CN117568304A - Recombinant DNA polymerase for sequencing - Google Patents

Recombinant DNA polymerase for sequencing Download PDF

Info

Publication number
CN117568304A
CN117568304A CN202311527009.3A CN202311527009A CN117568304A CN 117568304 A CN117568304 A CN 117568304A CN 202311527009 A CN202311527009 A CN 202311527009A CN 117568304 A CN117568304 A CN 117568304A
Authority
CN
China
Prior art keywords
dna polymerase
mutant
dna
sequencing
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311527009.3A
Other languages
Chinese (zh)
Inventor
蒋析文
刘霭珊
黄珞
朱伟伟
王周全
郑桑桑
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Da'an Gene Co ltd
Original Assignee
Guangzhou Da'an Gene Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Da'an Gene Co ltd filed Critical Guangzhou Da'an Gene Co ltd
Priority to CN202311527009.3A priority Critical patent/CN117568304A/en
Publication of CN117568304A publication Critical patent/CN117568304A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides a recombinant DNA polymerase for sequencing, which is a mutant of 9N DEG DNA polymerase, and the 9N DEG DNA polymerase mutant can recognize a 3-O-azido modified reversible terminator and keep higher doping activity, so that the recombinant DNA polymerase can be used for second-generation sequencing. The invention adopts the recombinant expression 9N DEG DNA polymerase mutant of the genetically engineered escherichia coli, and the expressed mutant enzyme realizes the soluble expression in an escherichia coli system and has high catalytic activity.

Description

Recombinant DNA polymerase for sequencing
Technical Field
The invention belongs to the technical field of biology, and particularly relates to recombinant DNA polymerase for sequencing.
Background
DNA polymerase is used in many reactions involving nucleic acid replication, one important direction being DNA sequencing. The current mainstream DNA sequencing method is a sequencing-by-synthesis technology, which relies on the incorporation and detection of a reversible terminator by DNA polymerase to realize large-scale parallel sequencing of DNA molecules, thereby reducing the sequencing cost. Unlike natural nucleotides, the 3-OH group of the reversible terminator is modified with a larger reversible group, such as 3-O-allyl, 3-O- (2-nitrobenzyl), 3-O-azido, and also carries a fluorescent group for ease of detection. Due to the difference of two substrates, natural DNA polymerase has low doping efficiency to reversible terminators and can not be identified, and meanwhile, the inherent fidelity of the DNA polymerase also causes bias to the doping of modified nucleotides, which is easy to cause hysteresis (sequencing) of sequencing reaction and limits the sensitivity of the reaction. On the other hand, sequencing-by-synthesis extends only one base at a time, and then the reversible terminator 3-OH structure is restored and the fluorescent group is excised through a chemical reaction, but the Linker for connecting the fluorescent group is still present on the template DNA, and as the sequencing reaction proceeds, the structure of the template DNA and the structure of the natural DNA are more and more different, so that the enzyme is incompatible with the DNA template, and therefore, a novel DNA polymerase needs to be modified to overcome the limitation.
The 9N DEG DNA polymerase is a heat resistant DNA polymerase derived from Thermococcus sp.9N-7, and since the bacterium was found in 9℃North latitude Pacific ocean bottom volcanic, the enzyme was named 9N DEG DNA polymerase. 9N DNA polymerase belongs to the family of DNA polymerase B, has a molecular weight of about 95kDa, and, like most DNA polymerases, requires magnesium ions as cofactors to exert enzymatic activity while having 3'-5' exonuclease activity. The polymerase active center is similar to the right-hand conformation of the E.coli Klenow fragment, and can be further divided into palm, thumb and finger domains. The occasional research shows that 9N DEG DNA polymerase from thermophilic coccus can well identify and bind reversible terminator and can accept wide modified nucleotide as substrate, so that the B family 9N DEG DNA polymerase is the first enzyme for important biotechnology such as NGS sequencing.
Therefore, those skilled in the art have focused on engineering and recombinant expression of 9N DNA polymerase to prepare 9N DNA polymerase for optical sequencing, which is suitable for industrial production at low cost and maintains high reaction efficiency.
Disclosure of Invention
The invention aims to provide a recombinant DNA polymerase for sequencing, which is a 9N DEG DNA polymerase mutant.
In a first aspect of the invention, there is provided a 9n° DNA polymerase mutant, the 9n° DNA polymerase mutant having a mutation at one or more sites selected from the group consisting of: 141, 143, 381, 485 and 497, wherein the amino acid residue number is as shown in SEQ ID NO.2.
In another preferred embodiment, the amino acid sequence of the 9n°dna polymerase mutant has at least 80% homology to SEQ ID No. 2; more preferably, it has a homology of at least 90%; most preferably, having at least 95% homology; such as having at least 96%, 97%, 98%, 99% homology.
In another preferred embodiment, the number of mutation sites in the 9N DEG DNA polymerase mutant is 1-5, preferably 4 or 5.
In another preferred embodiment, the 9N DNA polymerase mutant is mutated at amino acid residue positions 141, 143, 381, 485 and 497 of the 9N DNA polymerase shown in SEQ ID NO. 2; the 141 th amino acid residue is mutated to A, the 143 th amino acid residue is mutated to A, the 381 th amino acid residue is mutated to K, the 485 th amino acid residue is mutated to L, and the 497 th amino acid residue is mutated to V.
In another preferred embodiment, the amino acid sequence of the 9N DEG DNA polymerase mutant is shown in SEQ ID NO. 4.
In a second aspect of the invention there is provided a polynucleotide molecule encoding a 9n°dna polymerase mutant according to the first aspect of the invention.
In a third aspect of the invention there is provided a vector comprising a nucleic acid molecule according to the second aspect of the invention.
In a fourth aspect of the invention there is provided a host cell comprising a vector or chromosome according to the first aspect of the invention incorporating a nucleic acid molecule according to the second aspect of the invention.
In another preferred embodiment, the host cell is a prokaryotic cell, or a eukaryotic cell.
In another preferred embodiment, the prokaryotic cell is E.coli.
In another preferred embodiment, the eukaryotic cell is a yeast cell.
In a fifth aspect of the invention, there is provided a method of preparing a 9n°dna polymerase mutant according to the first aspect of the invention, comprising the steps of:
(i) Culturing the host cell of the fourth aspect of the invention under suitable conditions to express the 9n°dna polymerase mutant; and
(ii) The 9N DEG DNA polymerase mutant was isolated.
In another preferred embodiment, the temperature at which the host cells are cultured in step (i) is from 20℃to 40 ℃; preferably from 25℃to 37℃such as 35 ℃.
In another preferred embodiment, said host cell in step (i) is an E.coli cell.
In a sixth aspect of the invention, there is provided a kit comprising the 9n°dna polymerase mutant of the first aspect of the invention.
In a seventh aspect, the invention provides the use of the 9n°dna polymerase mutant of the first aspect of the invention in the preparation of a gene sequencing kit.
It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.
Drawings
FIG. 1 is a 9N DEG DNA polymerase expression test result;
FIG. 2 is a graph of a standard enzyme activity detection curve;
FIG. 3 is an electrophoresis chart of a commercial enzyme substrate compatibility test;
FIG. 4 is an electrophoretogram of a preferred mutant enzyme substrate compatibility test of the present invention.
Detailed Description
Through extensive and intensive research, the inventor adopts a genetically engineered escherichia coli recombinant fusion 9N DEG DNA polymerase mutant, and the expressed 9N DEG DNA polymerase mutant realizes soluble expression in an escherichia coli system, has high protein yield and higher catalytic activity. Has the advantages of short production period, easy purification of expression products, low cost and the like, and can realize the industrialized production of the 9N DEG DNA polymerase mutant. Meanwhile, the mutant enzyme can identify the 3-O-azido modified reversible terminator, keeps higher doping activity and can be applied to second-generation sequencing. On this basis, the present invention has been completed.
Before describing the present invention, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.
Currently 9N DNA polymerase mutants have been commercialized (named therapist) TM DNA polymerase) carrying a D141A, E143A, A L3 site mutation, wherein the D141A, E143A mutation is in the 3'-5' exonuclease domain, such that it loses its proofreading enzymatic activity, and the a485 amino acid is in the finger domain, opposite the polymerase active center, and does not directly contact the substrate nucleotide, so that mutation at this site may reduce the discrimination of modified nucleotides, but the optimal substrates for the enzyme are ddNTPs and acyclic nucleotides (AcyNTPs). The other mutant of the enzyme carries a Y409A mutation besides the 3 mutation, and can recognize and combine with a reversible terminator, however, the polymerase mutant has lower doping efficiency on the 3 '-end modified reversible terminator, and long incubation time and high concentration of the 3' -end modified nucleotide reversible terminator are needed to complete the reaction.
In a preferred embodiment of the invention, the base sequence of the wild-type 9N DEG DNA polymerase (optimized for E.coli synonymous codon preference, SEQ ID NO. 1):
ATGATCCTGGACACTGACTACATCACCGAAAATGGCAAACCGGTTATCCGTGTATTCAAAAAGGAAA
ACGGCGAATTCAAAATCGAATACGATCGCACGTTCGAACCGTACTTTTATGCGCTGCTGAAAGACGA
CTCCGCGATTGAAGATGTTAAAAAAGTGACGGCGAAGCGTCACGGTACTGTCGTCAAAGTGAAACGT
GCCGAAAAAGTTCAGAAGAAATTCCTGGGCCGTCCGATCGAAGTATGGAAACTGTACTTCAATCATC
CGCAGGACGTTCCGGCAATCCGTGATCGCATCCGTGCACACCCTGCTGTAGTGGATATCTACGAATA
CGACATCCCATTTGCGAAACGTTACCTGATCGACAAAGGCCTGATCCCGATGGAAGGCGACGAAGAA
CTGACCATGCTGGCATTCGACATCGAAACCCTGTATCACGAAGGTGAGGAATTCGGTACCGGCCCTA
TCCTGATGATCAGCTACGCTGACGGTTCCGAAGCGCGTGTTATCACCTGGAAAAAAATCGACCTGCC
GTATGTTGATGTTGTTTCCACTGAAAAGGAAATGATCAAACGCTTCCTGCGTGTAGTGCGTGAAAAA
GACCCGGATGTACTGATCACCTACAACGGCGACAACTTTGATTTCGCTTATCTGAAAAAACGCTGTG
AAGAACTGGGTATTAAATTCACTCTGGGTCGTGATGGCTCCGAACCTAAAATCCAGCGTATGGGTGA
CCGCTTTGCAGTTGAAGTTAAAGGTCGCATCCATTTCGATCTGTATCCAGTCATCCGCCGCACGATT
AACCTGCCGACCTACACTCTGGAAGCTGTGTATGAGGCAGTATTTGGCAAACCGAAAGAAAAGGTTT
ATGCGGAAGAAATCGCTCAGGCTTGGGAATCCGGCGAAGGTCTGGAACGTGTTGCGCGCTATTCCAT
GGAAGATGCGAAAGTGACTTACGAACTGGGTCGCGAATTTTTCCCGATGGAAGCCCAGCTGTCTCGT
CTGATCGGTCAGTCTCTGTGGGACGTTAGCCGCAGCAGCACTGGTAACCTGGTGGAGTGGTTCCTGCTGCGTAAGGCCTACAAACGTAACGAGCTGGCACCGAACAAGCCGGACGAACGTGAACTGGCACGCCGTCGCGGCGGTTATGCTGGTGGCTATGTGAAAGAACCGGAGCGCGGTCTGTGGGATAATATCGTATATCTGGATTTCCGTTCCCTGTACCCGTCCATCATCATTACCCACAACGTTTCTCCGGATACCCTGAACCGTGAGGGCTGTAAGGAATATGATGTTGCGCCGGAGGTCGGCCACAAATTCTGCAAAGACTTCCCGGGCTTCATTCCTTCTCTGCTGGGCGATCTGCTGGAAGAGCGTCAGAAGATTAAACGCAAGATGAAAGCTACGGTAGATCCGCTGGAAAAAAAGCTGCTGGATTATCGTCAACGTGCGATCAAAATCCTGGCGAACTCCTTCTATGGTTATTACGGTTACGCAAAAGCTCGTTGGTACTGTAAAGAATGCGCGGAATCTGTTACGGCCTGGGGCCGTGAATATATCGAAATGGTAATCCGTGAACTGGAAGAAAAATTCGGCTTCAAGGTTCTGTACGCAGACACCGACGGTCTGCATGCTACGATCCCGGGTGCTGACGCCGAGACCGTTAAAAAGAAAGCGAAGGAATTCCTGAAATACATCAACCCGAAACTGCCAGGCCTGCTGGAACTGGAATATGAGGGTTTCTACGTGCGCGGTTTCTTCGTTACCAAAAAAAAATACGCAGTTATTGACGAAGAGGGTAAGATCACCACCCGTGGCCTGGAGATCGTTCGCCGTGACTGGTCCGAGATCGCAAAAGAGACTCAGGCACGTGTTCTGGAAGCAATCCTGAAACACGGCGATGTAGAAGAAGCGGTTCGCATCGTAAAAGAGGTTACGGAGAAGCTGAGCAAGTATGAAGTTCCGCCGGAAAAGCTGGTTATCCACGAACAAATCACGCGTGATCTGCGTGACTATAAGGCAACTGGTCCGCATGTAGCAGTCGCAAAACGTCTGGCCGCGCGTGGTGTTAAAATCCGTCCGGGTACCGTGATTTCCTACATTGTTCTGAAGGGTTCCGGTCGTATCGGTGATCGTGCCATCCCTGCGGACGAATTCGATCCGACGAAACATCGTTACGATGCCGAGTACTACATCGAAAATCAGGTGCTGCCAGCGGTTGAACGTATCCTGAAAGCTTTTGGTTACCGTAAAGAAGATCTGCGTTATCAGAAAACTAAACAGGTGGGTCTGGGCGCCTGGCTGAAAGTTAAAGGTAAGAAG
in a preferred embodiment of the invention, the amino acid sequence of the wild-type 9N℃DNA polymerase (SEQ ID NO. 2) is as follows:
MILDTDYITENGKPVIRVFKKENGEFKIEYDRTFEPYFYALLKDDSAIEDVKKVTAKRHGTVVKVKRAEKVQKKFLGRPIEVWKLYFNHPQDVPAIRDRIRAHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELTMLAFDIETLYHEGEEFGTGPILMISYADGSEARVITWKKIDLPYVDVVSTEKEMIKRFLRVVREKDPDVLITYNGDNFDFAYLKKRCEELGIKFTLGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGKPKEKVYAEEIAQAWESGEGLERVARYSMEDAKVTYELGREFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYKRNELAPNKPDERELARRRGGYAGGYVKEPERGLWDNIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPEVGHKFCKDFPGFIPSLLGDLLEERQKIKRKMKATVDPLEKKLLDYRQRAIKILANSFYGYYGYAKARWYCKECAESVTAWGREYIEMVIRELEEKFGFKVLYADTDGLHATIPGADAETVKKKAKEFLKYINPKLPGLLELEYEGFYVRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLRDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPADEFDPTKHRYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTKQVGLGAWLKVKGKK
according to the three-dimensional structure published by the database (PDB: 5 omv), the 9N DEG DNA polymerase was modified with amino acid sites by using a computer molecular modeling technique, and the relevant mutation sites include:
d141, E143, T267, V282, R381, L408, Y409, P410, K464, Q483, a485, N491, Y494, Y497, E578, E580, amino acid residue numbering according to SEQ ID No.2. The final test results showed that the mutants comprising the D141A, E143A, R381K, A485L, Y497V mutant combination had the best performance of integrating fluorescent modified sequencing substrates. Preferably, the base sequence of the mutant 9N DNA polymerase of the invention (optimized for E.coli synonymous codon preference, SEQ ID NO. 3) is as follows: ATGATCCTGGACACTGACTACATCACCGAAAATGGCAAACCGGTTATCCGTGTATTCAAAAAGGAAAACGGCGAATTCAAAATCGAATACGATCGCACGTTCGAACCGTACTTTTATGCGCTGCTGAAAGACGACTCCGCGATTGAAGATGTTAAAAAAGTGACGGCGAAGCGTCACGGTACTGTCGTCAAAGTGAAACGTGCCGAAAAAGTTCAGAAGAAATTCCTGGGCCGTCCGATCGAAGTATGGAAACTGTACTTCAATCATCCGCAGGACGTTCCGGCAATCCGTGATCGCATCCGTGCACACCCTGCTGTAGTGGATATCTACGAATACGACATCCCATTTGCGAAACGTTACCTGATCGACAAAGGCCTGATCCCGATGGAAGGCGACGAAGAACTGACCATGCTGGCATTCGCGATCGCAACCCTGTATCACGAAGGTGAGGAATTCGGTACCGGCCCTATCCTGATGATCAGCTACGCTGACGGTTCCGAAGCGCGTGTTATCACCTGGAAAAAAATCGACCTGCCGTATGTTGATGTTGTTTCCACTGAAAAGGAAATGATCAAACGCTTCCTGCGTGTAGTGCGTGAAAAAGACCCGGATGTACTGATCACCTACAACGGCGACAACTTTGATTTCGCTTATCTGAAAAAACGCTGTGAAGAACTGGGTATTAAATTCACTCTGGGTCGTGATGGCTCCGAACCTAAAATCCAGCGTATGGGTGACCGCTTTGCAGTTGAAGTTAAAGGTCGCATCCATTTCGATCTGTATCCAGTCATCCGCCGCACGATTAACCTGCCGACCTACACTCTGGAAGCTGTGTATGAGGCAGTATTTGGCAAACCGAAAGAAAAGGTTTATGCGGAAGAAATCGCTCAGGCTTGGGAATCCGGCGAAGGTCTGGAACGTGTTGCGCGCTATTCCATGGAAGATGCGAAAGTGACTTACGAACTGGGTCGCGAATTTTTCCCGATGGAAGCCCAGCTGTCTCGTCTGATCGGTCAGTCTCTGTGGGACGTTAGCCGCAGCAGCACTGGTAACCTGGTGGAGTGGTTCCTGCTGCGTAAGGCCTACAAACGTAACGAGCTGGCACCGAACAAGCCGGACGAACGTGAACTGGCACGCCGTAAGGGCGGTTATGCTGGTGGCTATGTGAAAGAACCGGAGCGCGGTCTGTGGGATAATATCGTATATCTGGATTTCCGTTCCCTGTACCCGTCCATCATCATTACCCACAACGTTTCTCCGGATACCCTGAACCGTGAGGGCTGTAAGGAATATGATGTTGCGCCGGAGGTCGGCCACAAATTCTGCAAAGACTTCCCGGGCTTCATTCCTTCTCTGCTGGGCGATCTGCTGGAAGAGCGTCAGAAGATTAAACGCAAGATGAAAGCTACGGTAGATCCGCTGGAAAAAAAGCTGCTGGATTATCGTCAACGTTTAATCAAAATCCTGGCGAACTCCTTCTATGGTTATGTAGGTTACGCAAAAGCTCGTTGGTACTGTAAAGAATGCGCGGAATCTGTTACGGCCTGGGGCCGTGAATATATCGAAATGGTAATCCGTGAACTGGAAGAAAAATTCGGCTTCAAGGTTCTGTACGCAGACACCGACGGTCTGCATGCTACGATCCCGGGTGCTGACGCCGAGACCGTTAAAAAGAAAGCGAAGGAATTCCTGAAATACATCAACCCGAAACTGCCAGGCCTGCTGGAACTGGAATATGAGGGTTTCTACGTGCGCGGTTTCTTCGTTACCAAAAAAAAATACGCAGTTATTGACGAAGAGGGTAAGATCACCACCCGTGGCCTGGAGATCGTTCGCCGTGACTGGTCCGAGATCGCAAAAGAGACTCAGGCACGTGTTCTGGAAGCAATCCTGAAACACGGCGATGTAGAAGAAGCGGTTCGCATCGTAAAAGAGGTTACGGAGAAGCTGAGCAAGTATGAAGTTCCGCCGGAAAAGCTGGTTATCCACGAACAAATCACGCGTGATCTGCGTGACTATAAGGCAACTGGTCCGCATGTAGCAGTCGCAAAACGTCTGGCCGCGCGTGGTGTTAAAATCCGTCCGGGTACCGTGATTTCCTACATTGTTCTGAAGGGTTCCGGTCGTATCGGTGATCGTGCCATCCCTGCGGACGAATTCGATCCGACGAAACATCGTTACGATGCCGAGTACTACATCGAAAATCAGGTGCTGCCAGCGGTTGAACGTATCCTGAAAGCTTTTGGTTACCGTAAAGAAGATCTGCGTTATCAGAAAACTAAACAGGTGGGTCTGGGCGCCTGGCTGAAAGTTAAAGGTAAGAAG
In a preferred embodiment of the invention, the sequence of the mutant 9n°dna polymerase according to the invention is as follows (SEQ ID No. 4):
MILDTDYITENGKPVIRVFKKENGEFKIEYDRTFEPYFYALLKDDSAIEDVKKVTAKRHGTVVKVKRAEKVQKKFLGRPIEVWKLYFNHPQDVPAIRDRIRAHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELTMLAFAIATLYHEGEEFGTGPILMISYADGSEARVITWKKIDLPYVDVVSTEKEMIKRFLRVVREKDPDVLITYNGDNFDFAYLKKRCEELGIKFTLGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGKPKEKVYAEEIAQAWESGEGLERVARYSMEDAKVTYELGREFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYKRNELAPNKPDERELARRKGGYAGGYVKEPERGLWDNIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPEVGHKFCKDFPGFIPSLLGDLLEERQKIKRKMKATVDPLEKKLLDYRQRLIKILANSFYGYVGYAKARWYCKECAESVTAWGREYIEMVIRELEEKFGFKVLYADTDGLHATIPGADAETVKKKAKEFLKYINPKLPGLLELEYEGFYVRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLRDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPADEFDPTKHRYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTKQVGLGAWLKVKGKK
the mutant enzyme gene sequences of the invention may be obtained by conventional methods used by those of ordinary skill in the art, such as total artificial synthesis or PCR synthesis. One preferred synthesis method is an asymmetric PCR method. The asymmetric PCR method is to amplify a large amount of single-stranded DNA (ssDNA) by PCR using a pair of primers in unequal amounts. The pair of primers is referred to as non-limiting primer and limiting primer, respectively, in a ratio of typically 50-100:1. During the first 10-15 cycles of the PCR reaction, the amplified product is mainly double stranded DNA, but when the restriction primer (low concentration primer) is consumed, the non-restriction primer (high concentration primer) directed PCR will produce a large amount of single stranded DNA. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.
The mutant enzymes of the invention may be expressed or produced by conventional recombinant DNA techniques comprising the steps of:
(1) Transforming or transducing a suitable host cell with a polynucleotide encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;
(2) Culturing the host cell in a suitable medium;
(3) And separating and purifying the target protein from the culture medium or the cells to obtain the target enzyme.
Methods well known to those skilled in the art can be used to construct expression vectors comprising the coding DNA sequences for the enzymes of the invention and appropriate transcriptional/translational control signals, preferably commercially available vectors: pET28. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. In addition, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.
The recombinant vector comprises in the 5 'to 3' direction: a promoter, a gene of interest and a terminator. If desired, the recombinant vector may further comprise the following elements: a protein purification tag; a3' polynucleotide acidification signal; an untranslated nucleic acid sequence; transport and targeting nucleic acid sequences; selection markers (antibiotic resistance genes, fluorescent proteins, etc.); an enhancer; or an operator.
Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. The expression vector may be a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid or vector may be used as long as it is capable of replication and stability in a host.
The person skilled in the art can construct vectors containing the promoter and/or the gene sequence of interest of the present invention by means of well known methods. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.
The expression vectors of the invention may be used to transform an appropriate host cell to allow the host to transcribe the RNA of interest or to express the protein of interest. The host cell may be a prokaryotic cell such as E.coli, corynebacterium glutamicum, brevibacterium flavum, streptomyces, agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote (e.g., E.coli), the host can beTo use CaCl 2 The treatment can also be carried out by electroporation. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods (e.g., microinjection, electroporation, liposome encapsulation, etc.). The transformed plant may also be transformed by Agrobacterium or gene gun, such as leaf disc method, embryo transformation method, flower bud soaking method, etc. Plants can be regenerated from the transformed plant cells, tissues or organs by conventional methods to obtain transgenic plants.
The term "operably linked" refers to the attachment of a gene of interest to be expressed by transcription to its control sequences in a manner conventional in the art.
Culturing engineering bacteria and fermenting production of target protein
After obtaining the engineered cells, the engineered cells may be cultured under appropriate conditions to express the protein encoded by the gene sequence of the present invention. The medium used in the culture may be selected from various conventional media according to the host cell, and the culture is performed under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time.
In the present invention, conventional fermentation conditions may be employed. Representative conditions include (but are not limited to):
(a) In terms of temperature, the fermentation and induction temperatures of the enzymes are maintained at 25-37 ℃;
(b) The pH value in the induction period is controlled to be 3-9;
(c) In the case of Dissolved Oxygen (DO), the DO is controlled to be 10-90%, and the maintenance of dissolved oxygen can be solved by the introduction of oxygen/air mixed gas;
(d) For the feeding, the type of the feeding preferably comprises carbon sources such as glycerol, methanol, glucose and the like, and the feeding can be carried out independently or by mixing;
(e) As for the induction period IPTG concentration, conventional induction concentrations can be used in the present invention, and usually the IPTG concentration is controlled to 0.1-1.5mM;
(f) The induction time is not particularly limited, and is usually 2 to 20 hours, preferably 5 to 15 hours.
The target protein of the invention exists in E.coli cells, host cells are collected by a centrifuge, and then the host cells are broken up by high pressure, mechanical force, enzymatic hydrolysis cell cover or other cell disruption methods to release recombinant protein, preferably a high pressure method. The host cell lysate can be purified primarily by flocculation, salting out, ultrafiltration and other methods, and then subjected to chromatography, ultrafiltration and other purification methods, or can be directly subjected to chromatography purification.
The chromatographic techniques include cation exchange chromatography, anion exchange chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography, etc. Common chromatographic methods include:
1. anion exchange chromatography:
anion exchange chromatography media include (but are not limited to): Q-Sepharose, DEAE-Sepharose. If the salt concentration of the fermentation sample is high, which affects the binding to the ion exchange medium, the salt concentration is reduced before ion exchange chromatography is performed. The sample can be replaced by dilution, ultrafiltration, dialysis, gel filtration chromatography and other means until the sample is similar to the corresponding ion exchange column equilibrium liquid system, and then the sample is loaded to perform gradient elution of salt concentration or pH.
2. Hydrophobic chromatography:
hydrophobic chromatography media include (but are not limited to): phenyl-Sepharose, butyl-Sepharose, octyle-Sepharose. Sample by adding NaCl, (NH) 4 ) 2 SO 4 And the salt concentration is increased in an equal mode, then the sample is loaded, and the sample is eluted by a method of reducing the salt concentration. The hetero proteins with a large difference in hydrophobicity were removed by hydrophobic chromatography.
3. Gel filtration chromatography
Hydrophobic chromatography media include (but are not limited to): sephacryl, superdex, sephadex. The buffer system is replaced by gel filtration chromatography or further purified.
4. Affinity chromatography
Affinity chromatography media include (but are not limited to): hiTrap TM HeparinHPColumns。
5. Membrane filtration
The ultrafiltration medium comprises: organic membranes such as polysulfone membranes, inorganic membranes such as ceramic membranes, and metal membranes. The purposes of purification and concentration can be achieved by membrane filtration.
The invention has the main advantages that:
(1) The 9N DEG DNA polymerase mutant can identify the 3-O-azido modified reversible terminator, keeps higher doping activity, and can be applied to optical sequencing.
(2) The 9N DEG DNA polymerase mutant can realize a large amount of soluble expression in an escherichia coli expression system, is easy to purify, has high yield, and maintains higher biocatalysis activity.
The present invention will be described in further detail with reference to the following examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The following examples are not to be construed as limiting the details of the experimental procedure, and are generally carried out under conventional conditions such as those described in the guidelines for molecular cloning laboratory, sambrook.J.et al, (Huang Peitang et al, beijing: scientific Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.
EXAMPLE 1 construction, expression and purification of E.coli 9N DNA polymerase plasmid
1) Based on the protein sequence (SEQ ID NO. 2) of the wild 9N DEG DNA polymerase, the coding base sequences of the wild type and different mutants are respectively obtained after optimization of the synonymous codon preference of escherichia coli by combining the experimental design requirements of the invention, and each base sequence is respectively connected with a vector pET-28a (+), and is synthesized by the Suzhou Jin Weizhi biotechnology Co.
TABLE 1
Strain numbering Mutation site
1 Wild type
2 D141A、E143A、A485L、L408A、P410G
3 D141A、E143A、A485L、E578G、E580A
4 D141A、E143A、A485L、V282F、K464L
5 D141A、E143A、A485L、T267G、Q483K
6 D141A、E143A、A485L
7 D141A、E143A、A485L、N491V、Y494H
8 D141A、E143A、R381K、A485L、Y497V
2) Recombinant plasmid transformed E.coli BL21 (DE 3)
Taking 1 mu L of plasmid, adding the plasmid into 30 mu L of escherichia coli competent BL21 (DE 3) under ice bath condition, standing for 20min in ice bath, carrying out heat shock for 45s in water bath at 42 ℃, standing for 2min on ice immediately, adding 400 mu L of SOC culture medium without antibiotics, and carrying out shaking culture at 220rpm for 50min at 37 ℃. mu.L of the bacterial liquid was uniformly spread on LB plates containing 100. Mu.g/mL of kana resistance, and incubated overnight at 37 ℃.
3) Expression of the protein of interest
Picking the monoclonal in the step 2), aseptically inoculating in SOC medium containing 100 μg/mL kana resistance, shake culturing at 37deg.C and 220rpm to OD 600 Between 0.6 and 0.8, IPTG was induced (final concentration 0.1 mM), incubated overnight at 18℃with shaking, no IPTG was added as a control, incubated at 37℃for 3h, and each experiment was repeated. Sampling ultrasonic disruption for SDS-PAGE identification, and the result shows that the 9N DEG DNA polymerase can realize soluble expression in the supernatant fluid in the culture mediums of the strains 4, 5, 6, 7 and 8, and the yield of the soluble target protein of the strain 8 is higher than that of other strains; strains 2 and 3 did not detect the soluble expressed protein of interest. The molecular weight of the target protein was about 100Kda, and the predicted protein size (95 Kda) was substantially identical on the Expasy website (fig. 1).
4) Purification of 9N DNA polymerase
The solution formulation used to prepare the samples was as follows:
Buffer A:50mM Tris，50mM NaCl,，5％ Glycerol，pH 8.0
Buffer B:50mM Tris，50mM NaCl,，500mM Imidazole，5％ Glycerol，pH 8.0
Buffer C：100mM Tris，1M NaCl，10％ Glycerol，pH 8.0
Lysis Buffer：50mM Tris，300mM NaCl，5％ Glycerol，pH 8.0
9N dialysate: 10mM Tris-HCl,100mM KCl,1mM DTT,0.1mM EDTA,50%Glycerol,pH 7.4
The specific operation steps are as follows:
culturing 1.5L of bacterial liquid in a shaking flask of the SOC culture medium, wherein the expression condition is consistent with the expression of the target protein of 3). And (5) centrifuging and collecting thalli. About 20g of the cells were weighed, and 100ml of Lysis Buffer was added thereto to resuspend the cells on ice. Ultrasonic disruption of cells: the phi 10 probe has 20 percent of power, works for 5.5 seconds, stops for 9.9 seconds and is subjected to ultrasonic crushing for 30 minutes. After crushing, the sample is placed in a water bath kettle at 70 ℃ for heat treatment for 20min. Centrifugation was carried out at 20000rpm at 4℃for 35min, and the supernatant was collected and filtered through a 0.22 μm membrane. Subjecting the supernatant to Ni-column affinity chromatography using HisTrap as purification column TM HP，0-60％ BPerforming linear elution with buffer B, subjecting the eluate to ion exchange eluting with HisTrap TM SP-HP was eluted linearly with 0-60% Buffer C to give 90ml of the target protein solution.
The purified sample was dialyzed overnight in a dialysate and the protein concentration was determined by SDS-PAGE gray scale analysis.
The protein concentration of the purified samples is shown in Table 2 below.
TABLE 2
The results show that the protein concentration of the sample obtained by purifying the strain 8 is the highest, and the protein yield is the highest.
EXAMPLE 2 recombinant 9N DNA polymerase Activity assay
1. Purpose of experiment
The 9N DEG DNA polymerase activity was calibrated.
2. Experimental materials
Sample: 9N DEG DNA polymerase
Equipment and reagents: real-time fluorescent quantitative PCR system, picogreen, lambda DNA (merck).
Substrate T2 (SEQ ID No. 5):
the above substrates were synthesized from 5 'tagcgaatgtgtcacctatcgctcgcgcgcgcgcgcgcgcgggagcgcgcgggagca 3' and purified by HPLC to prepare a 100 pmol/. Mu.l mother liquor as required by the experiment.
4) Preparing 9N DEG enzyme diluent:
10mM Tris-HCl,100mM KCl,1mM DTT,0.1mM EDTA,50％Glycerol,(pH 7.4@25℃)
3. experimental procedure
3.1 The 10 XPCR Buffer is configured as follows:
1M Tris(pH8.5) 2.5ml
1M(NH4) 2 SO4 0.5ml
1M KCl 5ml
10％TritonX-100 1ml
ddH 2 O 1ml
3.2λ DNA pre-dye solution was configured as follows:
10×PCR Buffer 30ul
picogreen 15ul
ddH 2 O 255ul
3.3λ DNA was diluted to gradient as follows:
3.4 dilution of the sample to be tested:
the 9n°enzyme sample was diluted with 9n°enzyme dilution. The dilution factors are 1/100, 1/200, 1/400, 1/800, 1/1600 and 1/3200. The dilution factor can be adjusted according to the actual situation, and the measurement is carried out under the same protein concentration.
3.5 configuration of reaction System (Single reaction System)
10×PCR Buffer 2ul
25mM MgCl 2 2ul
T2(100p) 0.1ul
25mM dNTP 0.2ul
picogreen 0.5ul
Water and its preparation method 13.9ul
Polymerase sample to be tested 1.3ul
The lambda DNA and lambda DNA pre-dye solution of each dilution gradient are uniformly mixed according to the proportion of 1:1. The 0ug/ml lambda DNA group served as the control group. After the required number of wells (N) was calculated, the components of the reaction system except for 9N enzyme were mixed uniformly in the number of N+3, and the mixture was spotted into a 96-well plate at 18.7. Mu.L per well. Each gradient of lambda DNA was spotted into 96-well plates at 20 μl per well, and each concentration gradient of sample enzyme and lambda DNA was repeated at least 3 times. The diluted 9N enzyme (on ice) was then added, 1.3. Mu.L/well, centrifuged after shaking, and the NTC set was added with 1.3. Mu.L of 9N enzyme dilution. Lambda DNA group was not added with sample enzyme. The 96-well plate was placed in a qPCR instrument and fluorescence values were monitored in real time according to (74 ℃ 14s,74 ℃ 2 s). Times.120 cycles,74 ℃ 2s read SYBR.
4. Experimental results:
4.1 drawing of DNA Standard Curve
1) And (3) deriving the Q5 on-machine data into an Excel table, selecting a lambda DNA standard substance and a fluorescence value of the lambda DNA NTC group at the 30 th cycle, calculating the average value of the 3 groups of data under each lambda DNA concentration, and subtracting the average value of the 3 groups of data of the NTC group to obtain a net fluorescence value. Drawing a linear standard curve by taking the input lambda DNA amount as an abscissa and the net fluorescence value as an ordinate to ensure that R is the same 2 > 0.99, standard curve as shown in fig. 2:
and (3) deriving the Q5 on-machine data into an Excel table, selecting fluorescence values of the gradient 9N DEG enzyme experimental group and the control group NTC group in the 30 th cycle, calculating the average value of the gradient 9N DEG enzyme experimental group 3 data, and subtracting the average value of the NTC group 3 data to obtain a net fluorescence value. The net fluorescence value is brought into a lambda DNA standard curve, and the generated DNA quantity A1 is calculated. A1/649 gives the amount of dNTPs A2 consumed by the reaction in nmol. Finally, the activity of the 9n°enzyme was calculated by formula A2 x 0.449 x dilution.
Definition of enzyme activity: the amount of enzyme required to incorporate 10nmol dNTPs at 74℃for 30min was defined as 1U.
The measurement results are shown in Table 3 below.
TABLE 3 Table 3
Strain numbering Test 1 (U/. Mu.L) Test 2 (U/. Mu.L) Test 3 (U/. Mu.L) Average (U/. Mu.L)
1 8.5 7.2 11.6 9.1
4 0 0 0 0.0
5 18.5 24.3 22.6 21.8
6 54.9 53.6 49.8 52.8
7 10.6 12.5 13.2 12.1
8 105.6 109.5 106.3 107.1
Commercial enzyme 52.3 58.7 55.1 55.4
Note that: commercial enzyme is a thermo-terminator TM DNA polymerase(NEB)。
Results: lambda DNA concentration standard curve R 2 Higher activities of > 0.99, strain 8 and strain 6 were about 107U/. Mu.L and 53U/. Mu.L, respectively. According to the results of the batch enzyme test, when CV value is within 10%, dNTPs are consumed in an amount of 0.01-0.14nnmol, 9N ° The measurement results of each gradient interval of the enzyme are close. The enzyme activity of the invention is far higher than that of commercial enzyme (Therminator DNA polymerase).
EXAMPLE 3 recombinant 9N DNA polymerase substrate compatibility test
1. Purpose of experiment
Testing 9N DEG DNA polymerase Performance
2. Experimental materials
1) Sample: 10XReaction Buffer (NEB), 9N DNA polymerase mutants each. />
2) And (3) equipment: chemiluminescent fluorescent imaging system and gene analyzer
3) A substrate:
9N Test-A(SEQ ID NO.6)：
CGATCACGATCACGATCACGATCACGATCACGATCACGCTGATGTGCATGCTGTTGTTTTTTT ACAACAGCATGCACATCAGCGTG
9N Test-T(SEQ ID NO.7)：
CGATCACGATCACGATCACGATCACGATCACGATCACGCTGATGTGCATGCTGTTGTTTTTTT ACAACAGCATGCACATCAGCG
9N Test-G(SEQ ID NO.8)：
CGATCACGATCACGATCACGATCACGATCACGATCACGCTGATGTGCATGCTGTTGTTTTTTT ACAACAGCATGCACATCAGC
9N Test-C(SEQ ID NO.9)：
CGATCACGATCACGATCACGATCACGATCACGATCACGCTGATGTGCATGCTGTTGTTTTTTT ACAACAGCATGCACATCAG
the sequencing substrate contains A, T, G, C sequencing nucleotide substrates, wherein OH at the 3' end of the sequencing substrate is replaced by an azide group and each sequencing substrate carries a fluorescent group, wherein an A base can emit fluorescence in a red-green channel, a T base can emit fluorescence in a green channel, a C base can emit fluorescence in a red channel, and a G base cannot emit fluorescence in the red-green channel. The above 4 templates (HPLC purification, purity > 90%) were synthesized by off-site and sterile water was added to a final concentration of 100 pmol/. Mu.L of mother liquor. The solution was diluted 10-fold with sterilized water to prepare a working solution having a concentration of 10 pmol/. Mu.L.
4) Experimental materials
10 Xsequencing substrate, geneScan 600LIZ Size Standard v2.0, hiDi-Formamide deionized Formamide, 6X DNA Loading Buffer.
3. Experimental procedure
3.1 substrate compatibility test
1) Configuration of reaction Buffer
10X sequencing substrate, 10XThe Reaction Buffer and deionized water were proportioned to a substrate concentration of 1.1X Mix, 9n°enzyme: 1.1 Xmix was mixed in a 1:9 ratio with an enzyme concentration of 5U/. Mu.L.
2) Reaction system configuration (single person reaction):
the number of holes (N) required is calculated, 8 rows are added according to the number of N+3 and 9 mu L of each hole, 9N DEG Test-A/T/G/C after annealing and 1 mu L/hole are respectively added, and the mixture is centrifuged after shaking. Placing into a PCR instrument, and reacting at 60 ℃ for 4min and 95 ℃ for 10 min. The reaction product was added to 2. Mu.L of 6X DNA Loading Buffer (without dye) SDS at a final concentration of 0.1% and subjected to 15% Urea-PAGE, and the gel was subjected to red and green channel scanning by a chemiluminescent fluorescent imaging system.
4 experimental results
The test results show that the enzyme samples of the strains 1, 5 and 6 and the commercial enzyme sample are not compatible with sequencing substrates, and single base extension bands are not found at 100 bp; the strain 7 enzyme sample shows a very weak single base extension band signal at 100bp, which indicates that the mutant has lower doping efficiency. Representative electrophoresis patterns of commercial enzyme substrate compatibility tests are shown in FIG. 3. As can be seen, neither red nor green imaging revealed a single base extension band at 100bp, thus indicating that the commercial enzyme sample was not compatible with sequencing substrates.
Electrophoresis diagram of the substrate compatibility test of 9N DEG DNA polymerase sample of strain 8 is shown in FIG. 4. The red light channel is scanned to see the A template and the C template group, and obvious single base extension bands are displayed at the position of 100 bp; the green channel scan visualizes the A template and the T template set, revealing a distinct single base extension band at 100 bp. It was demonstrated that the 9n°dna polymerase mutant was compatible with sequencing substrates.
All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims (10)

1. The 9N DEG DNA polymerase mutant is characterized in that the amino acid sequence of the 9N DEG DNA polymerase mutant is shown as SEQ ID NO. 4.
2. A polynucleotide molecule encoding the 9n°dna polymerase mutant of claim 1.
3. A vector comprising the nucleic acid molecule of claim 2.
4. A host cell comprising the vector of claim 3 or a chromosome incorporating the nucleic acid molecule of claim 2.
5. The host cell of claim 4, wherein the host cell is a prokaryotic cell or a eukaryotic cell.
6. The host cell of claim 5, wherein the prokaryotic cell is an e.
7. A method of making the mutant 9n°dna polymerase of claim 1 comprising the steps of:
(i) Culturing the host cell of claim 4 under suitable conditions to express said 9n°dna polymerase mutant; and
(ii) The 9N DEG DNA polymerase mutant was isolated.
8. The method of claim 7, wherein the host cell in step (i) is an e.
9. A kit comprising the 9n°dna polymerase mutant of claim 1.
10. Use of the 9n° DNA polymerase mutant of claim 1 for the preparation of a gene sequencing kit.
CN202311527009.3A 2023-11-15 2023-11-15 Recombinant DNA polymerase for sequencing Pending CN117568304A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311527009.3A CN117568304A (en) 2023-11-15 2023-11-15 Recombinant DNA polymerase for sequencing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311527009.3A CN117568304A (en) 2023-11-15 2023-11-15 Recombinant DNA polymerase for sequencing

Publications (1)

Publication Number Publication Date
CN117568304A true CN117568304A (en) 2024-02-20

Family

ID=89885550

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311527009.3A Pending CN117568304A (en) 2023-11-15 2023-11-15 Recombinant DNA polymerase for sequencing

Country Status (1)

Country Link
CN (1) CN117568304A (en)

Similar Documents

Publication Publication Date Title
CN114945663B (en) Gao Wenni-resistant transcriptase mutant and application thereof
CN113061591B (en) Novel firefly luciferase mutant, preparation method and application thereof
CN111172129B (en) Phi29DNA polymerase mutant for improving thermal stability, amplification uniformity and amplification efficiency and application thereof
CN112175980B (en) Method for improving activity of polymerase large fragment through site-directed mutagenesis and application
CN112795546B (en) High-temperature-resistant reverse transcriptase mutant with high reverse transcription efficiency and application thereof
CN112795550B (en) High temperature resistant reverse transcriptase mutants
CN117660404A (en) Taq enzyme mutant and polynucleotide encoding same
CN112795547B (en) Reverse transcriptase mutant with high reverse transcription efficiency
CN114262697B (en) Bsu DNA polymerase and Bsu DNA polymerase mutant as well as gene, plasmid and genetic engineering bacteria thereof
CN115058398B (en) Arginine mutated nucleic acid ligase
CN114480334B (en) Reverse transcriptase mutants for detection of novel coronaviruses
CN114480329B (en) High efficiency MMLV enzyme mutants
CN114480337B (en) Reverse transcriptase mutant and reverse transcription method
CN117568304A (en) Recombinant DNA polymerase for sequencing
CN112795549B (en) Reverse transcriptase mutant
CN114480332B (en) High-temperature-resistant M-MLV enzyme mutant and application thereof
CN114480336B (en) Nucleic acid detection kit containing reverse transcriptase mutant
CN114480338B (en) Reverse transcriptase mutants for nucleic acid detection
CN114480333B (en) Reverse transcriptase mutant and application thereof
CN114480335B (en) Reverse transcriptase and reverse transcription detection reagent
CN112779238B (en) DNA polymerase mixture for hepatitis C virus detection
CN112592905B (en) DNA polymerase mixture for novel coronavirus detection
CN117511915A (en) Method for preparing formamide pyrimidine DNA glycosylase
CN112779237B (en) DNA polymerase mixture for hepatitis B virus detection
CN117821407A (en) Recombinant glucose dehydrogenase and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination