CN117547621A

CN117547621A - Application of activating GATA5 and ISL1 in repairing cardiac injury after myocardial infarction

Info

Publication number: CN117547621A
Application number: CN202311505935.0A
Authority: CN
Inventors: 周祥; 张淑晨; 徐建锋; 肖思羽
Original assignee: Shanghai Xuanyan Biotechnology Co ltd; Second Affiliated Hospital of Soochow University
Current assignee: Shanghai Xuanyan Biotechnology Co ltd; Second Affiliated Hospital of Soochow University
Priority date: 2023-11-13
Filing date: 2023-11-13
Publication date: 2024-02-13

Abstract

The invention relates to the use of activating GATA5 and ISL1 in the repair of cardiac injury following myocardial infarction. In particular, the invention provides an application of a viral vector co-expressing GATA5 and ISL1 proteins in preparing medicines for treating heart injury after myocardial infarction, in particular, for slowing down heart injury caused by myocardial infarction and improving heart function. Also provided are pharmaceutical formulations prepared from the viral vectors of the invention that can rapidly and effectively treat post-myocardial infarction cardiac injury.

Description

Application of activating GATA5 and ISL1 in repairing cardiac injury after myocardial infarction

Technical Field

The invention relates to the field of biological medicine, in particular to application of GATA5 and ISL1 in heart injury repair after myocardial infarction.

Background

Myocardial Infarction (MI) refers to the occurrence of a sharp decrease or interruption of blood supply on the basis of coronary lesions, causing severe and persistent acute ischemic necrosis of the corresponding myocardial tissue. Has been a difficult problem in myocardial infarction treatment.

During myocardial infarction, a range of factor changes, including changes in multiple genes or protein levels, occur and many have been reported.

However, up to now, no method has been developed which can achieve rapid and effective improvement of myocardial infarction by controlling certain factors alone.

Therefore, the discovery of a method for rapidly and effectively improving cardiac injury after myocardial infarction by independently regulating and controlling certain factors is of great importance.

Disclosure of Invention

The invention provides a method for rapidly and effectively improving heart injury after myocardial infarction.

In a first aspect of the invention, there is provided a viral vector co-expressing GATA5 and ISL1 proteins, said viral vector carrying a gene expression cassette expressing GATA5 and ISL1 proteins, for use in the manufacture of a medicament for the treatment of post-myocardial infarction cardiac injury; in the expression cassette, a first coding sequence encoding a GATA5 protein is operably linked to a first promoter specific for cardiac fibroblasts, and a second coding sequence encoding an ISL1 protein is operably linked to a second promoter specific for cardiac fibroblasts.

In another preferred embodiment, the first coding sequence encoding GATA5 protein and the second coding sequence encoding ISL1 protein are located in two different expression cassettes, respectively; or located in the same expression cassette.

In another preferred embodiment, the first and second promoters are the same promoter (i.e., the first coding sequence encoding the GATA5 protein and the second coding sequence encoding the ISL1 protein are co-expressed under the drive of a single promoter).

In another preferred embodiment, the first coding sequence and the second coding sequence are operably linked to a cardiac fibroblast-specific promoter.

In another preferred embodiment, the first coding sequence and the second coding sequence are linked by a 2A element or an IRES element.

In another preferred embodiment, the 2A element is selected from the group consisting of: P2A, T a.

In another preferred embodiment, the viral vector is selected from the group consisting of: an adenovirus vector, an AAV vector, a lentiviral vector, or a combination thereof.

In another preferred embodiment, the first cardiac fibroblast-specific promoter and the second cardiac fibroblast-specific promoter are the same or different cardiac fibroblast-specific promoters.

In another preferred embodiment, the cardiac fibroblast specific promoter is Collagen type I (Collagen I).

In another preferred embodiment, the sequence of the cardiac fibroblast specific promoter is shown in SEQ ID NO. 1.

In a second aspect of the invention, there is provided an expression cassette having the structure of formula I from the 5'-3' end:

Z0-Z1-Z2-Z3 (I)

wherein each "-" is independently a bond or a nucleotide linking sequence;

z0 is an none or 5' -UTR element;

z1 is a heart fibroblast specific promoter;

z2 is a nucleotide sequence encoding GATA5 and ISL1 proteins, wherein the nucleotide sequence encoding the GATA5 protein and the nucleotide sequence encoding the ISL1 protein are linked by a 2A element; and

z3 is an element of the none or 3' -UTR.

In another preferred embodiment, the 3' -UTR element comprises a polyA element.

In another preferred embodiment, the cardiac fibroblast specific promoter is a first Collagen promoter (Collagen I).

In another preferred embodiment, the nucleotide sequences encoding GATA5 and ISL1 proteins are shown in SEQ ID NO. 2.

In another preferred embodiment, the nucleotide sequence comprises a DNA sequence, a cDNA sequence, or an mRNA sequence.

In another preferred embodiment, the nucleotide sequence includes a single-stranded sequence and a double-stranded sequence.

In a third aspect of the invention there is provided a vector comprising an expression cassette according to the second aspect of the invention.

In another preferred embodiment, the carrier comprises: plasmid and viral vector.

In another preferred embodiment, the viral vector is selected from the group consisting of: the viral vector is selected from the group consisting of: an adenovirus vector, an AAV vector, a lentiviral vector, or a combination thereof.

In another preferred embodiment, the viral vector is an adenovirus vector.

In a fourth aspect of the invention there is provided the use of a carrier according to the third aspect of the invention for the preparation of a formulation or composition for the treatment of post-myocardial infarction cardiac injury.

In a fifth aspect of the invention there is provided a pharmaceutical formulation comprising (a) a carrier according to the third aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the pharmaceutical formulation is for treating cardiac injury following myocardial infarction.

In another preferred embodiment, the pharmaceutical formulation is for:

(a) Increasing left ventricular ejection fraction;

(b) Increasing the short axis shortening rate;

(c) Alleviating an increase in left ventricular end-diastole volume;

(d) Decreasing left ventricular end systole volume;

(e) Lowering the end diastole inner diameter of the left ventricle;

(f) Decreasing the increase in left ventricular end-systole inner diameter; and

(g) Inhibiting the area of fibrosis following myocardial infarction.

In another preferred embodiment, the pharmaceutical formulation is in the form of a liquid formulation.

In another preferred embodiment, the formulation is administered intravenously.

In another preferred embodiment, the vector is a viral vector.

In another preferred embodiment, the viral vector is present in the pharmaceutical formulation in an amount of 1X 10 ⁹ -1×10 ¹⁶ Individual viruses/ml, preferably 1X 10 ¹² -1×10 ¹³ Each virus/ml.

In a sixth aspect of the invention there is provided a host cell comprising the vector of the third aspect of the invention or an expression cassette of the second aspect of the invention integrated into its chromosome.

In another preferred embodiment, the host cell is a mammalian cell, including human and non-human mammals.

In another preferred embodiment, the host cell is a cardiac fibroblast.

In a seventh aspect of the present invention, there is provided a method for preparing GATA5 and ISL1 proteins, comprising the steps of:

culturing the host cell of the sixth aspect of the invention under conditions suitable for expression, thereby expressing the GATA5 and ISL1 proteins; and isolating said GATA5 and ISL1 proteins.

In an eighth aspect of the invention, there is provided a method of treatment by administering a carrier according to the third aspect of the invention or a pharmaceutical formulation according to the fifth aspect of the invention to a subject in need thereof.

In another preferred embodiment, the adenovirus formulation is administered intravenously to a subject in need thereof.

In another preferred embodiment, the subject in need thereof includes humans and non-human mammals.

In another preferred embodiment, the method of treatment is a method of treating cardiac injury following myocardial infarction.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

Fig. 1 shows the change in expression of a specific class of cytokines following myocardial infarction: (a-b) cardiomyocyte markers Troponin T and cardiomyocyte-characteristic molecules GATA4 and Mef2c are expressed in a specific subset of cardiac fibroblasts; (c) Heart fibroblasts positive for GATA5 and ISL1 exist in myocardial infarction mouse tissues; (d) Cardiac fibroblasts positive for GATA5 and ISL1 are present in myocardial tissue of patients with myocardial infarction.

FIG. 2 shows the effect on myocardial infarction tissue following target on cardiac fibroblast over-expression of GATA5 and ISL 1: (a-b) significant increases in GATA5 and ISL1 expression in the adenovirus vector Ad-GATA5-ISL1 group; (c) immunofluorescence images of GATA5 and ISL1 overexpression; (d) mouse echocardiography; (e-f) Left Ventricular Ejection Fraction (LVEF) and short axis shortening (LVFS) resulting from left anterior descending ligation are reversed following overexpression of GATA5 and ISL 1; (g) Myocardial infarction-induced increases in left ventricular end-diastolic volume (LVEDV) in mice were reduced upon overexpression of GATA5 and ISL 1; (h-j) myocardial infarction induced increases in Left Ventricular End Systole Volume (LVESV), left ventricular end diastole inner diameter (LVIDd) and left ventricular end systole inner diameter (LVIDs) in mice decrease to some extent; (k) Overexpression of GATA5 and ISL1 effectively inhibited the area of fibrosis following myocardial infarction.

FIG. 3 shows adenovirus vectors overexpressing GATA5 and ISL1 for injection.

Detailed Description

The present inventors have made extensive and intensive studies and have developed an adenovirus vector for treating cardiac injury after myocardial infarction by mass screening. The expression cassette is provided with a fibroblast specific promoter, and under the action of the promoter, when GATA5 and ISLl are expressed simultaneously, the function of cardiac muscle can be improved, so that cardiac injury after myocardial infarction can be relieved rapidly. The present invention has been completed on the basis of this finding.

Terminology

In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meanings given below, unless expressly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" may refer to a value or composition that is within an acceptable error of a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or measured. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

Sequence identity is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of a reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a well known method to those skilled in the art.

As used herein, the terms "subject," "subject in need thereof" refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, goats.

As used herein, the terms "type I Collagen", "rat type I Collagen promoter", "first Collagen promoter", "Collagen I" are used interchangeably to refer to the rat type I Collagen promoter as shown in SEQ ID No. 1.

GATA5 and ISL1

GATA5 is an important member of the GATA family of transcription factors. GATA5 (GATA binding protein 5) is a gene encoding a protein. Diseases associated with GATA5 include various types of congenital heart defects and aortic valve diseases. Pathways associated with this gene include DREAM inhibition and Dynorphin expression and increased platelet cytoplasmic Ca ²⁺ Is a reaction of (a). Gene Ontology (GO) annotations associated with this gene include DNA binding transcription factor activity and transcriptional cis-regulatory region binding. An important side-system of this gene is GATA4. It plays an important role in vascular inflammation, endothelial function, oxidative stress and cellular metabolism. ISL1 is a transcription factor critical for cardiovascular development. ISL1 (ISL LIM homology box 1) is a gene encoding a protein. Diseases associated with ISL1 include bladder eversion and right ventricular bioutlet. Pathways associated with this gene include nervous system development and expression regulation of SLITs and ROBOs. The genome-ontology (GO) annotation associated with this gene includes specific DNA binding and RNA polymerase II specific DNA binding transcription factor binding.

Formulations and compositions

The present invention provides a formulation or composition comprising (a) a carrier according to the third aspect of the invention and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the pharmaceutical formulation is for use in the treatment of cardiac injury following myocardial infarction, preferably the pharmaceutical formulation is for use in the treatment of myocardial infarction.

For convenience of clinical application, the pharmaceutical composition of the present invention may be contained in an injection applicator (e.g., an injection needle) in which a single dose of the pharmaceutical composition may be contained. The injection applicator may be contained in a kit for convenient storage and use. The tiny container containing the drug suspension is placed in dry ice during transportation. It should be stored in-80deg.C refrigerator at ordinary times.

Instructions for use may also be included in the kits or kits of the invention to facilitate proper use by those skilled in the art.

The "active ingredient" in the pharmaceutical composition of the present invention refers to the vector of the present invention, such as an adenovirus vector. The "active ingredients", formulations and/or compositions described herein may be used to treat myocardial infarction. "safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition or symptom without causing serious side effects. "pharmaceutically acceptable carrier or excipient" means: one or more compatible solid or liquid filler or gel materials which are suitable for human use and must be of sufficient purity and sufficiently low toxicity. "compatibility" as used herein means that the components of the composition are capable of blending with and between the active ingredients of the present invention without significantly reducing the efficacy of the active ingredients.

The composition may be a liquid or a solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

In the present invention, the carrier may be administered to the heart by intravenous administration. In either mode of administration, preferably, the carrier is provided as an injectable liquid. Preferably, the injectable liquid is provided as a capsule or syringe.

Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g., sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, and the like), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, and the like), polyols (e.g., propylene glycol, glycerol, mannitol, sorbitol, and the like), emulsifiers (e.g.) Wetting agents (such as sodium lauryl sulfate), coloring agents, flavoring agents, stabilizing agents, antioxidants, preservatives, pyrogen-free water and the like.

The compositions may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and a sterile powder for reconstitution into a sterile injectable solution or dispersion. Suitable aqueous and nonaqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

The nucleic acid or fusion nucleic acid for targeting cardiac fibroblasts, which is provided by the invention, is used for encoding GATA5 and ISL1, can be used for producing GATA5 and ISL1 proteins in vitro or in vivo, and the preparation containing the GATA5 and ISL1 encoding sequences can be applied to preparing medicaments for treating myocardial infarction.

When more GATA5 and ISL1 proteins are expressed at the tissue site of myocardial infarction, the heart injury after myocardial infarction can be better treated.

Therapeutic method

The present invention provides a method of treating cardiac injury following myocardial infarction comprising introducing into cardiac fibroblasts a vector comprising sequences encoding GATA5 and ISL 1. The method can include administering the nucleic acid vector into cardiac fibroblasts.

The present invention provides nucleic acid vectors comprising sequences encoding GATA5 and ISL1 for use in methods of treating myocardial infarction by providing cells with functions such as interstitial development, cardiac morphogenesis, actin filament tissue, and interstitial cell differentiation. The compositions of the invention may be administered alone or in combination (e.g., formulated in the same pharmaceutical composition) with other therapeutic agents.

As used herein, treating a disease means administering a nucleic acid or vector as described herein to ameliorate or alleviate one or more symptoms of the disease, including repairing the structure of the heart after myocardial infarction, such as thickening the left ventricular wall, enhancing ejection fraction, and the like.

When the nucleic acid sequence and the one or more enzymes are provided in multiple (two or more) doses, the doses may be separated by a suitable time interval, for example 30 seconds to several hours or 1 or more days.

Each dose may comprise an effective amount of a nucleic acid sequence or viral vector. An effective dose of the nucleic acid sequence or viral vector may be 1X 10 per treatment regimen ⁹ -1×10 ¹⁶ The range of viruses.

The invention has the main advantages that:

1. the adenovirus vector of the invention is specifically expressed only at the heart fibroblast, thus being capable of accurately achieving the aim position to implement accurate treatment.

2. Since the adenovirus vector of the invention is not expressed in other parts, no obvious side effect is caused to other tissues.

3. The adenovirus vector can obviously inhibit the fibrosis area after myocardial infarction and repair the structure of the heart after myocardial infarction, thereby effectively treating myocardial infarction and heart injury.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

General method

Single cell ATAC-seq and data processing, calibration and cluster analysis

In the present invention, the 'cellrange-ATAC' tool is downloaded from 10XGenomics to process raw single cell ATAC sequencing data, and 10XGenomics can compare reads in the sequencing results to mm10 genomic reference sequences and generate fragment type files.

Downstream analysis was performed using the R-package 'archR' with the fragment file as input data.

Cells with specific fragments less than 4000 or TSS enrichment scores less than 8 were removed by mass control, while the default settings were used to remove the doublets. Cells passing through the filter were clustered using the 'SEURat' method in 'archR' software with high resolution.

The degradation and visualization analysis was performed with UAMP.

For cell cluster annotation, the "addgeneintegration matrix" function of the "archR" software is first used to integrate the cell cluster annotation results generated from previous single cell RNA-seq data, and then the cell cluster annotation is further sorted according to the specific marker gene.

The integration coverage profile of the identified cell population was set to default settings using 'MACS2' software for tapering.

Motif enrichment, footprint analysis and trace maps were further sorted and analyzed using the "archR" software package.

Immunoblotting

Total protein from mouse heart tissue was extracted using RIPA lysis buffer containing 1mM PMSF and 1mM phosphatase inhibitor. After ultrasonication of the tissue and lysate mixture, the tissue was lysed on ice for 5 minutes and then centrifuged at 12000g for 10 minutes at 4 ℃. Protein supernatants were quantified using BCA method.

Protein samples were electrophoresed through SDS-polyacrylamide gel and transferred to polyvinylidene fluoride membranes (Millipore).

After blocking with 5% skimmed milk for 1 hour at room temperature, the membrane was incubated with anti-GATA5 (Santa cruz) and anti-ISL1 (Abcam) overnight at 4℃and then the corresponding secondary antibody was incubated for 1 hour at room temperature.

After washing 3 times with TBST, the relative expression level of the protein was detected by chemiluminescence.

Ultrasound cardiography examination

Echocardiographic examination evaluates cardiac structure and function. The probe was placed on the left side of the mouse sternum showing the long axis cross section of the left chamber. After the images are acquired, the probe is rotated clockwise approximately 90 ° to acquire short axis cross-sectional images. The following parameters were measured: left Ventricular (LV) end systole diameter, LV end diastole diameter, LV systolic fraction, and LV ejection fraction. All measurements were made by an experienced technician and averaged over 5 consecutive cardiac cycles.

Cardiac histological analysis and immunofluorescent staining of mice

The mouse hearts were collected, fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned into 5 μm thick sections. Subsequently, hematoxylin-eosin (HE) staining and Masson staining were performed, and the heart histological morphology was observed under an optical microscope.

In addition, frozen tissue sections were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.3% Triton X-100 for 10 min, blocked with 10% sheep serum for 1 hr, and then incubated overnight at 4 ℃. Sections were washed 3 times with 0.3% tween20 and secondary antibodies were incubated for 1 hour at room temperature.

Sections were fixed with anti-quench blocking agent containing DAPI and observed under a fluorescence microscope. Antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA) and Abcam (Cambridge, UK).

Myocardial infarction patient heart section staining

Heart tissue of a patient with myocardial infarction is taken, frozen sections are prepared by selecting infarct areas and non-infarct areas, and after fixation with 4% paraformaldehyde for 10 minutes, the sections are permeabilized with 0.3% Triton-X100 for 10 minutes.

Followed by blocking with 10% goat serum containing 0.3M glycine for 1 hour at room temperature. The primary antibody was incubated overnight at 4℃and washed 3 times with 0.1% Tween20 for 10 minutes each. The corresponding secondary antibodies were incubated for 1 hour at room temperature and washed 3 times with 0.1% Tween20 for 10 minutes each.

The primary direct antibody was incubated at room temperature for 2 hours and then washed 3 times with 0.1% Tween20 for 10 minutes. The tablets are sealed with anti-quenching sealing agent containing DAPI, and are preserved at 4 ℃ or observed under a laser confocal microscope.

Example 1

A special cardiac fibroblast subgroup exists in myocardial tissue of a myocardial infarction mouse through single cell sequencing, and expresses a myocardial cell marker Troponin T and myocardial cell characteristic molecules GATA4 and Mef2c (figure 1a and figure 1 b).

We therefore demonstrated the presence of GATA5 and ISL1 positive cardiac fibroblasts in myocardial tissue of myocardial infarction mice and myocardial infarction patients using immunofluorescence (FIGS. 1c and 1 d).

Example 2

Establishing a mouse myocardial infarction disease model

SPF grade 8-10 week old C57BL/6J male black mice were selected and randomly divided into myocardial infarction group (n=3) and sham surgery group (n=3).

The method comprises the steps of pre-operation skin preparation, intraoperative isoflurane inhalation, parallel to the xiphoid process, making a 1.5cm longitudinal incision on the left side of the xiphoid process, slightly pushing the heart to the right side of a mouse by the thumb of the left hand, fixing the heart leftwards by the index finger and the middle finger of the left hand, slightly applying force between the fourth five ribs by using elbow hemostats, extruding the heart leftwards and downwards by the index finger and the middle finger of the left hand while the elbow hemostats enter the heart cavity, exposing the apex of the heart to the outside, finding the position of the junction between the continuation line of the left auricle towards the apex of the heart and the lower 1/3 of the heart, namely, inserting a needle by using a 6-0 silk thread, inserting the needle to a thickness of 2-3mm, and ligating. After the chest gas was sufficiently evacuated, the skin incision of the mice was sutured, and the mice were placed on a thermostat until awakening.

The sham operation group was performed in the same manner as the myocardial infarction group except that ligation was not performed. Mice were euthanized 14 days after left anterior descending ligation.

Myocardial infarction groups take left ventricular infarction zone tissues, and sham operation groups take left ventricular tissues.

The tissues were snap frozen in liquid nitrogen and subsequently stored at-80 ℃ for subsequent single cell ATAC sequencing.

Example 3

Construction of adenovirus vectors

To demonstrate the protective effect of GATA5 and ISL1 on myocardial infarction mice injured myocardium, adenoviral vectors overexpressing GATA5 and ISL1 were constructed.

The invention uses adenovirus vector pADV-mcv-MCS-3 xFLAG to carry out the overexpression of GATA5 and ISL 1. The promoter mCMV was replaced with a rat type one Collagen promoter (Collagen I) which specifically recognizes cardiac fibroblasts as shown in SEQ ID No. 1.

The coding sequence of mouse GATA5-P2A-ISL1 shown in SEQ ID NO. 2 is synthesized on pGC-FU plasmid. This fragment was digested with AgeI and AscI and ligated with T4 DNA ligase, together with pADV-rat type I collagen+first intron promoter (pADV-rate type 1collagen+first intron Promoter) vector. Empty vector was used as an over-expression control.

The adenovirus vector pADV-rat type-I collagen+first intron promoter (pADV-rat type 1collagen+first intron Promoter,Ad-NC) and the adenovirus vector pADV-rat type-I collagen+first intron promoter-GATA5-P2A-ISL1 (pADV-rat type 1collagen+first intron Promoter-GATA5-P2A-ISL1, ad-GATA5-ISL 1) as shown in FIG. 3 were obtained.

The over-expression efficiency of the recombinant adenovirus is verified by qPCR and Western blot.

CCGCGGTGGCGGCCGCTCTAGAATATAGAAGCCAAGGATTTCAAGGGTTTCCTTTTCTCTCTTCTTCTTTTTTTTTCTTTTTCTTTTTCCTGAGATGGAGTTTCCTTTTGTAGCCCTGACTGTCCTGGAATTCACTCTATAGACCAGGCTAGCCTCACACTTAGTGATCTGCCTGCCTCTGCCTCTTGGGTGCTCAGGATTCAAGGCATGAACCACCACTACCCGACCAGGGATTTCTTACACACTTCTGACTGGACTAACCAGGAAAGCAGAGAGGGAGACAGGAAGAAAATGCTCAGAAGGAAGGAGTAGGATTGGAGGTGAGCTGGGGGAACCCAGACTGAGCCGTGCAGAAGACAAGGAAGAAGAAAGCCACCCACACACCTAGGATCCACCCACAGATTTTGCTCTGGGTACCCCTGTCTGGAGACTGTAGGGCTTTGTGATGGAGGGTGGGGTATGCTTCATGCCCCGTGCCCTTTACTCCAGACCTAAATGCCCACCCCCACATACAGCTGCTCGCTCTCTCTCTCCCCTGCCCTTCTCCCAAGAGACCAGTTCTCCATCCCTGGTCTGCAGCCAAGGCTGGGGGCAGAAGAACTTTCTGGAGGATTTGAGTGAGAAAAGCAAGAGAGCCTCAAGTAGGGACTGGAACCTCTGGGAAGGGAGTGCAGAGGAGACCCGGGTATGTGCCCTACCTGGTACATTTATACCTGGGCAGCCTCTGCTCCTGTTCCAGACTTCAGAGCCCAGACGGGTCCTCTCCCTCCCTCATGAGGGGAAACATTTGGGGAAATTTGGAGAGAGACAGAACTCAGAGCTCAGCACTTTCCTCTTTCTGTTTTTCTTCTTGAGGAATTTTTTCCCCCAACTGCTGATGACTTTACCATTCTTGGGGGTGGGGGGGTGGAGATTCTGGCTTTTGCTCCCCCTACACTCCAAGTGCCGGACAAAGCCCTACATTCCACAAGAAGCCAGGGCTTCAGAGTTTCCTAAAGATGAGGTGGCGTGGCGAGTCTCCTCCCTCTCCCAGCTCCAACTCCCCCTCCCCCAGTCTCCAGCCCTCAGCCTGGCCAGGGAGGCCCCGCCAGGCTGGGAGGAGACCCCAAGCACATTCTTCCTCTCGCTGTCATGCTGCAGAAATTAAAGACACATCTCTGAGCTGGGTACCCGCCAATCGTTTCAAGTTGAGAAGTGGCAGAGGAGGTCCCGAGCTTCAGCTCCATGCCACGTGTAAAGGAAGCTTGGAACCCACTGCCCACAACTCCTGGGGCAAAAACCTGGAGTCAGACATGGG

GTGAAGGCTGTCACACGGCACAGACACGTCAAGCACCCCCCCCAATTCTA

GTAGTCTCCTAGCCTCCACCAGAACCCCAGACCCTTGATGTGGCAGTCAC

CAGTCCACACCTGTTAGGCTCTTGTCTCTTCTTCCAGATGAGCCTGGGGGG

CGGGGGGGTGCTAGATCAGGAGCAGGGAAAAGTAGCTTTGGATAAGTGC

TTTTCCCAATACAAAACCCAACAAAGAGTGGGCAGATCACACTGTGTAGT

GCTTCGTGGAACCCTACCCTAGACAACTGCCTTGAACACCTATTCCCTCTG

ATGTACACCATCCCCGTCCACTGTTAGGGAGTGGGCATCCTTTGGAACTG

ACCACTGTGGAAGGCAGGACTTTACTGAGTTCCGGAACTACCATCTCAGC

TTCTCAGCCCCAGCCTTACCCTACAGGCACTGGCATAGGCGGGGGCAGAT

CCTGGGCCACAAGTCACTGCCACATGGTTGGGATAATTGATGAAGTCCTG

TCCTTCCATTGCTGTCTCCAGTTCTGCTTCTCTGGAAACTCTATATTTTTCC

CTTTAATTATAGCCTCTGCAGTCTCCCTCTGCCACCCCACCCGCACCGCTT

AGCCTAACTGCCCACGGCCAGCGACGTGGCTCCCTCCCCTTCTGCTCCCTT

GGTCTTTTTTATTTTTTTTTCTTTGCCTTCGTTGCACAAAACTAGCTCAGGG

AGGGCGTGAAGGGGGGGGGAGCAATGGAATCTTGGATGGTTTGGAGGAG

GCGGGACTCCTTGCTTCCACGTTTACAGCTCTGAAGACGGCTGTGGGGGA

AGTGATACAGGACGTCTATGGGCCCTGAGAGGAGACCCCTATGCTTCCCT

GCCACCCACACAGTTTAACAAAATGAAGTTCCTAAGTAGAGTGGGGGTCA

GGCAGAGCACCTTTGCAGGGTTGATGGGAGCCCAGGGAAAGAAAGGACA

CTGTCTTTTAGGGACACATTTAAATATAAGCCACTTTTCTTGGGGGACGA

CAAATGACCCTTTCCTGATTGCAGAGGTGGGGAACAATGGCTGAGATTTT

CAGCAAAGAAGCGAGGACATGAGGAGTAGCCTTCAAATAAAGTCACTCA

GCTACCAAAAACAAGTTTCTGCCACACACCGAGTTCACCTAGGTGTCCCC

AGACCAGATCCAAGTACAGTAAGGAAAGCAGGTTCTCTACAGAGAGAAC

ACGGCTCTATGGCCAATGCCTTCTACCTGCTCTTTCTGGATTGATACTGCT

ACCTAAGAGGGCCTCTAACCAATTCCTGGCTGTAGCCACAGCTGACACAA

GACCTTTTTCTAAGACATCCCTGGTCACAGGCCTCCTGTAGCAAATTCCA

GCCCTGGGATGGAGGTGGTCAGGAAAGAGTTTATACAAGAAGACCCAGG

CCACAGCTTTAAGGACTCAGAAACCCCCCTGCCCACACGGCTGCCCATCA

TAACGCAGAAGGTTTCTTCTGGAAGGACAAGGATGTCAAACTTCTCCCCA

AGCCTAATCCTCAGAGATGTCTCCCTCTGTTACACCTGGGGCTGGAGAAA

GGTGGGTCTTTCATGGAGCCACATTCATGGCAGAACAGATAGCCACCCCA

CTCCTTTCAAACAACCACATATCTGACTCTTAGTATCTGTGAAGAGATGTC

TAATTTGTTCCCAAATATTCCTACCCTGCATACCTGGGCCCACACCATGAG

GTATTCTCCTCCCTCTAACAGTCACATCTGCTTAGCTGCCTGGTTCTTCGG

ATTTGGAGAGATGCTTGCCTAACTTATTCTTCCTTAGGTCTTCCCAAGGAT

GCCAGAAAGACTATGAGACATGGCCAAGAGGACCTTTTCCCAATTGTGCC

TGACACTGAACCCTTTGTAATGTTCCCCAACTCAGATTCCCAATTCTACAT

CCTTCTGATTTGAGGTCCCAGAAGGAAAGTGCAAGGGGCATCCCCTACCC

ACAATCAGTATATCGAGGGCCCAGCCACACTCAGTGATAGCACCTCTGGC

CCATGTAGATCTGGGGGACAAGGGTGGCAGAATTGCAAAGGGGGGAGGG

GGCTGGGTGGACTCCTTTCCCTTCCTTTCCCTCCTCCCCCCTCTTCGTTCCA

AATTGGGGGCCGGGCCAGGCAGTTCTGATTGGCTGGGGGCCGGGCTGCTG

GCTCCCCCTCTCCAAGAGGCAGGGTTCCTCCCAGCCCTCCTCCATCAGGA

TGGTATAAAAGGGGCCCAGGCCAGTCGTCGGAGCAGACGGGAGTTTCAC

CTCCGGACGGAGCAGGAGGCACACGGAGTGAGGCCACGCATGAGCCGAA

GCTAACCCCCCACCCCAGCCGCAAAGAGTCTACATGTCTAGGGTCTAGAG

GCGGCCGCCTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGGGGCC

ACTGCCCTCCTGACGCATGGCCAAGAAGACAGTAAGTTCCAAACTCTGGG

GAGGTTATGGTTTCTTGCTATCGCGTTCTGCATAGGGGTCCTAGCAATAA

AGACTTAAACGGAAGCGCGGGGTGCTCCAGAGTTAGGAGGGATGAGAAG

GTGATGGAGAGGAACTGGGAAGAGAGAGGTCACCCTCGCGAGCAGAGGA

GAGTGAGCGGATCTCAGAAGTGGAGCCCTGGTTGAGATGGCACGGCAGG

AAATTTCAAGCATCTATCTGTAGCGCGACGGGAAAAGTGGGAATCTGGGC

AGGGGTTGGGTCAGAGTACGTCGAAGATCAAATAAGACCTCTGGAATAG

AGATTCGAAGCTCAAGATGTAAAAGCAATCAAAAAGGCTGCGGGATGAT

TCATAAGGAAAGATTGTTTGCCCTCTCTGCAGGCTAGACAGTGTTGCTGG

GGCCTCCGGGGTGCTGGGCTCTGGGAGTGGGGTGGGGGGAGGAAGGGAC

GCACGGAGAGGGCGGGTTGCTGGATGAGAAAGTTTGGCTAAGACTTGAC

TGGGCGCGGTCCCTGTGCCTCCTGCTGGTCAACCTTGAGCACTACGAGTC

CTGGTACAGTACTTTACAGCGCGCGGGCTTAAGAGGGAAAACCTGGGCTA

TTGCCGGGCCTGGACCCTCATCTCCAGACTAGGAAAATAAAAGCACAGAT

GGATGTGATAGCTTTGGTCTTTGAAAGTGACCCAGGCCAGTAAAATTGGG

TCCGCCCCGTGCATTGCTTAGCGTTGCCCGCCACCTAGTGGTTGCTTTGAT

CCGGTGCTAGAGAGGTGGGCGTGGTTAACTAATCATTGCTATTTGTAGAC

TTGAGTTCTTTCTTTGGCTAAGGAGTGACCCCAAAGCTCTACTGGCTTTGA

AGGAAGGACCGGGCAAGCTTTGATTCCTGGGAGCGGAGAGTTAGGGTGT

ATCTAACTTTAGGGATATATTTTACTACTCTGGACAAGGCTCCACGGAAG

TCACCCTCCTCCATTTTAGCCCCGCCCATTCCGTCCCACCTGCCCAAGGAA

AGGAGGTGGGACCAGGGCTGGAATTTCCCTTCTCTCCTCCCACCCCCGCC

TCCGGTCTCCCCGCAAACCACGTCCCACAAACTTCCACCTACTTTGTAGG

AGCCCTCCTACTCTCCGTCAGGAGGACTTCTATTTCATTTGGTTCCCGCGC

GCGTGGGCTGAAGTTGAGTTTGGAAGCAACCCCAGTCTAAAGCTTTGTTT

AAATTCCTGGGAACTTGGAAGTAACAGCCCTGGCCAGGCTTCTTGGTGCT

GTCACTGAACGCCGTTACAGAGCAGACCTGCATTTAAGGATTTAAGGGAA

GAAAATAGGGGTTGGGGGAAGATGTGGGAAGTGGAAAATCTACGTGCAC

CTCTTAGACAGGGGAAAGGGTGAGTAAGGCTGGGATCCGGTGGTGGTGC

AAATCAAAGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGT

ACGGAAGTGTTACTTCTGCTCTAAAAGCTGCTGCAGGTCTTAGTTAACTA

AGACTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGC

TTATCGATAAGCTTGGCATTCCGGTACTGTTGGTAAAACCGGTGGCGCGCC(SEQ ID NO:1)

ATGTACCAAAGCTTGGCGTTAGCCCAGAGCCCCGGCCAGGGCACTTACGCCGACTCCGGAGCCTTTCTGCACTCTTCGGGAACCGGCTCCCCGGTGTTCGTGGCACCCACTCGCATGCCCTCCATGCTGCCGTACCTGCCTTCGTGTGAGCCGGGCTCGCAGGCTCCCGCGCTCGCCGCGCACTCCAGCTGGACACAAGCAGTTGCCGCTGATTCCTCAGCCTTCGGCTCCGGAAGCCCGCACCCGCCAGCCGCACACCCACCGGGAGCCACCACCTTCCCGTTCGCTCACAGCCCTCCGGGGTCGGGCAGCGGCGGCAGCGCGGGGGTCCGGGACGGCGGCGCCTTCCAGGGCGCGCTGCTGGCTCGCGAACAGTACCCGACCCCGCTCGGGAGACCCATGGGCGCCTCGTACCCCACAACCTACCCAGCATACATGAGTTCCGACGTAGCCCCTTCGTGGACCTCCGGAGCCTTCGACAGCAGCATCCTGCACGGTCTGCAAGCTCGCCCTGGTGGCCTCCCTGGCCGCAGGACCAGCTTCGTACCTGACTTCTTGGAGGAGTTCCCTGGTGAGGGCCGGGAGTGCGTCAACTGTGGAGCCCTGTCTACACCACTGTGGCGCAGGGACGGCACCGGACACTATCTATGCAATGCCTGCGGCCTCTATCACAAGATGAACGGGGTCAACCGACCG

CTAGTGAGGCCCCAGAAGCGTCTGTCCTCATCCCGAAGATCCGGCCTATG

CTGCTCCAACTGCCATACTGCCACCACCACCCTCTGGAGGCGCAACTCGG

AGGGCGAACCAGTGTGCAACGCCTGTGGCCTCTACATGAAGCTCCATGGG

GTGCCAAGGCCACTGGCAATGAAAAAGGAGAGTATCCAGACAAGAAAAC

GGAAGCCAAAGAACCCTGCCAAAATCAAGGGCTCCTCAGGATCCACAGC

AAACACCACAGCCTCTTCTCCCACTCTCCTCAACTCTGAGAGCTCAGCCA

CCACTTTGAAGGCAGAGTCCAGTCTGGCATCTCCAGTGTGTGCTGGGCCC

ACTATCACCTCCCAGGCCTCCAGCCCAGCGGACGAATCCCTGGCCTCCAG

CCATTTGGAGTTCAAGTTCGAACCTGAAGACTTTGCCTTCACCTCCTCGTC

CATGAGCCCCCAGGCTGGTCTCAGTGGGGTCCTACGTCAGGAGACCTGGT

GTGCTCTGGCCTTGGCCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAG

CAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGGGAGACATGGGCG

ATCCACCAAAAAAAAAACGTCTGATTTCCCTGTGTGTTGGTTGCGGCAAT

CAAATTCACGACCAGTATATTCTGAGGGTTTCTCCGGATTTGGAGTGGCA

TGCAGCATGTTTGAAATGTGCGGAGTGTAATCAGTATTTGGACGAAAGCT

GTACGTGCTTTGTTAGGGATGGGAAAACCTACTGTAAAAGAGATTATATC

AGGTTGTACGGGATCAAATGCGCCAAGTGCAGCATAGGCTTCAGCAAGA

ACGACTTCGTGATGCGTGCCCGCTCTAAGGTGTACCACATCGAGTGTTTC

CGCTGTGTAGCCTGCAGCCGACAGCTCATCCCGGGAGACGAATTCGCCCT

GCGGGAGGATGGGCTTTTCTGCCGTGCAGACCACGATGTGGTGGAGAGA

GCCAGCCTGGGAGCTGGAGACCCTCTCAGTCCCTTGCATCCAGCGCGGCC

TCTGCAAATGGCAGCCGAACCCATCTCGGCTAGGCAGCCAGCTCTGCGGC

CGCACGTCCACAAGCAGCCGGAGAAGACCACCCGAGTGCGGACTGTGCT

CAACGAGAAGCAGCTGCACACCTTGCGGACCTGCTATGCCGCCAACCCTC

GGCCAGATGCGCTCATGAAGGAGCAACTAGTGGAGATGACGGGCCTCAG

TCCCAGAGTCATCCGAGTGTGGTTTCAAAACAAGCGGTGCAAGGACAAG

AAACGCAGCATCATGATGAAGCAGCTCCAGCAGCAGCAACCCAACGACA

AAACTAATATCCAGGGGATGACAGGAACTCCCATGGTGGCTGCTAGTCCG

GAGAGACATGATGGTGGTTTACAGGCTAACCCAGTAGAGGTGCAAAGTT

ACCAGCCGCCCTGGAAAGTACTGAGTGACTTCGCCTTGCAAAGCGACATA

GATCAGCCTGCTTTTCAGCAACTGGTCAATTTTTCAGAAGGAGGACCAGG

CTCTAATTCTACTGGCAGTGAAGTAGCATCGATGTCCTCGCAGCTCCCAGATACACCCAACAGCATGGTAGCCAGTCCTATTGAGGCATGA(SEQ ID NO:2)

Injection and transfection of adenovirus vectors

Adv-NC (5.5X10) was administered by mouse tail intravenous injection the first day after ligation of the left anterior descending branch ¹⁰ vg/mL) and Adv-GATA5-ISL1(7.9×10 ¹⁰ vg/mL), the injection dose is 1X 10 ⁹ vg/g. The overexpression efficiency of GATA5 and ISL1 and the post-myocardial function and fibrosis levels of mice were then observed 7 days after left anterior descending ligation.

The overexpression efficiency of mouse myocardial tissue GATA5 and ISL1 was verified at RNA and protein levels (fig. 2a and 2 b) by taking the material after cardiac perfusion and using immunofluorescence to obtain representative images of overexpression (fig. 2 c).

Results

As shown in fig. 2d, compared with MI (myocardial infarction) +ad-NC (control group), mi+ad-GATA5-ISL1 significantly thickened the left ventricular wall; and MI+Ad-GATA5-ISL1 enhanced its ejection fraction (FIG. 2 e) and increased short axis shortening (FIG. 2 f) compared to MI (myocardial infarction) +Ad-NC (control).

It follows that the reduction in left ventricular ejection fraction and short axis shortening rate of mice caused by left anterior descending branch ligation can be reversed upon overexpression of GATA5 and ISL 1.

At the same time, the increase in left ventricular end-diastole volume in mice induced by myocardial infarction was also reduced upon overexpression of GATA5 and ISL1 (fig. 2 g).

Whereas the mouse left ventricular end systole volume, left ventricular end diastole inner diameter and left ventricular end systole inner diameter increases induced by myocardial infarction also decreased to some extent, but were not statistically significant (fig. 2h, 2i and 2 j).

Histopathology found that overexpression of GATA5 and ISL1 was effective in inhibiting the area of fibrosis following myocardial infarction (figure 2 k).

In conclusion, the cardiac fibroblasts positive for GATA5 and ISL1 have the potential to be transformed into myocardial cells, and the overexpression of GATA5 and ISL1 can reduce post-myocardial ischemia injury by improving cardiac function and inhibiting myocardial fibrosis, which illustrates that the adenovirus of the invention can repair the structure of the heart after myocardial infarction.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims

1. Use of a viral vector co-expressing GATA5 and ISL1 proteins for the manufacture of a medicament for the treatment of cardiac injury following myocardial infarction, characterized in that said viral vector carries a gene expression cassette expressing GATA5 and ISL1 proteins; in the expression cassette, a first coding sequence encoding a GATA5 protein is operably linked to a first promoter specific for cardiac fibroblasts, and a second coding sequence encoding an ISL1 protein is operably linked to a second promoter specific for cardiac fibroblasts.

2. The use of claim 1, wherein the first promoter specific for cardiac fibroblasts and the second promoter specific for cardiac fibroblasts are the same or different promoters specific for cardiac fibroblasts.

3. The use of claim 1, wherein the first coding sequence and the second coding sequence are operably linked to a cardiac fibroblast-specific promoter.

4. The use according to claim 3, wherein the cardiac fibroblast-specific promoter is a Collagen type I promoter (Collagen I).

5. An expression cassette, characterized in that the expression cassette has the structure of formula I from the 5'-3' end:

Z0-Z1-Z2-Z3(I)

wherein each "-" is independently a bond or a nucleotide linking sequence;

z0 is an none or 5' -UTR element;

z1 is a heart fibroblast specific promoter;

z3 is an element of the none or 3' -UTR.

6. The expression cassette of claim 5, wherein the cardiac fibroblast specific promoter is a Collagen type I promoter (Collagen I) and has the sequence set forth in SEQ ID NO. 1.

7. A vector comprising the expression cassette of claim 5.

8. Use of the vector of claim 7 for the preparation of a formulation or composition for the treatment of post-myocardial infarction cardiac injury.

9. A pharmaceutical formulation comprising (a) the carrier of claim 7, and (b) a pharmaceutically acceptable carrier or excipient.

10. A host cell comprising the vector of claim 7 or the expression cassette of claim 5 integrated into its chromosome.