CN117568353A - Living body screening method of aptamer and aptamer obtained through screening - Google Patents

Living body screening method of aptamer and aptamer obtained through screening Download PDF

Info

Publication number
CN117568353A
CN117568353A CN202311366905.6A CN202311366905A CN117568353A CN 117568353 A CN117568353 A CN 117568353A CN 202311366905 A CN202311366905 A CN 202311366905A CN 117568353 A CN117568353 A CN 117568353A
Authority
CN
China
Prior art keywords
aptamer
screening
nucleic acid
protein
round
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311366905.6A
Other languages
Chinese (zh)
Inventor
谭蔚泓
武晓秋
邴涛
刘雨晴
张登伟
张明鑫
符婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute Of Basic Medicine And Oncology Chinese Academy Of Sciences Preparatory
Original Assignee
Institute Of Basic Medicine And Oncology Chinese Academy Of Sciences Preparatory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute Of Basic Medicine And Oncology Chinese Academy Of Sciences Preparatory filed Critical Institute Of Basic Medicine And Oncology Chinese Academy Of Sciences Preparatory
Priority to CN202311366905.6A priority Critical patent/CN117568353A/en
Publication of CN117568353A publication Critical patent/CN117568353A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181—Peptide nucleic acid, PNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/13—Applications; Uses in screening processes in a process of directed evolution, e.g. SELEX, acquiring a new function
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method for screening a nucleic acid aptamer in vivo and the nucleic acid aptamer obtained by screening. The screening method comprises the following steps: firstly, carrying out single-round ex-vivo screening, and pre-enriching library sequences; then, in-vivo screening is carried out, and sequences bound to tumor parts are recovered; and finally, establishing a library, sequencing and analyzing the sequence through a molecular identity card marking strategy, and verifying the selected sequence. The method provided by the invention can be realized through one round of in-vivo screening, and the screening period is obviously shortened; the screening method provided by the invention has the advantages that the screening success rate is high because the aptamer obtained by the screening method passes the examination of the in-vivo actual environment. Meanwhile, the aptamer specifically recognizing the CD318 protein obtained by screening has good targeting and nuclease degradation resistance in vivo.

Description

Living body screening method of aptamer and aptamer obtained through screening
Technical Field
The invention relates to the field of cancer diagnosis and treatment, in particular to a single-round living body aptamer screening method based on molecular identity card recognition and a screened nucleic acid aptamer capable of specifically recognizing a CD318 molecule.
Background
The aptamer is a single stranded oligonucleotide sequence (DNA/RNA) generated by exponential enriched ligand system evolution technology (Systematic Evolution of Ligands by Exponential Enrichment, SELEX). The novel peptide can be folded into different structures, specifically combines with target molecules, has the advantages of wide target molecule range, low immunogenicity, good thermal stability, small molecular weight, easy synthesis, small batch-to-batch difference, easy modification and the like, and is widely used for clinical diagnosis and clinical treatment research. The traditional SELEX technology mainly aims at screening recombinant proteins or cell lines, and the in vitro screened aptamer has weaker targeting ability to organs or tissues under physiological states due to different antigen densities, interactions and microenvironments. In order to solve the problem, researchers take tumor-bearing mice as research objects to screen out nucleic acid aptamers capable of specifically targeting tumor sites in physiological environments, and the feasibility of screening in living animals is verified. The traditional SELEX technology needs to remove non-specific binding molecules by using a reverse screen, but in the living screening, the non-binding molecules can be removed by kidneys, and other molecules enriched in non-target tissues in the body can be used as a control to remove the non-specific binding, so that the nucleic acid aptamer with good targeting property and nuclease degradation resistance under physiological conditions can be screened out. In addition, the targets of in vivo screening are unknown, and new tissue-specific markers can be screened for tumor diagnosis and targeted therapy by the interaction of aptamers and histones.
The existing screening strategy of the living aptamer is basically consistent with the traditional in-vitro screening strategy, the modified or unmodified library is injected into a tumor-bearing mouse through tail vein, after circulation for a period of time, the aptamer combined with tumor tissue is extracted, amplified, screened for multiple rounds, and subjected to high-throughput sequencing to obtain the aptamer. The problems of difficult recovery, difficult amplification, large number of short fragments and the like of the aptamer are mainly faced at present in the screening of living bodies, along with the increase of the number of screening rounds, the efficiency of PCR amplification is obviously reduced, screening failure is often caused, and the traditional screening of living bodies faces the challenges of low success rate, time and labor waste and the like. Therefore, shortening the number of living screening rounds has great significance for successful screening.
Disclosure of Invention
The invention aims to provide a single-round living body nucleic acid aptamer screening method based on molecular identity card identification. The screening method comprises the following steps: firstly, single-round ex-vivo screening is carried out, library sequences are pre-enriched, the loss of library sequences caused by metabolism is reduced, and the sequence diversity is increased; then, in-vivo screening is carried out, and the sequence bound to the tumor part is recovered; and finally, establishing a library, sequencing and analyzing the sequence through a molecular identity card marking strategy, and selecting the sequence for verification. The method obviously shortens the screening period of the aptamer and improves the screening success rate.
In a first aspect, the invention provides a single round of in vivo nucleic acid aptamer screening method based on molecular identity card recognition, the method comprising the following steps:
1) Incubating the random nucleic acid library with target cells for in vitro screening to obtain a first round of ssDNA library;
2) Combining the ssDNA library obtained in the step 1) with in-vivo tumor tissues to perform in-vivo screening to obtain a second round of ssDNA library;
3) Incubating the ssDNA library obtained in the step 2) with target cells, and performing high-throughput sequencing on the sequence combined with the target cells based on molecular identity card markers.
In some embodiments, the ex vivo screening in step 1) is specifically:
i) Performing variegation treatment on the random nucleic acid library;
ii) preparing a target cell;
iii) Incubating the variegated random nucleic acid library of step i) with the target cells of step ii);
iv) PCR amplification;
v) preparing a first round of ssDNA library.
Preferably, the random nucleic acid library used in step 1) is:
AAG GAG CAG CGT GGA GGA TA-NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNN-TTA GGG TGT GTC GTC GTG GT；
an upstream primer: 5 '-fluorescein isothiocyanate-AAG GAG CAG CGT GGA GGA TA TA-3';
a downstream primer: 5 '-biotin-ACC ACG ACG ACA CAC CCT AA-3';
n represents A, T, C, G random arbitrary bases.
In some embodiments, the in vivo screening in step 2) is specifically:
i) Step 1), performing variegation treatment on the ssDNA library obtained by screening in the first round;
ii) injecting the first round of ssDNA library renatured in step i) into tumor tissue in vivo;
iii) Taking out the tumor tissue after a period of time, carrying out denaturation treatment and PCR amplification on the tumor tissue;
iv) preparing a second round ssDNA library.
Preferably, in step 2) the in vivo tumor tissue of step ii) is obtained by transplantation of the target cells of step 1);
preferably, in step 2), step ii), the ssDNA obtained by screening in step 1) is injected into the tumor tissue by intravenous injection, for example by tail vein injection;
preferably, the tumor tissue is e.g. ovarian tumor tissue, tumor tissue of OVCAR3 cell line xenograft mice;
in some embodiments, the high throughput sequencing of the sequence bound to the target cell in step 3) based on molecular identity card labeling is specifically:
i) Step 2), performing variegation treatment on the ssDNA library obtained by screening in the second round;
ii) preparing a target cell;
iii) Incubating the second round of ssDNA library renatured in step i) with the target cells of step ii);
iv) carrying out denaturation treatment on the incubated product after the incubation is finished, then adding TBLK, UMI and DNA ligase for incubation, and carrying out PCR amplification;
TBLK：aaaAGG CAG ACA AGA CAG GTA CCA CGA CGA CAC ACCaaa；
UMI：P’-CCTGTCTTGTCTGCCTACCT(N)xACCTCTCAGAATTCGCACCA；
An upstream primer: 5-AAG GAG CAG CGT GGA GGA TA TA-3'
A downstream primer: 5-TGG TGC GAA TTC TGA GAG GT-3',
n represents A, T, C, G random arbitrary base;
x is selected from any integer between 7 and 100;
v) high throughput assay.
In some embodiments, the target cells used in steps 1) -3) are the same and are selected from primary cells obtained from tumor tissue, e.g., primary cells obtained from ovarian tumor tissue; for example primary cells obtained from tumor tissue of OVCAR3 cell line, primary cells obtained from tumor tissue of OVCAR3 cell line xenograft mice.
The invention also aims to provide a single-round living body screening method based on the molecular identity card recognition strategy, which is used for screening the obtained nucleic acid aptamer specifically recognizing the CD318 protein. Because the aptamer is subjected to the examination of the actual environment in the body in the screening process, the screened aptamer specifically recognizing the CD318 protein has good targeting and nuclease degradation resistance in the body.
In a second aspect, the invention provides a nucleic acid aptamer specifically recognizing the CD318 protein, said nucleic acid aptamer comprising at least one of the sequences as shown in seqno. 1-4:
SEQ NO.1：HIM XQ-Apt3-CD318:
AAGGAGCAGCGTGGAGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGG GTATCGATTAGGGTGTGTCGTCGTGGT；
SEQ NO.2：HIM XQ-Apt3a-CD318:
AGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTATCGA；
SEQ NO.3：HIM XQ-Apt3b-CD318:
ATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT；
SEQ NO.4：HIM XQ-Apt-CD318:
ATACCCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT。
In some embodiments, the nucleic acid aptamer further comprises at least one of the following:
(1) A sequence obtained by modifying the nucleic acid aptamer;
(2) Coupling modification is carried out on the nucleic acid aptamer to obtain a sequence;
(3) Deleting and/or adding one, two or more nucleotides to said aptamer results in a sequence having the same or very similar function as said aptamer.
Specifically, deletion and/or addition of one, two or more nucleotides, the similarity is 80% or more (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and the same or very similar function as the above-mentioned aptamer.
Preferably, the modification comprises at least one of the following modification methods:
(1) Phosphorylation; (2) methylation; (3) amination; (4) thiolation; (5) isotopic; (6) fluorination; (7) replacing oxygen with sulfur; (8) substituting selenium for oxygen.
Preferably, the coupling modification comprises at least one of the following modification methods:
(1) Ligating a fluorescent label to the aptamer;
(2) Ligating a radioactive substance to the aptamer;
(3) Ligating a therapeutic substance (e.g., an anti-tumor drug) to the aptamer;
(4) Ligating biotin to the aptamer;
(5) Ligating a biological enzyme to the aptamer;
(6) Connecting a nanomaterial on the aptamer;
(7) Ligating a small peptide to the aptamer;
(8) Ligating an siRNA to the aptamer;
(9) Attaching a micron material to the aptamer;
(10) Cells and/or vesicles are attached to the aptamer.
In a third aspect, the invention also provides a nucleic acid aptamer derivative specifically recognizing CD318 protein according to the second aspect, the nucleic acid aptamer derivative comprising at least one of the following:
(1) Phosphorothioate backbone sequences derived from the aptamer backbones described above;
(2) A peptide nucleic acid sequence modified by the above-mentioned aptamer.
In a fourth aspect, the invention also provides the use of a nucleic acid aptamer according to the second aspect or a nucleic acid aptamer derivative according to the third aspect, the use comprising at least one of:
(1) Use in the preparation of an agent that specifically recognizes CD318 protein;
(2) Use in the preparation of a reagent for the qualitative or quantitative detection of CD318 protein;
(3) Use in the preparation of a CD318 protein antagonist;
(4) Use in the preparation of a CD318 protein imaging agent;
(5) Use as a pharmaceutical carrier (e.g. a tumor-targeting pharmaceutical carrier);
(6) The application in preparing molecular probes and cell maps.
In a fifth aspect, the invention also provides a medicament comprising a nucleic acid aptamer according to the second aspect or a nucleic acid aptamer derivative according to the third aspect.
In a sixth aspect, the present invention also provides the use of a medicament according to the fifth aspect, said use being selected from at least one of the following:
(1) The application in preparing medicines for inhibiting or reversing tumor (such as ovarian cancer, gastric cancer, colorectal cancer and the like) drug resistance;
(2) Use in the manufacture of a medicament for the treatment or co-treatment or prevention of a tumor/cancer (e.g. ovarian cancer, gastric cancer, colorectal cancer, etc.).
In a seventh aspect, the invention also provides an agent comprising a nucleic acid aptamer according to the second aspect or a nucleic acid aptamer derivative according to the third aspect; the agent is selected from at least one of the following:
(1) Agents that target recognition of CD318 protein;
(2) Reagents for qualitative or quantitative detection of CD318 protein;
(3) Inhibitors that inhibit or reverse tumor/cancer (e.g., ovarian, gastric, colorectal, etc.) resistance;
(4) An imaging agent that binds CD318 protein;
(5) Molecular probes, reagents for cell mapping.
Advantageous effects
The invention provides a single-round living body nucleic acid aptamer screening method based on molecular identity card identification. The method obviously shortens the screening period of the aptamer and improves the screening success rate. The traditional living body screening usually needs 10-20 rounds of screening, and the method provided by the invention can be realized through one round of in-vivo-living body screening. Meanwhile, compared with the traditional in-vitro screening, the screening method provided by the invention has the advantage that the aptamer can be screened to meet in-vivo application, such as good targeting in vivo and nuclease degradation resistance, due to the fact that the screening method provided by the invention is subjected to the examination of in-vivo actual environment.
The aptamer for specifically recognizing the CD318 protein, which is obtained by single-round living body screening based on a molecular identity card recognition strategy, has stable property, is easy to synthesize, has excellent performance, and can be used for application and research of the CD318 protein.
Drawings
FIG. 1A) a flowchart of in vivo screening; b) Aptamer candidate copy number profile.
Figure 2 binding of aptamer to OVCAR3 cell line before and after truncation optimization.
FIG. 3 HIM XQ-Apt-CD318 competition assay.
FIG. 4. Binding of HIM XQ-Apt-CD318 to single cell suspensions prepared from tumor tissue.
FIG. 5 equilibrium dissociation constant for HIM XQ-Apt-CD 318.
FIG. 6. A) stability of HIM XQ-Apt-CD318 in 10% serum; b) Stability of HIM XQ-Apt-CD318 in 100% serum.
FIG. 7 HIM XQ-Apt-CD318 target protein knockdown validation.
FIG. 8. A) binding of HIM XQ-Apt-CD318 to CD318 protein; b) Equilibrium dissociation constants of HIM XQ-Apt-CD318 and CD318 proteins.
FIG. 9 is a thermal diagram of HIM XQ-Apt-CD318 binding to different cells.
FIG. 10 confocal imaging of HIM XQ-Apt-CD318 binding to HCT-8 cells at different temperatures.
FIG. 11. A) in vivo imaging images of the intravenous injection of the Cy5.5-labeled aptamer HIM XQ-Apt-CD318 in OVCAR3 xenograft mice; b) Fluorescence images of different organs after dissection of the Cy5.5-labeled aptamer HIM XQ-Apt-CD318 mice were injected intravenously.
FIG. 12 HIM XQ-Apt-CD318-GEM binds to HCT-8 cells at different temperatures.
FIG. 13.CCK-8 detects HIM XQ-Apt-CD318-GEM, random sequence-GEM cytotoxicity.
Detailed Description
The following examples facilitate a better understanding of the present invention, but are not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.
The invention utilizes living screening technology to screen randomly synthesized ssDNA sequences, and xenografts mice experimental objects with OVCAR3 human ovarian cancer cell lines, aiming at screening out nucleic acid aptamers capable of specifically recognizing ovarian cancer under physiological conditions.
Example 1: aptamer in vivo screening
1. Cell culture
Cell line culture
The specific sources of the cells required for the experiment and the required minimal medium are shown in Table 1, 10% fetal bovine serum (Fetal Bovine Serum, FBS) and 100U/mL penicillin and streptomycin are added to the culture medium, and the mixture is cultured in a constant temperature incubator with carbon dioxide of 37 ℃, CO 2 The concentration was 5%. The digestive juice used for cell passage is 0.25% Trypsin-EDTA, and the frozen stock solution used for frozen cell is commercial serum-free frozen stock solution.
TABLE 1 cell culture
(II) Primary cell culture
The primary cells required for the experiment are all from tumor tissues of an OVCAR3 cell line xenograft mouse, and the culture medium is DMEM/F12 (1:1), 10% FBS, 100U/mL penicillin and streptomycin and 1% optional amino acid are added, and the mixture is cultured in a constant temperature incubator at 37 ℃ of carbon dioxide, and CO 2 The concentration was 5%. The digests used for cell passaging were 0.25% Trypsin-EDTA.
2. Construction and feeding of tumor-bearing mice
The mice required for the experiment are 4-8 week nude mice, purchased from the animal center of the basic medical science and tumor research institute of China academy of sciences, and subjected to the experiment according to the standard specification approved by the basic medical science and tumor research institute of China academy of sciences. OVCAR3 cell suspension (100 μl,5×10 6 Individual cells) are subcutaneously injected into the back of nude mice with a volume of up to 1000mm 3 In this case, in vivo screening or imaging is performed.
The nude mice used in the experiment are fed into a clean laminar flow frame of an SPF-level animal house barrier system, the temperature is 20-25 ℃, the relative humidity is 40-70%, 12h illumination and 12h darkness are ensured every day, the noise is less than 60 dB, the mice can eat at will, and padding, feed and drinking water required by growth are sterilized.
3. Solution preparation
(1) Washing buffer solution: DPBS buffer (ph=7.4), 5mM MgCl 2 4.5g/L glucose.
(2) Binding buffer solution: consists of washing buffer with 1mg/mL Bovine Serum Albumin (BSA) and 0.1mg/mL herring sperm DNA.
(3) Tumor tissue digestive juice: consists of DMEM minimal medium with 2mg/mL neutral protease, 0.2mg/mL collagenase IV and 0.002mg/mL DNase I.
(4) 5X Mix solution: consists of an upstream primer (final concentration: 6. Mu.M), a downstream primer (final concentration: 6. Mu.M), dNTPs (final concentration: 375. Mu.M), taq DNA polymerase, 10 Xbuffer and ultrapure water.
In the screening of the above nucleic acid aptamer, the nucleic acid library and primers used are designed as follows:
random nucleic acid library (LibTB 1 DNA):
AAG GAG CAG CGT GGA GGA TA-NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNN-TTA GGG TGT GTC GTC GTG GT
an upstream primer: 5 '-fluorescein isothiocyanate-AAG GAG CAG CGT GGA GGA TA TA-3'
A downstream primer: 5 '-biotin-ACC ACG ACG ACA CAC CCT AA-3'.
Wherein N represents A, T, C, G random arbitrary bases.
4. The living body screening flow is shown in fig. 1A, and the specific steps are as follows:
first round of ex vivo screening
1) Library preparation: 7.2nmol of Lib TB1 library was dissolved in 150. Mu.L of DPBS, denatured at 95℃for 10min, cooled on ice for 5min, and renatured at room temperature for 15 min.
2) Target cell preparation and treatment
(1) Preparation of tumor tissue Single cell suspension
a) One OVCAR3 cell line xenograft mouse was sacrificed, tumor tissue was removed, washed 3 times with DPBS, and sheared to 2mm 2 Small blocks.
b) 2mL of tumor tissue digestion solution is added to the cut tumor tissue fragments, and the mixture is digested in a constant temperature water bath at 37 ℃ for 20min.
c) Filtering the mixed solution of tissue cells obtained in the previous step by using a 70 mu m filter screen, collecting single cell suspension, centrifuging for 5min by using a table type low-speed automatic balancing centrifuge at 1500rpm, and removing the supernatant.
d) Cells were washed 2 times with 5mL DPBS, centrifuged at 1500rpm for 5min in a bench low-speed autobalance centrifuge, and the supernatant removed to give a cell pellet.
e) To the cell pellet, 5mL of erythrocyte lysate was added, and the mixture was blown up and left at room temperature for 5min. DPBS was added for neutralization and digestion, and the supernatant was removed by centrifugation at 1500rpm for 5min with a bench-top low-speed automatic balance centrifuge.
f) The cells were washed 2 times with 5mL DPBS, centrifuged at 1500rpm for 5min in a bench low-speed automatic balancing centrifuge, and the supernatant was removed to obtain a cell pellet.
g) DMEM/F12 (1: 1) Complete media was resuspended, counted, and grown on wall overnight.
(2) Cell treatment
a) The cells treated the day before were removed, the medium was aspirated, and the cells were washed 2 times with DPBS.
b) The adherent cells were digested with 0.02% EDTA in an incubator at 37℃for 5min, gently blown and collected in a 1.5mL EP tube, centrifuged at 2000rpm for 1min, and the supernatant removed.
c) The cell pellet obtained in the above step was washed 2 times with a washing buffer and resuspended in 850. Mu.L of binding buffer.
3) The prepared 150. Mu.L of Lib TB1 DNA library solution was added to 850. Mu.L of the cell suspension, mixed well and incubated on ice for 1h.
4) After the incubation, the supernatant was aspirated and the cells were gently washed 3 times with wash buffer.
5) The washed cells were denatured at 95℃for 10min with 160. Mu.L of ultrapure water and cooled on ice for 10min for PCR amplification.
6) PCR amplification
a) PCR1 amplification System:
(1) 160. Mu.L of supernatant +40. Mu.L of 5 Xmix was split into two tubes of 100. Mu.L each.
(2) Cell pellet +160. Mu.L of ultra pure water +40. Mu.L of 5 Xmix, split into two tubes of 100. Mu.L each.
(1) And (2) the annealing temperature is set at 60 ℃, the cycle number is set at 8, and the supernatant is collected into a 1.5mL EP tube for later use after amplification is completed.
b) Cycle number optimization PCR2: mu.L of PCR1 product +10. Mu.L of 5 Xmix +39. Mu.L of ultrapure water was mixed and dispensed into 5 tubes of 10. Mu.L each. The annealing temperature was set at 60℃and the number of cycles was 8-16, with 2 cycles per sample. The optimal number of cycles was confirmed to be 16 by 8% denaturing polyacrylamide gel electrophoresis (PAGE) bands.
c) PCR3: the PCR3 amplification was performed under PCR2 fumbling conditions with an amplification system of 1mL (20. Mu.L of PCR1 product+200. Mu.L of 5 Xmix+780. Mu.L of ultrapure water).
7) Preparation of ssDNA
a) 70. Mu.L of streptavidin agarose bead suspension was added to an empty mini-vial and the liquid was drained under pressure. The residual beads are on the upper part of the filter element.
b) The column was washed 2 times with 100. Mu.L DPBS.
c) The products from PCR3 were combined and passed through a mini-column.
d) The mixture was washed with 100. Mu.L of DPBS 2 times.
e) The mini-column was washed 2 times with 50 μl of 200mM NaOH solution and the eluate was collected.
f) NAP-5 desalting column desalting (GE Healthcare, UK) was pre-rinsed with ultrapure water, not less than 15mL.
g) 100. Mu.L of ssDNA eluate was added to the column.
h) After all the solution was introduced into the column, 400. Mu.L of ultrapure water was further added.
i) After all the solution had entered the column, 600. Mu.L of ultrapure water was added.
j) The effluent was collected using a 1.5mL EP tube, with a volume of approximately 600. Mu.L.
k) The ssDNA content was determined using an ultraviolet spectrophotometer.
l) marking the prepared ssDNA, spin-drying in vacuum, and freezing at-40 ℃ for later screening.
(two) second round-in vivo screening
1) 1nmol of the ssDNA library prepared in the previous round is taken and dissolved in 150 mu L of DPBS, denatured for 10min at 95 ℃, cooled for 5min on ice, and renatured for 15min at room temperature.
2) 150 μl of the renatured library was injected into OVCAR3 cell line xenograft mice by tail vein injection, the mice were suddenly killed after 40min, tumor tissues were removed, and after 3 times of washing with DPBS, sheared and placed on ice for use.
3) 160 mu L of ultrapure water is added into the tumor tissue fragments obtained in the last step, the denaturation is carried out for 10min at 95 ℃, and the tumor tissue fragments are cooled for 10min on ice for standby.
4) PCR amplification
a) PCR1 amplification System:
(1) 160. Mu.L of supernatant +40. Mu.L of 5 Xmix was split into two tubes of 100. Mu.L each.
(2) Cell pellet +160. Mu.L of ultra pure water +40. Mu.L of 5 Xmix, split into two tubes of 100. Mu.L each.
(1) And (2) the annealing temperature is set at 60 ℃, the cycle number is set at 8, and the supernatant is collected into a 1.5mL EP tube for later use after amplification is completed.
b) Cycle number optimization PCR2: 15. Mu.L of PCR1 product +10. Mu.L of 5 Xmix +25. Mu.L of ultrapure water were mixed and dispensed into 5 tubes of 10. Mu.L each. The annealing temperature was set at 60℃and the number of cycles was 16-24, with 2 cycles per sample. The optimal number of cycles was confirmed to be 24 by 8% denaturing polyacrylamide gel electrophoresis (PAGE) bands.
c) The target band was recovered using a DNA purification kit (FastPure Gel DNA Extraction Mini Kit) to remove part of the impurity band, and finally 60. Mu.L of the product was obtained.
d) PCR3: the amplification of PCR3 was performed according to PCR2 fumbling conditions, with an amplification system of 500. Mu.L (60. Mu.L of PCR1 product+100. Mu.L of 5 Xmix+340. Mu.L of ultrapure water).
5) Preparation of ssDNA: and (3) consistent with the preparation method of the step 7) of the first round of in-vitro screening, carrying out vacuum suspension and preserving at the temperature of minus 40 ℃ for standby.
5. High throughput sequencing based on molecular identity card strategy
Molecular identification card mark of binding sequence
1) Library preparation: diluting the ssDNA library obtained by the second round of screening with DPBS, denaturing for 10min at 95 ℃, cooling for 5min on ice, and renaturating for 15min at room temperature for standby.
2) Preparation of target cells: consistent with the method of preparation and treatment of target cells in step 2) of the first round of ex vivo screening, counts were made to ensure 5X 10 per sample 5 Individual cells.
3) The library prepared in step 1) (final concentration 400 nM) was incubated with the target cells of step 2), with shaking, and with ice for 30min.
4) After the incubation was completed and the cells were washed 2 times with the washing buffer, 15. Mu.L of sterilized water was added thereto, and denatured at 95℃for 10min.
5) To the product of the previous step, 2. Mu.M TBLK (aaaAGG CAG ACA AGA CAG GTA CCA CGA CGA CAC ACCaaa, final concentration 80 nM), 2. Mu.M UMI (P' -CCTGTCTTGTCTGCCTACCT nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ACCTCTCAGAATTCGCACCA, final concentration 80 nM) and 1X DNA Ligase Buffer were added, and after mixing, the mixture was placed in a PCR apparatus at 95℃for 3min and at 55℃for 3min, and after adding 10X T4 DNA buffer, the mixture was placed at room temperature for 20min. And adding T4 DNA Ligase, uniformly mixing, and standing at room temperature for 30min. The UMI is a molecular identity card for marking a target, the CCTGTCTTGTCTGCCT part is a known fixed sequence, the sequence and the length of the UMI are variable, and the UMI is used for marking and screening a library under the mediation of a connecting sequence; ACCT is a known fixed sequence, variable in sequence and length, used to label nucleic acid aptamers, or used to label different experiments; nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn is a random sequence of 7-100 in length for counting molecules; ACCTCTCAGAATTCGCACCA is for PCR amplification after labelling of library molecules. TBLK is used to assist the coupling of a potential aptamer to a unique identification tag.
6) And (3) putting the product obtained in the last step into a PCR instrument for inactivation at 65 ℃ for 10min, so that the T4 DNA Ligase is inactivated.
7) PCR amplification
a) PCR1 amplification System:
and adding 5 Xmix with a certain proportion into the connection complex, uniformly mixing, performing PCR amplification, setting the annealing temperature to 57 ℃ and setting the cycle number to 10.
An upstream primer: 5-AAG GAG CAG CGT GGA GGA TA TA-3'
A downstream primer: 5-TGG TGC GAA TTC TGA GAG GT-3',
b)PCR2：
mu.L of the PCR1 product was further amplified, the annealing temperature was set at 57℃and the number of cycles was 25, and it was judged by 8% denaturing polyacrylamide gel electrophoresis (PAGE) whether or not the ssDNA was successfully ligated with UMI (length about 150 bp). If the color of the strip is lighter, the input amount of the template can be properly increased.
c)PCR3：
PCR3 was performed according to the conditions of PCR2 fumbling, with an amplification system of 100. Mu.L.
(II) high throughput assay
The PCR3 product was submitted to Hangzhou Repu Gene technology Co.Ltd for sequencing.
The sequencing result is shown in FIG. 1B, after single-round living screening, the variety and the quantity of the nucleic acid sequences of the enrichment library are obviously different, the result obtained by high-throughput sequencing is sequenced according to the sequence repeatability, abundance and homology by using open source software Python, and 1 candidate sequence HIM XQ-Apt3-CD318 is selected from the result to carry out chemical synthesis and truncated optimization to verify the binding characteristic of the sequence.
In order to realize single round living screening, example 1 performs ex vivo screening, pre-enriches library sequences, reduces library sequence loss caused by metabolism, and can also be omitted if a chemical synthesis method is used for synthesizing a non-single copy nucleic acid library; then, in-vivo screening is carried out, and sequences bound to tumor parts are recovered, wherein the process directly carries out real environment examination on the nucleic acid library in vivo; and finally, marking the nucleic acid sequence combined with the target cells through a molecular identity card marking strategy, constructing a library, sequencing and analyzing the sequence, and selecting the sequence for verification.
Example 1 significantly shortens the screening cycle of the aptamer compared to conventional in vivo screening methods. The traditional living body screening usually needs 10-20 rounds of screening, but the method can be realized through one round of in-vitro-in-vivo screening, and the screening period is shortened from 1-2 months to 1-2 weeks; the probability of failure caused by excessive uncontrollable interference factors in the living body screening process is reduced, and the probability of success is further improved. Meanwhile, the aptamer is subjected to the examination of the in-vivo actual environment in the screening process, so that the aptamer which has good targeting in vivo and is resistant to nuclease degradation and the like and meets the in-vivo application can be screened.
Example 2: optimization and characterization of nucleic acid aptamers
1. Sequence optimization of the aptamer HIM XQ-Apt3-CD318
Sequence enrichment and homology analysis are carried out according to high-throughput sequencing results, 1 potential aptamer sequence HIM XQ-Apt3-CD318 is selected and extracted, truncation optimization is carried out, and specific sequence information is shown in Table 2. Binding of Fluorescein Isothiocyanate (FITC) -labeled aptamers (HIM XQ-Apt3-CD318, HIM XQ-Apt3a-CD318, HIM XQ-Apt3b-CD318, and HIM XQ-Apt-CD 318) to OVCAR3 cells was first determined by flow cytometry.
As shown in FIG. 2, HIM XQ-Apt3-CD318, HIM XQ-Apt3a-CD318, HIM XQ-Apt3b-CD318, HIM XQ-Apt-CD318 and OVCAR3 cells all had good binding ability compared to the control sequence, and were substantially consistent with the binding of the cells, indicating that 4 sequences before and after truncation may be potential nucleic acid aptamers.
TABLE 2 sequence information
/>
2. Nucleic acid aptamer competition experiments
To further investigate whether HIM XQ-Apt3-CD318 still recognizes the same target before and after truncation, unlabeled HIM XQ-Apt-CD318 and 4 aptamers with FITC label were mixed with cells simultaneously, incubated on ice for 30min, and after washing, centrifugation and resuspension, the cells were detected by flow cytometry. The results of the competition experiments (see FIG. 3) demonstrate that 4 sequences recognize the same target in a competing relationship. Compared with the original sequence, the sequence of HIM XQ-Apt-CD318 is shortest, and the binding condition with cells after truncation optimization is not obviously changed, so that the sequence is used in subsequent experimental study.
3. Characterization of binding of aptamer HIM XQ-Apt-CD318 to tumor tissue single cell suspension
The binding capacity of HIM XQ-Apt-CD318 was initially verified on a cell line, one OVCAR3 xenograft mouse was randomly selected for further investigation of the binding of HIM XQ-Apt-CD318 (cyanine dye Cy5.5 labeling) to tumor tissue, and the tumor tissue was removed to prepare a single cell suspension (see example 1 for specific procedures), and then incubated with HIM XQ-Apt-CD318 (cyanine dye Cy5.5 labeling) on ice for 30min, washed and resuspended, and then examined with a flow cytometer. The flow results showed a strong binding of HIM XQ-Apt-CD318 to the tumor tissue single cell suspension (FIG. 4).
4. Aptamer HIM XQ-Apt-CD318 affinity assay
The affinity of the FITC-labeled aptamer HIM XQ-Apt-CD318 obtained by screening was characterized by flow cytometry. Nucleic acid aptamer is diluted in gradient and then is respectively mixed with 3 multiplied by 10 5 The OVCAR3 cells were mixed well, incubated on ice for 30min, and after washing, centrifugation and resuspension, the cells were detected by flow cytometry. Flow cell experimental data were processed with FlowJo software and plotted with GraphPad Prism 8.0 software, with single strand DNA concentration (nM) on the abscissa and mean fluorescence intensity after deduction of cell autofluorescence values on the ordinate. The binding dissociation constant of the aptamer was calculated using the formula y=bmaxx/(kd+x), as shown in fig. 5, and the apparent equilibrium dissociation constant (kd=14.15± 3.065 nM) of HIM XQ-Apt-CD318 was on the nanomolar scale, indicating a strong affinity.
5. Stability of aptamer HIM XQ-Apt-CD318 in serum
1) Stability of HIM XQ-Apt-CD318 in 10% serum
The aptamer HIM XQ-Apt-CD318 was diluted to 100. Mu.M with DPBS, denatured at 95℃for 10min, cooled on ice for 5min, and left at room temperature for 15min. 6.6. Mu.L of 100. Mu.M HIM XQ-Apt-CD318 (final concentration 3. Mu.M) was added to 213.4. Mu.L of DMEM medium containing 10% FBS, and the average was divided into 11 samples, 20. Mu.L each, and incubated in a 37℃biochemical incubator, and removed at 0,1,2,4,6, 10, 12, 18, 24, 36, 48h, denatured at 95℃for 10min and frozen at-80 ℃. Degradation of HIM XQ-Apt-CD318 was observed by 3% agarose gel. The results show (see FIG. 6A) that HIM XQ-Apt-CD318 starts to degrade at 10h, has obvious degradation at 24h, has a half-life of 22h, and has better stability for the aptamer HIM XQ-Apt-CD 318.
2) Stability of HIM XQ-Apt-CD318 in 100% serum
The aptamer HIM XQ-Apt-CD318 was diluted to 100. Mu.M with DPBS, denatured at 95℃for 10min, cooled on ice for 5min, and left at room temperature for 15min. mu.L of 100. Mu.M HIM XQ-Apt-CD318 (final concentration 3. Mu.M) was added to 194. Mu.L of 100% FBS, and the mixture was divided into 10 samples in average, 20. Mu.L of each sample, and incubated in 37℃biochemical incubator, and taken out at 0,5, 10, 20, 30, 45, 60, 90, 120, 180min, denatured at 95℃for 10min and frozen at-80 ℃. Degradation of HIM XQ-Apt-CD318 was observed by 8% denaturing polyacrylamide gel electrophoresis. The results show (see FIG. 6B) that HIM XQ-Apt-CD318 starts to degrade at 30min, has more obvious degradation at 90min, has a half-life of 93min, and has better stability in 100% serum of the aptamer HIM XQ-Apt-CD 318.
Example 3 capturing and results validation of aptamer HIM XQ-Apt-CD318 target protein
1. Preparation of stable isotope labeled cells
CD318 high expressing cell line OVCAR4 cells were selected for target protein identification. The passage times of the OVCAR4 cells are not more than 10 generations, and the cell growth and adherence state are good. The common culture medium is discarded, DPBS is washed for 2 times, SILAC special complete culture medium containing light and heavy isotope amino acid is added, and the cells are passaged for at least 8 generations, and the isotope-stable marked cells are collected for mass spectrum identification.
2. Aptamer target capture and mass spectrometry identification
1) Cell preparation: OVCAR4 cells cultured in complete medium dedicated to SILAC containing light and heavy isotope amino acids were taken separately, the medium was discarded, and after 2 times of washing with DPBS, they were digested with cell digests containing 0.02% EDTA in an incubator at 37 ℃ for 5min. The cells are gently blown down to be respectively collected, washed for 2 times by a washing buffer solution, counted, and the number of the cells of each sample is ensured to be not less than 10 8 。
2) HIM XQ-Apt-CD318 with biotin modification and control sequences (final concentration: 200 nM), see in particular Table 3, for 30min on ice, after incubation, centrifugation, removal of supernatant, gentle washing of cells 2 times with wash buffer, taking small amounts of cell suspension and monitoring binding with flow cytometry.
TABLE 3 sample information
3) Crosslinking of formaldehyde: 2% formaldehyde solution is added into the sample, the sample is incubated on ice for 15min, and after the incubation is finished, 3M glycine solution is added to stop crosslinking.
4) Cell lysis: to the sample, a freshly prepared cell lysate (1 mL of lysate containing 10. Mu.L of PMSF, 10. Mu. Lcocktail protease inhibitor) was added and shaken at 4℃for 1h.
5) Protein extraction: the sample was placed in a pre-chilled 4 ℃ high speed centrifuge, 10000g was centrifuged for 10min, and after the completion the protein supernatant was transferred to a new centrifuge tube.
6) Capturing a target protein: to the protein supernatant, 20. Mu.L of streptavidin agarose beads (purchased from Situo, cat# 17511301) were added, and incubated at 4℃for 2h. After the incubation, the agarose beads were washed 3 times with cell lysate and 3 times with DPBS.
7) Mixing light and heavy isotopes: agarose beads corresponding to sample (1) and agarose beads corresponding to sample (4) were mixed, agarose beads corresponding to sample (2) and agarose beads corresponding to sample (3) were mixed, and at 4 ℃ overnight.
8) And (3) electrophoresis separation: equal amounts of each sample were denatured by heating at 2X SDS Loading,95 ℃for 1 hour, and separated by 12% SDS-PAGE gel.
9) Cutting and decoloring: 1cm of glue is recovered after bromophenol blue strips are cut up, 50% acetonitrile ammonium bicarbonate solution is added for washing for 30min, 2 times, 100% acetonitrile is added for washing 1 time, acetonitrile is removed, and the mixture is dried for standby.
10 Denaturation: adding 300 mu L of 1.5mg/mL DTT solution into a sample, heating for 45min at 56 ℃, centrifuging to remove the DTT solution, adding 50% acetonitrile ammonium bicarbonate solution for washing for 30min, washing for 2 times, adding 100% acetonitrile for washing for 1 time, removing acetonitrile, and airing. And respectively adding 300 mu L of 10mg/mL IAA solution into the sample, standing at room temperature for 30min, centrifuging to remove the IAA solution, adding 50% acetonitrile ammonium bicarbonate solution for washing for 30min, washing for 2 times, adding 100% acetonitrile for washing for 1 time, removing acetonitrile, and airing for later use.
11 Overnight enzymolysis: to the sample, 100. Mu.L of pancreatin was added, the liquid level was above the gel block, and after 30min on ice, the temperature was 37℃overnight.
12 Peptide fragment collection: 100. Mu.L of acetonitrile was added to the sample, and after shaking and mixing, the mixture was centrifuged, and the supernatant was placed in a new centrifuge tube. 200. Mu.L of solution A (composition: 1% formic acid, 50% acetonitrile, 50% deionized water) was then added to the fresh tube and washed 2 times, and the polypeptide supernatant was recovered by centrifugation and dried by vacuum spin.
13 Peptide segment desalting: sequentially adding solution B (100% acetonitrile, 0.1% formic acid), solution C (50% acetonitrile, 50% deionized water, 0.1% formic acid) and solution D (0.1% formic acid) into desalting column for activation balance. Dissolving the dried polypeptide with 150 μl of 0.1% formic acid solution, blowing the desalting column in a polypeptide solution centrifuge tube for 20 times to adsorb the polypeptide, blowing the solution D for 2 times to desalt, blowing the solution C for 20 times to elute the polypeptide, and vacuum concentrating the polypeptide solution for use.
14 Mass spectrometry detection and analysis: the polypeptide product was identified by analysis using an LTQ-orbitrapVelos mass spectrometer (Thermo Fisher Scientific, san Jose, calif.). The acquired raw mass spectral data was retrieved in uniprot protein databases using the MaxQuant search engine.
The specific parameters for the database search are as follows: the immobilization modification is alkylation modification on cysteine, and the variable modification is oxidation modification on methionine and acetylation modification on the N-terminal of protein. 2 leaky sites were allowed, the parent ion tolerance was 20ppm and the MS/MS fragment ion mass error was 0.5Da.
The results of the two repeated experiments show (see Table 4) that the ratio of the intensity of the protein captured by the nucleic acid sequence HIM XQ-Apt-CD318 to the intensity of the protein captured by the control sequence is greater than 20, and the ratio of the remaining endogenous biotinylated proteins is close to 1, which indicates that the nucleic acid aptamer HIM XQ-Apt-CD318 has the specific capability of separating the pull-down target protein and can specifically capture the CD318 protein (CUB domain protein 1, CDCP1 protein).
TABLE 4 identification of HIM XQ-Apt-CD318 target proteins Using SILAC
/>
( And (3) injection: f, R represents two repeated experiments, F1 represents the ratio of the amount of the captured protein of the sample (3) to the amount of the captured protein of the sample (2), and F2 represents the ratio of the amount of the captured protein of the sample (1) to the amount of the captured protein of the sample (4); r1 represents the ratio of the amount of the capture protein of the sample (3) to the amount of the capture protein of the sample (2), and R2 represents the ratio of the amount of the capture protein of the sample (1) to the amount of the capture protein of the sample (4). )
3. Verification of aptamer HIM XQ-Apt-CD318 target protein
The target protein for the aptamer HIM XQ-Apt-CD318 was found by mass spectrometry detection to be CD318 (CDCP 1). In order to further confirm the target protein of HIM XQ-Apt-CD318, the present invention also carried out siRNA interference experiments (the siRNA used in the experiments was published in the literature, guide strand: 5'-GCUCUGCCACGAGAAAGCAACAUUA-3', antisense strand: 5'-UAAUGUUGCUUUCUCGUGGCAGAGC-3', synthesized by Shanghai Ji Ma Gene Co., ltd.) to knock down the CD318 protein. The fact that the binding between the aptamer HIM XQ-Apt-CD318 and the CD318 protein knockdown cell is obviously reduced through flow cytometry (see FIG. 7) further proves that the target protein of the HIM XQ-Apt-CD318 is CD318.
Example 4: surface Plasmon Resonance (SPR) characterization of HIM XQ-Apt-CD318 affinity with CD318
1) Reagent preparation
a) The unlabeled aptamer HIM XQ-Apt-CD318 was diluted to 100. Mu.M with DPBS, denatured at 95℃for 10min, cooled on ice for 5min and renatured at room temperature for 15 min.
b) His protein (purchased from Nanjing Jinsri Biotech Co., ltd., product number: c556AHK150-1/PE 8715) was diluted with water to 19mg/mL for use.
c) CD318 protein (purchased from beijing Yiqiao shenzhou science and technology, inc., cat No.: 13262-H08H) was diluted with water to 0.25mg/mL for use.
d) Preparing SPR buffer solution: DPBS buffer (ph=7.4), 5mM MgCl 2 。
2) Protein coupling:
flow cell 1 channel: equal volumes of NHS (N-hydroxysuccinimide, 0.1M aqueous solution) and EDC (1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride, 0.4M aqueous solution) were pre-mixed and added to 96-well microwell plates to activate carboxyl groups on CM5 chips at a flow rate of 10. Mu.L/min. His protein as a control antibody was diluted with 10mM sodium acetate pH=4.5 and added to a 96-well plate for coupling for 900s at a flow rate of 10. Mu.L/min, with a final His protein coupling amount of 684.2Ru. The chip was then blocked with ammonium acetate at 10. Mu.L/min.
Flow cell 2 channel: equal volumes of NHS (N-hydroxysuccinimide, 0.1M) and EDC (1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride, 0.4M in water) were pre-mixed and added to 96-well microplates to activate carboxyl groups on CM5 chips at a flow rate of 10. Mu.L/min. CD318 protein was diluted with 10mM sodium acetate ph=5.0 to 20 μg/mL and added to a 96 well plate for coupling for 900s at a flow rate of 10 μl/min, with a final CD318 protein coupling amount of 4637.3Ru. The chip was then blocked with ammonium acetate at 10. Mu.L/min.
3) HIM XQ-Apt-CD318 and CD318 binding detection
The aptamer HIM XQ-Apt-CD318 was diluted to 500nM with SPR buffer, and the binding of HIM XQ-Apt-CD318 to CD318 protein was detected by a surface plasmon resonance (model: biacore 8K), binding time 120s, dissociation time 180s,1.5M NaCl regeneration, flow rate 30. Mu.L/min. As shown in FIG. 8A, HIM XQ-Apt-CD318 has stronger binding to CD318 protein and is rapidly dissociated.
4) HIM XQ-Apt-CD318 affinity assay for CD 318:
the aptamer HIM XQ-Apt-CD318 was subjected to gradient dilution with SPR buffer at concentrations of 800nM,400nM,200nM,100nM,50nM,25nM,12.5nM,6.25nM,3.125nM,1.5625nM, and the binding with CD318 protein was detected by surface plasmon resonance and fitted with data. As shown in FIG. 8B, the dissociation constants of HIM XQ-Apt-CD318 and CD318 (Kd=8.24X10) -8 M) at the nanomolar level, HIM XQ-Apt-CD318 has a relatively strong affinity for the CD318 protein, in substantial agreement with the results of example 2.
Example 5: detection of aptamer HIM XQ-Apt-CD318 for cell surface CD318 molecule
According to the experimental results, the invention continuously explores the combination condition of the aptamer HIM XQ-Apt-CD318 and various cells (human normal ovarian epithelial cells, human ovarian cancer cells, human gastric cancer cells, human leukemia cells, human lung cancer cells and the like). FITC-labeled aptamer (final concentration: 200 nM) was mixed with the cells, incubated on ice for 30min, washed 2 times with wash buffer after incubation was completed, and monitored by flow cytometry. Flow cell experimental data were processed with FlowJo software and plotted with GraphPad Prism 8.0 software.
As shown in FIG. 9, the HIM XQ-Apt-CD318 has different binding capacities with various cells, and can realize detection of the expression condition of CD318 molecules of different cells, so that the aptamer has the capacity of representing different cell membrane proteins and can be used for molecular probes, cell maps and other aspects.
Example 6: application of aptamer HIM XQ-Apt-CD318 in fluorescence imaging
1. Application of aptamer HIM XQ-Apt-CD318 in cell imaging
1) FITC-labeled and Cy5.5-labeled aptamer HIM XQ-Apt-CD318 is dissolved in DPBS, and is heated and denatured at the concentration of 4 mu M for 10min at the temperature of 95 ℃, placed on ice for 5min, and renatured at room temperature for 15min for later use.
2) Cell treatment
Based on the results of example 5 (FIG. 9), the experiment was performed with HCT-8 cells that bind strongly to HIM XQ-Apt-CD 318.
a) After culturing HCT-8 cells on a 35mm confocal dish for 48h, the medium was removed and washed 2 times with wash buffer.
b) mu.L of binding buffer containing 200nM HIM XQ-Apt-CD318 was added to the confocal dish and incubated for 30min at 4deg.C (FITC-labeled aptamer) and 37deg.C (Cy5.5-labeled aptamer). Wash with wash buffer 2 times.
c) Cells were fixed at room temperature for 15min by adding 100. Mu.L of 4% paraformaldehyde, and washed 2 times with wash buffer.
d) mu.L of 1 Xhoechst 33342 was added and incubated at room temperature for 10min, and washed 2 times with washing buffer.
e) And (5) observing by using a Nikon single photon confocal scanning microscope.
As shown in FIG. 10, HIM XQ-Apt-CD318 bound to HCT-8 cells at both 4℃and 37℃and HIM XQ-Apt-CD318 bound to the cell membrane of HCT-8 cells at 4℃and HIM XQ-Apt-CD318 bound partially to the cell membrane and partially endocytosed into cells at 37℃confirming that the selected aptamer HIM XQ-Apt-CD318 bound specifically to cells at 4℃and 37 ℃.
2. Application of aptamer HIM XQ-Apt-CD318 in-vivo imaging
Cy5.5-labeled aptamer HIM XQ-Apt-CD318 (2.15 nmol) and control Sequence Random Sequence (2.4 nmol) were dissolved in 150. Mu.L DPBS, denatured by heating at 95℃for 10min, placed on ice for 5min, and renatured at room temperature for 15min, respectively. Injecting dissolved aptamer (HIM XQ-Apt-CD 318) and control Sequence (Random Sequence) into OVCAR3 cell line xenograft mice via tail vein, and performing in vivo imaging at intervalsLumina III in vivo animal imaging system), mice were sacrificed after 1h and tumors, heart, liver, spleen, lung and kidney were removed for imaging. As shown in FIG. 11, HIM XQ-Apt-CD318 has good tumor targeting ability compared to the control sequence.
Example 7: proliferation inhibition experiment of CD318 targeting aptamer coupled drug HIM XQ-Apt-CD318-GEMd in HCT-8 cells
Characterization of the binding Capacity of the CD318 targeting aptamer-coupled drug HIM XQ-Apt-CD318-GEM
And selecting a CD318 high-expression cell line HCT-8 cell as an in-vitro experimental object, and characterizing the combination condition of the FITC marked CD318 targeting aptamer coupling drug HIM XQ-Apt-CD318-GEM and the cell by a flow cytometry. Firstly, diluting aptamer (HIM XQ-Apt-CD318/Random Sequence) and aptamer coupling drug (HIM XQ-Apt-CD318-GEM/Random Sequence-GEM), and respectively mixing with 3×10 5 The HCT-8 cells were mixed and incubated on ice or at 37℃for 30min, and after washing, centrifugation and resuspension, the cells were examined for binding by flow cytometry.
As shown in FIG. 12, HIM XQ-Apt-CD318-GEM maintained good cell binding at both 4℃and 37℃compared to Random Sequence-GEM.
Proliferation inhibition experiment of CD318 targeting aptamer coupled drug HIM XQ-Apt-CD318-GEM
HCT-8 cells were seeded into 96-well plates (3000 cells per well) at 37℃with 5% CO 2 The cells were incubated for 24 hours with adherence, 1640 complete medium (containing 5% FBS) containing different concentrations of aptamer-coupled drug (HIM XQ-Apt-CD318-GEM/Random Sequence-GEM) (1.95 nM, 3.9nM, 7.8nM, 15.625nM, 31.25nM, 62.5nM, 125nM, 250nM, 400nM, 500 nM) was added, untreated cells served as control, the drug-containing medium was discarded, and after further incubation with drug-free medium for 72 hours, 100. Mu.L of complete cell medium containing 10% CCK-8 was added as a liquid change. After incubation for a suitable period, the cell viability was determined by measuring the absorbance at 450nm on a microplate reader. Data were processed with Excel software and plotted with GraphPad Prism 8.0 software.
As shown in FIG. 13, the CD318 targeting aptamer-coupled drug HIM XQ-Apt-CD318-GEM has good cell proliferation inhibition effect on colorectal cancer HCT-8 cells compared with Random Sequence-GEM, and its IC 50 The value was 300nM.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. The screening method of the single round living body nucleic acid aptamer based on molecular identity card identification is characterized by comprising the following steps:
1) Incubating the random nucleic acid library with target cells for in vitro screening to obtain a first round of ssDNA library;
2) Combining the ssDNA library obtained in the step 1) with in-vivo tumor tissues to perform in-vivo screening to obtain a second round of ssDNA library;
3) Incubating the ssDNA of the second round obtained in the step 2) with target cells, and performing high-throughput sequencing on the sequence combined with the target cells based on molecular identity card markers.
2. The screening method according to claim 1, wherein the ex vivo screening in step 1) is specifically:
i) Performing variegation treatment on the random nucleic acid library;
ii) preparing a target cell;
iii) Incubating the library of renatured random nucleic acids of step i) with the target cells of step ii);
iv) PCR amplification;
v) preparing a first round of ssDNA library.
Preferably, the random nucleic acid library used in step 1) is:
AAG GAG CAG CGT GGA GGA TA-NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNN-TTA GGG TGT GTC GTC GTG GT；
an upstream primer: 5 '-fluorescein isothiocyanate-AAG GAG CAG CGT GGA GGA TA TA-3';
a downstream primer: 5 '-biotin-ACC ACG ACG ACA CAC CCT AA-3';
n represents A, T, C, G random arbitrary bases.
3. The screening method according to claim 1 or 2, wherein the in-vivo screening in step 2) is specifically:
i) Step 1), performing variegation treatment on the ssDNA library obtained by screening in the first round;
ii) injecting the first round of ssDNA library renatured in step i) into tumor tissue in vivo;
iii) Taking out the tumor tissue after a period of time, carrying out denaturation treatment and PCR amplification on the tumor tissue;
iv) preparing a second round ssDNA library;
preferably, in step 2) the in vivo tumor tissue of step ii) is obtained by transplantation of the target cells of step 1);
preferably, step ii) of step 2), the first round of ssDNA obtained by screening in step 1) is injected into the tumor tissue by intravenous injection, for example by tail vein injection;
Preferably, the tumor tissue is e.g. ovarian tumor tissue, tumor tissue of OVCAR3 cell line xenograft mice.
4. A screening method according to any one of claims 1-3, wherein the high throughput sequencing of the sequences bound to the target cells in step 3) based on molecular identity card labeling is specifically:
i) Step 2), performing variegation treatment on the ssDNA library obtained by screening in the second round;
ii) preparing a target cell;
iii) Incubating the second round of ssDNA library renatured in step i) with the target cells of step ii);
iv) carrying out denaturation treatment on the incubated product after the incubation is finished, then adding TBLK, UMI and NDA ligase for incubation, and carrying out PCR amplification;
TBLK：aaaAGG CAG ACA AGA CAG GTA CCA CGA CGA CAC ACCaaa；
UMI：P’-CCTGTCTTGTCTGCCTACCT(N)xACCTCTCAGAATTCGCACCA；
n represents A, T, C, G random arbitrary base;
x is selected from any integer between 7 and 100;
v) high throughput assay;
preferably, the target cells used in steps 1) -3) are identical and are selected from primary cells obtained from tumor tissue, e.g. from ovarian tumor tissue; for example primary cells obtained from tumor tissue of OVCAR3 cell line, primary cells obtained from tumor tissue of OVCAR3 cell line xenograft mice.
5. A nucleic acid aptamer that specifically recognizes CD318 protein, said nucleic acid aptamer comprising at least one of the sequences shown in SEQ No. 1-4:
SEQ NO.1：HIM XQ-Apt3-CD318:
AAGGAGCAGCGTGGAGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGG GTATCGATTAGGGTGTGTCGTCGTGGT；
SEQ NO.2：HIM XQ-Apt3a-CD318:
AGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTATCGA；
SEQ NO.3：HIM XQ-Apt3b-CD318:
ATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT；
SEQ NO.4：HIM XQ-Apt-CD318:
ATACCCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT；
preferably, the nucleic acid aptamer further comprises at least one of the following:
(1) A sequence obtained by modifying the nucleic acid aptamer;
(2) Coupling modification is carried out on the nucleic acid aptamer to obtain a sequence;
(3) Deleting and/or adding one, two or more nucleotides to said aptamer resulting in a sequence having the same or very similar function as said aptamer;
specifically, deletion and/or addition of one, two or more nucleotides, with a similarity of 80% or more (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), has the same or very similar function as the above-mentioned nucleic acid aptamer;
further preferably, the modification comprises at least one of the following modification methods:
(1) Phosphorylation; (2) methylation; (3) amination; (4) thiolation; (5) isotopic; (6) fluorination; (7) replacing oxygen with sulfur; (8) replacing oxygen with selenium;
further preferably, the coupling modification comprises at least one of the following modification methods:
(1) Ligating a fluorescent label to the aptamer;
(2) Ligating a radioactive substance to the aptamer;
(3) Ligating a therapeutic substance (e.g., an anti-tumor drug) to the aptamer;
(4) Ligating biotin to the aptamer;
(5) Ligating a biological enzyme to the aptamer;
(6) Connecting a nanomaterial on the aptamer;
(7) Ligating a small peptide to the aptamer;
(8) Ligating an siRNA to the aptamer;
(9) Attaching a micron material to the aptamer;
(10) Cells and/or vesicles are attached to the aptamer.
6. A nucleic acid aptamer derivative of claim 5 that specifically recognizes CD318 protein, said nucleic acid aptamer derivative comprising at least one of the following:
(1) A phosphorothioate backbone sequence derived from the aptamer backbone of claim 5;
(2) A peptide nucleic acid sequence modified by the aptamer of claim 5.
7. Use of the aptamer of claim 5 or the aptamer derivative of claim 6 to specifically recognize CD318 protein, the use comprising at least one of the following:
(1) Use in the preparation of an agent that specifically recognizes CD318 protein;
(2) Use in the preparation of a reagent for the qualitative or quantitative detection of CD318 protein;
(3) Use in the preparation of a CD318 protein antagonist;
(4) Use in the preparation of a CD318 protein imaging agent;
(5) Use as a pharmaceutical carrier (e.g. a tumor-targeting pharmaceutical carrier);
(6) The application in preparing molecular probes and cell maps.
8. A pharmaceutical composition comprising the aptamer of claim 5 that specifically recognizes CD318 protein or the aptamer derivative of claim 6.
9. Use of the pharmaceutical composition of claim 8, selected from at least one of the following:
(1) The application in preparing medicines for inhibiting or reversing tumor (such as ovarian cancer, gastric cancer, colorectal cancer and the like) drug resistance;
(2) Use in the manufacture of a medicament for the treatment or co-treatment or prevention of a tumor/cancer (e.g. ovarian cancer, gastric cancer, colorectal cancer, etc.).
10. An agent comprising the aptamer of claim 5 or the aptamer derivative of claim 6 that specifically recognizes CD318 protein; the agent is selected from at least one of the following:
(1) Agents that target recognition of CD318 protein;
(2) Reagents for qualitative or quantitative detection of CD318 protein;
(3) Inhibitors that inhibit or reverse tumor/cancer (e.g., ovarian, gastric, colorectal, etc.) resistance;
(4) An imaging agent that binds CD318 protein;
(5) Molecular probes, reagents for cell mapping.
CN202311366905.6A 2023-10-20 2023-10-20 Living body screening method of aptamer and aptamer obtained through screening Pending CN117568353A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311366905.6A CN117568353A (en) 2023-10-20 2023-10-20 Living body screening method of aptamer and aptamer obtained through screening

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311366905.6A CN117568353A (en) 2023-10-20 2023-10-20 Living body screening method of aptamer and aptamer obtained through screening

Publications (1)

Publication Number Publication Date
CN117568353A true CN117568353A (en) 2024-02-20

Family

ID=89861347

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311366905.6A Pending CN117568353A (en) 2023-10-20 2023-10-20 Living body screening method of aptamer and aptamer obtained through screening

Country Status (1)

Country Link
CN (1) CN117568353A (en)

Similar Documents

Publication Publication Date Title
RU2475539C2 (en) Method to separate spermatozoa and applied compositions, containing aptamers or sequences of nucleic acids
CN102703454B (en) Nucleic acid aptamer capable of detecting myohemoglobin, microfluidic chip for screening and screening method and application
CN108707606B (en) Aptamer and kit for specific target recognition of melanoma drug-resistant cells
JP2002520074A (en) Cis-acting nucleic acid elements and methods of use
WO2022095141A1 (en) Gpc1 dna aptamer and use thereof
CN108929873B (en) Aptamer specifically binding to metastatic gastric cancer cells and application thereof
CN109517722B (en) Device for capturing specific trace cells and manufacturing and using methods thereof
AU2018265432A1 (en) Compositions and methods for loading extracellular vesicles with chemical and biological agents/molecules
CN110184272B (en) Novel annular ternary aptamer and synthesis method and application thereof
CN112501174B (en) RNA aptamer specifically combined with CD 44-hyaluronic acid binding domain protein, and screening method and application thereof
CN114392358A (en) Tumor-targeted aptamer drug conjugate
CN113713118A (en) Establishment and synthesis method of double-targeting DNA nano drug-loaded complex
CN106282361B (en) Gene capturing kit for capturing genes related to blood diseases
CN117568353A (en) Living body screening method of aptamer and aptamer obtained through screening
Dasgupta et al. Global analysis of contact-dependent human-to-mouse intercellular mRNA and lncRNA transfer in cell culture
CN116376917A (en) Application of aptamer SWL-3G, SWL-3bG in preparation of medicines for treating bladder cancer
JP2019511566A (en) Nucleic acid condensing peptide, nucleic acid condensing peptide set, nucleic acid delivery carrier, nucleic acid delivery method, cell production method, cell detection method and kit
CN109554369B (en) Use of aptamers for recognition and binding of alkaline phosphatase heterodimers
CN113730594A (en) Double-targeting DNA nano drug-loaded complex and pharmaceutical application thereof
CN114807150B (en) Aptamer targeting and antagonizing HMGB1 molecule
CN116790607A (en) Nucleic acid aptamer binding to IGFBP-3 protein and application thereof
JP2021530230A (en) Compositions and Methods Related to Aptamer-Based Reversible Cell Selection
WO2015168656A2 (en) Biological complexes and methods for using same
US11535891B2 (en) Barcoded solid supports and methods of making and using same
CN114895029B (en) DNA nucleic acid chain targeting system for detecting and/or treating triple negative breast cancer, preparation and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination