CN117511882A

CN117511882A - Universal immune effector cell and preparation method and application thereof

Info

Publication number: CN117511882A
Application number: CN202310054093.5A
Authority: CN
Inventors: 曾浔; 方宏玉; 张毅茜; 王国璨
Original assignee: First Affiliated Hospital of Zhejiang University School of Medicine
Current assignee: First Affiliated Hospital of Zhejiang University School of Medicine
Priority date: 2022-08-03
Filing date: 2023-02-03
Publication date: 2024-02-06
Also published as: WO2024027758A1

Abstract

The invention provides a universal CAR-T cell (IRU-CAR-T), a preparation method and application thereof, wherein the universal CAR-T cell simply and efficiently introduces CAR and mutated CnA or CnB fragments by using gene editing technology such as CRISPR/Cas9 and AAV fixed-point knockout knock-in technology. The universal CAR-T cells and the immunosuppression medicament CsA/FK506 are adopted to treat tumors, so that the activity of T cells of a patient can be reduced, the rejection of the patient on IRU-CAR-T cells can be reduced, the field planting of the IRU-CAR-T cells in the patient can be improved, and the anticancer effect of the IRU-CAR-T cells can be exerted. Meanwhile, the universal CAR-T cell enables a strategy of removing the CAR-T after treatment, and the safety of CAR-T therapy can be greatly improved.

Description

Universal immune effector cell and preparation method and application thereof

The application requires the priority of the prior application of the patent application number 202210926814.2 which is filed by the China national intellectual property office on the 8 th and 3 th days of 2022 and has the name of 'a general CAR-T cell and a preparation method and application thereof'. The entirety of this prior application is incorporated by reference into this application.

Technical Field

The invention belongs to the technical field of biological medicines, and relates to an improved immune effector cell, in particular to a general T cell and application thereof in treating tumors and autoimmune diseases.

Background

Chimeric antigen receptor T Cell (Chimeric Antigen Receptor T-Cell, CAR-T) immunotherapy is a promising immunotherapeutic approach today, showing higher survival rates in many clinical phase III trials of advanced cancers. Currently, the therapy has been commercialized and approved by the U.S. food and drug administration, including Kymriah and yescanta approved in 2017, and Tecartus approved in 2020.

The basic structure of a CAR generally includes a Tumor Associated Antigen (TAA) binding region, a transmembrane region and an intracellular signaling region. The CAR can directly target the TAA on the surface of the tumor, activate CAR-T cells, release perforin/granzyme B and kill the tumor cells. T cells of current CAR-T therapies are mostly taken from the patient's own peripheral blood, CAR is chimeric on T cell surface in vitro by gene editing technology and mass expanded in vitro, and then CAR-T cells are re-injected into the patient to treat the disease. Although such autologous CAR-T therapy has met with great success, its range of application is very limited. First, this "personalized" treatment regimen is very expensive, e.g., kymeriah requires $475,000, far beyond the tolerance range of an average household. Second, autologous CAR-T cells can take about three weeks to prepare, and some critically ill patients can become extremely ill or even die during the preparation process. Third, the number of T cells in a patient may be small or the quality of T cells may be poor due to disease or prior treatment (e.g., radiation and chemotherapy), making it difficult to meet the requirements for T cells in preparation. The current autologous CAR-T therapy efficacy or varies from person to person and is more difficult to evaluate.

Thus, a need for generalization of CAR-T therapies has arisen. The general CAR-T cells are taken from healthy human T cells, the quality and the quantity of the general CAR-T cells are ensured, the CAR-T preparation can be scaled and unified, and the preparation cost is greatly reduced. More importantly, the universal CAR-T cells can be frozen and taken at any time, so that the CAR-T therapy is more instant. However, since universal CAR-T therapy is based on healthy people rather than autologous T cells, this therapy necessarily faces two major problems in allogeneic cell transplantation: graft-versus-host disease (GVHD) and host rejection graft (HVGR). The former is caused by the attack of the donor cells on the recipient cells, which can lead to serious and even life-threatening complications. The latter is caused by rejection of the donor cells by the recipient cells, making it difficult for CAR-T cells to persist and proliferate in the patient, reducing tumor killing effects and losing subsequent tumor monitoring effects.

The main solution for universal CAR-T cell GVHD involves genetic engineering of T cells. Since GVHD occurs predominantly with the αβ T cell surface receptor (TC)R), prior studies have focused on the knockout of T cell surface αβ TCRs by various genetic tools such as transcription activator-like effector nuclease, TALENs, CRISPR-Cas9, and the like. First example Using allogeneic αβ TCR ^- Cancer treatment with CAR-T cells was found in 2015, poilot and Qasim et al knocked out T cell surface αβ TCR and CD52 by TALENs, and B-ALL tumors were cleared in NSG mice, and no GVHD was evident. After two years, qasim et al successfully applied this technique to clinic, cured two B-ALL infants around 13 months at the molecular level, and did not see GVHD. In recent years, TCR was constructed ^- CAR-T has become a popular strategy for general purpose CAR-T to address GVHD. Moreover, due to rapid developments in gene editing technology (e.g. crispr-Cas 9) and viruses (e.g. adeno-associated viruses, AAV) or non-viral vectors that introduce CARs into cells, researchers have gradually achieved efficient knockout of αβ TCRs and precise introduction of CARs at specific sites. For example, eyqm et al use CRISPR-Cas9 to form a gap at the TRAC site of the αβ TCR, and use homologous recombination template repair principle to accurately introduce the CAR into the TRAC site using AAV as a vector while disrupting the αβ TCR locus structure. The one-step method for knocking out the TCR+knocking in the CAR reduces the self-activation signal of the CAR, internalizes the expression of the CAR, slows down the differentiation and the exhaustion of effector T cells, and finally improves the anti-tumor capability of the CAR-T cells, thereby being one of the mainstream methods for preparing the general CAR-T in the prior art.

A second important problem with universal CAR-T cells is that allogeneic CAR-T cells, due to expression of their own HLA, are recognized, attacked and rejected by recipient cells, particularly recipient T cells, i.e., HVGR occurs, thereby affecting proliferation and anti-tumor effects of donor CAR-T cells in vivo. At present, besides the traditional measures of HLA matching or marrow cleaning before the implantation of the CAR-T cells, the solution of the HVGR mainly has two major directions, and firstly, the HLA of the CAR-T cells is made to be 'invisible' relative to a receptor immune system, for example, the rejection is solved by knocking out beta 2 microglobulin to construct the CAR-T cells with HLA-I molecules deleted. However, the absence of HLA-I makes it more vulnerable to NK cells of the recipient, and therefore, the rejection of NK cells by such HLA-I molecule-deleted CAR-T would be greatly increased. To solve rejection from an HLA perspective, or to require more complex gene editing work, such as expression of non-classical HLA (e.g., HLA-E and HLA-G) on the surface of T cells, or siglec-7, -9, etc., to evade NK cell-mediated rejection. However, excessive gene editing presents greater safety risks, such as greater off-target effects and cytotoxicity, among others. In addition, another approach to addressing HVGR has focused on suppressing the recipient immune system, especially T cells. Such as expressing certain molecules on CAR-T cells that can bind to activated lymphocyte markers, can inhibit the rejection of CAR-T cells by receptor-activated lymphocytes, thereby avoiding receptor rejection. For example, 41BB is one of the lymphocyte markers activated, and the Mamonkin research group can inhibit recognition and attack of the receptor lymphatic system by expressing 41BB receptor on the surface of the CAR-T cells, so that the survival time of the CAR-T cells in a patient is prolonged, and an important foundation is laid for the continuous existence of the subsequent CAR-T cells in the patient and the immune monitoring. However, since such CAR-T cells can indiscriminately recognize activating lymphocyte markers, there is a continuing inhibition of the normal functioning of the recipient lymphatic system, and safety is questionable. And the activated CAR-T cells themselves also express 41BB receptor, resulting in self-killing of the CAR-T cells, reducing the tumor clearance efficiency of the CAR-T cells. Following the idea of suppressing the recipient immune system, the use of immunosuppressive drugs would be or would be a new approach to solving HVGR. For example, the immunosuppressive drugs cyclosporin (CsA) or Tacrolimus (FK 506) are commonly used in the treatment of diseases requiring stem cell transplantation or organ transplantation. The mechanism is mainly to combine with cyclophilin to form a complex, inhibit the phosphorylation of calmodulin phosphatase (Calcineurin), inhibit the nuclear transport process and then block the activation of the subsequent NFAT signal channel, thereby inhibiting T cell activation, proliferation and transcription and secretion of cytokines (such as IL-2 and IFN-gamma). Thus, if CsA/FK506 can be used to inhibit a recipient T cell, it is necessary to greatly reduce the HVGR response of the recipient T cell to the donor CAR-T cell. Furthermore, csA/FK506 is a first-line drug for preventing rejection of organ transplantation, and can be used for a long time by patients, and the safety of the CsA/FK506 is fully verified. However, due to the general inhibition of T cells by CsA/FK506, both recipient T cells and infused CAR-T cell activation are inhibited, making them unusable in the field of CAR-T therapies. Thus, there is a need to engineer CAR-T cells to be able to antagonize the inhibitory effects of CsA/FK506, thereby allowing the CAR-T cells to perform normal killing functions.

However, if the modified CAR-T cells exist for a long time, the hidden danger of tumor initiation exists. Therefore, there is a need to provide a universal CAR-T cell that can still function properly in the event that the recipient immune system is suppressed, killing tumor cells; and the HVGR needs to be restarted after the treatment is finished, so that the variant general CAR-T cells can be cleared, and evacuation after the tumor treatment is finished is realized.

Disclosure of Invention

The present invention provides a universal immune effector cell that expresses a foreign protein 1, the foreign protein 1 being a mutant CnA (calmodulin phosphatase a subunit) and/or a mutant CnB (calmodulin phosphatase B subunit). The immune effector cells may be T cells, NK cells, etc., and the T cells may be CD4 ⁺ T cells or CD8 ⁺ T cells. Preferably, the immune effector cell further expresses a foreign protein 2, said foreign protein 2 being capable of recognizing a tumor antigen or a pathogen antigen, in some embodiments of the invention said foreign protein 2 is a CAR (chimeric antigen receptor). The exogenous protein 1 and the exogenous protein 2 can be inserted into any position of immune effector cell genome.

In a preferred embodiment, to further avoid rejection of the host cell by the immune effector cell, it is preferred to interfere with the function of the TCR complex of the immune effector cell. The T cell receptor alpha constant region protein in the cell may be knocked out, and/or the T cell receptor beta constant region protein in the cell may be knocked out, in various ways known in the art, including, but not limited to, knocking out a T Cell Receptor (TCR) complex in the cell. In some embodiments of the invention, the TCR complex function of the cell is disrupted by inserting a gene encoding exogenous protein 1 and/or exogenous protein 2 into a gene encoding any one or any two or more of the constituent elements of the TCR complex of the immune effector cell, thereby disrupting the expression or function of any one or any two or more of the constituent elements of the TCR complex. In one embodiment of the invention, the CAR is inserted into the TCR TRAC site of immune effector cells. In another embodiment of the invention, the mutant CnA and/or mutant CnB is inserted into the TCR TRAC site of an immune effector cell. In yet another embodiment of the invention, the CAR and the mutant CnA are inserted into the TCR TRAC site of immune effector cells. In yet another embodiment of the invention, the CAR and the mutant CnB are inserted into the TCR TRAC site of immune effector cells. In yet another embodiment of the invention, the CAR, mutant CnA and mutant CnB are inserted into the TCR TRAC site of immune effector cells.

In a preferred embodiment of the present invention, a universal T cell is provided which expresses a foreign protein 1, said foreign protein 1 being a mutant CnA (calmodulin phosphatase a subunit) and/or a mutant CnB (calmodulin phosphatase B subunit). Preferably, the T Cell Receptor (TCR) complex, T cell receptor alpha constant region protein, and/or T cell receptor beta constant region protein in the universal T cell is knocked out. The T cells may be CD4 ⁺ T cells or CD8 ⁺ T cells.

In other preferred embodiments of the invention, a universal CAR T cell is provided that expresses a foreign protein 1 that is a mutant CnA (calmodulin phosphatase a subunit) and/or a mutant CnB (calmodulin phosphatase B subunit) and a foreign protein 2 that recognizes a tumor antigen or a pathogen antigen. Preferably, the T Cell Receptor (TCR) complex, T cell receptor alpha constant region protein, and/or T cell receptor beta constant region protein in the universal CAR T cell is knocked out. The T cells may be CD4 ⁺ T cells or CD8 ⁺ T cells.

In one embodiment of the invention, the universal CAR-T cell is a CAR inserted with mutant CnA and/or mutant CnB at the TCR TRAC site of the T cell.

According to the invention, the mutant CnA comprises an amino acid sequence which is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence shown in SEQ ID NO. 17. In one embodiment of the invention, the amino acid sequence of mutant CnA comprises SEQ ID No. 17 having an amino acid substitution at a position selected from the group consisting of: V314R, V314K, Y341F, T351E, L a or M347E. In one embodiment of the invention, the amino acid sequence of mutant CnA is as shown in any of SEQ ID NOS.1-7. Preferably, the nucleotide sequence encoding mutant CnA is as shown in any one of SEQ ID NOS.24-30.

According to the invention, the mutant CnB comprises an amino acid sequence which is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence shown in SEQ ID NO. 18. In one embodiment of the invention, the amino acid sequence of mutant CnB comprises SEQ ID NO 18 having an amino acid substitution at a position selected from the group consisting of: L124T, K LA, K125VQ, K125IE, V120S. In one embodiment of the invention, the amino acid sequence of mutant CnB is as set forth in any of SEQ ID No. 8-16. Preferably, the nucleotide sequence encoding mutant CnB is as shown in any of SEQ ID NOS.31-39.

According to the invention, endogenous T Cell Receptor (TCR) complexes, T cell receptor alpha constant region proteins, and/or T cell receptor beta constant region proteins in the T cells are knocked out. Preferably, the knockout comprises administering to the T cells one or more substances selected from the group consisting of: antisense RNA, siRNA, shRNA, CRISPR/Cas systems, RNA editing systems such as RNA Adenosine Deaminase (ADAR), RNA-guided endonucleases, zinc Finger Nucleases (ZFNs), mega-TAL nucleases, transcription activator-like effector nucleases (TALENs), meganucleases (meganucleases), base editing, CRISPR interference, and Zinc finger protein (zincfinger) gene repressor and/or transcription activator-like effector (TALE) gene repressor mediated transcriptional repression.

Preferably, the CRISPR/Cas9 technique is used to administer to T cells a guide RNA (gRNA) targeting a nucleic acid molecule (TRAC) encoding the T cell receptor alpha constant region protein to knock out the endogenous TCR. More preferably, the gRNA is selected from the sequences shown in any of SEQ ID NOS.19-23.

According to the present invention, the foreign protein 2 recognizes a tumor antigen or a pathogen antigen. The tumor antigen or pathogen antigen may be selected from Claudin18.2, claudin18.1, claudin 6, vascular endothelial growth factor receptor, phosphatidylinositol proteoglycan-3 (GPC 3), B Cell Maturation Antigen (BCMA), carbonic anhydrase 9 (CAIX), tEGFR, CD19, CD20, CD22, mesothelin, CEA and hepatitis B surface antigen, antifolate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), EPHa2, erb-B3, erb-B4, erbB dimer, EGFR vIII, folic acid binding protein (FBP), FCRL5, FCRH5, fetal acetylcholine receptor, GD2, 3, HMW-MAA, IL-22R-alpha, IL-13R-alpha 2 kinase insertion domain receptor (kdr), kappa light chain, lewis Y, L1 cell adhesion molecule (L1-CAM), melanomA-Associated antigen (MAGE) -A1, MAGE-A3, MAGE-A6, preferentially expressed melanoma antigen (PRAME), survivin, TAG72, B7-H6, IL-13 receptor alpha 2 (IL-13 Ra 2), CA9, GD3, HMW-MAA, CD171, G250/CAIX, HLA-AI MAGEA1, HLA-A2, PSCA, folate receptor-a, CD44v6, CD44v7/8, avb6 integrin, 8H9, NCAM, VEGF receptor, 5T4, fetal AchR, NKG2D ligand, CD44v6, double antigen, cancer-testis antigen, mesothelin, murine CMV, mucin 1 (MUC 1), MUC16, PSCA, NKG2D, NY-ESO-1, MART-1, gp100, G protein coupled receptor 5D (GPCR 5D), ROR1, TAG72, VEGF-R2, carcinoembryonic antigen (CEA), prostate specific antigen, PSMA, her2/neu, estrogen receptor, progesterone receptor, ephrin B2, CD123, c-Met, GD-2, O-acetylated GD2 (OGD 2), CE7, wilms tumor 1 (WT-1), cyclin A2, CCL-1, CD138, pathogen specific antigen, and antigens associated with a universal TAG. In one embodiment of the invention, the tumor antigen is CD19.

According to the invention, the foreign protein 2 is a Chimeric Antigen Receptor (CAR).

The CAR comprises: an antigen binding domain, a transmembrane domain, and an intracellular signaling domain.

The antigen binding domain binds to a tumor antigen or pathogen antigen as described previously. In one embodiment of the invention, the tumor antigen is CD19.

The intracellular signaling domain refers to the functional portion of the CAR that functions by transmitting information within the cell to regulate cellular activity via a defined signaling pathway by either generating a second messenger or by acting as an effector in response to such a messenger. In some embodiments of the invention, the intracellular signaling domain comprises a functional signaling domain derived from a stimulatory molecule and/or co-stimulatory molecule as defined below. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that contribute to an effective immune response. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD 11a/CD 18), ICOS (CD 278) and 4-1BB (CD 137), and the like, other examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF 1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2 Rbeta, IL2 Rgamma, IL7 Ralpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11D, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11B, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGA4 LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL, DNAM1 (CD 226), SLAMF4 (CD 244, 2B 4), CD84, CD96 (Tactive), CEACAM1, CRTAM, ly9 (CD 229), CD160 (BY 55), PSGL1, CD100 (SEMA 4D), CD69, SLAMF6 (NTB-A, ly 108), SLAM (SLAMF 1, CD150, IPO-3), BLAMME (SLAMF 8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a and ligands that specifically bind to CD 83. In some embodiments of the invention, the stimulatory molecule is a zeta chain that binds to a T cell receptor complex.

In some embodiments of the invention, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule.

In some embodiments of the invention, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from a stimulatory molecule.

In some embodiments of the invention, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain comprising two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule.

In some embodiments of the invention, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule.

In some embodiments of the invention, the CAR comprises an optional leader sequence at the amino terminus (N-terminus) of the CAR fusion protein.

In some embodiments of the invention, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., scFv) during cell processing and localization of the CAR to the cell membrane.

In some embodiments of the invention, the CAR comprises:

1) An antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, cd3ζ;

2) An antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, and cd3ζ;

3) An antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD137, and cd3ζ; and/or

4) An antibody or functional fragment thereof that specifically binds to a target antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, a costimulatory signaling domain of CD137, and cd3ζ.

In one embodiment of the invention, the CAR comprises an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% identical to the amino acid sequence set forth in SEQ ID No. 50.

In yet another aspect of the present invention, there is provided a method for preparing the aforementioned universal immune effector cell, the method comprising: engineering the immune effector cell to obtain the universal immune effector cell expressing the exogenous protein 1.

Preferably, the method further comprises knocking out endogenous T cell receptor complexes, T cell receptor alpha constant region proteins, and/or T cell receptor beta constant region proteins in the cells.

More preferably, the method further comprises causing the cell to express a foreign protein 2 capable of recognizing a tumor antigen or pathogen antigen, in one embodiment of the invention the foreign protein 2 is a chimeric antigen receptor.

In a preferred embodiment of the present invention, there is provided a method for preparing a universal T cell, the method comprising: engineering the T cells to obtain the universal T cells expressing the mutant CnA and/or the mutant CnB.

Preferably, the method further comprises knocking out endogenous T cell receptor complexes, T cell receptor alpha constant region proteins, and/or T cell receptor beta constant region proteins in the T cells.

More preferably, the method further comprises causing the T cells to express a chimeric antigen receptor capable of recognizing a tumor antigen or pathogen antigen.

In some embodiments, the method comprises the steps of:

1) Obtaining and culturing healthy human T cells;

2) Knocking out TCR in T cells;

3) Transferring the CAR and the mutant CnA and/or the mutant CnB into T cells;

4) Universal CAR T cells expressing mutant CnA and/or mutant CnB and CAR, with or without TCR expression down-regulated, were isolated.

Preferably, step 1) comprises: t cells were extracted from peripheral blood mononuclear cells of healthy donors and cultured for 24-72 hours after stimulation with Human TCD3/CD28 beads.

Preferably, step 2) employs a technique selected from CRISPR/Cas technique, artificial Zinc Finger Nuclease (ZFN) technique, transcription activation-like effector (TALE) technique or TALE-CRISPR/Cas technique; more preferably, CRISPR/Cas technology is employed; more preferably, the gRNA is selected from the sequences shown in any of SEQ ID NOs 19-23:

SEQ ID NO 19:GCCGUUACGUGGUUGACCUA；

SEQ ID NO 20:GGCCGUUACGUGGUUGACCU；

SEQ ID NO 21:CAGGGUUCUGGAUAUCUGU；

SEQ ID NO 22:GGCCGUUACGUGGUUGACCU；

SEQ ID NO 23:ACGGCACAUGGUCGACUCUC。

preferably, step 3) comprises constructing an IRU-CAR plasmid comprising "left homology arm-self-cleavage sequence-CAR-self-cleavage sequence-mutant CnA and/or mutant CnB-right homology arm".

The self-cleaving sequence may be selected from, for example, P2A, T2A, E2A and F2A.

In some embodiments of the invention, step 3) comprises constructing an IRU-CAR plasmid comprising a "left homology arm-P2A-CAR-T2A-mutant CnA and/or mutant CnB-right homology arm".

In some embodiments of the invention, after the TRAC site is excised by Cas9 to create a gap, the DNA of 350-450bp to the left of the gap is the left homology arm sequence, and the DNA of 350-450bp to the right of the gap is the right homology arm sequence; in one embodiment of the invention, the left homology arm comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the nucleotide sequence set forth in SEQ ID NO. 48; the right homology arm comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the nucleotide sequence set forth in SEQ ID NO. 49.

The CAR comprises:

2) An antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, and step cd3ζ;

4) Concurrently, an antibody or functional fragment thereof that specifically binds to the target antigen, the transmembrane region of CD28 or CD8, the costimulatory signaling domain of CD28, the costimulatory signaling domain of CD137, and CD3 ζ.

In one embodiment of the invention, the CAR comprises an amino acid sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the amino acid sequence set forth in SEQ ID NO. 50.

In one embodiment of the invention, the amino acid sequence of P2A is shown in SEQ ID NO. 42.

In one embodiment of the invention, the amino acid sequence of T2A is shown in SEQ ID NO. 43.

In one embodiment of the invention, the amino acid sequence of mutant CnA is shown in any one of SEQ ID NO. 1-7, and the amino acid sequence of mutant CnB is shown in any one of SEQ ID NO. 8-16.

Preferably, the transfection method is selected from electrotransfection, lipofection. More preferably, T cells are cultured for a further 6-10 days after transfection.

Preferably, the TCR is removed in step 4) using biotin-CD3 and streptavidin beads ⁺ T cells.

In a fourth aspect of the invention, there is provided a pharmaceutical composition comprising a universal immune effector cell of the first aspect of the invention, and an immunosuppressant. In one embodiment of the invention, the pharmaceutical composition comprises a universal T cell or universal CAR T cell according to the invention, and an immunosuppressant.

Preferably, the immunosuppressant comprises: calcineurin inhibitors such as cyclosporin a or FK 506; DMARDs such as gold salts, sulfasalazine, antimalarials, methotrexate, D-penicillamine, azathioprine, mycophenolic acid, tacrolimus, sirolimus, minocycline, leflunomide, glucocorticoids; modulators of lymphocyte recirculation, such as FTY720 and FTY720 analogs; mTOR inhibitors, such as rapamycin, 40-O- (2-hydroxyethyl) -rapamycin, CCI779, ABT578, AP23573, or TAFA-93; ascomycins having immunosuppressive properties, such as ABT-281, ASM981, etc.; corticosteroids; cyclophosphamide; azathioprine; leflunomide; mizoribine; mycophenolate mofetil; 15-deoxyspergualin or an immunosuppressive homolog, analog or derivative thereof; immunosuppressive monoclonal antibodies, e.g., directed against leukocyte receptors, e.g., MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40. Monoclonal antibodies to CD45, CD58, CD80, CD86 or ligands thereof. More preferably, the immunosuppressant is selected from cyclosporin a or FK 506.

In a fifth aspect, the invention provides the use of a universal immune effector cell according to the first aspect of the invention for the manufacture of a medicament for the treatment of an anti-tumour or autoimmune disease.

In a preferred embodiment of the invention, there is provided the use of a universal T cell or universal CAR T cell according to the invention for the manufacture of a medicament for the anti-tumour or treatment of autoimmune diseases.

And provides the application of the universal immune effector cell combined immunosuppressant in preparing an anti-tumor or autoimmune disease treatment medicament.

In a preferred embodiment of the invention, there is provided the use of a universal T cell or universal CAR T cell combined immunosuppressant according to the invention for the manufacture of a medicament for the treatment of an anti-tumour or autoimmune disease.

And, there is provided the use of a universal immune effector cell according to the first aspect of the invention for the manufacture of a medicament for use in combination with an immunosuppressant for the treatment of an anti-tumour or autoimmune disease.

In a preferred embodiment of the invention there is provided the use of a universal T cell or universal CAR T cell according to the invention for the manufacture of a medicament for use in combination with an immunosuppressant for the treatment of an anti-tumour or autoimmune disease.

Such tumors include, but are not limited to, leukemias (e.g., acute leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, polycythemia vera), lymphomas (hodgkin's disease, non-hodgkin's disease), primary macroglobulinemia, heavy chain diseases, solid tumors such as sarcomas and cancers (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovial vioma, mesothelioma), ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, bronchus cancer, medullary carcinoma, renal cell carcinoma, liver cancer, nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, wilms' cell tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngeal tumor, ependymoma, pineal tumor, angioblastoma, auditory neuroma, oligodendroglioma, neurosphingoma, meningioma, melanoma, neuroblastoma, retinoblastoma), esophageal cancer, gallbladder cancer, renal cancer, multiple myeloma; preferably, the "tumor" includes but is not limited to: pancreatic cancer, liver cancer, lung cancer, stomach cancer, esophageal cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gall bladder cancer, renal cancer, leukemia, multiple myeloma, ovarian cancer, cervical cancer, and glioma, and any combination thereof.

Such autoimmune diseases include, but are not limited to: systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, central axis spondyloarthritis, myasthenia gravis, polymyositis, psoriasis/psoriasis, pemphigus, vitiligo, multiple sclerosis, narcolepsy, neuromyelitis optica, type one diabetes, hyperthyroidism, hashimoto's disease/hypothyroidis, sjogren's syndrome, crohn's disease, ulcerative colitis, celiac disease, autoimmune gastritis, primary cholangitis, autoimmune hepatitis, lupus nephritis, pulmonary hemorrhage-nephritis syndrome, autoimmune ovarian inflammation, autoimmune orchitis, and the like.

In some embodiments, the combination of universal immune effector cells expressing mutant CnA and/or mutant CnB and immunosuppressants can include the following combinations: immunosuppressants may be CsA when a universal immune effector cell (e.g., universal T cell, universal CAR T cell) expresses a mutant CnA as shown in any one of SEQ ID nos. 1-5 and/or a mutant CnB as shown in any one of SEQ ID nos. 8-12; immunosuppressant can be selected from FK 506 when a universal immune effector cell (e.g., universal T cell, universal CAR T cell) expresses a mutant CnA as shown in SEQ ID NO.6 or 7 and/or a mutant CnB as shown in any of SEQ ID NO. 13-16. Specifically, the results are shown in Table 1.

TABLE 1

The preferred combination forms are: a universal immune effector cell (e.g., universal T cell, universal CAR T cell) expressing a mutant CnA having an amino acid sequence as set forth in SEQ ID No.1, the immunosuppressant being CsA; universal immune effector cells (e.g., universal T cells, universal CAR T cells) expressing mutant CnB having the amino acid sequence shown in SEQ id No.13, the immunosuppressant is FK506.

The invention also provides the following method.

A method of treating cancer/tumor comprising administering to a subject in need thereof a universal immune effector cell (e.g., a universal T cell or a universal CAR T cell) as described in the first aspect of the invention and an immunosuppressant, or administering to a subject in need thereof a pharmaceutical composition as described in the fourth aspect of the invention.

A method of treating an autoimmune disease, the method comprising administering to a subject in need thereof a universal immune effector cell (e.g., a universal T cell or a universal CAR T cell) as described in the first aspect of the invention and an immunosuppressant, or administering to a subject in need thereof a pharmaceutical composition as described in the fourth aspect of the invention.

List of sequences according to the invention:

/>

description of the terminology:

And/or is to be taken as a specific disclosure of each of two specified features or components with or without the other. Thus, the term "and/or" as used in phrases such as "a and/or B" is intended to include "a and B", "a or B", "a" (alone) and "B" (alone). Likewise, the term "and/or" as used in phrases such as "A, B and/or C" is intended to encompass each of the following aspects: A. b and C; A. b or C; a or C; a or B; b or C; a and C; a and B; b and C; a (alone); b (alone); and C (alone).

"comprising" and "including" have the same meaning and are intended to be open and allow for the inclusion of additional elements or steps but not required. When the terms "comprising" or "including" are used herein, the terms "consisting of" and/or "consisting essentially of … …" are therefore also included and disclosed.

In the present description and claims, nucleotides are referred to by their commonly accepted single letter codes. Unless otherwise indicated, nucleotide sequences are written in the 5 'to 3' direction from left to right. Nucleobases are represented herein by commonly known single letter symbols recommended by the IUPAC-IUB biochemical nomenclature committee. Thus, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, and U represents uracil. The skilled artisan will appreciate that the T base in the codons disclosed herein is present in DNA, whereas the T base will be substituted with a U base in the corresponding RNA. For example, a codon-nucleotide sequence in the form of DNA disclosed herein, such as a vector or an In Vitro Translation (IVT) template, has its T base transcribed into a U base in its corresponding transcribed mRNA. In this regard, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequences of the present disclosure. Those skilled in the art will also appreciate that equivalent codon patterns can be generated by substituting one or more bases with non-natural bases.

Homology: as used herein, the term "homology" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In general, the term "homology" means the evolutionary relationship between two molecules. Thus, two homologous molecules will have a common evolutionary ancestor. In the context of the present disclosure, the term homology includes identity and similarity.

In some embodiments, polymer molecules are considered "homologous" to each other if at least 25%,30%,35%,40%,45%,50%,55%,60%,65%,70%,75%,80%,85%,90%,95%,96%,97%,98%,99% or 100% of the monomers in the molecule are identical (identical monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

Identity: as used herein, the term "identity" refers to overall monomer conservation between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. For example, the calculation of the percent identity of two polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of the first and second nucleic acid sequences for optimal alignment and non-identical sequences can be abandoned for comparison purposes, in certain embodiments, the length of the sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.

Suitable software programs are available from a variety of sources and are used for alignment of both protein and nucleotide sequences. For example, one suitable program for determining percent sequence identity is the Bl2seq, which is part of the BLAST suite of programs available from the national center for Biotechnology information of the United states government (BLAST. Ncbi. Lm. Nih. Gov). Bl2seq is compared between two sequences using BLASTN or BLASTP algorithms. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are parts of the bioinformatics EMBOSS program suite, for example Needle, stretcher, water or Matcher, and are also available from European Bioinformatics Institute (EBI) of www.ebi.ac.uk/Tools/psa. Sequence alignment may be performed using methods known in the art, such as MAFFT, clustal (ClustalW, clustal X or Clustal Omega), MUSCLE, and the like.

Drawings

Fig. 1: the general CAR T cell (Immunosuppressant Resistant Universal (IRU) -CAR-T) schematic diagram of the invention; on the basis of the traditional general CAR-T (namely the CAR-T knocked out of the TCR, which is called as WT CAR-T hereinafter), a mutation CnA/CnB fragment is additionally introduced, so that the rejection of receptor immune T cells to the CAR-T can be greatly reduced or even avoided under the condition of being matched with immunosuppressive drugs.

Fig. 2: a flow chart of IRU-CAR-T; the abscissa represents CAR expression, and the ordinate represents TCR expression. The IRU-CAR-T target yield can reach more than 40%, and is similar to that of WT-CAR-T.

Fig. 3: IRU-CAR-T using principle; in contrast to traditional universal CAR-T (WT CAR-T), cell lines inserted with IRU genes can maintain the proportion of TCR activation in immunosuppressive drugs (e.g., FK506 and CsA); this experiment was verified on a J76-NFAT-GFP cell line with GFP positive expression as an indicator of TCR activation.

Fig. 4: the short-term killing experimental results of the WT CAR-T and the IRU-CAR-T are compared, the abscissa is E/T ratio, and the ordinate is killing efficiency.

Fig. 5: WT CAR-T and IRU-CAR-T long term killing experiments. The abscissa indicates experimental time and the ordinate indicates RLU values of tumor cells.

Fig. 6: results of release of cytokines 24hr after Nalm-6 tumor cell stimulation by WT CAR-T and IRU-CAR-T were compared.

Fig. 7: proliferation assay results of WT CAR-T and IRU-CAR-T.

Fig. 8: experimental results of anti-rejection function of IRU-CAR-T.

Fig. 9: IRU-CAR-T anticancer (in vivo) experimental results are shown in the figure as a survival curve of mice.

Fig. 10: IRU-CAR-T anti-rejection ability (in vivo) experimental results are shown in the graph of survival curves of mice.

Fig. 11: after treatment with CAR-T cells, withdrawal of immunosuppressant (-CsA group) was used to reject IRU-CAR-T and recipient T cell reconstitution.

Detailed Description

The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention.

Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods. The experimental method is a conventional molecular biological method in the field, and can be operated by referring to the instruction of a molecular biological experimental manual or a kit product instruction in the field.

Example 1: schematic of general CAR T cells (hereinafter referred to as "IRU-CAR-T") of the present invention

Taking CsA and FK506 as examples, the present invention uses gene editing techniques to introduce CAR and mutant CnA and/or mutant CnB on T cells. The knockout of the αβ TCR will avoid GVHD from occurring. On the basis, the invention breakthrough co-expresses mutated CnA or CnB and CAR, and combines the use of CsA or FK506 to inhibit T cells of a recipient and reduce the rejection of IRU-CAR-T; meanwhile, the mutated CnA or CnB fragment helps IRU-CAR-T cells to avoid the inhibition of CsA/FK506 on IRU-CAR-T cell activation, proliferation and tumor killing, so that the IRU-CAR-T cells can still work normally under the condition that the receptor immune system is inhibited, and tumor cells are killed. After the end of treatment, the cessation of CsA/FK506 will restore function to the recipient immune system, trigger HVGR to reoccur, and recipient rejection clears IRU-CAR-T cells, avoiding the long-term risk of priming IRU-CAR-T cells (fig. 1).

Cell lines and culture conditions in the following examples:

nalm6 FFluc-GFP cells were purchased from Shanghai model organisms; nalm 6-FFluc-GFP-beta ₂ m ^KO Was constructed using lentiviruses produced by plasmid lentiCRISPR v2 (adedge) containing gRNA sequence 5'-AGCTCACATGGTTCACACGGCGTTT-3'. Jurkat NFAT GFP cells were given by university of Zhejiang Chen Wei. AAV-293 cells were purchased from a subset of the cell line ontology of the national infrastructure in china.

Adherent cell lines (AAV-293) and suspension cell lines (Jurkat NFAT GFP, nalm6 FFluc GFP and Nalm 6-FFluc-GFP-. Beta.) ₂ m ^KO ) At 37℃and 5% CO, respectively ₂ Is cultured in DMEM or RPMI 1640 complete medium (containing 10% fetal bovine serum FBS). All cell lines were routinely tested for mycoplasma at regular intervals, and all negative results were obtained.

Mice and study approval in the following examples:

NSG mice (females, 8-12 weeks old) were purchased from Shanghai model organisms and bred at the university laboratory animal center, hangzhou. All animal experiments were performed in accordance with the guidelines and ethical regulations for relevant animals (numbered HSD 20210703). Tumor progression was measured approximately once every 1 week: after intraperitoneal injection of 150mg/kg of D-fluorescein (Gold Biotechnology), mice were examined by a bioluminescence imaging device. Image datasets were acquired and analyzed using M3 Vision. The average radiance was measured by photons/second. For ex vivo experiments, mice were euthanized and their bone marrow cells were harvested from hind limbs.

Mouse acute lymphoblastic leukemia model (ALL) model: NSG mice were vaccinated 5X 10 on day 0 ⁵ Naml6 FFLuc-GFP cells (i.v.), then vaccinated 1X 10 on day 4 ⁵ CAR-T cells (i.v.). CsA (15 mg/kg, intraperitoneal injection) was injected daily from day 3 to day 21, followed by once every other day (n=5 per group).

Mice ALL model with RTCs: the model is built based on the ALL model described above. Similarly, naml6 FFLuc GFP-. Beta.was intravenously inoculated on NSG mice on the corresponding days ₂ m ^KO And CAR-T cells and CsA was injected intraperitoneally. In particular, in this model, an additional injection of 3.6X10 at day 2 was required ⁶ Receptor T Cells (RTCs) of different origin than CAR-T cells. The preparation method of RTCs comprises the following steps: 3X 10 ⁶ T cells were stimulated with CD3/CD28 for 6-8 days, 6X 10 ⁵ T cells were stimulated by donor PBMCs. After model construction was completed, tumor progression was monitored as described above (n=5 per group). In experiments assessing survival of CAR-T cells after CsA removal, the same dose of RTCs was re-injected 7 days after tumor inoculation. After RTCs injection, mice were divided into two groups: csA continuous injection group (+csa+csa) CsA was injected as described previously, and CsA removal group (+csa-CsA), 200 μl pbs was intraperitoneally injected (n=5 per group).

Example 2: preparation of IRU-CAR-T

A first part: peripheral blood flow of volunteer

1. Peripheral blood of volunteers was collected.

2. T cells were extracted using RosetteSepTM human T cell enrichment kit and Ficoll lymphocyte isolates.

2.1 adding RosetteSepTM human T cell enrichment cocktail to 50. Mu.l/ml blood in a suitable volumetric centrifuge tube;

2.2 adding Ficoll lymphocyte separating liquid with the volume indicated in the instruction book into a centrifuge tube with 15ml or 50ml according to the blood taking volume;

2.3 mixing peripheral blood with sterile FACS solution (PBS containing 0.1% serum) according to 1:1, slowly dripping on lymphocyte separation liquid along tube wall with Pasteur dropper, and keeping clear liquid interface;

2.4 putting the sample into a centrifuge, wherein 1200 Xg is adopted, the acceleration is set to be 1, the deceleration is set to be 0, and the centrifugation is carried out for 20 minutes;

2.5, after centrifugation, the inside of the tube can be seen to be divided into three layers, wherein the upper layer is blood plasma and FACS, the lower layer is mainly red blood cells and granulocytes, the middle is lymphocyte separating liquid, and a white cloud and fog layer narrow band mainly containing lymphocytes is arranged at the middle interface, namely a white membrane layer;

2.6 carefully removing part of the supernatant, leaving about 1ml, inserting into the buffy coat with a pipette, sucking away lymphocytes, placing the lymphocytes into another 15ml centrifuge tube, adding FACS with a volume of more than 5 times, placing into a centrifuge 400 Xg, and centrifuging for 10min;

2.7 repeating the above steps.

3. Stimulated with Human T CD3/CD28 beads and incubated with 5% CO at 37deg.C in X-vivo liquid medium containing IL-7, IL-15 ₂ The incubator cultures T cells for 48 hours.

A second part: IRU CAR-T cell preparation and in-vivo reinfusion

IRU-CAR plasmid vectors are prepared using different strategies depending on the IRU CAR virus type selected, e.g., lentivirus/retrovirus requires insertion of the fragment to be inserted into the lentivirus/retrovirus backbone, whereas AAV virus requires insertion of the fragment to be inserted into the AAV viral backbone (e.g., serotype AAV 6).

IRU-CAR plasmid construction is described below using AAV viruses as an example: an AAV viral backbone (serotype AAV 6) was used into which a "left homology arm-P2A-CAR-T2A-mutant CnA or mutant CnB fragment-right homology arm" sequence was inserted at the multiple cloning site.

After the TRAC site is excised by Cas9 to generate a gap, about 400bp DNA on the left of the gap is a left homology arm sequence, and about 400bp DNA on the right is a right homology arm sequence.

The left homology arm sequences can be amplified by primers primer1 and primer2, and the nucleotide sequences of primer1 and primer2 are shown in SEQ ID NO. 44 and 45, respectively.

The right homology arm sequences can be amplified by primers primer3 and primer4, the nucleotide sequences of primer3 and primer4 are shown in SEQ ID NOS 46 and 47, respectively.

The left homology arm comprises the nucleotide sequence shown as SEQ ID NO. 48.

The right homology arm comprises the nucleotide sequence shown as SEQ ID NO. 49.

The CAR comprises:

4) An antibody or functional fragment thereof that specifically binds to a target antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, a costimulatory signaling domain of CD137, and cd3ζ;

the amino acid sequence of FMC63 CAR used in the examples below is shown as SEQ ID NO. 50.

The P2A is a self-splicing peptide, and the amino acid sequence of the P2A is shown in SEQ ID NO. 42 in the following examples.

The T2A is a self-splicing peptide, and the amino acid sequence of T2A in the following examples is shown in SEQ ID NO. 43.

The amino acid sequence of the mutant CnA can be shown as any one of SEQ ID NO. 1-7, and the amino acid sequence of the mutant CnB can be shown as any one of SEQ ID NO. 8-16.

IRU CAR plasmid vector preparation

1.1 fragment acquisition: the "left homology arm-P2A-CAR-T2A-mutant CnA or mutant CnB fragment-right homology arm" fragment can be obtained by PCR or DNA synthesis method;

1.2 fragment backbone recombination: the fragment may be linked to the backbone using a one-step cloning or T4 ligation;

1.3 after construction of the plasmid, sequence accuracy was determined by Sanger sequencing and the like.

IRU CAR Virus preparation

As above, IRU CAR virus preparation requires different strategies depending on the selection of virus type, and the preparation of IRU CAR virus is illustrated below using AAV virus as an example.

2.1AAV toxigenic cell culture: complete medium (10% FBS) containing high sugar (DMEM) was used at 37deg.C with 5% CO ₂ AAV-293 cells were cultured in an incubator. Passaging every 2-3 days, and keeping it in log phase with active growth;

2.2IRU CAR Virus transfection: transfecting the IRU CAR plasmid constructed in the previous step and the AAV helper plasmid pDP6 plasmid into AAV-293 cells by using a PEI transfection method;

2.3IRU CAR virus purification: 48h after transfection, AAV-293 cells were collected. Repeatedly freezing and thawing to break cells, and releasing virus into supernatant. Subsequently, IRU CAR virus was purified using iodixanol density gradient centrifugation.

Preparation of IRU CAR-T cells

3.1 preparation of Cas9-gRNA mixture Ribonucleoprotein (RNP): uniformly mixing gRNA capable of targeting TRAC locus and Cas9 protein, and incubating at 37 ℃ for 15min to form RNP;

the gRNA can be selected from any one of the sequences shown in SEQ ID NOs 19-23; 5'-CAGGGUUCUGGAUAUCUGU-3' (SEQ ID NO: 21) is used in the following examples.

3.2 taking a proper amount of T cells cultured for 48 hours in the first step, and re-suspending in electrotransformation liquid at 90 Xg for 10 min;

3.3 mixing with RNP uniformly and transferring into an electric rotating cup, and using LONZA NucleofectorTM IIB machine U-014 to electrically transfer RNP into T cells;

3.4, adding 1ml of preheating culture medium after the electric transfer is finished;

3.5 After 20min, centrifuging 90 Xg for 10min to remove electrotransfer liquid;

3.6 IRU CAR AAV virus was added to the T cells after the electrotransformation of the above step. Culturing the T cells in X-vivo liquid medium containing IL-7 and IL-15 (50 ng/ml) for six days;

3.7 use of Biolegend ^TM CD3 removal by CD3 selection kit ⁺ T cells, obtaining IRU CAR-T cells, comprising the specific steps of:

a) Cell counts, taking the desired cell mass 300 Xg 5min for centrifugation and resuspension in FACS buffer at appropriate concentration;

b) Adding corresponding CD3-biotin anti-ibody into each 100 mu l of cell heavy suspension, and incubating on ice for 15min;

c) Corresponding streptavidin beads is added into each 100 mu l of cell heavy suspension, and the mixture is incubated on ice for 15min;

d) 2.5ml FACS buffer was added and the centrifuge tube placed on a magnet for 5min to remove streptavidin beads;

e) In vivo reinfusion TCR ^- IRU CAR-T cells.

Take FMC63 CAR (target is human CD19 protein) as an example. The TRAC site of the TCR was knocked out using the Crispr/Cas9 technique, and FMC63 CAR and mutant CnA (amino acid sequence shown in SEQ ID NO: 1) were introduced into the TRAC site using AAV as a vector, which resulted in greater than 40% of the target IRU-CAR-T (FIG. 2). Notably, the IRU-CAR-T in the present invention can be a CAR of various kinds, not just FMC63 CAR.

Example 3: functional verification of mutant CnA/CnB antagonism CsA/FK506

IRU-CAR-T was expressed in a Jurkat cell line with NFAT-GFP (Jurkat-NFAT-GFP), jurkat-NFAT-GFP cell line was stimulated with PMA/Ionomycin, and the amount of GFP expression was examined to reflect the intensity of the TCR signaling pathway. Experiments show that IRU-CAR-T-Jurkat-NFAT-GFP cell lines can highly express GFP under the condition of CsA or FK506 with different concentrations, so that mutant CnA/CnB can resist the inhibition of CsA or FK506 on TCR signal paths (figure 3), and the left graph is matched with FK506 and is a CnB variant with an amino acid sequence shown as SEQ ID NO. 13; the right panel cooperates with CsA to form a CnA variant having the amino acid sequence shown in SEQ ID NO. 1.

Example 4: functional experiments (in vitro) of IRU-CAR-T

CnA mutants with amino acid sequence as shown in SEQ ID No.1, and IRU-CAR-T cells containing FMC63 CAR of anti-CD 19 antibody were prepared as in example 2, and in vitro functional experiments were performed using CsA as immunosuppressant, the experiments comprising three parts: killing experiments, cytokine detection experiments, and proliferation experiments.

In short term killing experiments (FIG. 4), the human Nalm-6 tumor cell line (CD 19 was used ⁺ ) Is a target cell. Can be used forSee IRU-CAR-T has no obvious difference in killing efficiency under the conditions of different ratios of effector cell to target cell (E/T) and different CsA concentrations. In contrast, WT-CAR-T cells, i.e., conventional CAR-T cells (i.e., CAR-T cells without mutant CnA or mutant CnB). In the presence of CsA (300 ng/ml), the killing efficiency of WT-CAR-T was significantly reduced compared to that without CsA. (Note: 300ng/ml CsA is the clinically effective blood concentration).

In the long term kill experiment (FIG. 5), E/T was 1/10. Experiments show that: IRU-CAR-T cells can control proliferation of Nalm-6 tumor cells under the condition of CsA or not, and the killing effect is exerted; in contrast, in the presence of CsA, WT-CAR-T cells were unable to proliferate due to the inhibition of T cell activation and proliferation by CsA, and therefore, were unable to exert their control over Nalm-6 tumor cells.

Cytokine experiments further demonstrate that IRU-CAR-T can release cytokines in the presence of CsA. As shown in fig. 6, IRU-CAR-T cells released NFAT pathway-related killer cytokines without significant differences, regardless of CsA presence or absence, after 24hr of stimulation with Nalm-6 tumor cells: ifnγ, IL-2, and tnfα. However, WT-CAR-T cells had a reduced ability to release cytokines in the presence of CsA 24hr after Nalm-6 tumor cell stimulation, suggesting that they were not able to perform normal tumor killing activities.

Similarly, CAR-T proliferation experiments demonstrated that IRU-CAR-T cells can continue to proliferate with or without CsA stimulated by tumor antigens, or are important reasons that IRU-CAR-T cells can exert their anti-tumor function. Whereas WT-CAR-T cells can only proliferate in the absence of CsA (FIG. 7). The three basic experiments in the functional experiments jointly prove that IRU-CAR-T cells can resist the inhibition of CsA on the activation of the IRU-CAR-T cells, and perform normal proliferation and tumor killing functions.

Example 5: anti-rejection function test of IRU-CAR-T (in vitro)

Healthy human PBMC expressing different HLA-A were mixed in vitro with CnA mutants containing the amino acid sequence shown in SEQ ID NO.1, prepared as described in example 2, and IRU-CAR-T cells containing the CAR of anti-CD 19 antibody (FMC 63 CAR), and IRU-CAR-T cells were stimulated with Nalm-6 tumor cells as antigen (FIG. 8), simulating rejection in vivo. Without CsA PBMCs can reject CAR-T cells, i.e. either IRU-CAR-T or WT-CAR-T cells, which cannot proliferate due to PBMC rejection. This phenomenon mimics the HVGR response in vivo, i.e., rejection of CAR-T cells by a patient would result in the CAR-T cells failing to proliferate, and HVGR occurs, greatly reducing their anti-tumor effects. However, in the presence of CsA PBMCs were inhibited, although they no longer reject CAR-T cells, only IRU-CAR-T could survive and continue to proliferate in this case, and WT-CAR-T cells could not proliferate due to the presence of CsA. This phenomenon mimics that CsA inhibits rejection of CAR-T cells by the patient's immune system in vivo, reducing the HVGR response in vivo, but IRU-CAR-T functions against CsA immunosuppression.

Example 6: IRU-CAR-T anticancer experiment (in vivo)

IRU-CAR-T cells containing CnA mutant having the amino acid sequence shown in SEQ ID NO.1 and CAR (FMC 63 CAR) containing anti-CD 19 antibody were prepared as described in example 2, and CsA was used as an immunosuppressant, and the IRU-CAR-T cells prepared as described above were infused into mice in NSG mice model B acute lymphoblastic leukemia, while CsA was administered daily. As a result, the IRU-CAR-T cells can effectively control the number of tumors and maintain the survival of mice no matter the presence or absence of CsA. Whereas WT-CAR-T cell therapy can normally kill tumor cells only in the absence of CsA, maintaining mice survival, but cannot kill tumor cells in the presence of CsA (fig. 9, "nalm6 no CsA" in fig. 9 indicates model group, no CsA; "nalm6+csa" indicates control group, csA; "WT CAR no CsA" indicates WT-CAR-T cell therapy group, and no CsA; "WT car+csa" indicates WT-CAR-T cell therapy group, while CsA is administered, "IUR CAR no a" indicates IUR-CAR-T cell therapy group, and no CsA; "IUR car+csa" indicates IUR-CAR-T cell therapy group, while CsA is administered). This is because WT-CAR-T cells themselves are inhibited by CsA immunosuppression, cannot proliferate and survive in the presence of CsA, whereas addition of CnA mutant fragments allows IRU-CAR-T to escape CsA immunosuppression and continue to proliferate in vivo, which results verify at in vivo levels that IRU-CAR-T cells can effectively control tumor progression and cure disease in the presence of CsA.

Example 7: IRU-CAR-T anti-rejection Capacity (in vivo)

In NSG mice model B acute lymphoblastic leukemia, healthy human T cells of different origin than CAR-T cells were infused, followed by injection of WT-CAR-T or preparation of IRU-CAR-T cells containing CnA mutants with amino acid sequences as shown in SEQ ID No.1, and CAR containing anti-CD 19 antibodies (FMC 63 CAR) as described in example 2 were treated, mimicking the results of IRU-CAR-T therapy in mice in vivo (fig. 10). The results show that in the absence of CsA, WT-CAR-T mice are unable to effectively control tumor numbers and maintain mouse survival because CAR-T cells are recognized and challenged by T cells of different origin in the mice without CsA, unable to continue to proliferate in vivo, exerting anti-tumor function. In the case of CsA, however, the WT-CAR-T mice also cannot effectively control tumor numbers and maintain mouse survival because, in the case of CsA, although CsA can protect WT-CAR-T cells from rejection by T cells of different origins in mice, reducing HVGR, the anti-tumor function is still inhibited because WT-CAR-T cells themselves cannot continue to proliferate in mice in the presence of CsA. However, in the presence of CsA, IRU-CAR-T treated mice can effectively control tumor numbers and maintain survival of mice because T cells of different origins are inhibited in mice in the presence of CsA, HVGR effects are inhibited, and at the same time CsA fails to inhibit proliferation of IRU-CAR-T cells, so IRU-CAR-T can continue to proliferate in mice and act as an anti-tumor.

Subsequent CsA withdrawal experiments prove that after the mice are effectively cured, the CsA withdrawal can enable the receptor T cells to survive and repel the IRU-CAR-T cells, so that the IRU-CAR-T cells timely withdraw after the anti-cancer task is finished, and the safety of the mice is further improved. As shown in fig. 11, CAR-T and recipient T cell content in mouse bone marrow was detected 7 days after tumor, 4 days after CsA, and then two weeks (14 days, 21 days after tumor) after reinjecting allogeneic T cells (recipient T). The ordinate is the percentage of CAR-T or recipient T cells in bone marrow, -CsA is the allogeneic T cell withdrawal group, +CsA is the allogeneic T cell withdrawal group, followed by continuous administration. As shown in fig. 11, withdrawal of CsA significantly reduced the CAR-T cell fraction in mice, demonstrating that allogeneic T cells can reject CAR-T cells, while the continuous CsA-group CAR-T cells, as a control, were unaffected and persisted. Meanwhile, withdrawal of CsA increases the proportion of the recipient T cells, but continuous administration of CsA can always inhibit the recipient T cells.

The invention provides a universal CAR T cell (IRU-CAR-T) that can be used in combination with an immunosuppressant. The invention uses a gene editing method, such as CRISPR/Cas9 and the fixed-point knockout knock-in technology of AAV, to simply and efficiently introduce the CAR and mutated CnA or CnB fragments, thereby avoiding excessive gene editing. By co-ordination with the combination of CsA/FK506, csA/FK506 can reduce activation of immune T cells in the recipient during treatment, reducing rejection of IRU-CAR-T cells. Meanwhile, IRU-CAR-T cells can be prevented from being inhibited by CsA/FK506 due to the existence of mutated CnA or CnB fragments, so that HVGR phenomenon caused by a receptor immune system to IRU-CAR-T can be effectively reduced during treatment. After the treatment is completed, the rejection of the recipient immune T cells to the IRU-CAR-T by the CsA/FK506 drug is restarted, so that the allogeneic IRU-CAR-T cells are cleared, evacuation after the treatment of tumors is realized, and the safety of the immune treatment is greatly improved.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A universal immune effector cell, wherein the immune effector cell expresses a foreign protein 1, the foreign protein 1 being a mutant calmodulin phosphatase a subunit and/or a mutant calmodulin phosphatase B subunit;

preferably, the amino acid sequence of the mutant calmodulin phosphatase A subunit comprises SEQ ID NO. 17 having an amino acid substitution at a position selected from the group consisting of: V314R, V314K, Y341F, T351E, L354A or M347E;

preferably, the amino acid sequence of the mutant calmodulin phosphatase A subunit is shown in any one of SEQ ID NOs 1 to 7;

preferably, the amino acid sequence of the mutant calmodulin phosphatase B subunit comprises SEQ ID No. 18 having an amino acid substitution at a position selected from the group consisting of: L124T, K LA, K125VQ, K125IE, V120S;

preferably, the amino acid sequence of the B subunit of the mutant calmodulin phosphatase is shown in any one of SEQ ID NOs 8 to 16;

Preferably, the nucleotide sequence encoding the mutant calmodulin phosphatase A subunit is as shown in any one of SEQ ID NOs 24 to 30; preferably, the nucleotide sequence encoding the B subunit of the mutant calmodulin phosphatase is as shown in any one of SEQ ID NOs 31-39.

2. The universal immune effector cell of claim 1, wherein the immune effector cell further expresses a foreign protein 2, the foreign protein 2 being capable of recognizing a tumor antigen or a pathogen antigen;

preferably, the foreign protein 2 is a chimeric antigen receptor;

preferably, the chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain and an intracellular signaling domain; the antigen binding domain binds to a tumor antigen or pathogen antigen; the intracellular signaling domain comprises a functional signaling domain derived from a stimulatory molecule and/or a co-stimulatory molecule;

preferably, the method comprises the steps of, the tumor antigen or pathogen antigen is selected from Claudin18.2, claudin18.1, claudin 6, vascular endothelial growth factor receptor, phosphatidylinositol proteoglycan-3 (GPC 3), B Cell Maturation Antigen (BCMA), carbonic anhydrase 9 (CAIX), tEGFR, CD19, CD20, CD22, mesothelin, CEA and hepatitis B surface antigen, antifolate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), EPHa2, erb-B3, erb-B4, erbB dimer, EGFR vIII, folic acid binding protein (FBP), FCRL5, FCRH5, fetal acetylcholine receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL-13R-alpha 2 kinase insertion domain receptor (kdr), kappa light chain, lewis Y, L1 cell adhesion molecule (L1-CAM), melanomA-Associated antigen (MAGE) -A1, MAGE-A3, MAGE-A6, preferentially expressed melanoma antigen (PRAME), survivin, TAG72, B7-H6, IL-13 receptor alpha 2 (IL-13 Ra 2), CA9, GD3, HMW-MAA, CD171, G250/CAIX, HLA-AI MAGEA1, HLA-A2, PSCA, folate receptor-a, CD44v6, CD44v7/8, avb6 integrin, 8H9, NCAM, VEGF receptor, 5T4, fetal AchR, NKG2D ligand, CD44v6, double antigen, cancer-testis antigen, mesothelin, murine CMV, mucin 1 (MUC 1), MUC16, PSCA, NKG2D, NY-ESO-1, MART-1, gp100, G protein coupled receptor 5D (GPCR 5D), ROR1, TAG72, VEGF-R2, carcinoembryonic antigen (CEA), prostate specific antigen, PSMA, her2/neu, estrogen receptor, progesterone receptor, ephrin B2, CD123, c-Met, GD-2, O-acetylated GD2 (OGD 2), CE7, wilms tumor 1 (WT-1), cyclin A2, CCL-1, CD138; preferably, the tumor antigen is CD19;

Preferably, the costimulatory molecule is selected from the group consisting of MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD 11a/CD 18), ICOS (CD 278) and 4-1BB (CD 137), GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF 1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2 Rbeta, IL2 Rgamma, IL7 Ralpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11D, ITGAE, CD, ITGAL, CD11a, LFA-1, ITGAM, CD11B, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR, TRANCE/RANKL, DNAM1 (CD 226), SLAMF4 (CD 244, 2B 4), CD84, CD96 (Tactile), CEACAM1, CRTAM, ly9 (CD 229), CD160 (55), PS1, CD100 (CD 69), CD69, CD6, SLA-1, SLAMG 6 (SLAMG 108), SLAMG-150 (SLIPG 8), SLAMG 3, SLAMG-150 (SLIPG 8), SLAMG-150;

preferably, the stimulatory molecule is a zeta chain associated with the T cell receptor complex;

preferably, the CAR comprises an antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, cd3ζ;

Preferably, the CAR comprises an antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, and cd3ζ;

preferably, the CAR comprises an antibody or functional fragment thereof that specifically binds a tumor antigen or pathogen antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD137, and cd3ζ;

preferably, the CAR comprises an antibody or functional fragment thereof that specifically binds to a target antigen, a transmembrane region of CD28 or CD8, a costimulatory signaling domain of CD28, a costimulatory signaling domain of CD137, and cd3ζ;

preferably, the CAR comprises an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% identical to the amino acid sequence set forth in SEQ ID No. 50.

3. The universal immune effector cell of claim 1 or 2, wherein the T cell receptor complex, T cell receptor alpha constant region protein, and/or T cell receptor beta constant region protein in the immune effector cell is knocked out.

4. A universal immune effector cell according to any one of claims 1 to 3, wherein the genes encoding exogenous protein 1 and/or exogenous protein 2 are inserted into the genes encoding any one or any two or more of the constituent elements of the TCR complex of the immune effector cell;

Preferably, the CAR is inserted into the TCR TRAC site of the immune effector cell;

preferably, the mutant CnA and/or the mutant CnB is inserted into the TCR TRAC site of the immune effector cell;

preferably, the CAR and mutant CnA are inserted into the TCR TRAC site of immune effector cells;

preferably, the CAR and mutant CnB are inserted into the TCR TRAC site of immune effector cells;

preferably, CAR, mutant CnA and mutant CnB are inserted into the TCR TRAC site of immune effector cells.

5. The universal immune effector cell of any one of claims 1-4, wherein the immune effector cell is a T cell or an NK cell;

preferably, the T cell is CD4 ⁺ T cells or CD8 ⁺ T cells.

6. A method for preparing the universal immune effector cell according to any one of claims 1 to 5, wherein the universal immune effector cell expressing the foreign protein 1 is obtained by engineering the immune effector cell;

preferably, the method further comprises knocking out endogenous T cell receptor complexes, T cell receptor alpha constant region proteins, and/or T cell receptor beta constant region proteins in the cells;

more preferably, the method further comprises causing the cell to express a foreign protein 2 capable of recognizing a tumor antigen or pathogen antigen.

7. The method of manufacturing as claimed in claim 6, comprising the steps of: 1) Obtaining and culturing healthy human T cells; 2) Knocking out TCR in T cells; 3) Transferring the CAR and the mutant CnA and/or the mutant CnB into T cells; 4) Isolating universal CAR T cells expressing mutant CnA and/or mutant CnB and CAR, with or without TCR expression down-regulated;

preferably, step 2) employs CRISPR/Cas technology, and the gRNA is selected from the sequences shown in any one of SEQ ID NOs 19-23; preferably, step 3) comprises constructing an IRU-CAR plasmid comprising "left homology arm-self-cleavage sequence-CAR-self-cleavage sequence-mutant CnA and/or mutant CnB-right homology arm"; preferably, the left homology arm comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the nucleotide sequence set forth in SEQ ID NO. 48; the right homology arm comprises a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the nucleotide sequence set forth in SEQ ID NO. 49; preferably, the CAR comprises a nucleotide sequence encoding an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or about 100% identical to the amino acid sequence set forth in SEQ ID No. 50; preferably, the self-cleaving sequence is selected from the group consisting of P2A, T2A, E a and F2A; preferably, the self-shearing sequence is P2A, and the amino acid sequence is shown as SEQ ID NO. 42; preferably, the self-shearing sequence is T2A, and the amino acid sequence is shown as SEQ ID NO. 43.

8. A pharmaceutical composition comprising the universal immune effector cell of any one of claims 1-5, and an immunosuppressant;

preferably, the immunosuppressant is selected from cyclosporin a or FK 506;

preferably, the pharmaceutical composition comprises a universal immune effector cell expressing a mutant CnA with an amino acid sequence shown as SEQ ID NO.1 and an immunosuppressant CsA;

preferably, the pharmaceutical composition comprises a universal immune effector cell expressing a mutated CnB of the amino acid sequence SEQ ID NO.13 and an immunosuppressant FK506.

9. Use of the universal immune effector cell of any one of claims 1-5 in the manufacture of a medicament for anti-tumor or treatment of autoimmune disease.

10. Use of a universal immune effector cell combined immunosuppressant of any one of claims 1 to 5 in the preparation of a medicament for the anti-tumor or treatment of autoimmune diseases;

preferably, the immunosuppressant is selected from cyclosporin a or FK 506;

preferably, the universal immune effector cell is a universal immune cell expressing a mutant CnA with an amino acid sequence shown as SEQ ID NO.1, and the immunosuppressant is CsA;

preferably, the universal immune effector cell is a universal immune effector cell expressing a mutant CnB with an amino acid sequence shown as SEQ ID NO.13, and the immunosuppressant is FK506.

11. Use of the universal immune effector cell of any one of claims 1-5 in the manufacture of a medicament for use in combination with an immunosuppressant for the treatment of an anti-tumor or autoimmune disease;

preferably, the immunosuppressant is selected from cyclosporin a or FK 506;

12. The use according to any one of claims 9 to 11, wherein the tumour is selected from leukemias (e.g. acute leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, polycythemia vera), lymphomas (hodgkin's disease, non-hodgkin's disease), primary macroglobulinemia, heavy chain disease, solid tumours such as sarcomas and cancers (e.g. fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endothelial sarcoma, lymphosarcoma, vascular sarcoma, lymphatic endothelial sarcoma, synovial vioma, mesothelioma), ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, bronchus cancer, medullary carcinoma, renal cell carcinoma, liver cancer, nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, wilms' cell tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngeal tumor, ependymoma, pineal tumor, angioblastoma, auditory neuroma, oligodendroglioma, neurosphingoma, meningioma, melanoma, neuroblastoma, retinoblastoma), esophageal cancer, gallbladder cancer, renal cancer, multiple myeloma; preferably, the "tumor" includes but is not limited to: pancreatic cancer, liver cancer, lung cancer, stomach cancer, esophageal cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gall bladder cancer, renal cancer, leukemia, multiple myeloma, ovarian cancer, cervical cancer and glioma; the autoimmune disease is selected from: systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, central axis spondyloarthritis, myasthenia gravis, polymyositis, psoriasis/psoriasis, pemphigus, vitiligo, multiple sclerosis, narcolepsy, neuromyelitis optica, type one diabetes, hyperthyroidism, hashimoto's disease/hypothyroidis, sjogren's syndrome, crohn's disease, ulcerative colitis, celiac disease, autoimmune gastritis, primary cholangitis, autoimmune hepatitis, lupus nephritis, pulmonary hemorrhage-nephritis syndrome, autoimmune ovarian inflammation, autoimmune orchitis.