CN117587114A - Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury - Google Patents

Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury Download PDF

Info

Publication number
CN117587114A
CN117587114A CN202210969103.3A CN202210969103A CN117587114A CN 117587114 A CN117587114 A CN 117587114A CN 202210969103 A CN202210969103 A CN 202210969103A CN 117587114 A CN117587114 A CN 117587114A
Authority
CN
China
Prior art keywords
lncrna
liver injury
mstrg
detecting
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210969103.3A
Other languages
Chinese (zh)
Inventor
汤纳平
杨紫轩
常艳
郑敏慧
石磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Yinuosi Biotechnology Ltd By Share Ltd
Original Assignee
Shanghai Yinuosi Biotechnology Ltd By Share Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Yinuosi Biotechnology Ltd By Share Ltd filed Critical Shanghai Yinuosi Biotechnology Ltd By Share Ltd
Priority to CN202210969103.3A priority Critical patent/CN117587114A/en
Publication of CN117587114A publication Critical patent/CN117587114A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an application of lncRNA with the number of MSTRG.73954.4 in preparing a detection agent or a chip for detecting liver injury. The application can apply the lncRNA with the number of MSTRG.73954.4 to the preparation of a detection agent or chip for detecting liver injury, particularly to the detection of drug-induced liver injury, has high detection specificity and simple detection method and reagent, can be widely applied to the timely detection of drug-induced liver injury, can timely find drug-induced liver injury in early stage, has reliable detection result, and can be singly detected or jointly evaluated by other indexes.

Description

Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of lncRNA (ribonucleic acid) with the number of MSTRG.73954.4 in preparation of a detection agent or chip for detecting liver injury.
Background
Drug-induced liver injury (Drug Induced Liver Injury, DILI), otherwise known as drug-induced liver injury, refers to liver injury caused by drugs and/or metabolites thereof, which may occur in healthy persons who have no history of liver disease in the past or in patients who have previously had serious disease, to varying degrees after administration of a certain drug.
For the occurrence of serious clinical adverse events that may be caused by DILI, the european medicines agency (EMEA) issued the guidelines of "Non-Clinical Guideline on Drug-Induced Hepatotoxicity" in 2008, and the us FDA issued "Drug-Induced Liver Injury" in 2009: premarketing Clinical Evaluation "guidelines" to help pharmaceutical enterprises evaluate the risk of DILI comprehensively and deeply in the development of new drugs.
For nearly half a century, traditional biomarkers have been used clinically for the detection of DILI, such as alanine transferase (ALT), glutamate oxaloacetate transaminase (AST), alkaline phosphatase (ALP), and Total Bilirubin (TBD), among others. ALT and AST are present in hepatocytes, and during a drug-induced liver injury, ALT and AST in serum are elevated, which is associated with death of hepatocytes and their release contents. Elevated serum ALP is associated with bile duct epithelial cell damage, and elevated TBIL may reflect impaired hepatocyte function or be associated with bilirubin production and processing. However, while existing liver injury biomarkers such as alanine Aminotransferase (ALT), aspartate Aminotransferase (AST), etc. may identify liver injury or altered function, these indicators have failed to meet early and accurate assessment of DILI risk due to lack of specificity (other organ or tissue injury may also result in increased activity) and poor consistency with histomorphometric data.
With the progressive depth of liver injury research, a number of new detection indexes of liver toxicity injury are discovered. Recently 2 new DILI biomarkers were discovered: glutamate dehydrogenase (GLDH) and miRNA-122, 2 biomarkers, have been received support by the United states food and drug administration and European drug administration as liver-specific candidate biomarkers.
Exosomes are one type of extracellular vesicles, which are divided into three types: apoptotic bodies, microbubbles, and exosomes. The process of exosome production involves the dual invagination of the plasma membrane and the formation of intracellular multivesicular bodies (MVB) containing endoluminal vesicles (ILV). ILV is finally fused to the plasma membrane by MVB and secreted in exosomes with diameters of 40-160 nm by exocytosis. The density of exosomes is 1.15-1.19g/mL. The tetrameric transmembrane proteins CD63, CD9 and CD81 found on their surfaces are often used as surface biomarkers for exosomes. Meanwhile, most cells secrete exosomes, which are widely present in various body fluids such as blood, saliva, urine, cerebrospinal fluid, etc. Exosomes transport various molecules from the parent cell to other cells, including proteins, DNA, mRNA/miRNA, lncRNA, and the like. The exosomes are similar in composition to the parent cell and thus are capable of providing specific information for the parent cell that can be tracked. Scanning Electron Microscopy (SEM), transmission electron microscopy, dynamic light scattering and nanoparticle tracking analysis are widely used to measure physical characteristics of exosomes, such as vesicle size, distribution and concentration.
Long non-coding RNAs (lncRNA) are a class of non-coding RNA molecules that lack an open reading frame that are more than 200 ribonucleotides in length, have no ability to code for proteins, or have limited coding functions. At the beginning, it was considered as "noise" of genome transcription, a by-product of RNA polymerase II transcription, with no biological effect. Through intensive studies, lncRNA has been found to be involved in important regulatory processes in cells, such as: regulate cell differentiation, aging, proliferation, apoptosis, necrosis, and tumor development. It was found that lncRNA expression is more cell specific than mRNA expression, although lncRNA is prone to expression at low levels compared to messenger RNA, suggesting that lncRNA may be a key regulator of cell fate. Meanwhile, studies show that lncRNA is closely related to liver related diseases and injuries. However, the lncRNA database is very large (up to 172,216) and no lncRNA closely related to liver injury, especially liver injury caused by exogenous compounds (e.g., acetaminophen), has been developed in clinical assays.
Numerous studies have reported that, under pathological conditions, the expression levels of many exosomes lncRNA are significantly different from normal control groups, indicating that exosomes can selectively package, secrete and transport lncRNA and specifically exert biological functions. Exosomes can protect lncRNA from rnase degradation, so they can be stably present in body fluids.
Disclosure of Invention
The technical problem to be solved by the invention is to overcome the defects that the traditional Chinese medicine physical liver injury biomarker has low specificity, the detection method is too complex, the reagent is expensive, the liver injury needs to be evaluated jointly by combining other indexes, the medicine physical liver injury cannot be predicted timely and accurately, and the like, and provide the application of lncRNA with the number of MSTRG.73954.4 in preparing a detection agent or chip for detecting the liver injury. The application can apply the lncRNA with the number of MSTRG.73954.4 to the preparation of a detection agent or chip for detecting liver injury, particularly to the detection of drug-induced liver injury, has high detection specificity and simple detection method and reagent, can be widely applied to the timely detection of drug-induced liver injury, can timely find drug-induced liver injury in early stage, has reliable detection result, and can be singly detected or jointly evaluated by other indexes.
The inventor conducts long-term research on liver injury, and through a large number of experiments, the inventor unexpectedly discovers that lncRNA derived from exosomes can be used as a specific biomarker of the liver injury, is highly expressed in plasma of the liver injury, and can exert the application of the lncRNA in preparing the biomarker of the liver injury, thereby detecting the liver injury.
In order to solve the technical problems, the invention provides a technical scheme as follows: the application of lncRNA with the number of MSTRG.73954.4 in preparing a detection agent or a chip for detecting liver injury is provided, wherein the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the detection agent or chip further comprises a reagent for detecting a marker of drug-induced liver injury, such as alanine aminotransferase and aspartate aminotransferase, for a non-specific marker of liver injury.
Preferably, the detection is detecting the level of transcriptional level expression of the lncRNA in the sample.
More preferably, the detection is RNA whole transcriptome sequencing; and/or, the sample is plasma.
In a preferred embodiment of the present invention, the liver injury is a drug-induced liver injury. More preferably, the pharmaceutical liver injury is produced by acetaminophen.
In order to solve the technical problems, the invention provides a technical scheme as follows: a combination of biomarkers, the combination comprising a first biomarker; the first biomarker is lncRNA with the number of MSTRG.73954.4, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the combination further comprises a second biomarker selected from the group consisting of lncRNA, alanine aminotransferase and aspartate aminotransferase of noncryde TRANSCRIPT ID for nonrat 018001.2 and lncRNA, NONCODE TRANSCRIPT ID for nonrat 004188.2.
In order to solve the technical problems, the invention provides a technical scheme as follows: use of a reagent for detecting the expression level of a biomarker of liver injury in the preparation of a product for diagnosing liver injury; the biomarker is lncRNA with the number of MSTRG.73954.4 or a combination as described above, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the liver injury is a drug-induced liver injury. More preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
In order to solve the technical problems, the invention provides a technical scheme as follows: a kit for detecting liver damage, the kit comprising reagents for detecting expression levels of lncRNA; the lncRNA is the lncRNA with the number of MSTRG.73954.4 or the combination thereof, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the reagent is a reagent that detects mRNA levels of the lncRNA in a sample; and/or, the liver injury is a drug-induced liver injury. More preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
In order to solve the technical problems, the invention provides a technical scheme as follows: a chip for detecting liver damage, said chip having disposed thereon a reagent comprising detecting the expression level of lncRNA; the lncRNA is the lncRNA with the number of MSTRG.73954.4 or the combination thereof, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the reagent is a reagent that detects mRNA levels of the lncRNA in a sample; and/or, the liver injury is a drug-induced liver injury. More preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
In order to solve the technical problems, the invention provides a technical scheme as follows: a system for assessing risk of liver injury, the system comprising a detection module and a judgment module; the detection module is used for detecting the expression level of the biomarker in the sample to be detected and inputting the detection result into the judgment module; the judging module judges according to the judging conditions and outputs a judging result; the biomarker is lncRNA with the number of MSTRG.73954.4 or a combination of the above, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
Preferably, the expression level is mRNA level; and/or, the judging condition is whether the expression level is higher than a preset threshold value.
In order to solve the technical problems, the invention provides a technical scheme as follows: use of a kit as described above, a chip as described above or a system as described above for the preparation of a product for detecting liver damage.
On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.
The reagents and materials used in the present invention are commercially available.
The invention has the positive progress effects that:
the invention discloses a method for preparing a detection agent or a chip for detecting liver injury by applying lncRNA with the number of MSTRG.73954.4, which is particularly used for detecting drug-induced liver injury, has high detection specificity and simple detection method and reagent, can be widely applied to detecting liver injury, has reliable detection result, and can be used for singly detecting or jointly evaluating liver injury (including whether liver injury exists or not and the degree of liver injury) in combination with other indexes.
Drawings
FIG. 1 is a schematic representation of changes in serum ALT, AST activity in acetaminophen-dosed rats, wherein ﹡ represents P <0.05 compared to vehicle group.
Fig. 2 is ROC curves for rats in the dosing group and rats in the control group.
Detailed Description
The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.
Example 1 search for biomarkers of liver injury
1.1 establishment of liver injury model
1.1.1 Experimental reagents and instruments, laboratory animals
(1) Positive drug: acetaminophen (lot number: D2114266, available from Shanghai Ala Biotechnology Co., ltd.);
(2) Vehicle control: 0.5% (w/w) sodium carboxymethylcellulose (0.5% cmc-Na);
ALT and AST detection kits are manufactured by Nippon and Wako pure chemical industries, ltd;
the HITACHI 7060 full-automatic biochemical analyzer was purchased from japan HITACHI industries, ltd.
(3) Experimental animal
10 male SD rats, 10 female rats, SPF grade, weight 180-320 g, 6-9 weeks old, purchased from Peking Violet laboratory animal technologies Co., ltd. [ license number: SCXK (Beijing) 2016-0006]. The animals are marked by a chip and a cage plate, 5 animals are fed in SPF-grade animal houses of Shanghai Yinuo biotechnology Co Ltd, the temperature of the animal houses is controlled at 22-26 ℃, the humidity is controlled between 40-70%, the ventilation times per minute is more than or equal to 15 times, the bright and dark illumination period is 12 hours/12 hours, the animals eat freely, SPF rats subjected to cobalt 60 irradiation sterilization maintain feed provided by Australian feed Co Ltd in Beijing, and the animals drink self-made deionized water freely through drinking water bottles.
1.1.2 Experimental methods
1.1.2.1 preparation of Positive drug
Preparation of Acetaminophen (APAP) suspension: 3.75g of acetaminophen was weighed out separately, transferred to glass bottles and added with an appropriate amount of 0.5% CMC-Na (W/W). Stirring with glass rod, turning on a homogenizer for full dispersion, turning off, adding CMC-Na 0.5% to required volume, mixing, preparing 1250mg/kg suspension, maintaining uniformity, and standing at room temperature in dark place. The preparation process needs to be protected from light.
1.1.2.2 animal test dose setting
Grouping with random granule design, 20 rats were randomly assigned to 2 groups according to body weight: the vehicle control group (0.5% CMC-Na), the dosing group (1250 mg/kg acetaminophen) are shown in Table 1.
Table 1 experimental dose design
Wherein F is female and M is male.
1.1.2.3 administration and visual inspection
The administration routes of the vehicle control group and the acetaminophen administration group are oral gastric lavage administration, and the administration capacity is 10mL/kg after single administration. The dosing volume was calculated from the last measured body weight.
After 24 hours from administrationAnesthesia is carried out by adopting 40mg/mL sultai+5 mg/mL ranolazine injection mixed preparation, and a small part of whole blood collected by the abdominal aorta is placed in a separation gel vacuum blood collection tube for separating serum: at 3500rpm and 4deg.C for 5min, the serum is sucked and packaged in EP tube, and stored in-80deg.C refrigerator for detecting liver function index. Most of them are placed in EDTA-K 2 In a vacuum blood collection tube for separating plasma: 800g,4 ℃ for 10min, sucking the upper plasma layer, sub-packaging in an EP tube, and storing in a refrigerator at-80 ℃ for performing the whole transcriptome sequencing of the exosome RNA.
1.1.2.4 serum biochemical detection result
The present experiment mainly examined changes in the hematological indices ALT (alanine aminotransferase) and AST (aspartate aminotransferase) commonly used for preclinical and clinical evaluation of liver injury. As shown in the results of FIG. 1, ALT and AST were significantly increased in serum from rats in the administered group (P < 0.05) 24h after administration of 1250mg/kg of acetaminophen as compared to the vehicle control group.
1.1.2.5 histopathological examination results
Liver histopathological examination showed that rats in vehicle control group had no obvious abnormality, and the administration group had different degrees of hepatocyte necrosis with concomitant inflammatory cell infiltration, perilobular cell cavitation, and even necrosis. The detailed scores are shown in table 2.
TABLE 2 pathological observations of liver tissue after 24h acetaminophen exposure
"N" represents no obvious abnormality.
In the column of "hepatocyte necrosis with inflammatory cell infiltration," 0 "represents no hepatocyte necrosis, no inflammatory cell infiltration; "1" represents less hepatocyte necrosis with a lighter concomitant inflammatory cell infiltration; "2" represents a few liver cell necrosis with slight inflammatory cell infiltration; "3" represents moderate hepatocyte necrosis with moderate inflammatory cell infiltration; "4" represents severe hepatocyte necrosis with severe inflammatory cell infiltration.
In the column of "small She Zhoubian cavitation denaturation," 0 "represents no degeneration of the cavitation bubbles around the leaflet; "1" represents a minor degeneration of the leaflet peripheral vacuoles; "2" represents a slight denaturation of small She Zhoubian vacuoles; "3" represents moderate degeneration of the perileaflet vacuoles; "4" represents severe vacuolation denaturation of small She Zhoubian vacuoles.
1.1.2.6 conclusion
In this part of the experiment, 1250mg/kg of acetaminophen and 0.5% sodium carboxymethylcellulose were administered orally and intragastrically to SD rats, and blood was collected 24 hours later for serum biochemical and histopathological examination to examine acetaminophen-induced liver injury.
In the serum biochemical assay, ALT and AST were significantly elevated in 1250mg/kg APAP group animals 24 hours after dosing. Pathological histology is mainly characterized by different degrees of hepatocyte necrosis, accompanied by inflammatory cell infiltration, cavitation degeneration and necrosis of cells around the lobules.
In summary, SD rats successfully induce liver injury after oral gavage administration of acetaminophen, so that a liver injury model induced by acetaminophen is established, and the method can be used for screening and verifying liver injury biomarkers.
1.2 exosome RNA complete transcriptome sequencing
1.2.1 exosome extraction
Exosomes in the samples were isolated using exoRNeasy Serum/Plasma Maxi kit (Qiagen) and operated according to standard protocols provided by the manufacturer.
The method comprises the following steps:
1) Taking out 500uL plasma sample at-80deg.C, thawing in water bath at 25deg.C;
2) 13000g and centrifuging at 4℃for 10 minutes
3) Adding Buffer XBP according to a sample volume of 1:1, and reversing the above steps for 5 times;
4) Transferring the sample and Buffer XBP mixed solution to exoEasy spin column, and centrifuging at 500g and 4 ℃ for 1min; discarding the waste liquid at the bottom;
5) 3.5mL Buffer XWP was added to exoEasy spin column and 5000g was centrifuged at 4℃for 5min; discarding the waste liquid at the bottom;
6) Transfer from exoEasy spin column to a new collection tube;
7) Adding 200uL Buffer XE,5000g 4 ℃ for centrifugation for 5 minutes, and collecting the bottom exosomes into a 1.5mL centrifuge tube;
8) Split charging exosomes, and preserving at-80deg.C.
1.2.2 identification of exosome-related indicators
1.2.2.1 identification of exosome markers WB
Taking a certain amount of PBS heavy suspension of exosomes, adding an equal volume of RIPA (strong) lysate for carrying out lysis to extract protein, and then carrying out protein concentration measurement and WB detection of exosome markers.
1.2.2.2 exosome nanoparticle tracking detection (NTA)
1) Taking a frozen sample, thawing in a water bath at 25 ℃, and placing on ice;
2) Exosome samples were taken and diluted with 1 XPBS and used directly for NTA detection.
3) Instrument information for testing
Instrument name: nanometer particle size particle tracking analyzer
Production company: PARTICLE METRIX
Instrument model: zetaVIEW S/N17-310
Analysis software version: zetaView 8.04.02
1.2.3 RNA quality identification
The initial sample of the sequencing experiment is total RNA, the total RNA of the exosomes is obtained from a QIAGEN exoRNeasy Midi Kit (Cat No./ID: 77144) kit, the quality inspection is carried out by the Agilent 4200tape station, and the RNA which is qualified in the quality inspection can be subjected to subsequent full transcriptome sequencing.
1.2.4 library construction and quality control
Separating exosomes, extracting total RNA, constructing library with super-high sensitivity microsample chain specific kit for exosome RNA, and constructing library2.0Fluorometer to detect concentration, agilent2100 to detect library size.
1.2.5 on-machine sequencing
Qualified libraries were tested and were prepared for Illumina sequencing with a sequencing strategy of PE150. The sequencing rationale is sequencing-by-synthesis (SBS, sequencing by Synthesis): and (3) loading the flow cell with the cluster, adding four fluorescence-labeled dNTPs, DNA polymerase and a joint primer into the flow cell for amplification, and when each sequencing cluster extends a complementary strand, releasing corresponding fluorescence by adding one fluorescence-labeled dNTP, wherein a sequencer captures a fluorescence signal and converts the optical signal into a sequencing peak through computer software, so that the sequence information of the fragment to be detected is obtained.
1.2.6 data quality control
After obtaining the sequencing Raw Data (Raw Data), the Data is filtered, the adaptor sequence is removed, the low-quality reads are processed, the sequencing quality is evaluated, and the high-quality Data (Clean Data) is obtained through repeated inspection. Comparing the clear Data with a reference genome, and quantitatively analyzing the known mRNA and the lncRNA; reads on the unalignment analyzed circular RNAs using ACFS.
1.2.7 data pretreatment
The original sequencing data contains sequencing linker sequences, and some reads contain unqualified conditions such as lower-quality bases, lower-quality ends of reads and the like, which can influence the reliability of subsequent analysis results, so that the original data is preprocessed to remove the linker sequences and the low-quality reads. The data preprocessing software uses Seqtk.
The method mainly comprises the following steps:
1) Removing the linker sequence contained in reads;
2) Removing bases with 3' end mass Q below 20, i.e. base error rate below 0.01, wherein q= -10log (error_ratio);
3) Removing reads with a length less than 25;
4) Ribosome RNA reads of the belonging species is removed.
And preprocessing the original data to obtain clear reads for subsequent analysis.
1.2.8 comparative analysis
The pretreated sequencing sequences were subjected to genome mapping analysis using HISAT2 software. Typically we aligned clean no RNA reads to the genome, which is also the basis for subsequent analysis. HISAT2 adopts a global and local search method, can perform mapping efficiently, can effectively compare the speed reads in the RNA Seq sequencing data, sets default parameters for parameters, and refers to genome version Rnor_6.0.95, and the result is a BAM file.
1.2.9 lncRNA quantification and differential analysis
1.2.9.1 novel lncRNA predictions
Comparing annotation information obtained by mapping with reference annotation (NONCODE and Ensembl databases) by using cuffcompact in cufflinks (version: 2.1.1) to obtain new transcripts which cannot be matched with known annotation genes, extracting { i, u, x } transcripts to perform lncRNA prediction, wherein the method comprises the following specific steps:
1) The transcription length is more than 200bp and exon >2;
2) Covering fragment counts >3;
3) Predicted ORF <300;
4) PhyoCSF (currently limited to human, rat, and Pfam, CPC, CNCI predictions), intersection of 4 (or 3) predictions, selects transcripts of PhyoCSF score <0& pfam alignment insignificant & CPC score <0& CNCI score <0 as potential lncRNAs.
5) The same sequence as the known lncRNA was removed as compared to the known lncRNA.
1.2.9.2 lncRNA expression quantification
The predicted novel lncRNA and NONCODE databases (version: NONCODE 2016; http:// www.noncode.org /) as well as the known lncRNA in the Ensembl database were quantitated for expression using Stringtie (version: 1.3.0). Wherein MSTRG has a head ID of NOVEL lncRNA, NON has a head ID of lncRNA known in the database, and ENS has a head ID of lncRNA known in the Ensembl database.
1.2.9.3 lncRNA differential expression analysis
Edge was used for sample-to-sample differential lncRNA analysis. And volcanic and Heatmap plots were drawn for the differential lncRNAs.
1.2.9.4 lncRNA target gene prediction and target gene enrichment analysis
The interaction relationship between lncRNA and mRNA is classified into cis (cis) and trans (trans), and the mRNA that has an interaction relationship with lncRNA is called a target gene of lncRNA.
High throughput sequencing gives a relatively large number of differential genes, ranging from hundreds to thousands of possible. To better understand the biological functions that these differential genes may perform in cells or the signal pathways that may be perturbed, we annotated and enriched the Gene on log and KEGG databases for differential genes.
1.3 Whole transcriptome sequencing results
1.3.1 overview
Statistical significance of the differences in the samples drawn by cluster analysis (P<0.05 Log) and log 2 FC (Fold changes) values>More than 2 times and at least one set of count minima>10 lncRNA. The results show (fold change in part lncRNA is listed in table 3): log of the dosing group compared to the vehicle control group 2 FC (abs, absolute value) varies by more than 2 times and p<0.05 had 24, 18 up-regulated and 6 down-regulated; 4 times more varied and p<0.05, 1 up-regulated, and 1 down-regulated. Suggesting that these differentially expressed lncrnas may be closely related to the occurrence, progression, and molecular regulation of drug-induced liver injury. Wherein MSTRG starts with sequencing newly discovered lncRNA; the expression level of lncRNA mstrg.73954.4 in the plasma exosomes of rats in the dosing group was 7.317 times that in the vehicle control group.
TABLE 3 fold change in partial lncRNA
1.3.2 GO analysis results
The differentially expressed genes were analyzed for GO using Fisher's exact test. Fisher's exact test calculation to obtain p-value, and multiple hypothesis test correction to obtain q-value. GO entries with q-value less than 0.05 were screened as significantly enriched GO entries. GO functional annotation analysis found that target gene mRNAs of differentially expressed lncRNAs focused mainly on biological processes: positive regulation of chromosome segregation; molecular function: ketosteroid monooxygenase activity, alditol: NADP+1-oxidoreductase activity.
1.3.3 KEGG analysis results
KEGG analysis was further performed on differentially expressed lncRNAs predictive of target gene mRNAs. Similar to GO classification statistics, the number of differentially expressed genes on each path major class of KEGG was counted. KEGG analysis found that differentially expressed lncRNAs predicted target gene mRNAs focused mainly on the body system: the immune system, the endocrine system; metabolic pathways: an integral metabolic pathway; cell passage: signal conduction. It is suggested that differentially expressed lncRNAs may be involved in the regulation of these pathways by modulating predicted target gene mRNAs.
Wherein, the sequence of mstrg.73954.4 is as follows:
AGGGUGAAAAGUUCAUGUUCUCACAGACUCUAUACUUCUUCUUUUUGAGUAGCUAGGCCCCUACUUCUUCUUUUUGGGUAGCUAGGCGGCUUUUUAUUAAAUUUUCAAUCCUUCAUUCCCCACUUCUUCUUUUUGAUCGGCUCUAAUCUUAGAGCCAUUGUUCAUCCCAUUGUAACUCUUGGUACUGUUGUCGCAGGACCAGUACCUGAACAGCACUUAUUCUUUCUUUUAUAAAUGUCACCAGCCUAUUGAGUAUACAUGGCCCGAAAGUAAGUAGAAGCAUGAGGAUUAUAAUGGGCCCAACUAAAGUAGAGAGGAGAGUGGUUAACCAUGGGGACUUAUUAAACCAACUUUCAAACCACCCCUGUCUGUCUUCUCUUUCUUUUUUCCGUAUAUCUAAGCGUUCUCUAAGUUUAGCCAUCGAAUCC(SEQ ID NO:1)
1.4 real-time quantitative PCR verification
1.4.1 reagents
Reverse transcription reagent TOYOBO ReverTra Ace qPCR RT Kit
Quantitative PCR reagent ABI Power SYBR Green PCR Master Mix
Primer synthesis: shanghai Bioengineering Co Ltd
1.4.2 instruments:
ABI 7500 real-time fluorescence quantitative PCR system of quantitative PCR instrument
1.4.3 Experimental procedure
1.4.3.1 First Strand Synthesis of cDNA
1) RNA was removed from the-80℃refrigerator, thawed at 4℃and then the reaction solution was prepared in a 0.2ml PCR tube as shown in Table 4, wherein X 1 And X 2 According to the value of notDifferent from the concentration of RNA extracted from the sample, the volume taken is converted according to the concentration.
TABLE 4 reaction solution System
2) The PCR tube was placed in a PCR apparatus, and the procedure was run: incubation was carried out at 37℃for 15min, denaturation at 98℃for 5min, and incubation at 4 ℃.
1.4.3.2 SYBR Green qPCR
1) The reaction solution was prepared in a 0.2ml PCR tube as shown in Table 5, wherein X 3 The value of (2) varies depending on the cDNA concentration of the sample, and the volume to be taken is converted based on the concentration.
TABLE 5 reaction solution System
2×SYBR Green PCR buffer 10μL
Forward primer(10μM) 0.5μL
Reverse primer(10μM) 0.5μL
Template 10ng
ddH 2 O X 3 μL
Total volume 20μL
2) The reaction solution was added to a 96-well plate
3) The 96-well plate was placed in an ABI 7500 real-time fluorescent quantitative PCR instrument. Running a program: incubating at 50 ℃ for 2min;95 ℃ for 10min;40 cycles: 95 ℃,15 seconds, 60 ℃ and 1min.
1.5ROC Curve
The ROC (Receiver operating characteristic curves) curve was plotted using spss (version 24.0).
The results are shown in fig. 2, in which auc=0.829, sensitivity is 80% and specificity is 71%, and thus, the lncRNA has a meaning in distinguishing rats of the administration group from rats of the control group.
1.6 specificity verification
1.6.1 Experimental reagents and instruments, laboratory animals
(1) Positive drug: isoprenaline hydrochloride (lot number: WXBD4216V, available from Shanghai Ala Biotechnology Co., ltd.);
(2) Vehicle control: 0.9% sodium chloride injection (lot number 21111304B, available from Anhui Shuanghe pharmaceutical Co., ltd.);
ALT, AST detection kit is manufactured by Nippon and Wako pure chemical industries, ltd;
the HITACHI 7060 full-automatic biochemical analyzer was purchased from japan HITACHI industries, ltd.
(3) Experimental animal
10 male SD rats, 10 female rats, SPF grade, weight 180-320 g, 6-9 weeks old, purchased from Peking Violet laboratory animal technologies Co., ltd. [ license number: SCXK (Beijing) 2016-0006]. The animals are marked by a chip and a cage plate, 5 animals are fed in SPF-grade animal houses of Shanghai Yinuo biotechnology Co Ltd, the temperature of the animal houses is controlled at 22-26 ℃, the humidity is controlled between 40-70%, the ventilation times per minute is more than or equal to 15 times, the bright and dark illumination period is 12 hours/12 hours, the animals eat freely, SPF rats subjected to cobalt 60 irradiation sterilization maintain feed provided by Australian feed Co Ltd in Beijing, and the animals drink self-made deionized water freely through drinking water bottles.
1.6.2 Experimental methods
1.6.2.1 preparation of Positive drug
2.5mg/kg (0.25 mg/mL) isoprenaline hydrochloride solution, a positive administration preparation having a volume of 60mL was prepared: 15mg of isoprenaline hydrochloride is weighed; transfer to beaker and add appropriate amount of 0.9% sodium chloride injection. Stirring with glass rod, adding rotor, turning on magnetic stirrer, dispersing, turning off, adding 0.9% sodium chloride injection to required volume (60 mL), mixing, maintaining uniformity, and standing at room temperature in dark place. The preparation process needs to be protected from light and aseptic operation.
1.6.2.2 animal test dose setting
Grouping with random granule design, 20 rats were randomly assigned to 2 groups according to body weight: the details of the vehicle control group (0.9% sodium chloride injection) and the administration group (2.5 mg/kg isoprenaline hydrochloride) are shown in Table 6.
Table 6 experimental dose design
Wherein F is female and M is male.
1.6.2.3 administration and visual inspection
The administration routes of the vehicle control group and the isoprenaline hydrochloride administration group are tail vein injection, and the single administration is carried out, and the administration capacity is 10mL/kg. The dosing volume was calculated from the last measured body weight.
After 4 hours following dosing, anesthesia was performed with a 40mg/mL sultai+5 mg/mL xylazine injection mix, and a small portion of the abdominal aortic collection whole blood was placed in a gel separation vacuum tube for serum separation: at 3500rpm and 4deg.C for 5min, the serum is sucked and packaged in EP tube, and stored in-80deg.C refrigerator for detecting liver function index. Most of them are placed in EDTA-K2 vacuum blood collection tubes for separating plasma: 800g,4 ℃,10min, the upper plasma was pipetted into EP tubes and stored in a-80 ℃ freezer for subsequent PCR validation.
1.6.2.4 serum biochemical detection result
The present experiment mainly examined changes in the hematological indices ALT (alanine aminotransferase), AST (aspartate aminotransferase) commonly used for preclinical and clinical assessment of central muscle injury. After 2.5mg/kg isoprenaline hydrochloride is administered for 4 hours, ALT and AST in serum of rats in the administration group are slightly increased compared with those in a solvent control group, but no significant difference exists; furthermore, CTn1 levels in serum of rats in the dosed group were significantly elevated compared to vehicle control group (p < 0.05), suggesting successful modeling of myocardial injury model.
1.6.2.5 PCR verification
The specific procedure is the same as 1.4, and the conclusion is as follows.
1.7 summary
The lncRNA sequencing result of the plasma exosomes of the rats in the experiment shows that the quantity of the lncRNA differentially expressed in the exosomes is more, wherein the expression quantity of the lncRNAMSTRG.73954.4 in the plasma exosomes of the rats in the administration group is 7.317 times that in the solvent control group, and the expression difference multiple is very high, which indicates that the lncRN A (NONCODE TRANSCRIPT ID: NONRATT 004188.2) can be used as a liver injury biomarker to detect liver injury caused by exogenous compounds.
Verification was performed using real-time fluorescent quantitative PCR, and the verification results showed: the expression level of lncRNA (NONCO DE TRANSCRIPT ID: NONRATT 004188.2) in the plasma exosomes of the rats in the administration group was 3.05 times (p < 0.05) that in the vehicle control group. This demonstrates that mstrg.73954.4 can be detected in time with reliable detection results when used as a biomarker, demonstrating that the detection of liver injury caused by exogenous compounds using nonrat 004188.2 as a biomarker has good specificity.
ROC curves were used to examine whether lncrna mstrg.73954.4 better differentiated rats in the dosing group from rats in the control group. Area under the curve auc=0.829, sensitivity of 80% and specificity of 71%, showing that the lncRNA has a certain discrimination capability.
The specificity of lncRNA mstrg.73954.4 was examined by modeling myocardial injury in rats using isoprenaline hydrochloride. The PCR validation results showed that the lncRNA was not elevated in the myocardial injury model (i.e. it was able to distinguish between liver injury and myocardial injury), thus showing that it has good specificity.

Claims (10)

1. The application of lncRNA with the number of MSTRG.73954.4 in preparing a detection agent or a chip for detecting liver injury is provided, wherein the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1.
2. The use of claim 1, wherein the detection agent or chip further comprises a reagent for detecting a marker of drug-induced liver injury, such as alanine aminotransferase and aspartate aminotransferase, for a non-specific marker of liver injury.
3. The use of claim 2, wherein the detection is detecting the transcriptional level expression level of the lncRNA in the sample;
preferably, the detection is RNA whole transcriptome sequencing; and/or, the sample is plasma.
4. The use according to any one of claims 1 to 3, wherein the liver injury is a pharmaceutical liver injury; preferably, the pharmaceutical liver injury is produced by acetaminophen.
5. A combination of biomarkers, wherein the combination comprises a first biomarker; the first biomarker is lncRNA with the number of MSTRG.73954.4, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1;
preferably, the combination further comprises a second biomarker selected from the group consisting of lncRNA, alanine aminotransferase and aspartate aminotransferase of noncryde TRANSCRIPT ID for nonrat 018001.2 and lncRNA, NONCODE TRANSCRIPT ID for nonrat 004188.2.
6. Use of a reagent for detecting the expression level of a biomarker of liver injury in the preparation of a product for diagnosing liver injury, wherein the biomarker is lncRNA numbered mstrg.73954.4 or a combination according to claim 5, and the lncRNA numbered mstrg.73954.4 has the sequence shown in SEQ ID No. 1;
preferably, the liver injury is a drug-induced liver injury;
more preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
7. A kit for detecting liver damage, comprising a reagent for detecting the expression level of lncRNA; the lncRNA is the lncRNA with the number of MSTRG.73954.4 or the combination as set forth in claim 5, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1;
preferably, the reagent is a reagent that detects mRNA levels of the lncRNA in a sample; and/or, the liver injury is a drug-induced liver injury;
more preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
8. A chip for detecting liver injury, wherein a reagent for detecting the expression level of lncRNA is arranged on the chip; the lncRNA is the lncRNA with the number of MSTRG.73954.4 or the combination as set forth in claim 5, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1;
preferably, the reagent is a reagent that detects mRNA levels of the lncRNA in a sample; and/or, the liver injury is a drug-induced liver injury;
more preferably, the liver injury is a pharmaceutical liver injury caused by acetaminophen.
9. A system for assessing risk of liver injury, the system comprising a detection module and a judgment module; the detection module is used for detecting the expression level of the biomarker in the sample to be detected and inputting the detection result into the judgment module; the judging module judges according to the judging conditions and outputs a judging result; the biomarker is lncRNA with the number of MSTRG.73954.4 or the combination as set forth in claim 5, and the sequence of the lncRNA with the number of MSTRG.73954.4 is shown as SEQ ID NO. 1;
preferably, the expression level is mRNA level; and/or, the judging condition is whether the expression level is higher than a preset threshold value.
10. Use of a kit according to claim 7, a chip according to claim 8 or a system according to claim 9 for the preparation of a product for the detection of liver damage.
CN202210969103.3A 2022-08-12 2022-08-12 Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury Pending CN117587114A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210969103.3A CN117587114A (en) 2022-08-12 2022-08-12 Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210969103.3A CN117587114A (en) 2022-08-12 2022-08-12 Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury

Publications (1)

Publication Number Publication Date
CN117587114A true CN117587114A (en) 2024-02-23

Family

ID=89913865

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210969103.3A Pending CN117587114A (en) 2022-08-12 2022-08-12 Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury

Country Status (1)

Country Link
CN (1) CN117587114A (en)

Similar Documents

Publication Publication Date Title
CN114854851B (en) Application of exosome lncRNA (long chain ribonucleic acid) derived from plasma in preparation of drug-induced liver injury biomarker
EP2389453B1 (en) Single cell gene expression for diagnosis, prognosis and identification of drug targets
CN107660234A (en) The method of prediction organ-graft refection is sequenced using two generations
US20120264626A1 (en) MicroRNA Expression Profiling and Targeting in Chronic Obstructive Pulmonary Disease (COPD) Lung Tissue and Methods of Use Thereof
JP2009529880A (en) Primary cell proliferation
CA2620528A1 (en) Methods and compositions for identifying biomarkers useful in diagnosis and/or treatment of biological states
CN111662982B (en) Biomarker for early diagnosis and/or recurrence monitoring of brain glioma and application thereof
EP3543359A1 (en) Molecular marker, kit and application for use in early diagnosis and prediction of sepsis as complication of acute kidney injury
EP2307570B1 (en) Molecular signature of liver tumor grade and use to evaluate prognosis and therapeutic regimen
Hollegaard et al. High-throughput genotyping on archived dried blood spot samples
CA2677723C (en) Prognostic markers for classifying colorectal carcinoma on the basis of expression profiles of biological samples.
EP2603604B1 (en) Method and kit for the diagnosis and/or prognosis of tolerance in liver transplantation
CN104694534B (en) Non-small cell lung cancer marker, detection method and application thereof
CN117587114A (en) Application of lncRNA (ribonucleic acid) with number of MSTRG739544 in preparation of detection agent or chip for detecting liver injury
TWI598444B (en) Method and gene marker for assessing risk of suffering breast cancer
CN115011695A (en) Multiple cancer species identification marker based on free circular DNA gene, kit and application
WO2009123990A1 (en) Cancer risk biomarker
CN116926189B (en) Application of exosome lncRNA in detection of drug-induced myocardial injury
CN115261462A (en) Application of exosome lncRNA in preparation of liver injury biomarker
CN116904586B (en) Application of reagent for detecting plasma-derived exosome lncRNA in preparation of diagnostic reagent for detecting kidney injury
CN112852942A (en) Application of long-chain non-coding RNA in preparation of liver injury biomarker
CN112852944A (en) Application of long-chain non-coding RNA in preparation of liver injury biomarker
US20190330684A1 (en) Method for detecting and quantifying circulating dna and uses
CN116904585A (en) Application of reagent for detecting exosome lncRNA in preparation of diagnostic agent for detecting kidney injury
CN116144772B (en) Application of Hsa_circ_0006117 in preparation of lung adenocarcinoma treatment drugs

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination