CN117554616A

CN117554616A - Application of TAP1 in tumor drug resistance

Info

Publication number: CN117554616A
Application number: CN202310637282.5A
Authority: CN
Inventors: 罗永章; 黎博雅; 付彦
Original assignee: Yantai Protgen Biotechnology Development Co ltd; Tsinghua University
Current assignee: Yantai Protgen Biotechnology Development Co ltd; Tsinghua University
Priority date: 2022-05-31
Filing date: 2023-05-31
Publication date: 2024-02-13

Abstract

Methods of predicting responsiveness of a subject with pancreatic cancer to a MEK inhibitor based on the level of TAP1 expression in a sample of the subject and uses thereof are disclosed. Also disclosed are methods and uses of using TAP1 inhibitors to increase responsiveness of a subject having pancreatic cancer to treatment with MEK inhibitors.

Description

Application of TAP1 in tumor drug resistance

Cross Reference to Related Applications

The present application claims priority from chinese patent application CN202210608041.3 filed on 5 months 31 of 2022, which is incorporated herein by reference in its entirety.

Technical Field

The present invention relates to the field of cancer diagnosis and treatment, and more particularly to methods and medicaments for diagnosing and treating pancreatic cancer that is resistant to MEK inhibitors using TAP 1.

Background

Although pancreatic cancer ranks seventh among the global causes of cancer death in 2020, it is considered to be one of the most malignant cancers, with almost equal numbers of new cases and new cases of death ^[1] And the number of cases of death increases year by year. Over several decades of effort, the 5 year survival rate of pancreatic cancer has only recently reached 10%. The average survival time of pancreatic cancer patients in China is only 17.6 months. Thus, for pancreatic cancer patients, an increase in overall survival is of great clinical importance.

There are many causes of high mortality and low survival of pancreatic cancer, two of which are important, namely the lack of suitable markers, so that 52% of pancreatic cancers are diagnosed as already in a distant metastatic advanced state; secondly, in the existing treatment scheme based on chemotherapy, drug resistance often occurs ^[2] 。

The most common type of pancreatic cancer is pancreatic ductal carcinoma (Pancreatic ductal adenocarcinoma, PDAC), where 95% of PDACs contain KRAS mutations [3], which cause the activation state of KRAS binding to GTP to accumulate, downstream signaling cascades to amplify, ultimately leading to abnormal proliferation of tumor cells. There are various strategies for the development of KRAS-targeting drugs, some targeting membrane localization of KRAS, some targeting KRAS proteins directly, where targeting the downstream signaling molecule MEK (Mitogen-activated protein kinase kinase) is a very potential development strategy.

Treatment of pancreatic cancer is typically combined with a targeting agent in addition to the first-line drug gemcitabine. MEK inhibitors (MEKs) are mainly used to treat RAS or RAF mutated tumors, but exhibit resistance in both tumor cells and clinical trials, only a fraction of patients can benefit from the treatment of MEKs. Therefore, it is urgent to study and discover the potential mechanism of MEKi resistance.

Disclosure of Invention

One aspect of the invention provides a method of predicting responsiveness of a subject having pancreatic cancer to a MEK inhibitor comprising: (a) Detecting TAP1 expression levels in a sample from the subject; and (b) predicting responsiveness of the subject to a MEK inhibitor based on the TAP1 expression level.

In some embodiments, the TAP1 expression level is a TAP1 protein expression level or a TAP1 mRNA expression level.

In some embodiments, the sample comprises pancreatic cancer cells.

In some embodiments, the pancreatic cancer has a KRAS mutation.

In some embodiments, the KRAS is mutated to G12D or G12R.

In some embodiments, the MEK inhibitor is trametinib or semetinib.

In some embodiments, step (b) comprises: if the TAP1 expression level is greater than the reference TAP1 expression level, the subject is identified as unlikely to respond to a MEK inhibitor; if the TAP1 expression level is below the reference TAP1 expression level, the subject is identified as likely to respond to a MEK inhibitor.

Another aspect of the invention provides a method of treating pancreatic cancer in a subject comprising: (a) Detecting TAP1 expression levels in a sample from the subject; (b) Selecting whether to administer a therapeutically effective amount of a MEK inhibitor to the subject based on the TAP1 expression level.

In some embodiments, the sample comprises pancreatic cancer cells.

In some embodiments, the pancreatic cancer has a KRAS mutation.

In some embodiments, the KRAS is mutated to G12D or G12R.

In some embodiments, the MEK inhibitor is trametinib or semetinib.

In some embodiments, step (b) comprises: administering to the subject an additional pancreatic cancer therapy that does not include a MEK inhibitor, or administering to the subject a therapeutically effective amount of a TAP1 inhibitor and a MEK inhibitor if the TAP1 expression level is greater than the reference TAP1 expression level; administering to the subject a therapeutically effective amount of a MEK inhibitor if the TAP1 expression level is below a reference TAP1 expression level.

Another aspect of the invention provides a method of treating pancreatic cancer in a subject, comprising administering to the subject a therapeutically effective amount of a MEK inhibitor, wherein the subject has been identified as having a TAP1 expression level in a sample from the subject that is lower than a reference TAP1 expression level.

In some embodiments, the sample comprises pancreatic cancer cells.

In some embodiments, the pancreatic cancer has a KRAS mutation.

In some embodiments, the KRAS is mutated to G12D or G12R.

In some embodiments, the MEK inhibitor is trametinib or semetinib.

Another aspect of the invention provides a method of treating pancreatic cancer in a subject comprising administering to the subject a therapeutically effective amount of a TAP1 inhibitor and a MEK inhibitor.

Another aspect of the invention provides a method of increasing responsiveness of a subject having pancreatic cancer to treatment with a MEK inhibitor comprising administering a therapeutically effective amount of a TAP1 inhibitor to a subject receiving treatment with a MEK inhibitor.

In some embodiments, the pancreatic cancer has a KRAS mutation.

In some embodiments, the KRAS is mutated to G12D or G12R.

In some embodiments, the pancreatic cancer is resistant to a MEK inhibitor without administration of a TAP1 inhibitor.

In some embodiments, the MEK inhibitor is trametinib or semetinib.

In some embodiments, the TAP1 inhibitor is shRNA; preferably, the sequence of the shRNA is shown as SEQ ID NO. 1.

Another aspect of the invention provides a combination comprising a TAP1 inhibitor and a MEK inhibitor.

Another aspect of the invention provides a kit comprising reagents for detecting TAP1 expression levels and a MEK inhibitor.

In some embodiments, the MEK inhibitor is trametinib or semetinib.

Another aspect of the invention provides a method of predicting the outcome of a pancreatic cancer disease in a subject, comprising detecting (a) the level of TAP1 expression in a sample from the subject; and (b) predicting pancreatic cancer disease outcome of the subject based on the TAP1 expression level.

In some embodiments, the sample comprises pancreatic cancer cells.

In some embodiments, the pancreatic cancer has a KRAS mutation.

In some embodiments, the KRAS is mutated to G12D or G12R.

In some embodiments, step (b) comprises: predicting the presence of an adverse disease outcome if the TAP1 expression level is higher than a reference TAP1 expression level; if the TAP1 expression level is lower than the reference TAP1 expression level, good disease outcome is predicted.

In some embodiments, the adverse disease outcome refers to a reduction in overall survival as compared to a subject having a TAP1 expression level below a reference TAP1 expression level; the adverse disease outcome refers to an increase in overall survival compared to subjects with TAP1 expression levels above the reference TAP1 expression level.

Another aspect of the invention provides the use of an agent for detecting the level of TAP1 expression in a sample from a subject in the manufacture of a medicament for use in a method of any one of the preceding claims.

Another aspect of the invention provides the use of a combination of an agent for detecting TAP1 expression levels in a sample from a subject and a MEK inhibitor in the manufacture of a medicament for use in a method of any one of the preceding claims.

Another aspect of the invention provides the use of a MEK inhibitor in the manufacture of a medicament for use in a method according to any one of the preceding claims.

Another aspect of the invention provides a pharmaceutical combination of a TAP1 inhibitor and a MEK inhibitor or the use of a TAP1 inhibitor in the manufacture of a medicament for use in a method of any one of the preceding claims.

Drawings

FIG. 1 shows half-Inhibitory Concentrations (IC) of trametinib (A) and semetinib (B) in four cells ₅₀ ). Error bars represent SEM.

FIG. 2 shows the mRNA expression level (A) and the protein expression level (B) of TAP1 obtained by immunoblotting hybridization experiments in four pancreatic cancer cell lines of PANC-1, SW1990, asPC-1 and PSN-1.

FIG. 3 shows the relationship between the total survival (%) of pancreatic cancer patients derived from TCGA and the mRNA expression level of TAP1 in the patients. Wherein the abscissa is the total survival time (month) and the ordinate is the percentage of patients that remain alive for the corresponding survival time _。 Patients with TAP1 hypoexpression (z-score)<-0.5), 56 patient samples, pancreatic cancer patients with high TAP1 expression (z-score>-0.5), the number of patient samples 122.

FIG. 4 shows that TAP1 protein levels in pancreatic cancer patient samples are positively correlated with pancreatic cancer malignancy.

FIG. 5 shows half-maximal inhibitory concentrations (IC 50) of trametinib in TAP1 knockdown cells (SW 1990-shTAP 1) and control cells (SW 1990-GFP). * P <0.01, ns, no significant difference. Error bars represent SEM.

FIG. 6 shows the results of cell colony formation numbers of TAP1 knockdown cells (SW 1990-shTAP 1) and control cells (SW 1990-GFP) after 12 days of treatment with different concentrations of trimetinib (trametinib). * P <0.05, < P <0.001. Error bars represent SEM.

FIG. 7 shows the level of apoptosis of TAP1 knockdown cells (SW 1990-shTAP 1) and control cells (SW 1990-GFP) after 72 hours of treatment with different concentrations of trimetinib (trametinib). * P <0.001, ns, no significant difference. Error bars represent SEM.

Fig. 8: a shows volume data for SW1990-GFP and SW1990-shTAP1 tumors at each respective time point under each group of treatments. SW 1990-gfp+veccle, n=8; SW1990-gfp+tametinib, n=8; SW1990-shTAP1+ vector, n=7; SW1990-shTAP1+ Trametinib, n=7. * P <0.01, ns, no significant difference. Error bars represent SEM. Each dot shown in B represents a tumor tissue derived from a mouse. Tumor weight at the end of the experiment after 24 days of treatment with control conditions indicated at trimetinib (1 mg/kg) or vehicle. * P <0.01, ns, no significant difference. Error bars represent SEM.

Detailed Description

Unless otherwise indicated, the terms used in the present invention have meanings commonly understood in the art, and can be understood by referring to standard textbooks, reference books, and documents known to those skilled in the art. All publications mentioned herein are incorporated by reference in their entirety.

It is to be understood that the specific methods and materials described in the embodiments of the invention are for the purpose of describing the embodiments only and are not intended to be limiting, as any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention. The explanation of the theory or mechanism involved in the present invention is only for aiding in understanding the present invention and should not be construed as limiting the scheme to be protected by the present invention.

The recitation of numerical ranges herein, such as temperature ranges, time ranges, composition or concentration ranges, or other ranges of values, etc., includes the endpoints of the range, all intermediate ranges, sub-ranges (e.g., ranges between some intermediate value and some endpoint), and all individual values, particularly intermediate ranges, sub-ranges, and individual integer values, of the integer value. Also, any intervening ranges, subranges, and any individual value described in that numerical range may be excluded from the numerical range.

The present invention is based at least on the discovery that TAP1 can be used as a biomarker to indicate the disease outcome of pancreatic cancer, or to indicate the sensitivity of pancreatic cancer cells or pancreatic cancer patients to MEK inhibitors. In pancreatic cancer cells, particularly those with KRAS mutations, TAP1 expression levels correlate with resistance of the pancreatic cancer cells to MEK inhibitors, with higher TAP1 expression levels exhibiting greater resistance to MEK inhibitors and lower TAP1 expression levels, the pancreatic cancer cells being more sensitive to MEK inhibitors. This finding has application in the diagnosis and treatment of pancreatic cancer, particularly pancreatic cancer with KRAS mutations, for example, by detecting the TAP1 expression levels of pancreatic cancer cells to predict responsiveness of a pancreatic cancer patient to a MEK inhibitor, i.e., whether it will benefit from MEK inhibitor treatment or will be resistant to a MEK inhibitor agent, and based on the prediction, individual treatment regimens may be selected for the patient, for example, treatment of patients with lower TAP1 expression levels with a MEK inhibitor, and replacement of patients with higher TAP1 protein expression levels with other treatment regimens, or combination of a TAP1 inhibitor with a MEK inhibitor.

In another aspect, the invention is based on the discovery that the level of TAP1 expression in pancreatic cancer cells correlates with the disease outcome, e.g., survival status, overall survival, etc., of a pancreatic cancer patient, the higher the level of TAP1 expression, the worse the prognosis of the pancreatic cancer patient, the shorter the overall survival, the lower the level of TAP1 expression, the better the prognosis of the pancreatic cancer patient, and the longer the overall survival. Based on this finding, the disease outcome in pancreatic cancer patients can be predicted based on TAP1 expression levels.

In another aspect, the invention is based on the discovery that: inhibition or reduction of TAP1 expression may increase the sensitivity of pancreatic cancer cells, particularly pancreatic cancer cells with KRAS mutations, to MEK inhibitors. Based on this finding, effective treatment of pancreatic cancer, particularly pancreatic cancer having KRAS mutations, may be achieved more accurately, for example, TAP1 inhibitors may be combined with MEK inhibitors to increase the sensitivity of pancreatic cancer patients, particularly those exhibiting resistance to MEK inhibitors, to MEK inhibitors.

I. Definition of terms

The term "comprising" or other term form "including", "containing" or "having" etc. as used herein, having a similar meaning, is to be understood as including the listed elements but not excluding the presence of other elements. These terms also include cases where they consist only of the listed elements. The term "consisting of" means consisting of only the recited elements. The term "consisting essentially of … …" means that elements that do not have a significant effect on the scheme involved are not excluded.

"A," "an," or "the" as used herein includes both singular and plural forms unless specifically stated otherwise. The terms "at least one" or other similar expressions have the meaning as is equivalent to "one or more" or "one or more".

As used herein, "about" means within + -10% of the stated value.

The term "and/or" as used herein is understood to mean any one or combination of any of a plurality of elements connected by the term.

The term "pancreatic cancer" as used herein refers to malignant tumors of the pancreas, 90% of which are Pancreatic Ductal Adenocarcinoma (PDAC). Other examples of pancreatic cancer include neuroendocrine tumors, acinar cell tumors, and the like. In some embodiments, the "pancreatic cancer" described herein includes Pancreatic Ductal Adenocarcinoma (PDAC).

The term "TAP1" as used herein refers to antigen processing related transporter 1 (Transporter associated with antigen processing 1), also known as ABCB2, belonging to the family of ATP-binding cassette transporters (ATP-binding cassette transporter family). The human TAP1 protein is encoded by the TAP1 gene.

The term "TAP1 inhibitor" as used herein refers to a substance that can reduce the level of TAP1 expression, e.g., reduce the mRNA level or protein level of TAP1, wherein the level of TAP1 expression in a sample from a subject is reduced, e.g., by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% or about 90%, after administration of the TAP1 inhibitor to the subject relative to when no TAP1 inhibitor is administered.

The term "MEK inhibitor (MEKi)" as used herein refers to a chemical or drug that inhibits the mitogen-activated protein kinase MEK1 and/or MEK 2. They can be used to affect the MAPK/ERK pathway that is often overactive in some cancers. MEK inhibitors have been described in several review articles (s.price, putative Allosteric

MEK1and MEK 2inhibitors,Expert Opin.Ther.Patents,2008,18(6):603；J.I.Trujillo,

MEK Inhibitors: a patent review 2008-2010,Expert Opin.Ther.Patents 2011,21 (7): 1045). MEK inhibitors include, but are not limited to: trametinib (GSK 1120212), semetinib, RO5068760, MEK162, PD-325901, coumetinib (cobimeinib) or XL518 and CI-1040 or PD035901.

The term "KRAS mutation" as used herein includes any one or more mutations in the KRAS (which may also be referred to as KRAS2 or RASK 2) gene. KRAS mutations can cause uncontrolled proliferation and malignant changes in cells, and are common oncogenes in human tumors. Non-limiting examples of human KRAS gene mRNA sequences include Genbank accession nos. nm004985 and NM033360.KRAS mutations often occur at codons 12, 13, 61 or 143 of the human KRAS gene.

The term "sample" or "biological sample" as used herein refers to a substance from a source of interest, such as from a subject (e.g., a subject with pancreatic cancer). In some embodiments, the biological sample is or includes biological tissue or fluid.

In some embodiments, the biological sample may be or include bone marrow, blood cells, ascites, tissue or fine needle biopsy samples, cell-containing body fluids, free nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, stool, lymph, gynecological fluid, skin swab, vaginal swab, oral swab, nasal swab, wash or lavage (e.g., catheter lavage or bronchoalveolar lavage), aspirate, scrape, bone marrow sample, tissue biopsy sample, surgical sample, other body fluids, secretions and/or excretions, cells obtained therefrom, and the like. In some embodiments, the biological sample is or includes tissue or cells obtained from a source of interest, such as a subject (e.g., a subject with pancreatic cancer), such as pancreatic cancer tissue or pancreatic cancer cells, which may be from, for example, biopsy or surgically obtained pancreatic cancer tissue or circulating tumor cells obtained from peripheral blood. In some embodiments, the sample is a "primary sample" obtained directly or a "processed sample" obtained by processing the primary sample. For example, in some embodiments, a primary biological sample may be obtained by: biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, body fluid collection (e.g., blood, lymph, stool, etc.), and the like. In some embodiments, a "processed sample" may include, for example, specific cells isolated from the sample, extracted nucleic acids or proteins, or nucleic acids or proteins obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, and the like.

The term "disease" as used herein is used interchangeably with "disorder" and refers to an abnormal state of the human or animal body or portion thereof that impairs normal function, may manifest as specific symptoms and signs, and may degrade the life or quality of life of the human or animal. "disease" as used herein includes a particular subtype or class of disease, such as a subtype characterized or classified by histopathological criteria, or by molecular characteristics (e.g., by expression of one or a combination of particular genes or proteins encoded by the genes), or by resistance to a particular drug or therapy. Diseases with different classifications or different subtypes may be considered as different diseases in the present invention. In the present invention, the disease refers specifically to pancreatic cancer, in particular pancreatic cancer with KRAS mutations. Pancreatic cancer according to the present invention may be a subtype that is resistant to a MEK inhibitor or a subtype that is not resistant to a MEK inhibitor.

The term "treatment" as used herein refers to providing a beneficial or desired clinical outcome for a disease, such as eliminating the disease, alleviating symptoms, reducing the extent of the disease, stabilizing, ameliorating or alleviating the state of the disease, or slowing the progression of the disease. The measurement of the therapeutic results may be based on, for example, the results of physical examination, pathology tests, and/or diagnostic tests known in the art. Treatment may also refer to an increase in survival compared to the expected survival when the subject is not receiving treatment. Treatment may also refer to reducing the incidence or incidence of a disease, or recurrence thereof, as compared to a disease that would occur without such measures. Clinically, such treatment may also be referred to as prophylaxis. Subjects in need of treatment include those already with an undesired physiological change or disease, as well as those prone to the physiological change or disease. Parameters for assessing successful treatment and amelioration of a disease are readily measured by routine procedures well known to practitioners of corresponding skill in the art.

The term "diagnosis" as used herein refers to the identification or classification of a molecular or pathological state, disease or disorder, including determining a subject's susceptibility to a certain disease or disorder, determining whether a subject has a certain disease or disorder, determining a prognosis of a subject with a certain disease or disorder (e.g., identifying a pre-metastatic state or a metastatic state of cancer, determining the stage of cancer, or the response of cancer to treatment). For example, a "diagnosis" may be the identification of a particular type of disease. "diagnosis" may also refer to the classification of a particular subtype of a disease, for example by histopathological criteria, or by molecular characteristics (e.g., subtypes characterized by expression of one or a combination of particular genes or proteins encoded by the genes), or by the classification of resistance to a particular drug or therapy.

The term "marker" or "biomarker" as used herein refers to a marker that allows for the differentiation between normal and disease states, or enables the outcome of a treatment to be predicted or objectively measured. In particular, in the context of pancreatic cancer, a marker may refer to an organic biomolecule whose protein or gene expression level is significantly increased or decreased in a subject suffering from or at risk of developing pancreatic cancer compared to a normal control (subject not suffering from pancreatic cancer); or an organic biomolecule whose protein or gene expression level is significantly increased or decreased in a subject having pancreatic cancer that is resistant or more sensitive to a particular therapeutic agent, such as a MEK inhibitor, compared to a control (a subject having pancreatic cancer that is not resistant or less sensitive to a particular therapeutic agent, such as a MEK inhibitor). The organic biological molecule that can be used as a marker may be, for example, a polypeptide or a nucleic acid (e.g., mRNA, etc.), a lipid, a glycolipid, a glycoprotein, a sugar (monosaccharide, disaccharide, oligosaccharide, etc.), or the like.

The terms "predicting," "assessing," or "identifying" as used herein refer to assessing the likelihood that a subject will respond favorably or unfavorably to a drug (therapeutic agent) or combination of drugs or treatment regimen, or assessing the prognosis of a subject. In one embodiment, the prediction relates to the extent of these responses or to different conditions of prognosis. In some embodiments, the prediction relates to whether the patient will survive or improve and/or the likelihood of survival or improvement, or for a period of time without disease recurrence, following treatment (e.g., treatment with a particular therapeutic agent). In some embodiments, the prediction also relates to how the patient's survival or overall survival is after treatment.

The terms "subject" and "patient" as used herein are used interchangeably herein to refer to any organism to which a drug or agent of the invention may be administered, e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates such as chimpanzees and other apes, and humans). The subject may be a mammal, particularly a human, including a female (female) or male (male), and includes newborns, infants, juveniles, young adults, or elderly, and further includes various ethnicities and nationalities. In some examples, a subject refers to an individual in need of diagnosis, treatment, or prevention of a disease or disorder, who may have, or is at risk of having, the disease or disorder.

The term "benefit from" as used herein may refer to an improvement in one or more of overall survival, progression free survival, partial Response (PR), complete Response (CR), and may also include a reduction in tumor growth or size, a reduction in severity of disease symptoms, an increase in frequency and duration of disease free symptoms, or prevention of injury or disability due to disease affliction. "benefit from" includes having a beneficial response to a therapeutic agent.

The term "total lifetime" as used herein refers to the length of time from the date of diagnosis or from the beginning of treatment of a disease (e.g., cancer) to death for any reason. Subjects still alive at the time of analysis will be on the expiration date of the date they last contacted. The term "progression-free survival" as used herein refers to the length of time from the date of diagnosis or treatment starting from the disease (e.g., cancer) to the first described disease progression or death without disease progression. The term "complete response" or "CR" as used herein refers to the absence of a clinically detectable disease. "partial response" or "PR" refers to a decrease in the load of all measurable disease (e.g., tumor) in the absence of a new lesion (i.e., the number of disease cells present in a subject, or the measured volume of tumor tissue) of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

The term "response" or "responsiveness" as used herein may also be referred to as "sensitivity" or "sensitivity" when used in connection with a treatment or therapy, referring to the effectiveness of the treatment or therapy in alleviating a disease or alleviating a symptom. In some embodiments, the effectiveness may include any one or more of the following: extension of survival (including overall survival and progression-free survival); resulting in an objective response (including a complete response or a partial response); or to improve signs or symptoms of cancer. By "extending survival" is meant extending the overall survival or progression free survival of a subject receiving a particular treatment relative to a subject not receiving the treatment, or relative to a subject not expressing a biomarker at a specified level, and/or relative to a subject treated with another drug. Objective response refers to a measurable response, including a Complete Response (CR) or a Partial Response (PR).

Responsiveness may be assessed by any endpoint that is beneficial to the subject, including, but not limited to: (1) Inhibiting disease progression to some extent, including slowing and complete arrest; (2) Alleviating one or more symptoms of the disease, such as reducing the number, frequency, and/or intensity; (3) reducing lesion (e.g., tumor) size; (4) Inhibit (i.e., reduce, slow or completely terminate) disease spread or metastasis; (5) Stabilizing the disease, e.g., preventing or delaying deterioration that would be expected or normally observed to occur in the absence of treatment; (6) Prolonged survival (including overall survival and progression free survival); (7) mortality decreased at a given time point after treatment. Those skilled in the art will appreciate that enhancement or improvement of response may refer to an improvement in the effect of any of the aspects described above.

The term "response" as used herein may also refer to the response of an organism, organ, tissue (e.g., pancreatic cancer tissue), cell (e.g., pancreatic cancer cells), or cellular component or in vitro system. In some embodiments, the response is or includes a clinical response. In some embodiments, the presence, extent, and/or nature of the response may be measured and/or characterized according to certain criteria; in some embodiments, such criteria may include clinical criteria and/or objective criteria. In some embodiments, techniques for assessing response may include, but are not limited to, clinical examination, positron emission tomography, chest X-ray CT scanning, MRI, ultrasound, endoscopy, laparoscopy, the presence or level of a specific marker in a sample, cytology, and/or histology. When the response of interest is or includes a tumor response to a therapy, those of ordinary skill in the art will recognize that a variety of known techniques may be used to evaluate such responses, including, for example, determining tumor burden, tumor size, tumor stage, and the like. For example, certain techniques for assessing the response of a solid tumor to treatment are discussed in Therasse et al, "New guidelines to evaluate the response to treatment in solid tumors", european Organization for Research and Treatment of Cancer, national Cancer Institute of the United States, national Cancer Institute of Canada, J.Natl.cancer Inst, 2000,92 (3): 205-216. One of ordinary skill in the art will recognize and/or will understand, in light of the present disclosure, the particular response criteria for determining an individual tumor, tumor type, patient population or group, etc., and the strategies for determining appropriate references thereto.

The term "likelihood" as used herein refers to the probability of an event. The subject being "likely" to respond to a particular treatment when a condition is met means that the probability of the subject responding to a particular treatment is higher when the condition is met than when the condition is not met. For example, in subjects meeting a particular condition, the probability of responding to the particular treatment is 5%, 10%, 25%, 50%, 100%, 200% or more higher than subjects not meeting the condition. For example, when the level of TAP1 expression in a sample from a subject with pancreatic cancer is below a reference TAP1 expression level, the subject is "likely" to respond to treatment with a MEK inhibitor, and in subjects with TAP1 expression levels below the reference TAP1 expression level, the probability of the subject responding to treatment with a MKE inhibitor is 5%, 10%, 25%, 50%, 100%, 200% or more higher than in subjects with TAP1 expression levels above the reference TAP1 expression level.

The term "expression level" as used herein refers to the amount of a polynucleotide (e.g., mRNA) or protein in a biological sample. "expression" generally refers to the process by which information encoded by a gene is converted into a structure that is present and operational in a cell. Thus, as used herein, "expression" of a gene may refer to transcription into a polynucleotide, translation into a protein, or even post-translational modification of a protein. Transcribed polynucleotides, translated proteins, or fragments of post-translationally modified proteins are also considered to be expressed, whether they originate from transcripts generated by alternative splicing or degraded transcripts, or from post-translational processing of proteins (e.g., proteolysis). "expressed genes" include genes that are transcribed into polynucleotides (e.g., mRNA) and then translated into protein, as well as genes that are transcribed into RNA but not translated into protein (e.g., transfer RNA or ribosomal RNA).

The term "reference expression level" or "threshold" as used herein may be a predetermined target (e.g., TAP1 mRNA or protein) expression level for determining a high or low level of expression of a particular target (e.g., TAP1 mRNA or protein) in a sample from a subject. The reference expression level may be a threshold determined by one of ordinary skill in the art by statistical analysis of the expression level of the target in the sample population and the responsiveness of the individual in the sample population to the treatment or therapy. For example, by analyzing the expression levels of TAP1 in individuals of a sample population and the responsiveness of those individuals to MEKi treatment, one of ordinary skill in the art can determine a reference TAP1 expression level as a threshold, wherein if the subject's TAP1 expression level is below the reference expression level, the subject is likely to respond to MEKi treatment.

The term "drug resistance" as used herein means that a subject or disease is totally unresponsive or exhibits a reduced or delayed response to a particular drug or therapy.

The term "antibody" as used herein refers to a molecule comprising one or more antigen domains that specifically bind to an antigen, including full length antibodies, such as immunoglobulins, or antigen binding fragments thereof, such as Fab, F (ab') ₂ Fab' fragments, and the like, and also include single chain antibodies and single domain antibodies.

The term "specifically binds" as used herein means that two molecules that bind form a complex that is relatively stable under physiological conditions, and preferably does not exhibit significant binding to other undesirable molecules. A molecule may target, or specifically bind to more than one molecule. Specific binding can be characterized by the equilibrium dissociation constant KD of two molecule binding (smaller KD indicates tighter binding) or by EC of two molecules ₅₀ Values are used for characterization. Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

The term "ligand" as used herein refers to any molecule capable of binding a target protein, such as the TAP1 protein described herein, with a higher affinity.

The term "aptamer" as used herein refers to a nucleic acid that has specific binding affinity for a target molecule, such as a protein, polynucleotide, or small molecule (e.g., a metabolite).

The term "highly stringent conditions" as used herein means conditions that permit hybridization between or within one or more nucleic acid strands containing complementary sequences, but exclude hybridization of random sequences. Very little high stringency conditions allow for mismatches between the nucleic acid and the target strand. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, john Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.

The term "gene expression inhibitor" as used herein refers to an inhibitory molecule that can inhibit the expression of a target gene by, for example, inhibiting the production of mRNA or degrading mRNA such that the gene does not express mRNA or a protein encoded by the gene, or by reducing the amount of mRNA or protein expressed relative to the case where the inhibitor is not used, for example, by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. The "gene expression inhibitor" may be a molecule that inhibits the expression of a target gene by antisense inhibition or RNAi, for example, an inhibitory RNA molecule, and examples thereof include antisense RNA, siRNA, shRNA and miRNA. It will be appreciated that the gene expression inhibitor may also be other forms of inhibitor, such as dominant negative mutants of the gene of interest, etc. In the present invention, the gene expression inhibitor may be a gene having a specific inhibitory effect on a target gene. "specifically inhibit" generally means that the inhibitor inhibits the target gene without inhibiting or substantially inhibiting other genes.

The term "RNAi" as used herein refers to RNA interference, i.e., a nucleic acid molecule-mediated biological process that inhibits or down-regulates gene expression in a cell.

The term "shRNA" as used herein refers to a double-stranded structure formed from self-complementary RNA single strands. shRNA constructs containing a nucleotide sequence identical to a coding sequence or a portion of a non-coding sequence of a target gene can be used to inhibit expression of the target gene. When shRNA is expressed in cells, it is processed through a series of steps into small interfering RNAs (sirnas) for directing gene silencing. The shRNA may have a length of about 50-100 bp. The double-stranded forming portion of the shRNA may be at least 20, 21, or 22 nucleotides in length.

The term "siRNA" as used herein refers to small inhibitory RNA duplex (typically between 17-30 base pairs, but also longer base pairs, e.g. 31-50 bp) that induce an RNA interference (RNAi) pathway.

The term "antisense RNA" as used herein refers to RNA transcripts complementary to all or part of a target mRNA that can block expression of the target gene by interfering with mRNA processing, transport and/or translation. Antisense RNA can be complementary to any portion of the target mRNA, including 5 'non-coding sequences, 3' non-coding sequences, introns, and coding sequences.

The term "miRNA" as used herein refers to a single-stranded RNA molecule (or synthetic derivative thereof) that is capable of binding to a target gene (mRNA or DNA) and regulating the expression of that gene.

The term "vector" as used herein refers generally to an expression vector, which can be used to express a gene of interest, in the present invention. In a preferred embodiment, the vector is a non-integrative vector, i.e. will not be integrated into the genome of the cell into which it is transfected. Non-integrative vectors are well known to those skilled in the art, such as, but not limited to, plasmids, non-integrative recombinant viral vectors (e.g., non-integrative adenovirus vectors or adeno-associated virus vectors, etc.). The expression vector typically includes a gene of interest to be expressed and regulatory sequences operably linked to the gene of interest, such as promoters, enhancers, post-transcriptional regulatory sequences, and the like.

The terms "combination drug" and "pharmaceutical combination" as used herein are used interchangeably and refer to a combination of two or more active ingredients administered simultaneously or sequentially (either as the respective active ingredients themselves or as derivatives, prodrugs or compositions of their respective pharmaceutically acceptable salts or esters). The two or more active agents in combination may be administered to the subject simultaneously or sequentially. In some embodiments, when administration of the second drug or therapy begins, administration of one drug or therapy is still ongoing, thus there is an overlap in administration. Such a scheme may be referred to herein as "simultaneous". When administered simultaneously, two or more drugs and/or therapies may be formulated together in a single dosage form, or separately in two or more separate dosage forms. When administered sequentially, two or more drugs and/or methods of treatment may be administered minutes apart, hours apart, or days apart.

The terms "therapeutically effective amount" and "effective amount" as used herein are used interchangeably to refer to an amount effective over the necessary dosage and period of time to achieve the desired therapeutic effect. The therapeutically effective amount can vary depending on various factors such as the disease state, age, sex and weight of the individual, and the ability of a therapeutic method or combination of therapeutic methods to elicit a desired response in the individual. An "effective amount" may refer to an amount that causes a detectable change in biological or chemical activity. The detectable change may be detected and/or further quantified by one skilled in the relevant arts. In addition, an "effective amount" may also specify an amount that maintains the desired physiological state, i.e., reduces or prevents significant decline and/or promotes improvement in conditions. The exact effective amount will depend on the purpose of the treatment and can be determined by one skilled in the art using well known techniques (see, e.g., lloyd V.Allen,2020,The Art,Science and Technology of Pharmaceutical Compounding,6 ^th Edition)。

The term "pharmaceutically acceptable carrier" as used herein refers to any carrier that is included as an inactive ingredient in a pharmaceutical composition that gives the pharmaceutical composition an appearance and characteristics suitable for administration. Pharmaceutically acceptable carriers are substantially free of long-term or permanent adverse effects such as stabilizers, diluents, additives, adjuvants, excipients, and the like, when administered to a subject. A "pharmaceutically acceptable carrier" shall be a pharmaceutically inert material, essentially devoid of biological activity, and constitute a major part of the formulation.

Assay and diagnostic methods

The present invention provides methods and assays for identifying subjects with pancreatic cancer who may benefit from treatment with a MEK inhibitor. In the present invention, when referring to treatment with a MEK inhibitor or administration of a MEK inhibitor to a subject, the use of a combination with radiation therapy, immunotherapy or other chemotherapeutic agent is not precluded. In some embodiments, however, reference to treatment with a MEK inhibitor or administration of a MEK inhibitor to a subject does not include use in combination with a TAP1 inhibitor.

The assays described herein are used to measure TAP1 expression levels in a sample from a subject.

The methods and assays described herein can predict the efficacy of a MEK inhibitor in treating pancreatic cancer based on the level of expression of TAP1 in a sample from a subject. The methods and assays described herein include measuring the level of TAP1 expression in a sample of a subject having pancreatic cancer and predicting the responsiveness of the subject to a MEK inhibitor based on the TAP1 expression level; or predicting whether the subject is likely to respond to (or is sensitive to) a MEK inhibitor.

If the TAP1 expression level is greater than the reference TAP1 expression level, the subject may be identified as having a weak response to treatment with the MEK inhibitor, no response to treatment with the MEK inhibitor, or a low likelihood of response; if the TAP1 expression level is less than the reference TAP1 expression level, the subject is identified as responding more strongly to MEK inhibitor treatment, responding to MEK inhibitor treatment, or has a high likelihood of responding. Specific identification decisions may vary depending on the selection of reference TAP1 expression levels. In particular, a subject with a TAP1 expression level below the reference TAP1 expression level will respond to a MEK inhibitor more than a subject with a TAP1 expression level above the reference TAP1 expression level, or a subject with a TAP1 expression level below the reference TAP1 expression level will respond to a MEK inhibitor more than a subject with a TAP1 expression level above the reference TAP1 expression level; in other words, a subject with a higher level of TAP1 expression than the reference TAP1 expression level will respond to a MEK inhibitor less than a subject with a lower level of TAP1 expression than the reference TAP1 expression level, or a subject with a higher level of TAP1 expression than the reference TAP1 expression level will respond to a MEK inhibitor less likely than a subject with a lower level of TAP1 expression than the reference TAP1 expression level.

The methods and assays described herein can also identify, based on the level of TAP1 expression in pancreatic cancer cells (e.g., isolated, in vitro pancreatic cancer cells), a cell that predicts responsiveness of the pancreatic cancer cells to a MEK inhibitor, or whether the pancreatic cancer cells are likely to respond to a MEK inhibitor.

Also provided herein are methods of identifying a subject having pancreatic cancer who may benefit from treatment with a MEK inhibitor, or identifying a pancreatic cancer candidate for treatment with a MEK inhibitor, based on the level of expression of TAP1 in a sample from the subject. In particular, subjects with TAP1 expression levels below the reference TAP1 expression level will be more likely to benefit from a MEK inhibitor than subjects with TAP1 expression levels above the reference TAP1 expression level; in other words, a subject with a higher level of TAP1 expression than the reference TAP1 protein will be less likely to benefit from a MEK inhibitor than a subject with a lower level of TAP1 expression than the reference TAP1 expression. In some embodiments, if the TAP1 expression level is higher than the reference TAP1 expression level, the subject is identified as having a low likelihood of benefiting from or being able to benefit from a MEK inhibitor, and should not be a candidate for a MEK inhibitor therapy, at which time the subject may be replaced with another pancreatic cancer therapy that does not use a MEK inhibitor, or a TAP1 inhibitor in combination with a MEK inhibitor to treat pancreatic cancer in the subject, as described herein; if the TAP1 expression level is lower than the reference TAP1 expression level, the subject is identified as having a high likelihood of benefiting from or would benefit from a MEK inhibitor, and may be a candidate for MEK inhibitor therapy.

Also provided herein are methods of identifying a subtype of pancreatic cancer suffered by a subject based on the expression level of TAP1 in a sample from the subject. In particular, if the TAP1 expression level is greater than a reference TAP1 expression level, the subject has pancreatic cancer identified as a subtype of pancreatic cancer that is resistant (or resistant) to a MEK inhibitor, and the subject is identified as resistant to a MEK inhibitor; if the level of TAP1 expression is less than the reference level of TAP1 expression, the subject has pancreatic cancer that is identified as a subtype of pancreatic cancer that is not resistant (or not resistant) to the MEK inhibitor, and the subject is identified as not resistant to the MEK inhibitor.

Also provided herein are methods of selecting an individual therapy for a subject with pancreatic cancer based on the level of expression of TAP1 in a sample from the subject. Specifically, if the TAP1 expression level is greater than a reference TAP1 expression level, administering to the subject a pancreatic cancer therapy that does not include a MEK inhibitor, or administering to the subject a TAP1 inhibitor and a MEK inhibitor, as described herein; administering a MEK inhibitor to the subject if the TAP1 expression level is below a reference TAP1 expression level.

Also provided herein are methods of predicting the outcome of a pancreatic cancer disease in a subject based on the expression level of TAP1 in a sample from the subject. Specifically, if the subject's TAP1 expression level is greater than the reference TAP1 expression level, predicting that the subject's disease outcome is worse than a subject whose TAP1 gene expression level is less than the reference expression level; if the TAP1 expression level is below the reference TAP1 expression level, the disease outcome of the subject is predicted to be better than a subject having a TAP1 gene expression level above the reference expression level. Still further, the disease outcome may be selected from survival and overall survival. In some embodiments, the adverse disease outcome refers to a reduction in overall survival compared to a subject having a TAP1 gene expression level below a reference expression level; the favorable disease outcome refers to an increase in overall survival compared to subjects with TAP1 gene expression levels above the reference expression level.

In some embodiments, a medical use regimen based on the above regimen is also provided. In some embodiments, the invention also provides an agent for detecting TAP1 expression levels for use in predicting responsiveness of a subject with pancreatic cancer to a MEK inhibitor, or predicting whether the subject is likely to respond to a MEK inhibitor. In some embodiments, the invention also provides reagents for detecting TAP1 expression levels for predicting responsiveness of a pancreatic cancer cell to a MEK inhibitor, or predicting whether the pancreatic cancer cell is likely to respond to a MEK inhibitor. In some embodiments, the invention also provides an agent for detecting TAP1 expression levels for identifying a subject having pancreatic cancer who may benefit from treatment with a MEK inhibitor, or for identifying a pancreatic cancer candidate that may be treated with a MEK inhibitor. In some embodiments, the invention also provides an agent for detecting TAP1 expression levels for use in identifying a subtype of pancreatic cancer in a subject, e.g., identifying whether the pancreatic cancer in a subject is a subtype that is resistant to a MEK inhibitor. In some embodiments, the invention also provides an agent for detecting TAP1 expression levels for use in selecting an individual therapy for a subject with pancreatic cancer. In some embodiments, the invention also provides an agent for detecting TAP1 expression levels for use in predicting pancreatic cancer disease outcome in a subject, e.g., predicting total survival of a subject.

In some embodiments, a pharmaceutical use regimen based on the above regimen is also provided. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for predicting responsiveness of a subject having pancreatic cancer to a MEK inhibitor, or predicting whether the subject is likely to respond to a MEK inhibitor. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for predicting responsiveness of a pancreatic cancer cell to a MEK inhibitor, or predicting whether the pancreatic cancer cell is likely to respond to a MEK inhibitor. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for identifying a subject having pancreatic cancer who may benefit from treatment with a MEK inhibitor, or for identifying a pancreatic cancer candidate that may be treated with a MEK inhibitor. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for identifying a subtype of pancreatic cancer in a subject, e.g., identifying whether the pancreatic cancer in a subject is a subtype that is resistant to a MEK inhibitor. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for selecting an individual therapy for a subject with pancreatic cancer. In some embodiments, the invention also provides the use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for predicting the outcome of a pancreatic cancer disease in a subject, e.g., predicting the overall survival of a subject.

In the assay methods of the invention, the TAP1 expression level may be a TAP1 protein expression level or a TAP1mRNA expression level.

Methods for measuring protein expression levels are well known to those skilled in the art, examples of which include, but are not limited to, protein chip assays, immunoassays, ligand binding assays, MALDI-TOF (matrix assisted laser Desorption/ionization time of flight mass spectrometry), SELDI-TOF (surface enhanced laser Desorption/ionization time of flight mass spectrometry), radioimmunoassays, radioimmunodiffusion, two-dimensional immunodiffusion (Ouchterlony immunodiffusion), rocket immunoelectrophoresis, immunohistochemical staining, complement fixation assays, 2-D electrophoresis, liquid chromatography-mass spectrometry (LC-MS), liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS), western blot hybridization, ELISA (enzyme-linked immunosorbent assay), and the like. In the present invention, the reagent for measuring the protein expression level of TAP1 may comprise an antibody, ligand, or aptamer that can specifically bind to TAP1 protein.

Methods for measuring mRNA expression levels are well known to those skilled in the art, examples of which include, but are not limited to, polymerase Chain Reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, ribonuclease Protection Assay (RPA), northern blotting, and DNA chips. In the present invention, the reagent for measuring the mRNA expression level of TAP1 may comprise a primer for amplifying TAP1mRNA and/or a probe capable of detecting TAP1mRNA, for example, a probe capable of hybridizing with TAP1mRNA under highly stringent conditions, or the like.

The reference TAP1 expression level may be a predetermined threshold value, or may be a TAP1 expression level of pancreatic cancer cells of a subject as a reference subject (e.g., a TAP1 expression level in a sample from a subject of a reference subject, the sample comprising pancreatic cancer cells), the reference subject may be a subject treated with a MEK inhibitor, and the reference subject may be a pancreatic cancer patient that is responsive or non-responsive to a MEK inhibitor therapy. The reference expression level may also be a threshold determined by statistical analysis of TAP1 expression levels for each individual in the sample population (e.g., TAP1 expression levels in a sample from the individual, such as a sample comprising pancreatic cancer cells) and responsiveness to treatment with a MEK inhibitor. The individual in the sample population may be an individual having pancreatic cancer. The threshold may not be unique and may be determined based on the desire for the effect of the treatment of the disease, and/or the judgment of the clinician. For example, the threshold may be determined from the quartiles or percentiles of the particular parameters of the sample population, e.g., the threshold may be the first quartile (fourth-most quartile), the second quartile (median), or the third quartile (highest-most quartile) of the particular parameters of the sample population. For another example, the threshold may be determined based on the z-score (z-score) of a particular parameter of the sample population, e.g., the threshold may be a TAP1 expression level for individuals having a z-score between-1 and 1, e.g., a TAP1 expression level for individuals having a z-score between-0.5 and 0.5. The specific parameter may be any parameter that is useful in measuring the effect of a treatment of a disease (e.g., the effect of a MEK inhibitor on a patient with pancreatic cancer), such as any parameter useful in measuring the responsiveness of a disease (e.g., pancreatic cancer) to a drug (e.g., a MEK inhibitor), such as tumor size, total survival, progression free survival, etc. It is within the ability of one of ordinary skill in the art to determine a reference TAP1 expression level as a threshold.

In the present invention, a TAP1 expression level that is higher than a reference TAP1 expression level may be, for example, a measured increase in the subject's TAP1 expression level by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, or about 200% as compared to the reference TAP1 expression level. A TAP1 expression level that is lower than the reference TAP1 expression level may be, for example, a decrease in the measured TAP1 expression level of the subject by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% as compared to the reference TAP1 expression level.

In the assay, diagnostic and therapeutic methods provided herein, the subject may be a subject having pancreatic cancer or a subject suspected of having pancreatic cancer. In some embodiments, the pancreatic cancer is Pancreatic Ductal Adenocarcinoma (PDAC). In some embodiments, the cells of pancreatic cancer have a KRAS mutation. In some embodiments, the KRAS mutation occurs at position 12 of the amino acid sequence of KRAS. In some embodiments, the cells of pancreatic cancer have a KRAS mutation selected from G12D, G12R, G12V, G12C and G12S. In some embodiments, the cells of pancreatic cancer have a KRAS mutation of G12D or G12R.

In the assay, diagnostic and therapeutic methods provided herein, the sample from the subject comprises pancreatic cancer cells. The TAP1 expression level, e.g., the measured TAP1 expression level or the reference TAP1 expression level, refers to the TAP1 expression level in pancreatic cancer cells.

In the assay, diagnostic and therapeutic methods provided herein, the MEK inhibitor is one or more selected from the group consisting of trametinib (GSK 1120212), semetinib, RO5068760, MEK162, PD-325901, coumetinib, XL518, CI-1040 and PD 035901. In some embodiments, the MEK inhibitor is trimetinib or semantenib.

III methods of treatment and uses

The present invention provides a method of treating pancreatic cancer in a subject, the method comprising first measuring the level of TAP1 expression in a sample from the subject, and then determining whether to administer a therapeutically effective amount of a MEK inhibitor to the subject based on the TAP1 expression level. In particular, if the TAP1 expression level is greater than the reference TAP1 expression level, no MEK inhibitor is administered to the subject, e.g., a therapy that does not include a MEK inhibitor is administered to the subject, or a therapeutically effective amount of a TAP1 inhibitor and a MEK inhibitor are administered in combination to the subject as described herein; administering to the subject a therapeutically effective amount of a MEK inhibitor if the TAP1 expression level is below a reference TAP1 expression level.

The invention also provides a method of treating pancreatic cancer in a subject comprising administering to the subject a therapeutically effective amount of a MEK inhibitor, wherein the subject has been identified as having a TAP1 expression level in a sample from the subject that is lower than a reference TAP1 expression level.

The invention also provides a method of treating pancreatic cancer in a subject comprising administering to the subject a TAP1 inhibitor and a MEK inhibitor. The subject has been identified as having a TAP1 expression level that is lower than the reference TAP1 expression level in a sample from the subject, or has been identified as being resistant to a MEK inhibitor, or as having a pancreatic cancer subtype that is resistant to a MEK inhibitor, e.g., is not responsive (i.e., resistant or insensitive) to a MEK inhibitor without administration of a TAP1 inhibitor.

The invention also provides a method of increasing responsiveness of a subject having pancreatic cancer to treatment with a MEK inhibitor comprising administering a TAP1 inhibitor to a subject receiving treatment with a MEK inhibitor. The subject has an enhanced response to treatment with a MEK inhibitor after administration of the TAP1 inhibitor compared to when no TAP1 inhibitor is administered. In some embodiments, the increased response refers to an increase in the proliferation inhibitory effect of a MEK inhibitor on pancreatic cancer cells, or an increase in the effect of a MEK inhibitor on inducing apoptosis of pancreatic cancer cells, or an increase in the effect of a MEK inhibitor on inhibiting tumor growth, e.g., a decrease in tumor volume or a decrease in tumor weight in a subject treated with a MEK inhibitor after administration of a TAP1 inhibitor compared to when no TAP1 inhibitor is administered.

In some embodiments, a medical use regimen based on the above regimen is also provided. In some embodiments, the invention also provides a TAP1 inhibitor for use in treating pancreatic cancer in a subject, wherein the subject has been identified as having a TAP1 expression level in a sample from the subject that is lower than a reference TAP1 expression level. The invention also provides TAP1 inhibitors for use in increasing responsiveness of a subject having pancreatic cancer to treatment with a MEK inhibitor. The invention also provides a combination comprising a TAP1 inhibitor and a MEK inhibitor for use in the treatment of pancreatic cancer.

In some embodiments, a pharmaceutical use regimen based on the above regimen is also provided. In some embodiments, the invention also provides the use of a TAP1 inhibitor in the manufacture of a medicament for treating pancreatic cancer in a subject, wherein the subject has been identified as having a TAP1 expression level in a sample from the subject that is lower than a reference TAP1 expression level. The invention also provides the use of a TAP1 inhibitor in the manufacture of a medicament for increasing responsiveness of a subject having pancreatic cancer to treatment with a MEK inhibitor. The invention also provides the use of a TAP1 inhibitor and a MEK inhibitor in the manufacture of a combination medicament for the treatment of pancreatic cancer. The invention also provides the use of a TAP1 inhibitor in the manufacture of a medicament for use in combination with a MEK inhibitor in the treatment of pancreatic cancer.

The invention also provides a combination medicament or pharmaceutical combination comprising a TAP1 inhibitor and a MEK inhibitor.

The TAP1 inhibitor and the MEK inhibitor may be administered by different routes and regimens. The TAP1 inhibitor and the MEK inhibitor may be administered to a subject simultaneously or sequentially. When administered simultaneously, the TAP1 inhibitor and the MEK inhibitor may be formulated together in a single dosage form (or, alternatively, a single pharmaceutical composition), or separately in two or more separate dosage forms, e.g., in a pharmaceutical composition comprising the TAP1 inhibitor and a pharmaceutical composition comprising the MEK inhibitor, respectively. When administered sequentially, the TAP1 inhibitor and MEK inhibitor may be separated by minutes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 minutes or more), or by hours (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,

30. 35, 40, 45, 50, 60 hours or more), or a number of days (e.g., 1, 2, 3, 4, 5, 6, 7, 8,

9. 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 days or longer).

Any of the pharmaceutical compositions of the present invention may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier must be acceptable, i.e., compatible with any other ingredients in the formulation, and must be harmless to the subject. Pharmaceutically acceptable carriers may include, but are not limited to, buffers, excipients, stabilizers, preservatives, wetting agents, surfactants, emulsifiers, or combinations thereof. Examples of buffers include, but are not limited to, acetic acid, citric acid, histidine, boric acid, formic acid, succinic acid, phosphoric acid, carbonic acid, malic acid, aspartic acid, tris buffer, HEPPSO, HEPES, neutral buffered saline, phosphate buffered saline, and the like.

Any of the pharmaceutical compositions of the present invention may be administered in any manner suitable for pancreatic cancer and subjects. In certain embodiments, modes of administration may include, but are not limited to, parenteral or non-parenteral routes including oral, sublingual, buccal, transdermal, rectal, vaginal, intradermal, intranasal, or parenteral routes, such as intravenous (i.v.), intraperitoneal, intradermal, subcutaneous, intramuscular, intracranial, intrathecal, intratumoral, transdermal, transmucosal, intra-articular, intrathecal, intrahepatic, intraneural, or intracranial injection or infusion. For example, the pharmaceutical composition may be injected directly into a tumor, lymph node, tissue, organ or site of infection.

Dosage forms suitable for oral administration include, but are not limited to, tablets, capsules, powders, pills, granules, suspensions, solutions or pre-concentrates of solutions, emulsions or pre-concentrates of emulsions. Pharmaceutically acceptable carriers useful in oral dosage forms include water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like. Carriers such as starches, sugars, microcrystalline cellulose, diluents, fillers, lubricants, granulating agents, lubricants, binders, stabilizers, disintegrating agents and the like may be employed in the preparation of oral solid preparations such as powders, capsules or tablets.

Dosage forms suitable for parenteral administration include, but are not limited to, sterile liquid preparations such as isotonic aqueous solutions, emulsions, suspensions, dispersions or viscous compositions which are buffered to a desired pH. The parenteral dosage form may be either a ready-to-use form or a dry product ready to be dissolved or suspended in a pharmaceutically acceptable carrier. The parenteral dosage form may be a sterile formulation or may be sterilized prior to administration to a subject. Pharmaceutically acceptable carriers that can be used to provide parenteral dosage forms include, but are not limited to, water for injection; aqueous carriers such as, but not limited to, sodium chloride injection, ringer's injection, dextrose injection. Water-soluble carriers such as, but not limited to, ethanol, polyethylene glycol, and polypropylene glycol; nonaqueous carriers such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate; and solubilizing agents, such as cyclodextrins.

The number and frequency of administrations will be determined by factors such as the condition of the subject (e.g., age, weight, sex, and response of the subject to the drug), and the type and severity of the disease (e.g., pancreatic cancer) in the subject, although appropriate dosages may be determined by clinical trials.

Any of the medicaments or compositions of the invention are administered to a subject in a therapeutically effective amount, e.g., the subject can be administered in a therapeutically effective amount of about 0.5 to about 250 mg/kg, e.g., about 1 to about 250 mg/kg, about 2 to about 200 mg/kg, about 3 to about 120 mg/kg, about 5 to about 250 mg/kg, about 10 to about 200 mg/kg, or about 20 to about 120 mg/kg.

Any of the pharmaceutical compositions of the present invention may be administered once or twice a day; or once every 2, 3, 4, 5, 6, 7, 8, 9, or 10 days, once every 1, 2, 3, 4, 5, or 6 weeks, or once every 1, 2, 3, 4, 5, or 6 months or more. The pharmaceutical composition may also be administered on a weekly schedule (e.g., 1, 2, 3, 4, or 5 times) or a monthly schedule (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times). For example, in a 5-week regimen, the pharmaceutical composition may be administered once daily for 5 consecutive days, followed by 2 consecutive days of rest.

The invention also provides kits comprising reagents for detecting the level of TAP1 expression and a MEK inhibitor. The reagent for detecting the expression level of TAP1 and the MEK inhibitor may be placed in separate containers. The kit may further comprise instructions for use. The instructions may describe content for directing a user to first measure the level of TAP1 expression in a sample from the subject and then determine whether to administer a therapeutically effective amount of a MEK inhibitor to the subject based on the level of TAP1 expression. The instructions may be in the form of package inserts or may be printed on the package.

The TAP1 expression level may be a TAP1 protein expression level or a TAP1 mRNA expression level.

The subject described herein may be a subject having pancreatic cancer or a subject suspected of having pancreatic cancer. In some embodiments, the pancreatic cancer is Pancreatic Ductal Adenocarcinoma (PDAC). In some embodiments, the cells of pancreatic cancer have a KRAS mutation. In some embodiments, the KRAS mutation occurs at position 12 of the amino acid sequence of KRAS. In some embodiments, the cells of pancreatic cancer have a KRAS mutation selected from G12D, G12R, G12V, G12C and G12S. In some embodiments, the cells of pancreatic cancer have a KRAS mutation of G12D or G12R.

In some embodiments, the sample from the subject comprises pancreatic cancer cells. The TAP1 expression level, e.g., the measured TAP1 expression level or the reference TAP1 expression level, refers to the TAP1 expression level in pancreatic cancer cells.

In some embodiments, the MEK inhibitor is one or more selected from the group consisting of trametinib (GSK 1120212), semetinib, RO5068760, MEK162, PD-325901, coumetinib, XL518, CI-1040, and PD 035901. In some embodiments, the MEK inhibitor is trimetinib or semantenib.

The TAP1 inhibitor may be any inhibitor that results in a decrease in the amount or activity of a TAP1 protein expressed by the cell, e.g., may be a TAP1 protein antagonist, or may be a TAP1 gene expression inhibitor, e.g., a molecule that inhibits or down-regulates the expression of the TAP1 gene by antisense inhibition or RNAi means, e.g., antisense RNA, siRNA, shRNA or miRNA, etc.

Examples of TAP1 protein antagonists include, but are not limited to, antibodies or other small molecule antagonists that specifically bind to TAP1 protein.

Antisense RNA, siRNA, shRNA or miRNA and the like can be expressed from an expression vector. Thus, antisense RNA, siRNA, shRNA or miRNA expression vectors for expressing a polypeptide that inhibits or down-regulates TAP1 gene expression may also be considered TAP1 inhibitors of the invention. In some embodiments, the sequence of the shRNA of TAP1 may be 5'-CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGG TTTTTG-3', SEQ ID NO: 1)

The technical scheme of the present invention will be described in further detail below by way of examples with reference to the accompanying drawings, but the present invention is not limited to the following examples.

Example 1 response of different KRAS mutant pancreatic cancer cells to MEKi was different

To investigate the response of different KRAS mutant pancreatic cancer cells to MEKi, we treated four KRAS mutant PDAC cell lines with different concentrations of MEK inhibitors and examined the protein expression levels of TAP1 in the four PDAC cells.

The results show that the average half-maximal inhibitory concentrations of Trametinib (Trametinib) in AsPC-1 and PSN-1 cells are 0.69 μm and 1.5 μm, respectively; whereas the mean half-maximal inhibitory concentrations in PANC-1 and SW1990 cells were 9.2. Mu.M and 10.2. Mu.M, respectively. The average half-maximal inhibitory concentration of the two groups of cells differed by approximately 10-fold (fig. 1A).

The average half-maximal inhibitory concentrations of semantenib (Selumeinib) in AsPC-1 and PSN-1 were 1.2 μm and 4.8 μm, respectively; whereas the mean half-maximal inhibitory concentrations in PANC-1 and SW1990 were 18.0. Mu.M and 19.5. Mu.M, respectively. The average half-maximal inhibitory concentration of the two groups of cells differed by approximately 13-fold. It can be concluded here that PANC-1 and SW1990 cells are MEKi resistant cells and that AsPC-1 and PSN-1 are MEKi sensitive cells (FIG. 1B).

EXAMPLE 2A positive correlation between TAP1 expression level and resistance of KRAS mutant pancreatic cancer cells to MEK inhibitors

We detected the mRNA levels of TAP1 in four PDAC cell lines by real-time quantitative fluorescent PCR. The average value was 1 based on the mRNA level of TAP1 in AsPC-1. The results indicate that the mRNA levels of TAP1 in MEKi resistant cells (PANC-1 and SW 1990) were significantly higher than in MEKi sensitive cells (AsPC-1 and PSN-1) (FIG. 2A). Immunoblot hybridization experiments examined protein levels of TAP1 in four PDAC cell lines. The results showed that the protein expression level of TAP1 was significantly higher in the MEKi resistant cell group (PANC-1 and SW 1990) than in the MEKi sensitive cell group (AsPC-1 and PSN-1) (FIG. 2B). It was concluded that the expression level of TAP1 was positively correlated with resistance of KRAS mutant pancreatic cancer cells to MEK inhibitors.

EXAMPLE 3 negative correlation of TAP1 expression level and Total survival of pancreatic cancer patients

To study the expression of TAP1 in pancreatic cancer patients (in tumors), and the correlation of this expression level with clinical survival and disease progression, we used the cBioPortal website to sort and analyze the pancreatic cancer patient clinical information in the cancer genetic map (TCGA) database, and downloaded from the TCGA database the survival data of pancreatic cancer patients, including survival status, overall survival (overall survival), etc., which is generally considered as the best endpoint for evaluating the efficacy of clinical trials of tumors.

The results showed that the average total survival time of pancreatic cancer patients with high TAP1 expression levels was 19.48 months, and that of pancreatic cancer patients with low TAP1 expression levels was 71.68 months, with a foot extension of about 267% (fig. 3). It can be seen that the expression level of TAP1 is inversely related to the total survival of pancreatic cancer patients.

EXAMPLE 4 positive correlation between TAP1 expression level and pancreatic cancer malignancy

In clinical treatment, the malignancy of a tumor is an important factor affecting the difficulty of treatment, efficacy, and prognosis of a patient.

We examined the expression level of TAP1 in pancreatic cancer samples of different malignancy levels by the method of Immunohistochemistry (IHC). The brown-stained portion of the tissue represents the TAP1 protein, and we defined color cards containing 4 score (score) levels, score 0, 1, 2 and 3, respectively, in light to dark brown order, corresponding to increasing brown depths, i.e., increasing levels of TAP1 expression. Then, determining the score value of the dyeing control color card of each sample, and counting the corresponding quantity of different sample types under each score value, wherein the sample types are divided into three main types: normal tissue, malignant primary tumor, and malignant metastasis.

The results showed that 3 normal tissues, 2 primary malignant tumor samples and 0 malignant metastasis samples were contained in score 0; score 1 contained 1 normal tissue, 7 malignant primary tumors and 2 malignant metastasis samples; score 2 contained 0 normal tissues, 14 primary malignant tumors and 7 malignant metastasis samples; score 3 contained 0 normal tissues, 6 malignant primary tumors and 5 malignant metastatic tumor samples (see table in fig. 4 for details). By chi-square test, it was concluded that the expression level of TAP1 was positively correlated with the malignancy of pancreatic cancer, and that the P value was 0.0013 (FIG. 4).

Example 5 inhibition of TAP1 reduces resistance of pancreatic cancer cells to MEKi

To further confirm the relationship of TAP1 to pancreatic cancer cell resistance, we constructed a TAP1 knockdown cell line in MEKi-resistant PDAC cell line SW1990 (SW 1990-shTAP 1), constructed a TAP1 knockdown cell line using the shRNA of TAP1 (sequence 5'-CCGGCCGTGTGTACTTATCCTGGATCTCGAGATCCAGGATAAGTACACACGGTT TTTG-3', SEQ ID NO: 1), and examined the cell activity of these two cell lines under MEKi treatment using the empty plasmid transfected cell line SW1990-GFP as an experimental control, and analyzed to calculate half inhibition concentration.

The results showed that knocking down TAP1 significantly reduced the half inhibitory concentration of trimetinib in SW1990 cells (fig. 5).

Example 6 inhibition of TAP1 effectively enhances proliferation inhibition of tumor cells by MEKi

To examine the effect of knockdown TAP1 on cell proliferation capacity, we treated SW1990-GFP and SW1990-shTAP1 cell lines with trimetinib, respectively, and counted colony formation. The concentrations of trimetinib were 10nM and 100nM, respectively, and the control group was treated with DMSO for 12 days, during which fresh medium containing the corresponding concentrations of trimetinib was changed every 2 days. After the completion of the culture, the cells were stained with crystal violet.

The results showed that TAP1 knockdown significantly enhanced the inhibitory effect of trimetinib on cell proliferation, with a corresponding significant reduction in the number of cell colony formations (fig. 6).

Example 7 inhibition of TAP1 significantly enhances the effect of MEKi on inducing apoptosis in tumor cells

We detected MEKi-induced apoptosis rate in the event of TAP1 knockdown by an annexin V-FITC/PI kit. Cells were collected after 72 hours of treatment with different concentrations of trimetinib (10, 40. Mu.M) and DMSO, and the results of apoptosis were analyzed by flow cytometry by adding annexin V-FITC/PI double-staining reagent.

The results showed that the average apoptosis rate of SW1990-GFP cells was 19.81% and that of SW1990-shTAP1 cells was 41.87% in 40. Mu.M of trametinib treatment. It can be seen that knocking down TAP1 significantly increases the effect of trimetinib on inducing apoptosis (fig. 7).

Example 8 inhibition of TAP1 significantly enhances the inhibitory effect of MEKi on tumor growth

We validated the effect of TAP1 knockdown on the MEKi tumor killing effect in a mouse xenograft model. Both tumor cells were inoculated subcutaneously in nude mice using SW1990-GFP and SW1990-shTAP1 cell lines, respectively, according to the method of establishing xenograft models. After about one week, tumor volumes were measured and daily intragastric administration was started for each group of mice. The dose of trametinib group was 1mg/kg (dissolved in 0.5% hydroxypropyl methylcellulose and 0.2% tween 80), the control group was equal volumes of 0.5% hydroxypropyl methylcellulose and 0.2% tween 80, and tumor volumes of each group were recorded every 4 days for 17 consecutive days.

The results showed that the volume of SW1990-shTAP1 tumor was significantly reduced compared to the volume of SW1990-GFP tumor under treatment with trimetinib (FIG. 8A).

At the end of the experiment, we euthanized mice, dissected tumor tissue from each group of mice, and weighed and counted. The results showed that the average weight of SW1990-shTAP1 tumors was significantly lower than the weight of SW1990-GFP tumors under treatment with trametinib (FIG. 8B).

From the above results, it was concluded that TAP1 knock-down enhanced the inhibitory effect of trimetinib on PDAC tumor growth.

The embodiments of the present invention are not limited to the examples described above, and those skilled in the art can make various changes and modifications in form and detail without departing from the spirit and scope of the present invention, which are considered to fall within the scope of the present invention.

Claims

1. Use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for predicting responsiveness of a subject with pancreatic cancer to a MEK inhibitor, the prediction of responsiveness of a subject with pancreatic cancer to a MEK inhibitor comprising: (a) Detecting TAP1 expression levels in a sample from the subject; and (b) predicting responsiveness of the subject to a MEK inhibitor based on the TAP1 expression level.

2. The use of claim 1, wherein the TAP1 expression level is TAP1 protein expression level or TAP1mRNA expression level.

3. The use of claim 1 or 2, wherein the sample comprises pancreatic cancer cells.

4. The use of any one of claims 1-3, wherein the pancreatic cancer has a KRAS mutation.

5. The use of claim 4, wherein the KRAS mutation is G12D or G12R.

6. The use of any one of claims 1-5, wherein the MEK inhibitor is tramatinib or sematinib.

7. The use according to any one of claims 1-6, wherein step (b) comprises: if the TAP1 expression level is greater than the reference TAP1 expression level, the subject is identified as unlikely to respond to a MEK inhibitor; if the TAP1 expression level is below the reference TAP1 expression level, the subject is identified as likely to respond to a MEK inhibitor.

8. Use of a combination of an agent for detecting TAP1 expression levels and a MEK inhibitor in the manufacture of a medicament for treating pancreatic cancer in a subject, the treatment of pancreatic cancer in a subject comprising: (a) Detecting TAP1 expression levels in a sample from the subject; (b) Selecting whether to administer a therapeutically effective amount of a MEK inhibitor to the subject based on the TAP1 expression level.

9. The use of claim 8, wherein the TAP1 expression level is TAP1 protein expression level or TAP1mRNA expression level.

10. The use of claim 8 or 9, wherein the sample comprises pancreatic cancer cells.

11. The use of any one of claims 8-10, wherein the pancreatic cancer has a KRAS mutation.

12. The use of claim 11, wherein the KRAS mutation is G12D or G12R.

13. The use according to any one of claims 8-12, wherein the MEK inhibitor is trametinib or semetinib.

14. The use according to any one of claims 8-13, wherein step (b) comprises: administering to the subject an additional pancreatic cancer therapy that does not include a MEK inhibitor, or administering to the subject a therapeutically effective amount of a TAP1 inhibitor and a MEK inhibitor if the TAP1 expression level is greater than the reference TAP1 expression level; administering to the subject a therapeutically effective amount of a MEK inhibitor if the TAP1 expression level is below a reference TAP1 expression level.

Use of a mek inhibitor in the manufacture of a medicament for treating pancreatic cancer in a subject, comprising administering to the subject a therapeutically effective amount, wherein the subject has been identified as having a TAP1 expression level in a sample from the subject that is lower than a reference TAP1 expression level.

16. The method of claim 15, wherein the TAP1 expression level is TAP1 protein expression level or TAP1mRNA expression level.

17. The method of claim 16, wherein the sample comprises pancreatic cancer cells.

18. The method of claim 16 or 17, wherein the pancreatic cancer has a KRAS mutation.

19. The method of claim 18, wherein the KRAS mutation is G12D or G12R.

20. The method of any one of claims 15-19, wherein the MEK inhibitor is tramatinib or sematinib.

Use of a tap1 inhibitor and a MEK inhibitor in the manufacture of a combination medicament for treating pancreatic cancer in a subject.

Use of a tap1 inhibitor in the manufacture of a medicament for increasing responsiveness of a subject having pancreatic cancer to treatment with a MEK inhibitor.

23. The use of claim 21 or 22, wherein the pancreatic cancer has a KRAS mutation.

24. The use of claim 23, wherein the KRAS mutation is G12D or G12R.

25. The use of any one of claims 21-24, wherein the pancreatic cancer is resistant to a MEK inhibitor without administration of a TAP1 inhibitor.

26. The use of any one of claims 21-25, wherein the MEK inhibitor is tramatinib or sematinib.

27. The use of any one of claims 21-26, wherein the TAP1 inhibitor is shRNA; preferably, the sequence of the shRNA is shown as SEQ ID NO. 1.

28. Combination agents, including TAP1 inhibitors and MEK inhibitors.

29. A kit comprising reagents for detecting TAP1 expression levels and a MEK inhibitor.

30. The combination according to claim 21 or the kit according to claim 22, wherein the MEK inhibitor is tramatinib or sematinib.

31. The combination or kit of any one of claims 28-30, wherein the TAP1 inhibitor is shRNA; preferably, the sequence of the shRNA is shown as SEQ ID NO. 1.

32. Use of an agent for detecting TAP1 expression levels in the manufacture of a medicament for predicting a pancreatic cancer disease outcome in a subject, the predicting pancreatic cancer disease outcome in a subject comprising detecting (a) TAP1 expression levels in a sample from the subject; and (b) predicting pancreatic cancer disease outcome of the subject based on the TAP1 expression level.

33. The use of claim 32, wherein the sample comprises pancreatic cancer cells.

34. The use of claim 32 or 33, wherein the pancreatic cancer has a KRAS mutation.

35. The use of claim 34, wherein the KRAS mutation is G12D or G12R.

36. The use of any one of claims 32-35, wherein step (b) comprises: predicting the presence of an adverse disease outcome if the TAP1 expression level is higher than a reference TAP1 expression level; if the TAP1 expression level is lower than the reference TAP1 expression level, good disease outcome is predicted.

37. The use of any one of claims 32-36, wherein the adverse disease outcome is a reduction in overall survival compared to a subject having a TAP1 expression level below a reference TAP1 expression level; the adverse disease outcome refers to an increase in overall survival compared to subjects with TAP1 expression levels above the reference TAP1 expression level.