CN117511892B - Application of FTO protein in promotion of tree breeding - Google Patents

Application of FTO protein in promotion of tree breeding Download PDF

Info

Publication number
CN117511892B
CN117511892B CN202410014733.4A CN202410014733A CN117511892B CN 117511892 B CN117511892 B CN 117511892B CN 202410014733 A CN202410014733 A CN 202410014733A CN 117511892 B CN117511892 B CN 117511892B
Authority
CN
China
Prior art keywords
fto
tree
protein
poplar
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410014733.4A
Other languages
Chinese (zh)
Other versions
CN117511892A (en
Inventor
李晓娟
张耿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Forestry University
Original Assignee
Beijing Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Forestry University filed Critical Beijing Forestry University
Priority to CN202410014733.4A priority Critical patent/CN117511892B/en
Publication of CN117511892A publication Critical patent/CN117511892A/en
Application granted granted Critical
Publication of CN117511892B publication Critical patent/CN117511892B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses an application of FTO protein in promoting tree propagation, belonging to the field of forestry molecular biology science; the FTO protein is a protein in an animal that has no homologous proteins in a plant. After the FTO protein is highly expressed in poplar, plant height, internode number, adventitious root number and total root length are all increased; under salt stress, the overexpressed plants have increased tolerance to salt stress compared to the wild type. Thus by expression ofFTOThe gene can obtain new poplar variety with high yield and high stress resistance, and has important value in raising forestry productivity.

Description

Application of FTO protein in promotion of tree breeding
Technical Field
The invention belongs to the technical field of forestry molecular biology, and particularly relates to application of FTO protein in promoting tree breeding.
Background
Poplar @ treePopulusL.) is a populus plant, and the total genus is about 100 or more, and about 62 species in our country. The poplar has high growth speed, quick wood forming and straight trunk, and on one hand, the poplar can bring economic benefits to human beings, such as important processing raw materials of wood, paper making, matches, sanitary chopsticks, packaging industry and the like; on the other hand, the ecological agent has important ecological value, not only can prevent wind and fix sand and improve the ecological environment of the desert, but also can fix carbon dioxide and contributes to the double-carbon target.
FTO (Fat Mass and Obesity Associated) is an animal RNA demethylase, has the function of regulating development, and has no homologous protein in plants. Previous studies found that after FTO was transferred into rice and potato, both rice and potato yields and biomass increased significantly, significantly promoting proliferation of meristematic cells of rice roots and formation of tillering buds. However, by now the number of devices,FTOrelated studies of genes in woody plants have not been reported.
Forest is the most abundant renewable resource on earth, and can be used as an energy material and plays an important role in water and soil conservation and environmental protection. In the process of carrying out genetic improvement on the forest, the conventional genetic breeding method has the defects of long breeding improvement period and the like. The conventional breeding technology and the molecular biology means are combined, so that the breeding period can be greatly shortened, the wood quality of artificial forests can be improved from the source by utilizing the genetic engineering technology, and the wood growth rate is accelerated.
Disclosure of Invention
In view of this, in order to overcome the above-mentioned drawbacks, the present invention has been experimentally explored to apply FTO protein in animals to a tree cultivation method, specifically:
in a first aspect, the invention provides the use of an FTO protein in promoting tree propagation, said tree expressing the FTO protein.
Preferably, the tree comprises an exogenous lead-inFTOAnd (3) a gene.
Preferably, the tree expresses FTO protein at high levels.
Preferably, the amino acid sequence of the FTO protein comprises the amino acid sequence shown in SEQ ID No.1, or a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 1.
Preferably, the FTO protein is encodedFTOThe nucleotide sequence of the gene comprises the nucleotide sequence shown as SEQ ID NO.2 or a sequence with at least 90% identity with the sequence shown as SEQ ID NO. 2.
Based on the codon optimization strategies of different tree species, the codon optimization can be performed on the basis of the nucleotide sequence shown in SEQ ID NO.2, so that the nucleotide sequence is suitable for the application of different tree species.
Preferably, the sequence of at least 90% identity comprises any number between 90% and 100%, for example at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.
Preferably, said promoting tree propagation comprises exhibiting a relative non-introductionFTOGene wild type tree, introductionFTOThe root length of the transgenic tree after the gene is increased,An increase in the number of adventitious roots, an increase in plant height, an increase in internode number and/or an increase in salt stress tolerance.
Preferably, the tree is a broadleaf tree, including deciduous broadleaf trees, evergreen broadleaf trees, e.g., trees of the genus salix, populus and salix in the family salicaceae, more preferably, the tree is a tree of the genus populus, including populus pie（Tacamahaca）Populus alba pie（Leuce）Populus nigra pie（Aigeiros）Populus euphratica pie（Turanga）Large She Yangpa（Leucoides）Further preferably, the tree is aspen, silver aspen, river aspen, castanea longata Mao Yang, triploid aspen, 84k aspen in aspen pie.
In a second aspect of the invention, there is provided a cell expressing an FTO protein, the cell being derived from a tree cell.
Preferably, the cells highly express FTO protein.
Preferably, the cells include exogenous introductionFTOAnd (3) a gene.
Preferably, the amino acid sequence of the FTO protein comprises the amino acid sequence shown in SEQ ID No.1, or a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 1.
Preferably, the FTO protein is encodedFTOThe nucleotide sequence of the gene comprises the nucleotide sequence shown as SEQ ID NO.2 or a sequence with at least 90% identity with the sequence shown as SEQ ID NO. 2.
Based on the codon optimization strategies of different tree species, the codon optimization can be performed on the basis of the nucleotide sequence shown in SEQ ID NO.2, so that the nucleotide sequence is suitable for the application of different tree species.
Preferably, the sequence of at least 90% identity comprises any number between 90% and 100%, for example at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.
Preferably, the tree is a broadleaf tree, including deciduous broadleaf trees, evergreen broadleaf trees, e.g., trees of the genus salix, populus and salix in the family salicaceae, more preferably, the tree is populusTrees of genus, including populus pie（Tacamahaca）Populus alba pie（Leuce）Populus nigra pie（Aigeiros）Populus euphratica pie（Turanga）Large She Yangpa（Leucoides）Further preferably, the tree is aspen, silver aspen, river aspen, castanea longata Mao Yang, triploid aspen, 84k aspen in aspen pie.
Preferably, the cell may be a targeted cell from any tree, such as a cell from the root, stem, trunk, leaf, flower, callus, etc. of a tree.
In a third aspect, the present invention provides a method of promoting tree propagation, the method comprisingFTOThe gene is introduced into the tree.
Preferably, said promoting tree propagation comprises promoting an increase in root length, an increase in the number of adventitious roots, an increase in plant height, an increase in internode numbers, and/or an increase in salt stress tolerance.
Preferably, the tree expresses FTO protein at high levels.
Preferably, the amino acid sequence of the FTO protein comprises the amino acid sequence shown in SEQ ID No.1, or a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID No. 1.
Preferably, the FTO protein is encodedFTOThe nucleotide sequence of the gene comprises the nucleotide sequence shown as SEQ ID NO.2 or a sequence with at least 90% identity with the sequence shown as SEQ ID NO. 2.
Based on the codon optimization strategies of different tree species, the codon optimization can be performed on the basis of the nucleotide sequence shown in SEQ ID NO.2, so that the nucleotide sequence is suitable for the application of different tree species.
Preferably, the sequence of at least 90% identity comprises any number between 90% and 100%, for example at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.
Preferably, the said willFTOThe step of introducing the gene into the tree comprises:
s1 gene cloning: obtainingFTOCoding region sequences of genes, including synthetic FTO sequences and constructsConstructing plasmid and amplifying by using the obtained plasmid as templateFTOCoding region sequence of the gene;
s2, constructing a carrier: will beFTOThe coding region sequence of the gene is connected to an expression vector by a double enzyme digestion method to constructFTOAn overexpression vector; preferably, the over-expression vector is 35S:FTOoverexpression vector
S3 genetic transformation: introducing the expression vector into trees by using an agrobacterium-mediated genetic transformation method to obtain transgenic plants with over-expression;
s4, positive seedling identification: extracting genome of the plant, and identifying positive transgenic plant.
Preferably, the tree is adapted to the tree ranges defined above. More preferably, the tree is a aspen pie tree.
The fourth aspect of the invention provides a tree prepared by the method for promoting tree propagation, which is highly expressedFTOAnd (3) a gene.
Preferably, transgenic plants that highly express FTO have increased tree root length, increased number of adventitious roots, increased plant height, increased internode numbers, and/or increased salt stress tolerance relative to wild type trees.
Preferably, the tree is adapted to the tree ranges defined above. More preferably, the tree is a aspen pie tree.
In a fifth aspect of the present invention, there is provided an application of the tree described above, the application comprising:
(1) As an energy substance;
(2) Pulp manufacturing;
(3) Building decoration; or alternatively, the first and second heat exchangers may be,
(4) And (5) environmental protection.
Compared with the prior art, the invention has the following beneficial technical effects:
the invention transfers the FTO protein in animals into woody plants for the first time.
FTO protein is a protein in animals and no homologous protein in plants. The invention discovers that the plant extract is introduced into treesFTOAfter the gene and the FTO protein are expressed in high degree, the gene and the FTO protein can be expressed in high degreePromoting the growth of trees, and increasing plant height, internode number, number of adventitious roots and total root length; under salt stress, the overexpressed plants have increased tolerance to salt stress compared to the wild type. Thus by expression ofFTOThe gene can obtain new poplar variety with high yield and high stress resistance, and has important value in raising forestry productivity.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions of the prior art, the drawings that are needed in the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a backbone map of pCAMBIA2300 vector;
FIG. 2 is a schematic view of35Spro::FTOTransgenic poplarFTOTranscriptional level expression level detection
FIG. 3 is an overexpression ofFTOPromoting the rooting phenotype of poplar;
FIG. 4 is an overexpression ofFTOPromoting a poplar rooting statistical graph, wherein the statistical graph A is a total root length statistical graph of adventitious roots, and the statistical graph B is as follows: counting the number of adventitious roots;
FIG. 5 is an overexpression ofFTOPromoting poplar growth phenotype;
FIG. 6 is an overexpression ofFTOPromoting poplar growth statistical diagram, wherein A is plant height statistical diagram, B: an internode number statistical graph;
FIG. 7 is an overexpression ofFTOIncreasing the salt stress tolerance phenotype.
Detailed Description
The plant material is silver aspenPopulus alba×Populus glandulosa) Clone 84K.
The following materials or reagents, unless otherwise specified, are all commercially available.
The invention is further illustrated below with reference to specific examples.
Example 1: poplar treeFTOCloning of coding region sequences of genes
(1) Target geneFTOIs synthesized by (a)
Downloading in NCBI (https:// www.ncbi.nlm.nih.gov /) databaseFTO(Gene number: NM-001080432.3) Gene sequence and protein coding sequence of the Gene, the gene was synthesized by the company (Beijing Liuhua Dairy Gene technology Co., ltd.) and a plasmid containing the gene was provided.
The amino acid sequence of the FTO protein is shown in SEQ ID NO. 1:
MKRTPTAEEREREAKKLRLLEELEDTWLPYLTPKDDEFYQQWQLKYPKLILREASSVSEELHKEVQEAFLTLHKHGCLFRDLVRIQGKDLLTPVSRILIGNPGCTYKYLNTRLFTVPWPVKGSNIKHTEAEIAAACETFLKLNDYLQIETIQALEELAAKEKANEDAVPLCMSADFPRVGMGSSYNGQDEVDIKSRAAYNVTLLNFMDPQKMPYLKEEPYFGMGKMAVSWHHDENLVDRSAVAVYSYSCEGPEEESEDDSHLEGRDPDIWHVGFKISWDIETPGLAIPLHQGDCYFMLDDLNATHQHCVLAGSQPRFSSTHRVAECSTGTLDYILQRCQLALQNVCDDVDNDDVSLKSFEPAVLKQGEEIHNEVEFEWLRQFWFQGNRYRKCTDWWCQPMAQLEALWKKMEGVTNAVLHEVKREGLPVEQRNEILTAILASLTARQNLRREWHARCQSRIARTLPADQKPECRPYWEKDDASMPLPFDLTDIVSELRGQLLEAKP
the nucleotide sequence of the FTO gene is shown as SEQ ID NO. 2:
ATGAAGCGCACCCCGACTGCCGAGGAACGAGAGCGCGAAGCTAAGAAACTGAGGCTTCTTGAAGAGCTTGAAGACACTTGGCTCCCTTATCTGACCCCCAAAGATGATGAATTCTATCAGCAGTGGCAGCTGAAATATCCTAAACTAATTCTCCGAGAAGCCAGCAGTGTATCTGAGGAGCTCCATAAAGAGGTTCAAGAAGCCTTTCTCACACTGCACAAGCATGGCTGCTTATTTCGGGACCTGGTTAGGATCCAAGGCAAAGATCTGCTCACTCCGGTATCTCGCATCCTCATTGGTAATCCAGGCTGCACCTACAAGTACCTGAACACCAGGCTCTTTACGGTCCCCTGGCCAGTGAAAGGGTCTAATATAAAACACACCGAGGCTGAAATAGCCGCTGCTTGTGAGACCTTCCTCAAGCTCAATGACTACCTGCAGATAGAAACCATCCAGGCTTTGGAAGAACTTGCTGCCAAAGAGAAGGCTAATGAGGATGCTGTGCCATTGTGTATGTCTGCAGATTTCCCCAGGGTTGGGATGGGTTCATCCTACAACGGACAAGATGAAGTGGACATTAAGAGCAGAGCAGCATACAACGTAACTTTGCTGAATTTCATGGATCCTCAGAAAATGCCATACCTGAAAGAGGAACCTTATTTTGGCATGGGGAAAATGGCAGTGAGCTGGCATCATGATGAAAATCTGGTGGACAGGTCAGCGGTGGCAGTGTACAGTTATAGCTGTGAAGGCCCTGAAGAGGAAAGTGAGGATGACTCTCATCTCGAAGGCAGGGATCCTGATATTTGGCATGTTGGTTTTAAGATCTCATGGGACATAGAGACACCTGGTTTGGCGATACCCCTTCACCAAGGAGACTGCTATTTCATGCTTGATGATCTCAATGCCACCCACCAACACTGTGTTTTGGCCGGTTCACAACCTCGGTTTAGTTCCACCCACCGAGTGGCAGAGTGCTCAACAGGAACCTTGGATTATATTTTACAACGCTGTCAGTTGGCTCTGCAGAATGTCTGTGACGATGTGGACAATGATGATGTCTCTTTGAAATCCTTTGAGCCTGCAGTTTTGAAACAAGGAGAAGAAATTCATAATGAGGTCGAGTTTGAGTGGCTGAGGCAGTTTTGGTTTCAAGGCAATCGATACAGAAAGTGCACTGACTGGTGGTGTCAACCCATGGCTCAACTGGAAGCACTGTGGAAGAAGATGGAGGGTGTGACAAATGCTGTGCTTCATGAAGTTAAAAGAGAGGGGCTCCCCGTGGAACAAAGGAATGAAATCTTGACTGCCATCCTTGCCTCGCTCACTGCACGCCAGAACCTGAGGAGAGAATGGCATGCCAGGTGCCAGTCACGAATTGCCCGAACATTACCTGCTGATCAGAAGCCAGAATGTCGGCCATACTGGGAAAAGGATGATGCTTCGATGCCTCTGCCGTTTGACCTCACAGACATCGTTTCAGAACTCAGAGGTCAGCTTCTGGAAGCAAAACCC
the invention uses PCR method to amplify the obtained plasmid as templateFTOThe specific method of the coding region sequence of the gene is as follows:
(2) Target geneFTOAmplification of (2)
1) The FTO gene was analyzed and primers were designed with Kpn I and XbaI cleavage sites (bold italics for cleavage sites). The nucleotide sequence of the forward primer F1 is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse primer R1 is shown as SEQ ID NO. 4:
F1: CTGGTACCATGAAGCGCACCCCGACTGCCG（SEQ ID NO.3）
R1: GATTCTAGAGGGTTTTGCTTCCAGAAGCTGA（SEQ ID NO.4）
2) Containing compounds synthesized by companiesFTOThe plasmid of (2) is used as a template and amplified according to the following PCR reaction systemFTOA sequence; the reagents and amounts used below were as described in Takara primeSTAR Max DNA polymerase kit, see in particular the following Table:
table 1: PCR amplification system
3) The PCR reaction procedure was as follows:
pre-denaturation: 98 ℃ for 2 min; (denaturation: 98 ℃ C. 30 s, annealing: 55 ℃ C. 15 s, extension: 72 ℃ C. 30 s). Times.33 cycles; extension: 72 ℃ for 5 min; preserving heat at 4 ℃. Amplified outFTOThe gene sequence is shown as SEQ ID NO. 2.
4) Agarose gel electrophoresis detection
0.5g agarose was weighed, 50 mL of 1 xTAE was added, and after heating in a microwave oven, 5. Mu.L of GoldView (available from Zhongkey Biotech Co., ltd.) was added and thoroughly shaken and poured into a gel plate. After the agarose gel is solidified, adding the mixture of PCR product and Loading buffer (purchased from Beijing full-scale gold biotechnology Co., ltd.) into the gel well for electrophoresis detection, recoveringFTOIs a cDNA fragment of (C).
Example 2:FTOconstruction of Gene expression vector
(1) Double cleavage with cleavage sites using the endonucleases Kpn I and XbaIFTOThe product and expression vector pCAMBIA2300 (endonucleases Kpn I and XbaI are available from Bao Ri doctor materials technology Beijing Co., ltd.) are described in the specification for specific procedures and amounts. The structure of the pCAMBIA2300 vector is shown in FIG. 1: has 35S promoter to realize the over expression of the transformed gene. The products after cleavage were recovered separately, and the target gene fragment and the expression vector were ligated using T4-DNA ligase (available from Takara doctor materials technology Beijing Co., ltd., specific methods and amounts of operation were described in the specification).
(2) The ligation product was transformed into E.coli competent TOP 10 (available from Beijing Edley Biotech Co., ltd., specific methods of operation and amounts refer to the instructions), 600. Mu.L of LB medium was added, and then placed in a constant temperature shaker for resuscitation at 37℃and 150 rpm for 60 min. The resuscitated E.coli was centrifuged at 5,000 rpm for 5 min, 500. Mu.L of supernatant was aspirated and discarded. The remaining 100. Mu.L was sucked and stirred with a gun head, uniformly spread on LB solid medium containing 50. Mu.g/mL kanamycin, and the medium was inverted into a constant temperature incubator for growth at 37℃for 12-16 h. After colonies were grown, monoclonal colonies were picked and grown in 20mL LB liquid medium containing 50. Mu.g/mL kanamycin at 37℃for 6 h. Extracting plasmid (kit is purchased from Tiangen Biochemical technology Beijing Co., ltd., specific operation steps are referred to the instruction manual), sequencing by company, screening positive clone, and naming the carrier as pCAMBIA2300-35Spro::FTO。
(3) Vector pCAMBIA230035Spro::FTOTransformation into AgrobacteriumGV3101 (available from Vietnam company, beijing) was obtained as a vector pCAMBIA2300 (see the description for specific procedures)35Spro::FTOIs a strain of Agrobacterium.
Preparing an LB liquid culture medium: weighing 5g tryptone, 5g NaCl, 2.5 g yeast extract, adding ddH 2 The volume was fixed to a total volume of 500 mL. Sterilizing with steam at 121deg.C for 20 min, and cooling to room temperature. The preparation method of the LB solid medium refers to an LB liquid medium, 7 g agar powder is added before volume fixing, high-pressure steam sterilization is carried out for 20 min at 121 ℃, and cooling is carried out to room temperature.
Example 3: genetic transformation of poplar
Will beFTOThe expression vector is introduced into poplar leaves by agrobacterium-mediated genetic transformation, and is subjected to preculture, infection, dark culture, adventitious bud induction, bud rooting induction, propagation expansion, seedling hardening and greenhouse transplanting (the method refers to a method with subject group of forestry institute De of Chinese forestry science institute).
(1) And (3) material propagation: selecting 84K poplar aseptic seedlings which grow for about 4 weeks, cutting stem segments, and placing the stem segments in a rooting culture medium for breeding. The culture temperature is about 25 ℃, the illumination intensity is 50 mu mol m < -2 > s < -1 >, the photoperiod is 16 h/8 h, and the tissue culture seedlings are used for genetic transformation experiments after growing for 4-5 weeks.
(2) Blade preculture: cutting out the sterile tissue culture Miao Di to 6 leaf sequence leaves, transversely cutting 4-5 wounds on the main veins of the leaves by using a sterilized scalpel, and then placing the front surfaces of the leaves downwards on a differentiation culture medium without antibiotics for culturing for 1-2 days.
(3) Preparation of Agrobacterium invasion solution by absorbing vector pCAMBIA2300-35Spro::FTO300. Mu.L of Agrobacterium in 100mL of LB liquid medium containing antibiotics (50 mg/L kanamycin, 50mg/L rifampicin), were mixed and placed at 28℃and cultured overnight with shaking at 180 rpm/min. When the bacterial liquid OD 600 At 0.6-0.8, infection transformation is carried out.
(4) Infection and dark culture: in an ultra-clean bench, the pretreated leaves are soaked in agrobacterium liquid for 10-15 min, and the leaves are shaken for 2-3 times in order to make the injured parts of the leaves fully contact with the bacterial liquid. Taking out the leaf, sucking the bacterial liquid on the leaf with sterile filter paper, spreading the leaf surface of the leaf upwards on a differentiation culture medium without antibiotics, and culturing in dark at 25 ℃ for 3 days.
(5) Induction of resistant adventitious buds: in an ultra clean bench, dark treated leaves were transferred to a differentiation medium containing 50mg/L kanamycin and 200 mg/L timentin for cultivation (16: 16 h light/8: 8 h dark) at 25 ℃. 2. Growing adventitious buds around the week from the wound of the leaf, transferring the adventitious buds to a new differentiation medium for continuous growth when the adventitious buds grow to 0.5-1 cm;
(6) Rooting culture: the single adventitious bud with the length of more than 2cm is placed in a rooting culture medium containing kanamycin with the concentration of 30 mg/L and timentin with the concentration of 200 mg/L to induce rooting, so that the single adventitious bud grows into a complete plant. The stem segments are cut around and cultured on rooting culture medium containing timentin and kanamycin for secondary propagation.
(7) And (3) greenhouse transplanting: when the tissue culture seedlings grow for about one month and the root system is developed, seedling transplanting is carried out after hardening off for 2 days. Washing off the culture medium of poplar root with clear water, transplanting to sterilized nutrient soil, and culturing in a greenhouse.
The poplar medium formulation is shown in the following table:
table 2: culture medium formula
Example 4: identification of transgenic poplar
(1) To identify transgenic poplar: the forward primer was designed based on the 35S promoter sequence,FTOreverse primers were designed for sequence. The poplar genome is used as a template, if the vector is transferred into poplar, the gene fragment can be amplified by PCR, and if the vector is not transferred into poplar, the gene fragment cannot be amplified.
The primers were designed as follows:
35S-F：CAATGATGATGTCTCTTTGAAATCC （SEQ ID NO.5），
FTO-R：GGGTTTTGCTTCCAGAAGCTGA（SEQ ID NO.6）。
in an ultra clean bench, poplar leaves (transgenic poplar obtained in example 3) were cut and genomic DNA was extracted using DN 14-plant genomic DNA rapid extraction kit (available from beijing ideley biotechnology limited, reference instructions for specific procedures). PCR amplification was performed using the genomic DNA as a template and the primers 35S-F and FTO-R and 2xTaq Mix (purchased from Beijing Bomaide Biotechnology Co., ltd.). And (3) carrying out agarose gel electrophoresis detection on the PCR product, and identifying that the PCR product is successfully transferred into 35S:FTOpositive plants of (a).
The PCR reaction system and the reaction procedure are as follows:
example 5: and detecting the expression quantity of the FTO gene in the transgenic poplar.
(1) Extracting total RNA of 84K poplar leaves: 84K tissue culture seedling leaves were cut and ground in liquid nitrogen for later use, and an EASYspin Plus plant RNA rapid extraction kit (purchased from Beijing Edley Biotech Co., ltd., for specific procedures reference instructions) was used to obtain an RNA solution.
(2) cDNA synthesis: preparing a reverse transcription mixed solution according to the following system, and placing the reverse transcription mixed solution in a 200 mu L RNase free PCR tube; the system is as follows:
table 3: reverse transcription system
Fully and uniformly mixing, and then incubating at 42 ℃ for 15 min; then heating at 85 ℃ for 5s to inactivate the TransScript RT/RI and gDNA remote; the obtained cDNA was stored at-20 ℃. All reagents used in the reaction were purchased from Beijing full gold biotechnology Co.
(3) Fluorescent real-time quantitative PCR method detectionFTOExpression level:
the cDNA obtained by the reverse transcription was quantitatively determined for gene expression using the Tiangen Biochemical technology Co., ltd SuperReal PreMix Plus kit. The method comprises the following specific steps:
the amplification primers are as follows:
qRT-F (forward primer): ACTTGGCTCCCTTATCTGACC (SEQ ID NO. 7); qRT-R (reverse primer): TGTGCAGTGTGAGAAAGGCTT (SEQ ID NO. 8).
The Real-time PCR reaction system is as follows: 2X SuperReal PreMix Plus. Mu.L; the forward primer (10 mu M) is 0.8 mu L; reverse primer (10 [ mu ] M) 0.8 [ mu ] L; cDNA template 0.5 [ mu ] L; distilled water 7.9 μl.
The fluorescent real-time quantitative PCR amplification conditions are as follows: pre-denaturation: 95. at the temperature of 15 min; amplification by a three-step method: 95. repeating the amplification step 40 times at 10 s,50-60 ℃,20 s,72 ℃ and 30 s, and collecting fluorescent signals after each cycle is finished; and raising the temperature by 0.5 ℃ at 65-95 ℃ and 5. 5s, and drawing a melting curve.
The detection result of the transcription level expression level of the transgenic poplar is shown in figure 2. In FIG. 2, WT is a control of uninfected 84K poplar leaf explants; #1, #3, #6, #7, #8, #9 are respectively35S::FTODifferent lines of transgenic 84K poplar. As a result, it was found that in the wild-type plants, it could not be detectedFTOIn a heterologous over-expression plant, the detection ofFTOIs expressed by (a).
Example 6: transgenic poplar phenotyping
The first two internodes of the identified transgenic tissue culture seedling and the wild poplar tissue culture seedling and about 1-2cm including the stem tip are cut and placed in rooting culture medium for growth, and after the transgenic tissue culture seedling grows for 1 month, the root length and the number of adventitious roots are measured, as shown in fig. 3 and 4, and the result shows that the root length and the number of adventitious roots of the over-expression plant are obviously higher than those of the wild poplar tissue culture seedling.
The tissue culture seedlings growing for 1 month are transplanted to a greenhouse for growth after hardening, and the plant height and the internode number are measured after the tissue culture seedlings grow for 1 month, as shown in fig. 5 and 6. The results show that the plant height and the internode number of the over-expressed plants are obviously higher than those of the wild type plants.
The materials are used for researching salt stress response, the first two internodes of the identified transgenic tissue culture seedling and the wild poplar tissue culture seedling and about 1 cm to 2cm including the stem tip are cut and placed in rooting culture medium added with 75mM and 100 mM NaCl for growth respectively,after one month of culture, rooting was observed. According to the results shown in FIG. 7, the rooting number of wild type plants was reduced under 75mM salt stress treatment, while the over-expressed poplar plants still produced more roots. Under the 100 mM NaCl treatment condition, the wild type can not root along with the aggravation of the salt stress degree, and the over-expression plant can still root. Experimental results show that compared with wild type plants,FTOthe over-expression poplar plant has stronger tolerance to high-concentration salt environment.
The invention willFTOAfter the poplar is transferred into 84K poplar by molecular biology means, biomass is increased, and tolerance to salt stress is enhanced, so that a novel tree species is obtained. The invention also provides a novel poplar improvement method.
The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims (4)

  1. The application of the FTO protein in promoting tree propagation is characterized in that the tree expresses the FTO protein, the amino acid sequence of the FTO protein is shown as SEQ ID NO.1, the tree propagation is promoted to promote the root length increase, the number of adventitious roots increase, the plant height increase, the internode number increase and/or the salt stress tolerance increase of the tree, and the tree is 84K poplar.
  2. 2. The use of claim 1, wherein said tree comprises an exogenous lead-inFTOAnd (3) a gene.
  3. 3. The use according to claim 1 or 2, wherein the FTO protein is encodedFTOThe nucleotide sequence of the gene is shown as SEQ ID NO. 2.
  4. 4. A method for promoting tree propagation is characterized by comprising the following steps ofFTOGene transfer into trees, saidFTOThe amino acid sequence of the gene codes is shown as SEQ ID NO.1, the promotion of tree propagation is to promote the root length increase, the number of adventitious roots increase, the plant height increase, the internode number increase and/or the salt stress tolerance increase of trees, and the trees are 84K poplar.
CN202410014733.4A 2024-01-04 2024-01-04 Application of FTO protein in promotion of tree breeding Active CN117511892B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410014733.4A CN117511892B (en) 2024-01-04 2024-01-04 Application of FTO protein in promotion of tree breeding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410014733.4A CN117511892B (en) 2024-01-04 2024-01-04 Application of FTO protein in promotion of tree breeding

Publications (2)

Publication Number Publication Date
CN117511892A CN117511892A (en) 2024-02-06
CN117511892B true CN117511892B (en) 2024-04-05

Family

ID=89756992

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410014733.4A Active CN117511892B (en) 2024-01-04 2024-01-04 Application of FTO protein in promotion of tree breeding

Country Status (1)

Country Link
CN (1) CN117511892B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112063631A (en) * 2020-09-17 2020-12-11 东北林业大学 PtrLBD4-3 gene of populus trichocarpa as well as encoding protein and application thereof
CN113717265A (en) * 2021-09-08 2021-11-30 兰州大学 Gene PalZAT10-1 for improving abiotic stress tolerance of plants and application thereof
CN113831398A (en) * 2021-11-25 2021-12-24 北京林业大学 PagARGOS protein, coding gene and application thereof
CN115927233A (en) * 2022-09-02 2023-04-07 北京林业大学 PagFIP37 protein, coding gene of PagFIP37 protein and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112063631A (en) * 2020-09-17 2020-12-11 东北林业大学 PtrLBD4-3 gene of populus trichocarpa as well as encoding protein and application thereof
CN113717265A (en) * 2021-09-08 2021-11-30 兰州大学 Gene PalZAT10-1 for improving abiotic stress tolerance of plants and application thereof
CN113831398A (en) * 2021-11-25 2021-12-24 北京林业大学 PagARGOS protein, coding gene and application thereof
CN115927233A (en) * 2022-09-02 2023-04-07 北京林业大学 PagFIP37 protein, coding gene of PagFIP37 protein and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Exploring N6-methyladenosine (m6A) modification in tree species: opportunities and challenges;Muthusamy Ramakrishnan等;《Horticulture Research》;20231229;第11卷(第1期);uhad284 *
PagKNAT2/6b基因调控杨树生长发育的机制研究;赵岩秋;《中国博士学位论文全书数据库(农业科技辑)》;20220115(第1期);第1-146页 *

Also Published As

Publication number Publication date
CN117511892A (en) 2024-02-06

Similar Documents

Publication Publication Date Title
CN110317815B (en) Gene for regulating and controlling adventitious root generation of populus euphratica, detection primer, expression vector and application
CN110819639A (en) Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof
CN113831398B (en) PagARGOS protein, coding gene and application thereof
CN117511892B (en) Application of FTO protein in promotion of tree breeding
CN116083445A (en) CrBZR1 gene and application thereof
CN112521475B (en) Wheat TaLAX1-A gene and application thereof in improving wheat immature embryo regeneration efficiency
CN114921473A (en) Gene for negatively regulating synthesis of cassava endogenous salicylic acid and application thereof
CN111411124A (en) Application of peanut hairy root strain in improving low-nitrogen and high-salt resistance of peanuts
CN115181749B (en) Gene PsPRE for regulating root development of populus microphylla and application thereof
CN116375835B (en) Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology
CN118406698B (en) Application of ZmWIND gene in improving corn genetic transformation efficiency
CN113584055B (en) Pepper PNPAL3 gene and application thereof in resisting blast of peppers
CN118406669B (en) Thiol peroxidase coding gene and application thereof
CN116004646B (en) Tobacco NtSWEET gene and application thereof
CN115704035B (en) Tobacco NtDSR2 gene and application thereof
CN115948460B (en) Pepper epidemic disease resistance related gene CaWRKY66 and application thereof
CN115806999B (en) Tobacco NtEIJ gene and application thereof
CN114875043B (en) Betula alba BpPIF4 gene participating in adventitious root development and application thereof
CN117568396A (en) Application of overexpression of aspen strigoside receptor PtoD14 gene in improving wood yield
CN115820723A (en) PtrERF69 protein and application of coding gene thereof
CN118599886A (en) Application of PdRabG f gene in regulation and control of adventitious root elongation of populus deltoidea
CN118530325A (en) BnaDR1 gene, protein and application thereof in controlling drought resistance of brassica napus
CN116535476A (en) Stem tumor mustard BjuDA1 R356K Gene, protein coded by gene and application of gene
CN118222556A (en) PagMUR1a protein and application thereof
CN118813693A (en) Application of upland cotton GhLRP1 gene in regulation and control of plant dwarf

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant