CN117568391A

CN117568391A - Application of watermelon ClESR2 gene in light simplified cultivation of plants

Info

Publication number: CN117568391A
Application number: CN202311560633.3A
Authority: CN
Inventors: 牛欢欢; 杨路明; 汪虎; 朱华玉; 豆峻岭; 刘东明; 杨森; 张敏娟; 李鹏飞
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2023-11-20
Filing date: 2023-11-20
Publication date: 2024-02-20

Abstract

The invention belongs to the field of biotechnology, and particularly discloses application of a watermelon ClESR2 gene in plant light simplified cultivation, wherein the invention obtains the watermelon ClESR2 gene through plant genome cloning, constructs a ClESR2 over-expression vector, obtains a ClESR2 over-expression transgenic line by using an agrobacterium-mediated method, and finds that the plant height of the over-expression transgenic line is significantly shorter than that of a wild type and the quantity of basal side branches is significantly less than that of the wild type through comparison with the wild type, that is, the ClESR2 gene is beneficial to the light simplified cultivation of watermelons, and provides gene resources for molecular breeding for efficient cultivation management of watermelon crops.

Description

Application of watermelon ClESR2 gene in light simplified cultivation of plants

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a watermelon ClESR2 gene in light simplified cultivation of plants.

Background

Watermelon (Citrullus lanatus) is a annual vining crop belonging to cucurbitaceae, occupies an important position in the production and consumption of fruits and vegetables in China, is an important fruit capable of meeting the living demands of urban and rural residents, and can drive farmers to employment and increase income. China is the first major country of world watermelon production and consumption, and the watermelon yield accounts for more than 67% of the total world yield. For a long time, the watermelon planting in China is mainly performed in a traditional open field cultivation mode, but with the development of a watermelon protection field, facility cultivation gradually becomes a main planting mode of watermelon production in China, and the cultivation area accounts for 57.76% of the total area. The rapid development of watermelon facility cultivation enables the watermelon in China to be basically supplied all year round.

Reasonable plant type is the basis of high-yield breeding of crops, and dwarf traits have been valued by breeders for many years. However, the current facility cultivation of watermelons in China takes long vines as main cultivated varieties, which is not beneficial to high-density cultivation, and the late growth period affects ventilation and light transmission of plants, so that diseases are easily generated and spread, and the yield and quality of watermelons are affected; in addition, the overlong main vines of the watermelons are not beneficial to mechanized cultivation management, a large amount of labor is consumed to carry out pruning and vine falling, labor cost is increased, the standardization degree of watermelon cultivation is reduced, and the planting benefit is reduced. Therefore, the long vine variety has become a limiting factor affecting the light and simplified and labor-saving production targets in the development of watermelon facilities. The plant type of the dwarf variety of the watermelon is compact, the utilization rate of the planting space is high, and the dwarf variety of the watermelon is more suitable for high-density facility cultivation; the shielding among dwarf plants is weak, the light energy utilization rate is high, the ventilation and air permeability are good, the occurrence of plant diseases and insect pests can be reduced, and the yield and quality of watermelon facility cultivation are improved; meanwhile, the dwarf plant type does not need vine falling and pruning and branching in management, and is suitable for the light and simplified labor-saving management requirements under the facility condition. Therefore, the dwarf watermelon has a wider application prospect in facility production due to the special advantages.

In addition, side shoots are also one of the most important traits in plant types, directly determining plant structure and productivity. Too many branches not only affect nutrient distribution, light absorption and planting density, but also consume manpower to perform lateral branch pruning in cultivation, and the yield of crops is finally affected by too many lateral branches. Therefore, the ideal watermelon plant type is dwarfed and has little or no lateral branches, so that the plant density is increased, the yield per unit land area is improved, and the labor force required by pruning is greatly reduced.

Therefore, the materials with dwarf watermelons and few lateral branches are created, and the cultivation of new varieties which are beneficial to the light and simplified cultivation is of great significance for improving the management efficiency of watermelons and improving the yield.

Disclosure of Invention

The invention aims to provide application of a watermelon ClESR2 gene in light simplified cultivation of plants.

In order to achieve the above purpose, the technical scheme adopted by the invention is summarized as follows:

the nucleotide sequence of the watermelon ClESR2 gene is shown as SEQ ID NO.1, the length of the nucleotide sequence is 1083bp, the gene consists of 360 amino acids, and the amino acid sequence of the gene is shown as SEQ ID NO. 2.

The invention also constructs a series of plant expression vectors, recombinant vectors or transgenic plant lines containing the genes, and the functions of host cells containing the vectors in the aspect of facilitating the light and simplified cultivation of plants also fall into the protection scope of the invention.

The function of the gene protected by the invention not only comprises the ClESR2 gene, but also comprises the function of the homologous gene with higher homology (such as homology higher than 80%, more preferably higher than 90%, more preferably higher than 95%, more preferably higher than 98%) with the ClESR2 gene in improving the light and simplified cultivation of plants.

According to the invention, through constructing the transgenic watermelon plant over-expressed by the ClESR2 gene of the watermelon, the phenotype of the over-expressed plant line and the phenotype of the wild plant line are analyzed and compared, and the result shows that the over-expressed ClESR2 gene can effectively reduce the plant height and the quantity of lateral branches, thereby being beneficial to cultivation management. Thereby providing gene resources for molecular breeding of crop high-efficiency cultivation.

Preferably, the transgenic watermelon plant is constructed by agrobacterium-mediated methods.

Further preferably, the agrobacterium-mediated method comprises constructing a recombinant vector for overexpression of the watermelon ClESR2 gene, and transforming agrobacterium with the recombinant vector, wherein the recombinant vector is pcambia1305.4.

Preferably, the watermelon variety is TC.

The ClESR2 gene disclosed by the invention has the biological function in improving the plant cultivation management, wherein the improvement of the plant cultivation management is beneficial to the light simplified cultivation of plants, and the light simplified cultivation of the plants is shown as follows: the ClESR2 overexpressing strain was significantly lower in height than the wild-type and significantly less in number of side shoots than the wild-type.

According to its function, a plant advantageous for cultivation and management can be obtained by means of a transgene, in particular, a transgenic plant can be obtained by introducing the ClESR2 gene into a target plant, the transgenic plant having a plant height shorter than the target plant and a smaller number of side branches than the target plant.

Specifically, the ClESR2 gene can be introduced into the plant of interest through the recombinant expression vector. In the method, the recombinant expression vector may be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants.

The "promoting expression of the ClESR2 gene in the plant of interest" may be achieved as follows (1) or (2) or (3):

(1) Introducing ClESR2 gene into target plant;

(2) Introducing strong promoters and/or enhancers;

(3) Other methods are common in the art.

Wherein the target plant is watermelon.

Genes of interest, also known as target genes, are used in genetic engineering design and manipulation to recombine genes, alter receptor cell traits and obtain desired expression products. May be of the organism itself or from a different organism.

In the present invention, the plant suitable for the present invention is not particularly limited as long as it is suitable for performing a gene transformation operation such as various crops, flower plants, forestry plants, or the like. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous or gymnosperm plants.

As a preferred mode, the "plant" includes, but is not limited to: watermelon, all genes with the gene or homologous genes are applicable.

As used herein, the term "plant" includes whole plants, parent and progeny plants thereof, and various parts of plants, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, in which the gene or nucleic acid of interest is found. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises the gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by a method therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the sub-representations exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. And further relates to other derivatives after harvesting of the plants. The invention also relates to a food or food additive obtained from the relevant plant.

The invention has the advantages that:

(1) The invention obtains the ClESR2 gene of the watermelon by cloning a plant genome, constructs a ClESR2 overexpression vector, and obtains a ClESR2 overexpression transgene system by using an agrobacterium-mediated method. Compared with the wild type, the inventor has the advantages that the plant height of the ClESR2 over-expression strain is obviously lower than that of the wild type, the quantity of lateral branches is obviously lower than that of the wild type, the effect of the ClESR2 gene in improving plant cultivation management is disclosed, and gene resources are provided for efficient management of molecular breeding of crops.

(2) The plant which is cultivated in a light and simplified way (dwarf and few lateral branches) can be obtained through a transgenic way, and in particular, the transgenic plant can be obtained through introducing ClESR2 genes into a target plant, the plant is shorter than the target plant and the lateral branches are fewer than the target plant, so that a new way is provided for efficient cultivation and breeding of the plant.

Drawings

FIG. 1 is the identification of over-expressed lines of watermelon; FIG. 1-A shows the DNA level identification result, marker is commercial scale of band size, 1K is 1000bp,2K is 2000bp, and vector is the successfully constructed C1ESR2-1305.4 plasmid detection result; FIG. 1-B shows the result of identifying mRNA level, wherein ClActin7 is the reference gene in watermelon; FIG. 1-C shows the result of GFP fluorescence assay, light under bright field, GFP under green fluorescent channel;

FIG. 2 is a plant height comparison of the over-expressed strain of watermelon and the control;

FIG. 3 is a comparison of the number of side shoots of the over-expressed strain of watermelon and the control;

in the above figures, WT represents a wild control (TC), and OE-14 and OE-15 are over-expressed strains.

Detailed Description

The present invention will be described in detail with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials employed, unless otherwise indicated, are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botanicals, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to one of skill in the art. These techniques are fully explained in the published literature, and the methods of DNA extraction, construction of an overexpression vector, obtaining an overexpression plant, and the like used in the present invention can be realized by the methods disclosed in the prior art except for the methods used in the examples described below.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-or double-stranded structures. Such nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in genomic sequences, and/or coding sequences in cDNA, and/or cDNA and regulatory sequences thereof. In particular embodiments, for example in relation to isolated nucleic acid sequences, it is preferred that they are cDNA.

In addition, in order to more intuitively understand the technical scheme of the present invention, some terms related to the present invention are explained as follows:

the expression vector refers to a vector which is formed by adding expression elements (such as a promoter, RBS, terminator and the like) on the basis of the basic skeleton of a cloning vector so that a target gene can be expressed.

The experimental materials adopted by the invention comprise:

watermelon variety TC;

plasmid: pcmbia1305.4;

PCR Mix (KMM-101): 2X KOD ONE PCR Master Mix is a product of Toyo-yo (Shanghai) Biotechnology Co., ltd;

the restriction enzymes BamHI and PmlI are products of Bao Ri doctor Material technology (Beijing) Limited company;

the seamless cloning kit In-Fusion HD Cloning kits is a product of Bao Ri doctor Material technology (Beijing) Limited company;

gel DNA recovery kit: tiangen Biochemical technologies (Beijing) limited;

rapid plasmid DNA miniprep kit: tiangen Biochemical technologies (Beijing) limited;

coli competent DH 5. Alpha. Is a product of Optimus Praeparata;

agrobacterium competent EHA105 was from Shanghai Biotechnology, inc.;

primer synthesis and sequencing were all done by the qingke biotechnology company;

LB liquid medium: 25g of LB powder was weighed and dissolved in a small amount of distilled water, and then the volume was fixed to 1L with distilled water. Autoclaving at 121deg.C for 21min;

LB solid medium: weighing 25g of LB powder, dissolving in a small amount of distilled water, stirring uniformly, adding 15g of agar powder, and finally, using distilled water to fix the volume to 1L. Autoclaving at 121deg.C for 21min;

sowing culture medium: 6.7g of agar powder was weighed and dissolved in 1L ddH ₂ And in O, sterilizing at 121 ℃ for 21min under high temperature and high pressure.

And (3) dyeing liquid: sequentially weighing 4.43g of MS519 and 30g of sucrose, and fully dissolving in 1L of ddH ₂ Adding 750 μl of 6-BA (2 mg/mL) into O water, dissolving, adjusting pH with 1M NaOH to about 5.4-5.6, sterilizing at 121deg.C under high temperature and high pressure for 21min, and placing in a refrigerator at 4deg.C for use.

Co-culture medium: 4.43g of MS519, 30g of sucrose are weighed and fully dissolved in 1L of ddH ₂ To O, 750. Mu.L of 6-BA (2 mg/mL) was added, and after sufficient dissolution, pH=5.8 to 6.0 was adjusted with 1M NaOH, and then 7g of agar powder was weighed, stirred uniformly and sterilized at 121℃under high temperature and high pressure for 21 minutes.

Differentiation medium: 4.43g of MS519, 30g of sucrose are weighed and fully dissolved in 1L of ddH ₂ To O, 750. Mu.L of 6-BA (2 mg/mL) was added, after sufficient dissolution, pH=5.8 to 6.0 was adjusted with 1M NaOH, then 7g of agar powder was weighed, stirred uniformly, sterilized at 121℃under high temperature and high pressure for 21 minutes, and 1mL of timentin (200 mg/mL) was added after the temperature was lowered to about 50 ℃.

Bud elongation medium: 4.43g of MS524 and 30g of sucrose are weighed in turn and fully dissolved in 1L of ddH ₂ O, then sequentially adding 50 mu L of 6-BA (2 mg/mL), 10 mu L of NAA (1 mg/mL), 500 mu L of SH organic solvent and 1g of inositol, fully dissolving, adjusting pH to about 5.8-6.0 by using 1M NaOH, then adding 10.5g of agar powder, sterilizing at high temperature and high pressure at 121 ℃ for 21min, and then adding 1mL of timentin (200 mg/mL) after the temperature is reduced to about 50 ℃.

Rooting medium: 4.43g of MS519, 30g of sucrose are weighed and fully dissolved in 1L of ddH ₂ And O, adjusting the pH value to about 5.8-6.0 by using 1M NaOH, finally weighing 7g of agar powder, fully and uniformly stirring, sterilizing at the high temperature of 121 ℃ for 21min under high pressure, cooling to about 50 ℃ after sterilization, and adding 1mL of timentin (200 mg/mL).

The column type plant total RNA extraction and purification kit (RNAsimple Total RNAKit DP 419) is a product of Tiangen biochemical technology (Beijing) limited company;

ClESR2 Gene acquisition

1. Extraction of Total RNA

The specific procedure was carried out according to the kit instructions and is briefly as follows. 100mg of sample, liquid N ₂ Grinding, adding 1mL of lysate RZ, rapidly reversing and mixing, standing at room temperature for 5min, adding 200 μL of chloroform, shaking vigorously and fully extracting for 15s, standing at room temperature for 3min, centrifuging at 12000rpm and 4 ℃ for 10min, absorbing 400 μL of supernatant, transferring to 1.5mL of clean RNAase-free centrifuge tube, adding 200 μL of absolute ethanol, reversing and mixing, transferring the mixture into an adsorption column CR3, and transferring 120Centrifuging at 00rpm at 4 ℃ for 30s, and discarding the waste liquid. And cleaning twice by using deproteinized solution RD and rinsing solution RW respectively, discarding the waste liquid, fully airing in an ultra clean bench, transferring the adsorption column into a new 1.5mL clean RNAase-free centrifuge tube, and adding 30 mu L Diethyl pyrocarbonate (DEPC) water for dissolution.

RNA quality was detected by 1% agarose electrophoresis. The electrophoresis tank is soaked in 10% NaOH solution for 6-7h, the gel preparation concentration is 1%, a proper amount of bromine powder blue is added, 2.5 mu L of sample is loaded, the voltage of 120V (the voltage cannot be too low), and the gel is run for about 10min. And (5) irradiating the glue by an ultraviolet glue irradiation instrument.

2. cDNA Synthesis

The first strand cDNA was synthesized using 1ug of the top bud RNA of the watermelon as a template, using the reverse transcription kit (Lot#AK3701) from Bao Ri doctor technology (Beijing) Co., ltd. gDNA (genomic DNA) was first removed, and the system comprised 2. Mu.L RNA, 2. Mu.L 5X gDNA Eraser Buffer, 1. Mu.L 5 XgDNA Eraser, 5. Mu.L RNase free ddH ₂ O;42 ℃ for 2min. After the completion of the reaction, 1. Mu. L RT Enzyme Mix I, 1. Mu. L RT Primer Mix I, 4. Mu.L of 5X Prime Script Buffer and 6. Mu.L of RNase free ddH were added ₂ O; 15min at 37℃and 5s at 85℃followed by storage at 4 ℃.

3. The prepared cDNA was used as a template, and the pre-primer ClESR2-F was used: 5' -ACGGGGGACTCTAGAGGATCCATGGAAGAAGCACTAAGGCG

-3'; post primer ClESR2-R:5' -

CTGGTCACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTGAGCATTCTGTATTTTAGCAGCAT-3' to obtain PCR product.

The PCR amplification product was recovered using a gel DNA recovery kit.

Construction of CIESR2-1305.4 vector

The seamless cloning kit directly recombined the PCR product onto a1305.4 vector that has been linearized. The recombined vector is sequenced without error and then transferred into an agrobacterium EHA105 strain, and then watermelon (TC) is transformed by a cotyledonary node infection method.

Genetic transformation and acquisition of third-T0 generation watermelon plants

1. Agrobacterium transformation

1. Mu.g of plasmid containing the correct recombinant vector ClESR2-1305.4 was placed in 50. Mu.L of Agrobacterium EHA105 and transferred into Agrobacterium using the freeze thawing method.

2. T0 generation watermelon plant transformation

(1) Sowing: selecting full and uniform watermelon seeds, soaking in 55 deg.C water bath for 30min, and peeling off seed coats with forceps after the seed coats are soft. Sterilizing with 75% ethanol in ultra clean bench for 30s, washing with sterile water for 3-4 times, sterilizing with 3% sodium hypochlorite for 13min, and washing with sterile water for 3-4 times. After disinfection, the seeds are placed into a seeding culture medium and placed into a constant temperature incubator at 28 ℃ for dark culture for 2-3d.

(2) Explant infection and co-cultivation: when the seeds grow until root hairs do not grow, the hypocotyl is about 1cm, and the cotyledons are not unfolded, the infection can be carried out. Shaking the bacteria the day before infection, and detecting bacterial liquid OD by using a spectrophotometer ₆₀₀ The value of =0.8. In an ultra clean bench, the seeds were placed on sterilized filter paper and two cotyledons were cut into 12 pieces with a blade. Diluting the bacterial liquid concentration to OD by using the infection liquid according to the detected bacterial liquid concentration ₆₀₀ About=0.02, and the bacterial solution and the cut explants were placed into 20mL sterile syringes to the 10mL scale. The syringe is subjected to negative pressure to a 20mL scale for 90s, and is subjected to negative pressure infection twice, and after the infection, the syringe is sucked to dryness by filter paper and placed in a co-culture medium to be cultured in the dark for 3d at the temperature of 23 ℃.

(4) Recovery culture of explants: after co-culturing for 3d, the explant is washed by sterilized water for 6-8 times, placed on sterilized filter paper to completely absorb the clear water, placed in a recovery culture medium, and placed in a tissue culture room with a photoperiod of 16 h/dark 8h for recovery culture.

(5) Screening of explants and bud elongation: after one week of recovery, the explants were transferred to selection medium for about two weeks. The screening culture period is longer, and the culture medium is replaced by a new screening culture medium according to the condition of differentiated callus of the explant so as to avoid insufficient nutrition supply. In the screening culture stage, green fluorescent buds are screened by a handheld green fluorometer or a stereoscopic fluorescent microscope. The fluorescent shoots were transferred to shoot elongation medium for cultivation.

(5) Rooting and transplanting transgenic plants: after the buds grow for about two weeks to form buds about 1cm long, the buds with the growth points are cut off with a blade and transferred into rooting medium. Culturing for two to three weeks, hardening seedlings, washing off the culture medium at the root, planting the culture medium in a nutrient bowl, and carrying out transgene detection after survival.

Identification of transgenic plants

1. Identification of DNA level

(1) Extracting DNA of each transgenic plant by using a CTAB method, and taking the extracted DNA as a template, wherein the pre-primer is p35S:5'-GACGCACAATCCCACTATCC-3', the post primer is ClESR2-1305.4-R:5'-CTGGTCACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTGAGCATTCTGTATTTTAGCAGCAT-3'. If the PCR amplified strip contains DNA fragments with corresponding sizes, the DNA fragments are corresponding transgenic T0 generation positive transgenic ClESR2 plants; if the PCR amplified strip does not contain DNA fragments with corresponding sizes, the PCR amplified strip is a corresponding transgenic T0 generation negative transgenic ClESR2 plant.

10. Mu.L of PCR reaction system: PCR Mix (KMM-101) 5. Mu.L, each of the upstream and downstream primers 0.5. Mu.L, template 1. Mu.L, ddH ₂ O3. Mu.L. The reaction procedure is 98 ℃ for 3min;98℃for 5s,56℃for 5s,72℃for 30s, for a total of 36 cycles; and at 72℃for 5min.

In DNA detection, a positive control is required. The positive control is the overexpression vector ClESR2-1305.4 constructed in the implementation. As shown in FIG. 1-A, the wild type control (WT) did not amplify the band of the target size, and both OE-14 and OE-15 and the ClESR2-1305.4 overexpressing vector amplified the band of the target size, indicating successful transfer of the ClESR2 overexpressing vector into the plant.

2. Semi-quantitative PCR

The specific primer is qClESR2-F:5'-AGGACTCAAGGCTCGCACTA-3'; qClESR2-R:5'-GGGTTCAGGGTAATCAAAGGT-3';

specific primers were designed using National Center for Biotechnology Information (nih.gov) Primer Blast.

10. Mu.L of PCR reaction system: cDNA templates 2. Mu. L, qClESR2-F and qClESR2-R each 0.5. Mu.L, PCR Mix (KMM-101) 5. Mu. L, nuclease-free Water 2. Mu.L.

The reaction procedure: 98 ℃ for 3min;98℃for 5s,56℃for 5s,72℃for 30s; at 72℃for 5min, 36cycles in total.

The PCR products were detected by 0.8% agarose electrophoresis. The electrophoresis tank is soaked in 10% NaOH solution for 6-7h, the glue concentration is 0.8%, the sample is applied with 8 mu L, the voltage is 120V (the voltage cannot be too low), and the glue is run for about 10min. The ultraviolet irradiation glue instrument irradiates glue, and the brightness of the comparison strip is weak. As shown in FIG. 1-B, the results indicated that the bands of the OE-14 and OE-15 transgenic lines were brighter than the wild-type control WT, indicating a significant up-regulation of the expression level of ClESR2, indicating successful construction of the ClESR2 overexpression system.

3. GFP fluorescence assay

The identification of the ClESR2 overexpressing strain by means of stereoscopic fluorescence or hand-held fluorescence microscopy of the fusion of the Green Fluorescent Protein (GFP) in the ClESR2-1305.4 overexpressing vector, as shown in fig. 1-C, showed no GFP signal observed in the wild-control (WT) and GFP fluorescence detected in the OE-14 and OE-15 transgenic strains, indicating successful construction of the ClESR2 overexpression system.

Functional identification of watermelon plants regulated by over-expression of ClESR2 gene

Firstly, planting the T0 generation positive plants on a cultivation land, and obtaining the T3 generation pure line plants after three generations of selfing. The over-expressed pure line of the ClESR2 gene of the T3 generation and the wild type watermelon TC were planted in a greenhouse, and the plant heights and the number of basal side branches of 20d,25d,30d and 40d after the planting were measured and counted, and as a result, as shown in FIG. 2 and FIG. 3, the plant heights of the over-expressed lines OE-14 and OE-15 were significantly higher than that of the wild type control WT, and the number of basal side branches was significantly lower than that of the wild type control WT. It is concluded from this that overexpression of the ClESR2 gene can significantly reduce plant height, significantly reduce the number of side shoots, and facilitate a light simplification of cultivation management.

The experimental data show that in the watermelon, the over-expression of the ClESR2 gene can influence the plant type of the plant by reducing the plant height and the quantity of the lateral branches, thereby facilitating the cultivation and management of the watermelon plant and providing a new way for the light simplified cultivation and breeding of the plant.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.

Claims

1. The application of the watermelon ClESR2 gene in plant light simplified cultivation is characterized in that the nucleotide sequence of the watermelon ClESR2 gene is shown as SEQ ID NO. 1.

2. The use according to claim 1, characterized in that transgenic plants advantageous for a light simplified cultivation are obtained by constructing the ClESR2 overexpression vector.

3. The use according to claim 1, wherein the plant is watermelon.

4. The use according to claim 1, characterized in that the expression of a light simplified cultivation is: the ClESR2 overexpressing strain was significantly shorter in height than the wild-type and significantly less in number of side shoots than the wild-type.

5. A plant breeding method, which is characterized in that the method is to obtain a plant with a plant height shorter than a target plant and a lateral branch quantity smaller than the target plant by promoting the expression of ClESR2 gene in the target plant; the nucleotide sequence of the ClESR2 gene is shown as SEQ ID NO. 1.

6. The plant breeding method according to claim 5, wherein the target plant is watermelon.