular disease, with higher high density lipoproteins levels leading to lower risk of cardiovascular disease.
Further described are: the invention mainly provides a judging reference basis for medical staff, is not necessarily limited to adopting the current standard to judge high, low and medium risks, can be used as the reference basis according to the detected numerical range of the content of the substance to be detected in actual use, and can judge the disease risk without strictly referring to the current medical standard. Of course, when a diagnostic treatment regimen is required to be strictly matched, a risk judgment at the time of diagnosis can be referred to. Under current standards, dyslipidemia is also in fact a broad range of dyslipidemia including hypohdl-C blood. Laboratory test results are the main basis for diagnosing dyslipidemia. According to the national manual for preventing and treating dyslipidemia, the Chinese guidelines for preventing and treating dyslipidemia set new standards of blood lipid and cholesterol: the ratio of <5.18mmol/L is in a proper range, the ratio of 5.18-6.19 mmol/L is edge elevation, and the ratio of more than or equal to 6.22mmol/L is elevation. Low density lipoprotein: <3.37mmol/L is a proper range, between 3.37 and 4.12mmol/L is edge elevation, and is equal to or more than 4.14 mmol/L. Triglycerides: the ratio of the total weight of the catalyst to the total weight of the catalyst is below 1.70mmol/L, the ratio of the total weight of the catalyst to the total weight of the catalyst is 1.70-2.15 mmol/L, the marginal rise is more than or equal to 2.26 mmol/L. High density lipoprotein: male should not be <1.04mmol/L and female should not be <1.30mmol/L. However, after the standard is modified, as long as the concept of the invention for detecting and treating diseases is not deviated, the technical scheme is not affected by the change of the judging standard and falls into the protection scope of the invention.
The mutation sites and sequences shown above are all referenced to the Human GRCh38/hg38 version, and it will be understood by those skilled in the art that the mutation sites and sequences shown may be slightly different or changed due to database updates or database differences, and such differences or changes may be found in the database as standard, and such differences or changes are also included in the scope of the present invention.
Fourth inventionAspects are described in connection with a specific project study:
IL9 Gene Tag SNP selection
Inquiring the position information of the genes on a HapMap 3-phase database, and constructing linkage disequilibrium (Linkage disequilibrium, LD) maps of Chinese and Japanese populations in Haploview software. TagSNP on IL9 gene is selected, and the principle of selecting points is as follows:
1) Constructing LD Block map covering the whole gene and 5kbp region upstream and downstream thereof in the Haploview V4.2 version of CHB+JPT (China and Japan) population, and selecting TagSNP.
2)MAF>0.05，r2>0.8。
3) SNPs associated with inflammation have been reported in the literature for preference.
4) SNPs located in the promoter region and the exon region are preferentially selected.
As shown in FIG. 1, an IL9 gene linkage disequilibrium map was constructed based on the Chinese and Japanese population data in the HapMap database. Each box represents the degree of linkage disequilibrium between SNPs, and the in-box numerical value represents r2; the degree of linkage disequilibrium is indicated by the D' color:representing a strong linkage; />Indicating a low linkage. The black boxes represent the selected tagsnps.
According to the following principle: SNP covering the IL9 gene and 5kbp region upstream and downstream thereof is MAF-passed>Filtering 0.05 to obtain 1, 4, 5, 6, 8, 9 and 12 SNP, constructing LD map, and linkage r of 1, 4, 6 and 8 SNP 2 >0.8, all of which can represent several other SNPs by selecting one SNP, while SNP No. 8 is located in the promoter region, so that the SNP is preferentially considered, and several other SNPs 5, 9 and 12 are not linked to each other, so that all SNPs are selected. The IL9 gene eventually has 4 TagSNP inclusion studies: rs31564, rs2069870, rs2069868, rs31563. Details of the selected SNPs are shown in Table 1.
TABLE 1 SNP information selected for IL9 Gene
2. Sample collection
Collecting 1863 CAD samples and 1920 control samples, collecting detailed clinical data information includes: age, sex, height, weight, admission diagnosis, discharge diagnosis, smoking history, drinking history, hypertension history, diabetes history, blood pressure level, blood fat four (total cholesterol, triglyceride, high density lipoprotein, low density lipoprotein) and fasting blood sugar, which meets the requirements of the world medical society of helsinki statement and is approved by the ethical committee.
3. Extraction, split charging and preservation of human peripheral blood whole genome DNA
Human peripheral blood whole genome DNA was extracted using the BloodGen Mini Kit blood gene column type small extraction kit (CW 2087) provided for century. The operation steps are according to the instruction of the kit.
1) The concentration and purity of the extracted DNA were measured with an ultra-micro spectrophotometer (NanoDrop 2000 c).
2) Diluting according to the DNA concentration of each sample to make the diluted DNA concentration be 30 ng/. Mu.L and the volume be 30 mu.L, and respectively filling the diluted samples into 96-well plates sterilized by ultraviolet irradiation according to the number as working solution for experiments, storing the diluted samples in a refrigerator at-20 ℃ and storing the remaining DNA mother solution in a refrigerator at-80 ℃.
4. Primer design
Inputting gene IL9 into an Ensemble database (Human GRCh38/hg38 version), obtaining all gene sequences, displaying all mutation sites, finding the positions of all SNPs, looking up whether mutation with higher MAF value exists before and after the sites, avoiding the mutation with higher MAF value to obtain sequences near the SNP sites, designing primers by using Primer and Genetol software according to the Primer design principle, obtaining primers, performing electronic PCR on UCSC website, and customizing synthetic primers if the PCR result shows no special structure and single PCR target strip.
3) Genotyping primers designed for the selected SNPs on IL9 according to the above primer design rules are shown in Table 2.
TABLE 2HRM typing primers
PCR amplification
Amplification system (25 μl):
the amplification procedure is shown in FIG. 2.
HRM genotyping
The method comprises the steps of mixing a nucleic acid fluorescent dye with a common PCR reaction system before PCR reaction, inserting the fluorescent dye into a minor groove of a DNA double-helix structure in the PCR process, directly placing a product into a Rotor-Gene 6000 detection instrument after the PCR is finished, and gradually melting the PCR product when the temperature set by the instrument is gradually increased from 50 ℃ to 95 ℃, so that fluorescent dye molecules originally combined with double chains are separated from the DNA. In the initial stage of detection, the fluorescence intensity is very high, and as the temperature increases, the PCR product is gradually melted, and the fluorescence intensity also decreases. The HRM apparatus records the fluorescence change by camera and plots the data for each temperature rise of 0.02-0.1 ℃. Thus, as the temperature increases, the fluorescence signal of the test sample becomes weaker from strong to weak, forming a melting curve graph in which the fluorescence signal becomes weaker as the temperature increases, and then plotting the change rate of the fluorescence value with the temperature as an ordinate, forming a peak shape graph in which the change rate of the fluorescence changes with the temperature, each test sample being presented in the form of a peak shape curve.
The method comprises the steps of putting 36 sample PCR amplified products on a Rotor-Gene 6000 fluorescent quantitative PCR instrument for typing detection, reading results, respectively selecting 3 types of PCR products of each SNP, sending the PCR products to the Tian Yi Hui Yuan company for primary sequencing verification, detecting the accuracy of HRM typing, and if the HRM typing result is consistent with the primary sequencing result, indicating that the accuracy of HRM typing is accurate, and verifying that the accuracy of the method typing reaches 100%, wherein 36 samples can be detected every 8 minutes, and the detection efficiency is greatly improved.
7. Statistical analysis
(1) Data processing
SPSS software calculates that data can only be presented in numerical form, so that all data needs to be converted to numerical values when the calculation is performed.
Different analysis patterns are processed (taking one SNP locus as an example, two alleles are present in the population, alleles C and T as an example, three genotypes CC, CT and TT are present in the population, and SNP may act with disease in different genetic patterns such as dominant pattern (domino model, DOM, TT+CT/CC), recessive pattern (Recessed model, REC, TT/CT+CC) and additive pattern (additivetm model, ADD, TT/CT/CC), and each SNP is subjected to an allelic pattern (allel model, ALLE, C/T) and 3 different genotype patterns to convert the genotype into a numerical value.
ALLE mode: firstly, replacing genotype TT with 2, replacing genotype CT with 2, replacing genotype CC with 1, copying the same sample, replacing genotype TT with 2, replacing genotype CT with 1, and replacing genotype CC with 1;
ADD mode: genotype TT is replaced by 3, genotype CT is replaced by 2, and genotype CC is replaced by 1;
REC mode: genotype TT is replaced by 2, genotype CT is replaced by 1, and genotype CC is replaced by 1;
DOM mode: genotype TT is replaced by 2, genotype CT is replaced by 2, and genotype CC is replaced by 1.
(2) Hardy-Wenberg equilibrium
Hardy-Winberg equilibrium (Hardy-Weinberg equilibrium, HWE) is the most important principle in population genetics, which explains how reproduction affects the genetic and genotypic frequency of a population. They propose that in an infinitely large population of random mating without evolutionary stress (mutation, migration and natural selection), the genetic and genotypic frequencies of the population will remain unchanged as the genes are transferred from generation to generation. In case and control associative analytical studies, the detected variation often requires a Hardy-Weber balance test in the control population, and only variation (p > 0.001) passing the test indicates that the variation is not biased in the population under study and is representative of the genetic characteristics of the entire population. Variations that failed the hadi-wilberg balance test should be rejected in the study.
(3) Chi-square test
In both allele association analysis and dominant mode, the genotype association analysis in recessive mode was performed using the 2X 2 list chi-square test, while in additive mode the 2X 3 list chi-square test was performed. Allele association analysis and dominant mode, association analysis in recessive mode is to compare the median gene frequency distribution difference between the two groups, and corresponding OR value (Odds ratio) and 95% of the locality interval can be calculated (95%Confidence interval,95%CI). The OR value is also known as the odds ratio OR ratio, and refers to the ratio of the number of exposures to the number of non-exposures in the case group to the ratio of the number of exposures to the number of non-exposures in the control group. It is a common indicator in epidemiological case control studies, indicating that exposure factors are detrimental to disease when the OR value is greater than 1; when the OR value is less than 1, the exposure factor has a protective effect on the disease; exposure factors were not indicated for disease when the OR value was equal to 1.
(4) Linear regression analysis
Linear regression analysis (Linerregression analysis) is a statistical analysis method for determining quantitative relationships between two or more variables by using regression analysis in mathematical statistics, and is widely used. In association analysis, the relationship between the genetic polymorphism and quantitative trait is studied, and when the genotype of SNP has additive effect, the relationship between the genetic polymorphism and quantitative trait may have linear relationship. If the P value is detected to be smaller than 0.05 through a linear regression equation, the genotype and the quantitative trait are obviously linearly related, the statistical significance is achieved, the absolute value of the calculated regression coefficient beta shows the degree of the relationship between the two variables, the larger the absolute value is, the larger the relationship between the two variables is, and positive correlation is indicated when the beta value is a positive number; when the value of beta is negative, it indicates a negative correlation.
In linear regression analysis, if there are multiple (. Gtoreq.2) independent variables, it is called multiple linear regression (Mutiple regression analysis). In fact, a trait or disease is often associated with multiple factors, and the prediction or estimation of the dependent variable from an optimal combination of independent variables is more efficient and practical than the prediction or estimation with only a single independent variable. Multiple linear regression is therefore of practical significance compared to single linear regression. In the research of the relationship between SNP genotype and blood lipid level, the influence of factors such as gender, age, BMI and the like is eliminated by utilizing multiple linear regression analysis, and the independent influence of SNP genotype on blood lipid level is estimated.
Results of the study
Correlation analysis of IL9 with CAD
None of the four sites on IL9 deviated from Hardy-Weinberg equilibrium in the control population, with P values greater than 0.001. For 4 SNPs on IL 9: genotype association analysis is carried out on rs2069868, rs31563, rs31564 and rs2069870, and the relations between different genotypes and CAD are respectively analyzed in an additive mode, a dominant mode and a recessive mode, but 4 SNP on IL9 are not obvious in the P value observation or the P value after correction.
TABLE 3 genotype correlation analysis of SNPs on IL9 with CAD in Han population in China
Description: pobs, observe P values; padj, P value adjusted by covariates; OR, adjusted dominance ratio; age, sex, BMI, hypertension, diabetes, smoking history, tch, TG, HDL-c and LDL-c are regulatory parameters;
ADD, additive mode, r 31563_TT/CT/CC; rs2069868_AA/AG/GG; rs2069870_GG/AG/AA; rs31564_TT/GT/GG;
DOM, dominant mode, r 31563_TT+CT/CC; rs2069868_aa+ag/GG; rs2069870_GG+AG/AA; rs31564_TT+GT/GG;
REC, recessive model, rs31563_tt/ct+cc; rs2069868_aa/ag+gg; rs2069870_GG/AG+AA; rs31564_TT/GT+GG.
IL9 and blood lipid level correlation analysis
The blood fat plays an important role in the occurrence and development of coronary heart disease, is also an independent risk factor most closely related to the coronary heart disease, and further explores the relationship between SNP on IL9 and four blood fat (total cholesterol, triglyceride, high density lipoprotein and low density lipoprotein). And calculating the relationship between IL9 and the upper SNP and blood fat by using a multiple linear regression model in an additive mode, a recessive mode and a dominant mode. (see Table 4 for details)
TABLE 4 genotype-related analysis of IL9 and blood lipid
Noun description: tch, total cholesterol; TG triglycerides; HDL-c, high density lipoprotein cholesterol; LDL-c, low density lipoprotein cholesterol.
1) Total cholesterol
In dominant mode (GG+GA/AA), position rs2069870 on IL9 was negatively correlated with total cholesterol levels, corrected P value was 0.049 and beta value was-0.034. Other sites on IL9 were not found to be associated with total cholesterol in dominant, recessive and additive modes, with P values greater than 0.05.
2) Triglycerides (Triglycerides)
The site on IL9 was not found to be triglyceride dependent in dominant, recessive and additive modes, with P values greater than 0.05.
3) High density lipoprotein
In recessive mode (TT/CT+CC), the rs31563 site on IL9 is positively correlated with high density lipoprotein levels. The corrected P value is 0.016 and the beta value is 0.038. Other sites on IL9 were not found to be associated with high density lipoproteins in dominant, recessive and additive modes, with P values greater than 0.05.
4) Low density lipoprotein
The rs2069870 site on IL9 shows a significant negative correlation with low density lipoprotein levels in both additive (GG/GA/AA) and dominant (gg+ga/AA) modes, with post-correction P values of 0.006 and β values of-0.047; the P value after correction in dominant mode was 0.004 and the β value was-0.049. Other sites on IL9 were not found to be associated with total cholesterol in dominant, recessive and additive modes, with P values greater than 0.05.
In summary, in the association analysis with four blood lipids, it was found that the rs31563 site on IL9 correlated positively with high density lipoprotein levels in plasma, and rs2069870 correlated with plasma low density lipoprotein and total cholesterol levels. LDL-c of the rs2069870 locus GG or GA genotype carrier, low in Tch level, LDL-c of the rs2069870 locus AA genotype carrier, and higher in Tch level than the rs2069870 locus GG or GA genotype carrier. It is stated that the G allele is a protective allele, the GG or GT genotype carries a low risk of developing cardiovascular disease, while the AA genotype carrier is a group of dyslipidemia and high risk of cardiovascular disease. The TT genotype carrier at the rs31563 site has high HDL-c level, and the high HDL-c level is currently considered to be a favorable factor for cardiovascular diseases, which indicates that the TT genotype carrier has low cardiovascular risk.
The dyslipidemia susceptibility sites rs31563 and rs2069870 of the project are both positioned in the promoter region of the IL9 gene, and play an important role in IL-9 transcription.
Most disease susceptibility sites are located in non-coding regions of genes, and the specific mechanisms of most sites have not been elucidated due to limitations of research methods. RegulomeDB is a database of annotations for non-coding region SNPs and gene regulatory elements, including expression quantitative trait loci (Expression quantitative trait loci, eQTL), DNase I hypersensitive binding regions (DNases), transcription factor sites, known promoter regions, and the like. According to these comments, the website will score the SNPs comprehensively (1 a, 1b, 1c, 1d, 1e, 1f, 2a, 2b, 2c, 3a, 3b, 4, 5, 6, no data), and according to the scores, the regulatory mechanisms in which the SNPs of interest may participate can be presumed, as shown in fig. 3, and thus provide ideas for research. The rs31563 and rs2069870 sites are searched on the RegulomeDB database, the results show that the rs31563 and rs2069870 scores are respectively 4 and 5, and the peaks numbers are respectively 7 and 9, which indicates that a large number of regulatory elements exist at the positions of the two sites, and the gene expression is likely to be regulated.
The study data of our earlier animals show that under the condition of 10 weeks of high fat diet (western diet), compared with C57BL/6 mice, apoE-/-mice (after the deletion of mouse ApoE, a series of changes are generated in lipoprotein metabolism and transport in animals, so that the clearance rate of cholesterol is reduced, abnormal hyperlipidemia symptoms can be shown, and therefore, the gene knockout mice are widely applied to the study of hyperlipidemia and atherosclerosis) and obviously increase the IL-9 level in blood plasma, which indicates that IL-9 plays an important role in blood fat, and rs31563 and rs2069870 are both positioned in the promoter region of IL-9 genes, and regulate the transcription and expression of IL-9.
It will be apparent to those skilled in the art that various modifications to the above embodiments may be made without departing from the general spirit and concepts of the invention. Which fall within the scope of the present invention. The protection scheme of the invention is subject to the appended claims.

Claims (5)

  1. Application of IL9 gene rs31563 site TT gene detection agent in preparing high-density lipoprotein high-level screening reagent; or, the application of the IL9 gene rs31563 locus CT or CC gene detection agent in preparing a high-density lipoprotein low-level screening reagent.
  2. 2. The use according to claim 1, wherein the IL9 gene rs31563 site detector comprises the site amplification primer pair and a nucleic acid probe.
  3. 3. The use of claim 1, wherein the low level of high density lipoprotein is characterized by dyslipidemia and the high level of high density lipoprotein is characterized by a low risk of cardiovascular disease.
  4. 4. The application of the gene vector in preparing the medicine for preventing and treating the high-density lipoprotein level is that the gene vector contains gene fragments, wherein the gene fragments are T mononucleotide in an rs31563 locus allele in the IL9 gene.
  5. 5. The use according to claim 4, wherein the gene fragment is capable of replacing a single nucleotide C in the allele at position rs31563 of the IL9 gene with a single nucleotide T and expressing the gene fragment.
CN202310631281.XA 2021-08-25 2021-08-25 SNP locus related to blood fat in IL9 gene and application thereof Pending CN117587115A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310631281.XA CN117587115A (en) 2021-08-25 2021-08-25 SNP locus related to blood fat in IL9 gene and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110978816.1A CN113604560B (en) 2021-08-25 2021-08-25 SNP related to blood fat and application thereof
CN202310631281.XA CN117587115A (en) 2021-08-25 2021-08-25 SNP locus related to blood fat in IL9 gene and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN202110978816.1A Division CN113604560B (en) 2021-08-25 2021-08-25 SNP related to blood fat and application thereof

Publications (1)

Publication Number Publication Date
CN117587115A true CN117587115A (en) 2024-02-23

Family

ID=78341909

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202310631281.XA Pending CN117587115A (en) 2021-08-25 2021-08-25 SNP locus related to blood fat in IL9 gene and application thereof
CN202110978816.1A Active CN113604560B (en) 2021-08-25 2021-08-25 SNP related to blood fat and application thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202110978816.1A Active CN113604560B (en) 2021-08-25 2021-08-25 SNP related to blood fat and application thereof

Country Status (1)

Country Link
CN (2) CN117587115A (en)

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002097123A2 (en) * 2001-05-25 2002-12-05 Xenon Genetics, Inc. Diagnostic methods for cardiovascular disease, low hdl-cholesterol levels, and high triglyceride levels
WO2007038155A2 (en) * 2005-09-21 2007-04-05 Joslin Diabetes Center, Inc. Methods of diagnosing cardiovascular disease
US20070213274A1 (en) * 2005-12-20 2007-09-13 Oy Jurilab Ltd Novel genes and markers associated with high-density lipoprotein-cholesterol (HDL-C)
CN103397022A (en) * 2013-07-17 2013-11-20 上海交通大学医学院附属瑞金医院 Nucleotide polymorphism markers related to Graves diseases or Graves eye diseases and application thereof
JP6854752B2 (en) * 2014-07-30 2021-04-07 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ Genetic markers for predicting responsiveness to treatment with HDL-elevating agents or HDL mimetics
CN107653312B (en) * 2017-09-07 2021-10-15 中国医学科学院阜外医院 Rs7901016 detection system related to blood lipid level and coronary heart disease and related application
CN107653311B (en) * 2017-09-07 2021-11-02 中国医学科学院阜外医院 Single nucleotide polymorphism rs4883263 detection system related to blood lipid level and related application
CN107502666B (en) * 2017-09-22 2020-02-07 中国医学科学院阜外医院 Gene functional genetic variation related to HDL-C level and related application
CN111041088B (en) * 2017-09-22 2022-04-26 中国医学科学院阜外医院 Gene functional genetic variation related to LDL-C level and related application

Also Published As

Publication number Publication date
CN113604560B (en) 2023-07-28
CN113604560A (en) 2021-11-05

Similar Documents

Publication Publication Date Title
Satterstrom et al. Autism spectrum disorder and attention deficit hyperactivity disorder have a similar burden of rare protein-truncating variants
Tada et al. Oligogenic familial hypercholesterolemia, LDL cholesterol, and coronary artery disease
Johansen et al. LipidSeq: a next-generation clinical resequencing panel for monogenic dyslipidemias [S]
EP3325664B1 (en) Analysis of fragmentation patterns of cell-free dna
Oishi et al. Comprehensive molecular diagnosis of a large cohort of Japanese retinitis pigmentosa and Usher syndrome patients by next-generation sequencing
Smith et al. Longitudinal genome-wide association of cardiovascular disease risk factors in the Bogalusa heart study
CN107423534B (en) Method and system for detecting genome copy number variation
Duyzend et al. Maternal modifiers and parent-of-origin bias of the autism-associated 16p11. 2 CNV
Bilguvar et al. Susceptibility loci for intracranial aneurysm in European and Japanese populations
Cooper et al. A copy number variation morbidity map of developmental delay
Jamil et al. TNF-alpha− 308G/A and− 238G/A polymorphisms and its protein network associated with type 2 diabetes mellitus
Yamamoto et al. Genomic backgrounds of Japanese patients with undiagnosed neurodevelopmental disorders
WO2020242976A1 (en) Methods for diagnosis of polygenic diseases and phenotypes from genetic variation
Farrugia et al. Targeted next generation sequencing application in cardiac channelopathies: analysis of a cohort of autopsy-negative sudden unexplained deaths
WO2006065658A2 (en) A physiogenomic method for predicting clinical outcomes of treatments in patients
Anderson et al. Genetic variation at the 9p21 locus predicts angiographic coronary artery disease prevalence but not extent and has clinical utility
Lisyová et al. An unusually high frequency of SCAD deficiency caused by two pathogenic variants in the ACADS gene and its relationship to the ethnic structure in Slovakia
Li et al. Associations of MTRR A66G polymorphism and promoter methylation with ischemic stroke in patients with hyperhomocysteinemia
EP2467497B1 (en) sPLA2 IIA POLYMORPHISM ANALYSIS FOR THE DIAGNOSIS/PROGNOSIS OF A CARDIOVASCULAR DISEASE/EVENT
CN115029431A (en) Type 2diabetes gene detection kit and type 2diabetes genetic risk assessment system
Silva-Sena et al. An association study of FOXO3 variant and longevity
CN113604560B (en) SNP related to blood fat and application thereof
Wang et al. Molecular characterization of a pedigree carrying the hypertension‑associated mitochondrial tRNAGln T4363C mutation
Li et al. Evaluating the monogenic contribution and genotype–phenotype correlation in patients with isolated thoracic aortic aneurysm
Breen et al. Whole genome methylation sequencing in blood identifies extensive differential DNA methylation in late‐onset dementia due to Alzheimer's disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination