CN117487823A - Respiratory syncytial virus mRNA vaccine and preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of biological pharmacy, in particular to a respiratory syncytial virus mRNA vaccine, a preparation method and application thereof. The invention performs in vitro activity detection on different mRNA samples by mutating and optimizing the antigen sequence of Respiratory Syncytial Virus (RSV) F protein, and screens out the antigen protein sequence stably expressing the trimeric pre-F conformation. After immunization of mice and guinea pigs with mRNA vaccines prepared by LNP encapsulation, the results of the assay showed that high levels of serum IgG antibodies and neutralizing antibodies could be induced and higher TH1 type cellular immune response was generated. The lung tissue pathological results after toxin attack show that the immune mRNA vaccine can achieve good protection effect.

Description

Respiratory syncytial virus mRNA vaccine and preparation method and application thereof

Technical Field

The invention relates to the field of biological pharmacy, in particular to a Respiratory Syncytial Virus (RSV) mRNA vaccine, a preparation method and application thereof.

Background

Human respiratory syncytial virus (Human Respiratory Syncytial Virus, hRSV) is the primary causative agent of acute lower respiratory tract infection (LRTI, principally bronchiolitis and pneumonia) in infants. Can cause serious respiratory tract infection of infants, the elderly and patients with immunodeficiency. Young children are the most dominant infectious group, WHO estimates 6400 tens of thousands of children worldwide infected with respiratory syncytial virus each year, with severe infections of respiratory syncytial virus up to 3460 tens of thousands of people only in children under the age of 5 years worldwide in 2020, with 15 tens of thousands of children dying from respiratory syncytial virus infection, and 99% of deaths occurring in low and medium income countries. Due to the effects of immunity decline and underlying diseases, about 3% -7% of elderly people over 60 years old are also affected by RSV infection at the same time each year, with a higher risk of developing severe disease, bringing a very serious medical burden worldwide. The worldwide direct medical costs associated with RSV in 2017 were estimated to be about 48.2 hundred million euros. There are currently 2 types of humanized specific antibodies marketed abroad for passive immunotherapy, palivizumab (aslicon) and nirselimab ni plug Wei Shankang (aslicon and celecoxib), respectively, i.e. directly providing antibodies to infants to help prevent RSV infection, passive immunization being distinguished from active immunization (vaccination), which is the prevention of RSV infection by vaccine activation of the human immune system. Passive immunization can provide immediate protection, but the immunization duration is short, multiple injections are needed, the dosage requirement is high, and the active immunization can produce strong and durable immunoprotection after several weeks. Therefore, developing a highly effective related vaccine is of great importance in preventing the spread and infection of RSV global disease and maintaining public health safety.

RSV is a linear single stranded RNA virus that encodes 11 proteins in total. The fusion protein (F) and the adhesion protein (G) are key to virus invasion, are the most important antigenic sites for generating neutralizing antibodies, are the most important targets for inducing organisms to generate immunogenicity and antiviral, adhere to host cell membranes, promote the virus to adsorb on the cell surfaces, mediate fusion of a virus envelope and the host cell membranes, enable the virus to enter cells, and enable the F protein to be converted from a metastable pre-fusion conformation (pre-F) to a stable post-fusion conformation (post-F) during the fusion and the entry of the virus. In recent years, as the conformational transition process of the F protein is gradually revealed, phi epitopes with more than 90% of neutralizing activity of the F protein in the pre-fusion conformation are found, and meanwhile, mutation site modification for stabilizing the pre-F structure is also confirmed, so that stable pre-F protein mutants can be used as vaccine antigens to excite more efficient neutralizing antibodies. There are currently some monoclonal antibodies directed against these specific epitopes (e.g. D25:4D7: site I; palivizumab: site II; AM14: span two protomers) are reported, by which the structure of an antigen can be indirectly examined The presence or absence of an antibody response to a specific epitope in the serum induced by the vaccine can be detected by a competition assay, which provides an important tool for identifying and screening antigens with neutralizing active epitopes. At present, stable pre-fusion conformation F protein actively screened based on structural biology becomes a main target point for developing RSV vaccine, and stable pre-fusion conformation pre-F protein RSV vaccine developed based on the main target point also enters clinical stage. The "SC-TM" structure of the Yansen pharmaceutical company (Janssen) obtained a pre-fusion conformation with higher neutralizing activity by three point mutations (N67I, S215P, E487K) and substitution of the p27 region with a linker peptide. The first pre-fusion conformational F protein, "DS-Cav1", developed by the team of the National Institute for Allergy and Infectious Disease (NIAID), acquired intramolecular disulfide bonds by the S155C and S290C point mutations within the F1 fragment, with the addition of S190F and V207L point mutations to enhance the binding activity of the key neutralizing epitope. In 2023, 5 months, GSK (recombinant protein stabilizing pre-F conformation) announced that its RSV vaccine Arexvy was approved by the FDA for use in the elderly to prevent lower respiratory tract disease (RSV-LRTD) caused by RSV infection, which is the first worldwide commercial RSV vaccine. Meanwhile, clinical experimental results of the pre-F conformation stable recombinant protein RSV vaccine show that the vaccine can achieve better immune protection effect on the aged, infants and pregnant women, and is also commercially available at present; the protective effect of the third-phase clinical RSV vaccine developed by Moderna (mRNA for stabilizing pre-F conformation) on the aged also reaches the main endpoint index, and is expected to be rapidly marketed in batches. At present, most of RSV vaccines developed in China in nature are still in an early research stage.

The development progress of the mRNA vaccine is greatly promoted by the successful development of the novel coronavirus mRNA vaccine, and hundreds of millions of novel coronavirus mRNA vaccinators exist worldwide at present, so that the novel coronavirus mRNA vaccine has good safety and effectiveness. As a third generation vaccine technology, mRNA vaccines are also a development direction in which a small number of domestic vaccine enterprises can catch up with the technology of foreign advanced pharmaceutical enterprises. The mRNA vaccine has the related advantages of good safety, strong immune effect, high production speed, wide application range and the like, so the mRNA vaccine is also a hot spot direction of the development of the current biomedical industry.

At present, successful breakthrough of RSV vaccine is mainly concentrated in large-scale foreign pharmaceutical enterprises, while domestic research progress is relatively slow, and breakthrough progress is not great. The Beijing university of transportation reports that mutation is performed based on the F protein sequence through recombinant protein technology to achieve stable pre-F protein structure, but no related popularization and application are reported later. The junyi organism reports the RSV vaccine patents based on mRNA technology, but they are immune antigens prepared based on F protein of wild type RSV, and the reported research has proved that only the RSV antigen with stable pre-F conformation can induce to generate higher level neutralizing antibody, thereby exerting high immune protection efficacy, and the RSV vaccine entering clinic or marketed abroad is mainly developed and completed based on the theoretical basis.

Disclosure of Invention

Problems to be solved by the invention

The invention aims to solve the technical problem of screening antigen sequences with RSV stable pre-F antigen conformation and high-efficiency immunogenicity. Meanwhile, the technical advantages of the mRNA vaccine are exerted, and a specific mRNA molecule is provided, so that the antigen with high immune activity in the trimeric pre-F conformation can be efficiently expressed in vitro and in vivo. Through preparing an mRNA-LNP sample, strong humoral immunity and cellular immunity response can be induced after an experimental animal is immunized, and a good toxicity attack protection effect can be achieved.

Solution for solving the problem

The invention provides a nucleic acid encoding a respiratory syncytial virus F protein, comprising at least one of I) to III):

i) A nucleic acid having one or more nucleotide substitutions, deletions or additions in the fragment shown in SEQ ID NO. 6;

II) a nucleic acid which has a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homologous to the nucleotide sequence as shown in SEQ ID No. 6 and which encodes a respiratory syncytial virus F protein;

III) nucleic acids which are partially or completely complementary to any of I) to II).

Preferably, the nucleic acid comprises at least one of a) to d):

a) Has the sequence shown in SEQ ID NO:1, a nucleotide sequence shown in 1;

b) Has the sequence shown in SEQ ID NO:2, a nucleotide sequence shown in the specification;

c) Has the sequence shown in SEQ ID NO:3, a nucleotide sequence shown in 3;

d) Has the sequence shown in SEQ ID NO:4, a nucleotide sequence shown in figure 4;

e) Has the sequence shown in SEQ ID NO: 5.

The invention provides a ribonucleic acid molecule containing the nucleic acid, and the ribonucleic acid molecule also comprises a 5' -cap structure.

Preferably, the ribonucleic acid molecule further comprises a 5' -UTR.

Preferably, the ribonucleic acid molecule further comprises a 3' -UTR.

Preferably, the ribonucleic acid molecule further comprises PolyA.

Preferably, the 5' -cap structure is selected from at least one of dmCAP, mCAP, tmCAP or ARCA.

Preferably, the 5' -UTR is a globin nucleotide sequence or a retroviral antigen nucleotide sequence, preferably a nucleotide sequence as set forth in SEQ ID NO:7 or NO: shown at 8.

Preferably, the 3' -UTR is a ribosomal protein nucleotide sequence or a globin nucleotide sequence, preferably the sequence as set forth in SEQ ID NO:9 or NO: shown at 10.

Preferably, the PolyA is 20-120 a bases in length.

Preferably, the uracil nucleotide of the ribonucleic acid molecule contains a modifying group.

Preferably, the modifying group is selected from one or more of pseudouridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 5-methylcytosine, 2-thiouridine, 5-methoxyuridine or N1-methyladenosine.

The invention provides application of the nucleic acid or ribonucleic acid molecule in preparing vaccines for preventing and treating RSV virus infection.

The present invention provides a vaccine comprising the ribonucleic acid molecule.

Preferably, the vaccine further comprises a vaccine carrier and an adjuvant.

Preferably, the vaccine carrier is a liposome nanoparticle.

Preferably, the liposome nanoparticle comprises a cationic lipid, a structural lipid, a phospholipid or a PEG lipid.

Preferably, the cationic lipid is selected from one or more of DOTAP, DODMA, dlin-MC3-DMA, ALC-0315 and SM-102.

Preferably, the structural lipid is selected from one or more of cholesterol, dihydrocholesterol, lanosterol, beta-phytosterol, campesterol, stigmasterol, brassicasterol, ergosterol, algae sterol, 3 beta- [ N- (N ', N' -dimethylaminoethyl) carbamoyl ] cholesterol (DC-Chol).

Preferably, the phospholipid is selected from one or more of di-oleoyl phosphatidylethanolamine (DOPE), palmitoyl Oleoyl Phosphatidylcholine (POPC), lecithin phosphatidylcholine (EPC), dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), di-arachidoyl phosphatidylcholine (DAPC), di-behenyl phosphatidylcholine (DBPC), di (xylosyl) phosphatidylcholine (DLPC), di-oleoyl phosphatidylcholine (DOPC), sphingomyelin, cephalinamide, di-oleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), phosphatidylethanolamine (POPE), di-oleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal).

Preferably, the PEG lipid is selected from one or more of PEG2000-DMG (PEG 2000-dimyristoylglycerol), PEG2000-DPG (PEG 2000-dimyristoylglycerol), PEG2000-DSG (PEG 2000-distearylglycerol), PEG5000-DMG (PEG 5000-dimyristoylglycerol), PEG5000-DPG (PEG 5000-dimyristoylglycerol), PEG5000-DSG (PEG 5000-distearylglycerol), PEG-cDMA (N- [ (methoxypoly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), PEG-C-DOMG (R-3- [ (omega-methoxy-poly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), polyethylene glycol (PEG) -Diacylglycerol (DAG), PEG-Dialkyloxypropyl (DAA), PEG-phospholipids, PEG-brain amide (Cer).

Preferably, the auxiliary material is salt or aqueous solution of salt.

Preferably, the salt is selected from at least one of citrate, acetate or phosphate.

The invention provides a preparation method of the vaccine, which comprises the following steps:

dissolving the ribonucleic acid fragment in an auxiliary material aqueous solution to obtain an aqueous phase component; dissolving a vaccine carrier in an organic solution to obtain an organic phase component;

mixing the aqueous phase component and the organic phase component to obtain a vaccine;

or diluting the organic phase component with adjuvant water solution, and concentrating to obtain vaccine.

ADVANTAGEOUS EFFECTS OF INVENTION

The fusion (F) antigen protein of RSV is crucial for retaining the most effective neutralizing activity antibody epitope to endow high-efficiency protection efficacy in the natural trimerization and stable pre-fusion conformation (pre-F), but the expression of the wild type F antigen generated in vitro tends to the post-fusion conformation (post-F) and the stable pre-fusion F antigen is challenging, and the pre-F trimeric antigen sequence for stably and efficiently expressing RSV is identified by carrying out multiple sequence screening and optimization on the antigen F protein, and simultaneously, the codon optimization is further carried out through the antigen gene sequence, so that the fusion (F) antigen protein has higher effective biological activity compared with the F protein antigen sequence of the wild type RSV, and can be used as an effective candidate sequence of vaccine.

Compared with the traditional inactivated vaccine or recombinant protein vaccine, the animal immunity and toxicity attack protection experiment result shows that the prepared RSV mRNA vaccine can induce and simultaneously generate high-level serum neutralizing antibodies and cellular immune response without adding any adjuvant, and can provide better immunity protection efficacy compared with the inactivated vaccine.

Drawings

FIG. 1 is a schematic diagram of plasmid vector construction in example 1.

FIG. 2 is an agarose gel electrophoresis of mRNA samples of example 1.

FIG. 3 shows the results of in vitro activity assays for different mRNA samples of example 1.

FIG. 4 is a schematic illustration of an immunoassay for mice in example 2.

FIG. 5 shows the results of mouse serum IgG binding antibodies and neutralizing antibody titers in example 2.

FIG. 6 shows the results of cytokine level detection in example 2.

FIG. 7 is a schematic diagram of immunization and challenge tests of cotton rats in example 3.

FIG. 8 shows the results of the titers of antibodies bound and neutralizing antibodies by cotton mouse serum IgG in example 3.

FIG. 9 shows the viral nucleic acid content and average pathology score results in lung tissue of example 3.

FIG. 10 shows the results of pathological sections of lung tissue from different immune groups in example 3.

Detailed Description

In order to make the technical scheme and the beneficial effects of the invention more obvious and understandable, the following detailed description is given by way of example. Wherein the drawings are not necessarily to scale, and wherein local features may be exaggerated or reduced to more clearly show details of the local features; unless defined otherwise, technical and scientific terms used herein have the same meaning as technical and scientific terms in the technical field to which this application belongs.

The invention provides a nucleic acid encoding a respiratory syncytial virus F protein, comprising at least one of I) to III):

i) A nucleic acid having one or more nucleotide substitutions, deletions or additions in the fragment shown in SEQ ID NO. 6;

II) a nucleic acid which has a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homologous to the nucleotide sequence as shown in SEQ ID No. 6 and which encodes a respiratory syncytial virus F protein;

III) nucleic acids which are partially or completely complementary to any of I) to II).

SEQ ID NO:6

ATGGAGTTGCCAATCCTCAAAACAAATGCTATTACCACAATCCTTGCTGCAGTCACACTCTGTTTCGCTTCCAGTCAAAACATCACTGAAGAATTTTATCAATCAACATGCAGTGCAGTTAGCAAAGGCTATCTTAGTGCTTTAAGAACTGGTTGGTATACTAGTGTTATAACTATAGAATTAAGTAATATCAAGGAAAATAAGTGTAATGGTACAGACGCTAAGGTAAAATTAATAAAACAAGAATTAGATAAATATAAAAATGCTGTAACAGAATTGCAGTTGCTCATGCAAAGCACACCAGCAGCCAACAGTCGAGCCAGAAGAGAACTACCAAGATTTATGAATTATACACTCAACAATACCAAAAACACCAATGTAACATTAAGTAAGAAAAGGAAAAGAAGATTTCTTGGATTTTTGTTAGGTGTTGGATCTGCAATCGCCAGTGGCATTGCCGTATCCAAGGTCCTGCACCTAGAAGGGGAAGTGAACAAAATCAAAAGTGCTCTACTATCCACAAACAAGGCTGTAGTCAGCTTATCTAATGGAGTCAGTGTCTTAACCAGCAAGGTGTTAGACCTCAAAAACTATATAGATAAACAGTTGTTACCTATTGTTAACAAGCAAAGCTGCAGCATATCAAACATTGAAACTGTGATAGAGTTCCAACAAAAGAACAACAGACTACTAGAGATTACCAGAGAATTTAGTGTTAATGCAGGTGTAACTACACCTGTAAGCACTTATATGTTAACTAATAGTGAGTTATTATCATTAATCAATGATATGCCTATAACAAATGATCAGAAAAAATTAATGTCCAGCAATGTTCAAATAGTTAGACAGCAAAGTTACTCTATCATGTCAATAATAAAAGAGGAAGTCTTAGCATATGTAGTACAATTACCACTATATGGTGTAATAGATACTCCTTGTTGGAAACTACACACATCCCCTCTATGTACAACCAACACAAAGGAAGGATCCAACATCTGCTTAACAAGAACCGACAGAGGATGGTACTGTGACAATGCAGGATCAGTATCCTTTTTCCCACAAGCTGAAACATGTAAAGTTCAATCGAATCGGGTGTTTTGTGACACAATGAACAGTTTAACATTACCAAGTGAGGTAAATCTCTGCAACATTGACATATTCAACCCCAAATATGATTGCAAAATTATGACTTCAAAAACAGATGTAAGCAGCTCCGTTATCACATCTCTAGGAGCCATTGTGTCATGCTATGGCAAAACCAAATGTACAGCATCCAATAAAAATCGTGGAATCATAAAGACATTCTCTAACGGGTGTGATTATGTATCAAATAAGGGGGTGGATACTGTGTCTGTAGGTAATACATTATATTATGTAAATAAGCAAGAAGGTAAAAGTCTCTATGTAAAAGGTGAACCAATAATAAATTTCTATGATCCATTAGTGTTCCCCTCTGATGAATTTGATGCATCAATATCTCAAGTCAATGAGAAAATTAATCAGAGTCTAGCATTTATCCGTAAATCAGATGAATTATTACATAATGTAAATGCTGGTAAATCCACCACAAATATCATGATTACTACCATAATTATAGTAATTATAGTAATATTGTTAGCATTAATTGCAGTTGGACTGCTTCTATACTGCAAGGCCAGAAGCACACCAGTCACATTAAGTAAGGATCAACTGAGTGGTATAAATAATATTGCATTTAGTAACTAATAA

In certain embodiments, the nucleic acid comprises at least one of a) to d):

a) Has the sequence shown in SEQ ID NO:1, a nucleotide sequence shown in 1;

b) Has the sequence shown in SEQ ID NO:2, a nucleotide sequence shown in the specification;

c) Has the sequence shown in SEQ ID NO:3, a nucleotide sequence shown in 3;

d) Has the sequence shown in SEQ ID NO:4, a nucleotide sequence shown in figure 4;

e) Has the sequence shown in SEQ ID NO: 5.

SEQ ID NO：1

ATGGAACTGCCAATTCTGAAGACCAACGCCATCACCACAATCCTGGCCGCTGTCACACTGTGCTTCGCCTCCAGCCAGAACATCACAGAGGAATTTTACCAAAGCACATGTAGCGCCGTGTCTAAGGGCTACCTGAGCGCACTTAGAACCGGCTGGTATACAAGCGTGATCACAATCGAGCTGAGCAATATCAAGGAAAACAAATGTAATGGTACAGATGCCAAGGTGAAACTGATCAAACAGGAGCTGGACAAGTATAAGAATGCCGTGACAGAGCTGCAGCTGCTGATGCAGTCTACATGCGCCGCCAACAGCAGAGCCAGACGGGAACTGCCTAGATTCATGAACTACACCCTGAACAACACCAAAAACACAAATGTCACCCTGAGCAAAAAAAGAAAGCGGCGGTTCCTGGGATTTCTGCTCGGCGTGGGAAGCGCTATCGCCAGCGGCTGTGCCGTGTCTAAGGTGCTGCACCTGGAAGGCGAAGTGAATAAGATCAAGTCCGCCCTGCTGTCGACCAACAAGGCCGTGGTGTCTCTGAGCAATGGCGTTTCCGTTCTGACAATCAAAGTGCTGGATCTGAAGAACTACATCGATAAGCAGCTGTTGCCAATCGTGAACAAGCAAAGCTGCAGCATCAGCAACATCGAAACCGTGATCGAGTTTCAGCAGAAAAACAACCGGCTGCTGGAAATCACCAGAGAGTTCAGCGTGAACGCTGGCGTGACCACACCCGTGAGCACCTACATGCTGACCAATTCCGAGCTCCTGTCCCTGATCAACGACATGCCTATCACAAATGATCAGAAGAAGCTGATGAGCTCTAACGTGCAAATCGTCAGGCAGCAGAGCTACAGCATCATGAGCATCATCAAGGAAGAGGTGCTCGCCTACGTGGTGCAGCTGCCCCTGTACGGCGTTATCGACACCCCTTGTTGGAAGCTGCACACAAGCCCTCTGTGTACCACCAACACCAAGGAAGGATCTAACATCTGCCTGACGCGGACCGACAGAGGATGGTACTGCGACAACGCTGGCTCTGTGAGCTTCTTCCCCCAGGCCGAGACCTGCAAGGTGCAGAGCAACAGAGTGTTCTGCGATACCATGAACAGCCTGACCCTGCCTTCTGAGGTGAACCTGTGCAACATTGATATCTTCAACCCCAAGTACGACTGCAAAATCATGACCAGCAAGACCGACGTGAGCTCTAGCGTCATCACCTCCCTGGGCGCCATTGTGTCCTGCTACGGCAAGACAAAGTGCACCGCCTCTAATAAGAACCGCGGCATCATCAAGACTTTTAGCAACGGCTGCGACTACGTGAGCAACAAGGGCGTGGACACCGTGTCCGTGGGCAACACCCTGTACTACGTGAATAAACAGGAGGGCAAGTCCCTGTATGTGAAGGGAGAGCCTATCATTAACTTCTACGACCCTCTGGTGTTCCCTAGCAGCGAGTTCGACGCGTCCATCAGCCAGGTGAACGAGAAGATCAACCAGAGCCTGGCTTTCATTAGAAAGAGCGACGAGCTGCTCCACAACGTGAACGCCGGCAAAAGCACCACCAATATCATGATCACCACCATCATCATCGTGATCATCGTGATCCTGCTGGCCCTGATCGCCGTGGGCCTGCTGCTGTACTGATAA

SEQ ID NO：2

ATGGAACTTCCAATCCTCAAAACCAATGCTATCACCACCATCCTGGCCGCCGTGACACTGTGCTTCGCCAGCAGCCAGAACATCACCGAAGAGTTCTACCAGAGCACATGCAGCGCTGTGTCTAAGGGCTACCTGAGCGCCCTGAGAACCGGCTGGTATACAAGCGTGATCACCATCGAGCTGAGCAACATCAAAGAGAACAAATGTAATGGAACAGACGCCAAGGTGAAGCTGATCAAACAAGAGCTGGATAAGTACAAGAACGCCGTTACAGAGCTGCAGCTGCTGATGCAGTCTACATGCGCCGCTGGCAGCGGATCTGGTGGCTCTGGGTCTGGCAGAAGCCTGGGCTTCCTGTTAGGCGTCGGATCTGCCATCGCCAGCGGCTGCGCCGTCTCCAAGGTGCTGCACCTGGAAGGCGAGGTTAACAAGATCAAGAGCGCCCTGCTGTCCACCAACAAGGCCGTGGTGTCTCTGAGCAATGGCGTCTCTGTGCTGACCATCAAGGTGCTCGATCTGAAGAACTACATCGATAAGCAGCTGCTCCCTATCGTGAACAAGCAGTCCTGCAGCATCAGCAACATCGAGACAGTGATCGAGTTTCAGCAGAAAAACAACCGGCTGCTGGAAATCACTCGGGAATTTAGCGTGAACGCCGGCGTGACGACCCCTGTGTCTACATACATGCTGACCAACAGCGAGCTGCTGAGCCTGATCAACGACATGCCTATCACAAATGACCAGAAGAAGCTGATGAGCAGCAACGTGCAAATCGTGCGGCAGCAGAGCTACAGCATCATGTCCATCATCAAGGAGGAAGTGCTGGCCTACGTCGTGCAGCTGCCCCTGTATGGCGTGATCGACACCCCTTGCTGGAAGCTGCACACCTCCCCACTGTGCACCACCAACACAAAGGAAGGCAGCAATATCTGCCTGACCAGAACAGATAGAGGCTGGTACTGCGACAACGCCGGATCCGTGTCATTCTTCCCTCAGGCCGAAACCTGTAAAGTGCAGAGCAACAGAGTGTTCTGCGATACCATGAACAGCCTGACACTTCCTTCCGAGGTGAATCTGTGTAACATCGACATCTTCAACCCCAAGTACGACTGCAAGATCATGACCTCCAAGACCGACGTGTCGTCCAGCGTGATCACCAGCCTGGGCGCCATCGTGTCTTGTTACGGCAAGACAAAGTGCACCGCCAGTAACAAGAACCGCGGCATCATCAAGACCTTCAGCAACGGCTGTGACTACGTGAGCAATAAGGGAGTCGACACCGTGTCCGTGGGAAATACCCTGTACTACGTGAACAAACAGGAGGGCAAGAGCCTGTACGTGAAGGGCGAGCCTATCATTAACTTCTACGACCCCCTGGTGTTCCCCAGCTCTGAATTCGACGCTAGCATCAGCCAAGTGAACGAGAAGATCAACCAGAGCCTGGCATTTATCAGAAAGAGTGATGAGCTGCTGCACAACGTGAATGCCGGCAAAAGCACAACCAACATCATGATCACGACCATTATCATAGTGATTATCGTGATCCTGCTGGCTCTGATCGCCGTGGGCCTGCTGCTGTACTGATAA

SEQ ID NO：3

ATGGAACTGCCTATTCTGAAGACCAACGCCATCACAACCATCTTGGCTGCCGTGACACTGTGCTTCGCCTCTAGCCAGAACATTACCGAGGAATTCTACCAGAGCACCTGTAGCGCTGTGTCCAAAGGATATCTGTCTGCCCTGAGAACCGGATGGTACCACTGCGTGATCACCATTGAGCTGAGCAACATCAAGGAAAACAAGTGCAACGGTACAGACGCCAAGGTGAAGCTGATCAAGCAGGAGCTGGATAAGTACAAGAACGCCGTCACAGAACTGCAGCTGCTGATGCAGAGCACATGTGCCGCCGGCAGCGGCTCTGGAGGCAGCGGATCTGGCAGAAGCCTGGGCTTCCTGCTGGGCGTGGGCTCCGCTATCGCCTCTGGCTGCGCCGTATCCAAAGTGCTGCATCTGGAAGGCGAGGTGAACAAGATCAAGTCCGCCCTGCTGTCTACTAACAAGGCCGTCGTGTCACTCAGCAACGGCGTGTCCGTTCTGTGCAGCAAGGTGCTGGACCTGAAAAATTACATCGATAAGCAGCTGCTGCCTATCGTGAATAAACAAAGCTGTAGCATCTCTAATATCGAGACAGTGATCGAGTTTCAGCAGAAAAACAACCGGCTGCTGGAAATCACCAGAGAGTTTAGCGTGAACGCAGGCGTCACAACACCTGTGAGCACCTACATGCTGACCAATAGCGAGCTGCTGAGCCTGATCAATGACATGCCTATCACAAATGATCAGAAGAAGCTCATGAGCAGCAATGTTCAAATCGTGCGGCAGCAGTCCTACAGCATCATGTCTATTATTAAAGAGGAAGTGCTCGCTTATGTGGTGCAGCTGCCCCTGTACGGAGTGATCGACACCCCTTGCTGGAAGCTGCACACCAGCCCTCTGTGCACCACAAACACCAAGGAAGGCAGCAACATATGCCTGACAAGAACAGATAGAGGCTGGTATTGCGACAACGCTGGCAGTGTGTCTTTCTTCCCCCAGGCCGAGACCTGCAAGGTGCAGAGCAACCGGGTGTTCTGCGACACCATGAACAGCCTGACCCTGCCAAGCGAGGTGAACCTGTGTAATATCGACATCTTCAACCCCAAGTACGACTGCAAGATCATGACCAGCAAAACGGACGTGTCCAGCTCAGTCATCACCAGCCTGGGCGCCATCGTGTCTTGTTACGGCAAGACCAAGTGCACAGCCAGCAACAAAAACAGGGGCATCATCAAGACCTTCAGCAACGGCTGTGATTACGTGTCCAACAAGGGCGTGGACACCGTGAGCGTGGGCAACACCCTGTACTACGTGAACAAGCAGGAGGGAAAGAGCCTGTACGTCAAGGGCGAGCCTATCATCAACTTCTACGACCCCCTGGTGTTTCCATCTTCTGAATTCGACGCCAGCATCAGCCAAGTGAACGAGAAGATCAACCAGTCTCTGGCCTTCATCAGAAAGAGTGATGAGCTGCTGCACAACGTGAACGCCGGCAAAAGCACCACAAACATCATGATCACCACCATCATCATCGTGATCATCGTGATCCTGCTGGCCCTGATCGCCGTGGGACTTCTGCTGTACTGATAA

SEQ ID NO：4

ATGGAACTGCCTATCCTCAAGACCAACGCCATCACAACTATCCTGGCCGCCGTGACCCTGTGCTTCGCCAGTTCTCAGAACATTACAGAGGAATTCTACCAGTCCACCTGCAGCGCCGTGTCCAAAGGCTACCTGAGCGCTCTGAGAACAGGCTGGTACCACTGCGTGATCACCATAGAACTGAGCAACATCAAAGAGAACAAGTGCAACGGCACCGACGCCAAGGTGAAGCTGATCAAGCAAGAGCTCGATAAGTACAAGAACGCCGTGACCGAGCTGCAGCTGCTAATGCAGAGCACACCAGCCGCTGGCTCTGGCAGCGGAGGCAGCGGATCTGGTAGAAGCCTGGGCTTCCTGCTGGGCGTGGGCTCTGCTATCGCCTCCGGCATCGCCGTCAGCAAGGTGCTGCATCTGGAAGGCGAGGTGAACAAGATTAAAAGCGCCCTGTTATCTACAAATAAGGCCGTGGTGAGCCTGAGCAACGGCGTGAGCGTGCTGTGCAGCAAGGTGCTGGACCTGAAGAACTACATCGACAAGCAGCTGCTCCCCATCGTGAACAAGCAGAGCTGTAGCATCAGCAATATCGAAACCGTGATTGAATTTCAGCAGAAGAACAACAGACTGCTTGAGATCACACGGGAATTCAGCGTGAACGCCGGCGTGACAACACCTGTGAGCACCTACATGCTGACAAATAGCGAGCTGCTGTCTCTGATCAACGACATGCCCATCACCAACGACCAGAAAAAGCTGATGAGCTCTAATGTGCAGATCGTTAGACAGCAATCCTATTCTATCATGTCCATCATCAAGGAAGAGGTGCTGGCCTACGTGGTTCAGCTGCCTCTGTATGGCGTGATCGATACCCCTTGCTGGAAGCTGCACACCAGCCCTCTGTGTACCACCAACACCAAGGAGGGCTCTAACATCTGCCTGACCAGAACAGATAGAGGCTGGTATTGCGATAACGCCGGCAGCGTGTCATTCTTCCCTCAGGCCGAGACATGTAAAGTGCAGTCTAACCGGGTGTTCTGCGACACCATGAACAGCCTCACACTGCCATCTGAGGTGAATCTGTGTAATATCGATATCTTCAACCCCAAGTACGACTGTAAAATCATGACCAGCAAAACCGACGTGAGCAGCAGCGTCATCACCTCGCTGGGCGCCATCGTCTCCTGCTACGGCAAGACAAAGTGCACCGCCAGCAACAAAAACCGGGGCATTATCAAGACTTTTAGCAACGGCTGCGACTACGTGAGCAATAAGGGCGTCGACACCGTGTCTGTGGGCAACACACTGTACTACGTTAATAAGCAGGAGGGAAAGAGCCTGTACGTGAAAGGAGAACCTATCATCAACTTCTACGATCCTCTGGTGTTCCCCAGCAGCGAGTTCGACGCCAGCATCAGCCAGGTGAACGAGAAGATCAACCAAAGCCTGGCTTTTATCAGGAAGAGCGACGAGCTGCTGCACAACGTGAACGCTGGAAAGAGCACCACCAATATCATGATCACCACCATCATCATCGTGATCATCGTGATCCTGCTGGCTCTGATCGCCGTGGGACTGCTGCTGTACTGATAA

SEQ ID NO：5

ATGGAACTCCCAATTCTGAAGACAAACGCCATTACAACAATCCTGGCCGCTGTTACCCTCTGTTTTGCCAGCTCCCAGAACATCACCGAAGAATTTTACCAGAGCACATGTAGCGCCGTGAGCAAGGGATATCTGTCCGCTCTGAGAACCGGCTGGTACCACTGCGTGATCACCATCGAGCTGAGCAATATCAAAGAGAACAAGTGCAACGGCACCGATGCCAAGGTGAAGCTGATCAAGCAAGAGCTGGATAAGTATAAGAACGCCGTGACCGAGCTGCAGCTCCTGATGCAGAGCACCCCTGCTGCTGGCAGCGGCAGCGCCATCGCCTCTGGCATAGCCGTGAGCAAGGTTCTGCATCTGGAAGGCGAGGTCAACAAAATCAAGAGCGCTCTGCTGAGCACAAACAAGGCCGTCGTGTCCCTGTCCAATGGCGTGTCTGTGCTGTGCTCTAAGGTGCTGGACCTGAAAAACTACATCGACAAGCAGCTGCTGCCTATCGTGAACAAGCAGTCTTGTTCTATCAGCAACATCGAAACTGTGATCGAGTTTCAGCAAAAGAACAACCGGCTGCTGGAAATCACCAGAGAGTTCAGCGTGAACGCCGGAGTGACCACACCTGTGTCTACCTACATGCTGACCAATAGCGAGCTGCTGAGCCTGATCAATGACATGCCTATCACAAACGACCAGAAAAAGCTGATGAGCAGCAACGTGCAAATCGTCAGGCAGCAGAGCTACAGCATCATGAGCATCATCAAAGAAGAGGTGCTGGCCTACGTGGTGCAGCTGCCCCTGTACGGCGTGATCGATACCCCATGCTGGAAGCTGCACACCAGCCCCCTGTGCACCACCAACACAAAGGAAGGCTCCAACATCTGCCTGACACGGACCGATAGAGGCTGGTATTGCGACAACGCCGGCTCTGTGTCCTTCTTCCCCCAGGCCGAAACCTGCAAGGTGCAGAGTAACAGAGTGTTCTGCGATACAATGAACAGCCTGACCCTGCCTAGCGAGGTGAACCTGTGTAATATCGACATCTTCAACCCCAAGTACGACTGCAAGATCATGACCAGCAAGACCGACGTGAGTAGCTCTGTTATCACAAGCCTGGGCGCCATCGTGTCCTGCTACGGCAAAACCAAGTGCACCGCCAGCAACAAAAATCGGGGCATCATCAAGACATTCAGCAATGGATGTGACTACGTGAGCAACAAGGGCGTGGACACCGTGTCTGTGGGCAACACCCTGTACTACGTGAACAAACAGGAGGGCAAGTCTCTGTACGTCAAGGGAGAGCCTATCATCAACTTCTACGATCCTCTGGTGTTCCCTTCTAGCGAGTTCGACGCCAGCATCAGCCAGGTGAACGAGAAGATTAACCAGTCTCTGGCCTTCATCAGAAAGAGCGACGAGCTGCTGCACAACGTGAATGCCGGAAAGAGCACCACCAACATCATGATCACAACAATCATCATTGTGATCATTGTGATCCTGCTCGCTCTGATCGCCGTGGGCCTGCTGCTGTACTGATAA

The invention provides a ribonucleic acid molecule containing the nucleic acid, and the ribonucleic acid molecule also comprises a 5' -cap structure.

In certain embodiments, the ribonucleic acid molecule further comprises a 5' -UTR.

In certain embodiments, the ribonucleic acid molecule further comprises a 3' -UTR.

In certain embodiments, the ribonucleic acid molecules further comprise PolyA.

In certain embodiments, the 5' -cap structure is selected from at least one of dmCAP, mCAP, tmCAP or ARCA.

In certain embodiments, the 5' -UTR is a globin nucleotide sequence or a retroviral antigen nucleotide sequence, preferably

Selected as SEQ ID NO:7 or NO: shown at 8.

SEQ ID NO：7

AAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC

SEQ ID NO：8

GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

In certain embodiments, the 3' -UTR is a ribosomal protein nucleotide sequence or a globin nucleotide sequence, preferably a nucleotide sequence as set forth in SEQ ID NO:9 or NO: shown at 10.

SEQ ID NO：9

GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGA

SEQ ID NO：10

CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

In certain embodiments, the PolyA is 20-120 a bases in length.

In certain embodiments, the PolyA is as set forth in SEQ ID NO: 11.

SEQ ID NO：11

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

In certain embodiments, the uracil nucleotide of the ribonucleic acid molecule contains a modifying group.

In certain embodiments, the modifying group is selected from one or more of pseudouridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 5-methylcytosine, 2-thiouridine, 5-methoxyuridine, or N1-methyladenosine.

The invention provides application of the nucleic acid or ribonucleic acid molecule in preparing vaccines for preventing and treating RSV virus infection.

The present invention provides a vaccine comprising the ribonucleic acid molecule.

In certain embodiments, the vaccine further comprises a vaccine carrier and an adjuvant.

In certain embodiments, the vaccine carrier is a liposome nanoparticle.

In certain embodiments, the liposome nanoparticle comprises a cationic lipid, a structural lipid, a phospholipid, or a PEG lipid.

In certain embodiments, the cationic lipid is selected from one or more of DOTAP, DODMA, dlin-MC3-DMA, ALC-0315 and SM-102.

In certain embodiments, the structural lipid is selected from one or more of cholesterol, dihydrocholesterol, lanosterol, beta-phytosterol, campesterol, stigmasterol, brassicasterol, ergosterol, algae sterol, 3 beta- [ N- (N ', N' -dimethylaminoethyl) carbamoyl ] cholesterol (DC-Chol).

In certain embodiments, the phospholipid is selected from one or more of di-oleoyl phosphatidylethanolamine (DOPE), palmitoyl Oleoyl Phosphatidylcholine (POPC), lecithin phosphatidylcholine (EPC), dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), di-arachidoyl phosphatidylcholine (DAPC), dibbehenyl phosphatidylcholine (DBPC), di (woodwax acyl) phosphatidylcholine (DLPC), di-oleoyl phosphatidylcholine (DOPC), sphingomyelin, brain amide, di-oleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), phosphatidylethanolamine (POPE), di-oleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal).

In certain embodiments, the PEG lipid is selected from one or more of PEG2000-DMG (PEG 2000-dimyristoylglycerol), PEG2000-DPG (PEG 2000-dipalmitoylglycerol), PEG2000-DSG (PEG 2000-distearylglycerol), PEG5000-DMG (PEG 5000-dimyristoylglycerol), PEG5000-DPG (PEG 5000-dipalmitoylglycerol), PEG5000-DSG (PEG 5000-distearylglycerol), PEG-cDMA (N- [ (methoxy poly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), PEG-C-DOMG (R-3- [ (ω -methoxy-poly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), polyethylene glycol (PEG) -Diacylglycerol (DAG), PEG-Dialkyloxypropyl (DAA), PEG-phospholipid, PEG-brain amide (Cer).

In certain embodiments, the adjuvant is a salt or an aqueous solution of a salt.

In certain embodiments, the salt is selected from at least one of citrate, acetate or phosphate.

In certain embodiments, the vaccine is administered by intramuscular injection, nasal spray, and intravenous injection.

In certain embodiments, the vaccine is administered by intramuscular injection.

The invention provides a preparation method of the vaccine, which comprises the following steps:

Dissolving the ribonucleic acid fragment in an auxiliary material aqueous solution to obtain an aqueous phase component; dissolving a vaccine carrier in an organic solution to obtain an organic phase component;

mixing the aqueous phase component and the organic phase component to obtain the vaccine.

The invention provides a preparation method of the vaccine, which comprises the following steps:

dissolving the ribonucleic acid fragment in an auxiliary material aqueous solution to obtain an aqueous phase component; dissolving a vaccine carrier in an organic solution to obtain an organic phase component;

diluting the organic phase component with adjuvant water solution, and concentrating to obtain vaccine.

In certain embodiments, the molar ratio of cationic lipid, structural lipid, phospholipid, PEG lipid in the vaccine carrier is 30-60:30-60:5-20:1-5.

In certain embodiments, the molar ratio of cationic lipid, structural lipid, phospholipid, PEG lipid in the vaccine carrier is 50:38.5:10:1.5.

In certain embodiments, the molar ratio of cationic lipid, structural lipid, phospholipid, PEG lipid in the vaccine carrier is 43.6:42.7:9.4:1.6.

In certain embodiments, the mRNA-LNP sample is prepared at a nitrogen to phosphorus ratio of 3 to 6:1.

In certain embodiments, the mRNA-LNP sample is prepared at a nitrogen to phosphorus ratio of 4.5:1.

In certain embodiments, the prepared mRNA-LNP sample is concentrated and purified by multiple ultrafiltration tube centrifuges, replacing the organic and aqueous phase solutions with PBS solutions.

In certain embodiments, the prepared mRNA-LNP sample is prepared by diafiltration followed by filtration purification by TFF.

The invention specifically screens F antigen sequences of RSV, optimizes the gene sequences, screens out a plurality of candidate antigen sequences through specific antibody detection, and results show that the optimized antigen genes can efficiently express antigen proteins in stable pre-F conformation, which are obviously higher than F antigen genes expressing Wild Type (WT). Experiments prove that the mRNA vaccine prepared from the mRNA provided by the invention through LNP encapsulation has good stability, and can induce and generate higher serum binding antibodies and neutralizing antibody levels after mice and cotton mice are immunized, and simultaneously, the cell immune response reaction mainly generating TH1 is stimulated. The toxicity attack protection experiment also shows that the immune mRNA vaccine can provide good toxicity attack protection effect for cotton rats. Therefore, the RSV vaccine developed based on mRNA technology and clinical application of the invention have important development potential.

Some embodiments of the present invention are described in detail below with further reference to the accompanying drawings. The following embodiments and features of the embodiments may be combined with each other without conflict.

Example 1

Test 1: RSV sequence design and plasmid synthesis

The mRNA expression required elements 5'UTR (SEQ ID NO: 7), 3' UTR gene sequence (SEQ ID NO: 9), poly (A) sequence (SEQ ID NO: 11), and RSVF antigen sequence were synthesized by the company Style. Firstly, a RSV-WT antigen gene sequence is synthesized chemically, and inserted onto a pUC57 plasmid vector through molecular cloning, a successfully constructed plasmid structure schematic diagram is shown in figure 1, then, synthetic point mutation PCR primers are respectively designed, RSV F antigen other mutant genes are respectively constructed through a gene site-directed mutagenesis mode, the recombinant plasmids are named RSV-WT (wild type, SEQ ID NO: 6), RSV-4031 (P101 C\I312I\D486S, 550-574 amino acid sequence is removed, SEQ ID NO: 1), RSV-4032 (P101 C\I312C\S162I\D486S, 104-137 amino acid sequence is replaced by GSGSGGSGSGRS, 550-574 amino acid sequence is removed, SEQ ID NO: 2), RSV-4033 (T54 H\S55C\P7C\I316C\T12C\D486S, 104-137 amino acid sequence is replaced by GSGSGGSGSGRS, 550-574 amino acid sequence is removed, and the sequence is replaced by GS 54 H\C7C\375C\C7C\C7C\C6S, 550-574 amino acid sequence is removed, and the sequence is replaced by the sequence of any one of the sequence of SEQ ID No. 189.

Test 2: mRNA sample preparation

Plasmid linearization: 1) The constructed plasmid was transformed into E.coli DH 5. Alpha. Competent cells, monoclonal colonies were picked up, and plasmid DNA was extracted after amplification culture at 37℃by adding LB medium. 2) Plasmid DNA was linearized using Xba I restriction enzyme, and plasmid purification was performed by DNA purification beads, and the digested linearized product was used as a template for subsequent in vitro transcription.

In Vitro Transcription (IVT): the IVT system was prepared by the following table components, UTP was completely replaced with modified nucleotide (N1-methyl pseudouridine), incubated at 37℃for 3 hours, 1. Mu.L DNase I (RNase-free) was added to each tube after completion of the transcription reaction, and after mixing, the mixture was centrifuged briefly and incubated at 37℃for 15 to 30 minutes to remove the template DNA. The IVT product was purified by RNA magnetic beads (VAHTS RNA Clean Beads).

Component (A)	Volume (mu L)	Final concentration
			RNase-free H 2 O	Up to 20	-
10×Transcription Buffer	2	1×
			CTP/GTP/ATP/UTP(100mM each)	2each	10mM each
Template DNA	1μg	-
			T7 RNA Polymerase Mix	2	-

Capping of RNA: 10. Mu.g of RNA was taken with RNase-free H ₂ O was diluted to 13.5. Mu.L and treated at 65℃for 5-10min, immediately thereafter placed on ice for 5min, and the capping system was prepared as per the following table components. Incubate at 37℃for 1h. The capped mRNA product was purified by RNA magnetic beads.

Component (A)	Volume (mu L)	Final concentration
			Denatured RNA(from above)	13.5	-
10x Capping Buffer	2	1×
			GTP(10mM)	1	0.5mM
SAM(fresh 8mM)	1.25	0.5mM
			Murine RNase Inhibitor(40U/μL)	0.5	1U/μL
Vaccinia Capping Enzyme(10U/μL)	5	2.5U/μL
			2′-O-Methyltransferase(50U/μL)	1	2.5U/μL

mRNA detection: the prepared mRNA samples were identified for integrity, size and purity by agarose gel electrophoresis or capillary gel electrophoresis, as shown in FIG. 2, and the 6 mRNA sample sequence bands were single and all showed good integrity, designated mRNA-403l, mRNA-4032, mRNA-4033, mRNA-4034, mRNA-4035 and mRNA-WT, respectively.

Test 3: antigen Activity assay

HEK-293T cells were plated in 6 well plates in advance and transfected when cell confluency grew to around 80%. 6 in vitro synthesized mRNA samples were transfected into HEK-293T cells, with the transfected cells being set as negative controls. Cell samples were harvested 24h after transfection and purified using RSV F protein conformational antibody, motavizumab (epitope antibody II), D25 @, respectivelyNumber site, neutralizing antibody epitope, recognizing pre-F structure), AM14 (recognizing pre-F trimer structure) and 4D7 (recognizing Post-F structure) were immunostained for target protein detection using Flow Cytometry, and untransfected cells were used as negative controls. Detection of RSV by Flow Cytometry F protein conformation recognition antibody against different antigen sequences pre-F conformation, pre-F trimer structure and recognition efficiency of post-F conformation. As a result, as shown in FIG. 3, transfected wild-type and mutant mRNA samples were able to normally express RSV F protein on the surface of HEK-293T cells, but mRNA of different sequences was different in protein expression level, 5 mutant forms expressed higher levels of Pre-F conformational antibodies than that of wild-type (WT) F antigen sequences, and trimerized structure expression amounts were much higher than that of wild-type sequences, where mRNA-4031 sequences Pre-F conformational proteins were expressed in the highest amounts and the Pre-F/post-F ratio was the highest.

Example 2

Test 1: mRNA-LNP sample preparation

Lipid phase: the lipid phase was formulated at a total concentration of 12.5mM, according to cationic lipid: polyethylene glycol: cholesterol: dspc=50:10:38.5:1.5 (molar ratio) the corresponding substances were weighed, dissolved in absolute ethanol and thoroughly mixed. Aqueous phase: nucleic acid mRNA was diluted to corresponding concentrations with sodium citrate buffer at ph=4 according to a nitrogen to phosphorus ratio of 4.5:1. Encapsulation: volume ratio of aqueous phase to organic phase 3:1, the flow rate ratio is 3:1 wrapping by a microfluidic device. The sample was diluted to 15ml with sterile PBS solution. Purifying: ultrafiltration is performed by a 30KD ultrafiltration centrifuge tube, 10min and 2000rpm, after concentration to 1ml, 15ml of PBS solution is added, and ultrafiltration is continued, and the conditions are the same as above, and repeated for 2 times. The solution buffer is finally concentrated and displaced.

The encapsulated mRNA-LNP samples were subjected to particle size analysis using a malvern particle size analyzer, parameter t=20 ℃, equilibration time 20s, number of determinations 3 times. Detecting the encapsulation efficiency of an mRNA-LNP sample according to the operation instruction of a kit (Quant-iT riboGreen RNA), preparing a standard curve by diluting a standard substance by a multiple ratio, then respectively detecting the mRNA content before demulsification and after demulsification, reading the fluorescence intensity by an enzyme-labeled instrument, and then calculating the encapsulation efficiency of the LNP according to the mRNA standard curve.

4 lipid components of LNP were mixed with mRNA based on a microfluidic system to self-assemble into nanoparticles. By physical and chemical property detection of the mRNA-LNP encapsulated sample, the results are shown in figure 3, the particle sizes of mRNA-4031, mRNA-4032 and mRNA-4033 are about 80nm, the PDI values are low (less than 0.2), and in addition, the detection results of the mRNA-LNP sample encapsulation efficiency show good encapsulation effect, and the encapsulation efficiency is more than 95%.

Table 1: physicochemical property detection of different mRNA-LNP samples

Sample (mRNA-LNP)	Particle size (nm)	PDI value	Encapsulation efficiency (%)
				mRNA-4031	76.78	0.12	97.14
mRNA-4032	78.05	0.07	97.64
				mRNA-4033	77.94	0.09	98.23

Test 2: immunization experiments in mice

Both BALB/c mice and cotton mice used in this experiment were purchased from St Bei Fu. Design of immune experiment: BALB/c was selected from 5-7 week old female mice, immunized twice at 0 and 3 weeks (w), 10 μg per immunization dose, 3w to collect intermediate blood, 5w after immunization, mice were sacrificed, blood and spleen were collected, and immunization procedure is shown in FIG. 4.

Test 3: serum antibody titer detection

Serum IgG antibody detection: 1) Antigen coating: the RSV pre-F protein and post-F protein were each diluted (pH=7.4) with phosphate coating buffer to 2. Mu.g/ml, coating volume 100. Mu.l/well, and coated overnight at 4 ℃. 2) Closing: PBST was washed 6 times, 200. Mu.l/well of blocking solution (5% nonfat milk powder-PBS) was added, and the incubator was blocked at 37℃for 2 hours. 3) Serum dilution and sample incubation: the ELISA plate was washed 6 times with PBST, the serum of the mice was diluted with a diluent (2% nonfat milk powder-PBS) at an initial serum dilution concentration of 1:50, and then diluted 4-fold, 11 dilution gradients were added, and a negative control was set. Mu.l of each well was added and incubated in a 37℃incubator for 1h. 4) Incubation of HRP enzyme-labeled secondary antibody: PBST was washed 6 times, 100. Mu.l/well of GoatAnti-Mouse rats IgG (H+L) HRP-labeled secondary antibody was added and incubated at 37℃for 1H. 5) Color development: PBST was washed 6 times, 100. Mu.l/well of freshly prepared TMB color development solution was added and incubated at 37℃for 10min in the absence of light. 6) Termination and reading: h of 2M ₂ SO ₄ The chromogenic reaction was terminated and the absorbance of each well was read by a microplate reader at 450nm and 620 nm.

Neutralizing antibody titer detection: 1) Cell plating: HEp-2 cells were plated in advance into 96-well cell culture plates and experiments were performed when cell confluency was grown to 95%. 2) Serum complement inactivation: the packaged mouse serum is placed in a water bath kettle with the temperature of 56 ℃ and inactivated for 30min. 3) Serum sample dilution: the dilutions (2% FBS-DMEM medium) were used to dilute the mouse serum at an initial serum dilution of 1:20, followed by a 3-fold dilution ratio for a total of 8 dilution gradients. Positive control (D25 antibody) and negative control were set simultaneously. 4) RSV (A2 strain) virus dilution: respectively diluting the virus stock solution to a concentration of 10 ⁴ pfu/ml and 0.3X10 ⁴ pfu/ml. 5) Virus neutralization: the diluted serum and the virus were mixed uniformly by taking 120. Mu.l each, and incubated in a constant temperature incubator at 37℃for 1 hour. 6) Seeding HEp-2 cells: the cell culture supernatant was discarded, and 200. Mu.l of the virus serum mixture after neutralization was added to the cell culture plate. Culturing in a constant temperature incubator at 37 ℃ for 48 hours. 7) Indirect immunofluorescent staining: fixation/penetration: sucking and discarding cell culture solution, adding 100% of ice nailFixing with alcohol for 20min. Incubation resistance: PBS-1% BSA was washed 3 times, primary antibody (Motavizumab antibody) was added, and incubated in a constant temperature incubator at 37℃for 1 hour. Incubation of fluorescent secondary antibody: PBS-1% BSA was washed 3 times, FITC-anti-human IgG was diluted with PBS-1% BSA containing 0.02% Evan blue, 50. Mu.l of the diluted secondary antibody was added, and incubated in a 37℃incubator for 40min. 8) Reading fluorescent spots: PBS-1% BSA was washed 3 times, and after the liquid was dried, the liquid was placed on an Elispot reader to read out fluorescent spots.

The results of indirect Elisa detection of serum IgG antibody titers are shown in FIG. 5.A, and the serum antibody GMT values against pre-F protein after two immunizations of mRNA-4031, mRNA-4032, and mRNA-4033 vaccines can reach 4,194,304, and 2,642,246, respectively. Whereas the serum antibody titers GMT against post-F proteins can reach 1,664,511, 1,664,511 and 1,321,123, respectively (fig. 5. B). Wherein the pre-F/post-F antibody titer ratios were 2.00, 2.52, respectively (FIG. 5. C). The above data indicate that mRNA-4031, mRNA-4032 and mRNA-4033 vaccines all induced very high binding antibody titers, with antibodies against pre-F protein as the predominant antibody, more than twice the antibody titer against post-F protein. At the same time, the present study was also based on a minivirus neutralization assay to evaluate antibody titers of mouse serum neutralizing viruses after immunization of mRNA vaccines, as shown in fig. 5.D, serum neutralizing antibody titers (NTs ₅₀ ) GMT values can reach 36,628, 9,796 and 6,875, respectively.

Test 4: cellular immunoassay

Specific cytokine detection: 1) The mouse spleen cells were removed from the-80℃refrigerator and quickly thawed in a 37℃water bath. 2) Mu.l of 1640 medium containing 10% FBS was added to each tube of spleen cells, and 500g was centrifuged for 5min. 3) The cell supernatant was discarded, 300. Mu.l of complete medium was added, and the mixture was blown down and incubated in a 37℃cell incubator for 2 hours. 4) After incubation, the spleen cells of the mice were counted and the concentration of the spleen cells of the mice was adjusted to 2.5X10 ⁷ cell/ml. 5) ELISPot plates (IFN-. Gamma., IL-2, IL-4) from Mabtech were removed from the sealed package and washed 4 times with sterile PBS (200. Mu.L/well). 6) The ELISpot plates were equilibrated with 1640 medium (200 μl/well) of 10% fbs and incubated at room temperature for at least 30min. 7) The incubated ELISPot plates were removed and medium was discarded and 100. Mu.l of mouse spleen was added to each wellCell suspension (2.5X10) ⁶ A cell). 8) The stimulus was added, and each sample was stimulated with 5. Mu.g/mL RSV F protein peptide library, respectively, while a positive control group (PMA was set up&lonomycin) and a negative control group (no stimulant added). 9) The ELISPot plate was placed at 37℃with 5% CO ₂ The culture was performed in an incubator for 36-48 hours, during which time the ELISpot plate was not moved. 10 Spot count): cells were discarded, washed 5 times with PBS, 200. Mu.L/well. The detection antibody (R4-6A 2-biotin) was diluted to 1. Mu.g/ml in PBS containing 0.5% fetal calf serum (PBS-0.5% FCS). 100. Mu.L/well was added and incubated for 2h at room temperature. ELISpot plates were washed as above. streptavidin-ALP was diluted in PBS-0.5% FCS, 100. Mu.L/well was added, and incubated for 1h at room temperature. The plate was washed as above. The ready-to-use base solution (BCIP/NBT-Plus) was filtered through a 0.45 μm filter and 100. Mu.L/well was added. Color development was carried out until a clear spot appeared. The ELISpot plates were dried and spots were counted by washing in tap water.

Antigen-specific IFN-gamma, IL-2 and IL-4 cytokine secretion levels were detected based on Elispot. As shown in FIG. 6.A, mice spleen cells from the mRNA-4031, mRNA-4032 and mRNA-4033 vaccine immunized groups produced 2,706, 2,260 and 2,022 IFN-gamma cytokine spots, respectively. As shown in FIG. 6.B, each mRNA vaccine immunization group produced 844, 756, and 556 IL-2 cytokine spots, respectively. As shown in FIG. 6.C, each mRNA vaccine immunization component produced IL-4 cytokine plaques less than 10. In addition, the level of 3 cytokines produced by the immunized PBS control group was low. The above results indicate that all the 3 groups of RSV mRNA vaccines induce strong cellular immune response in animal bodies and belong to Th1 type biased immune response.

Example 3

Test 1: immune and toxicity attack experiment of cotton rats

Immunization and challenge protection experiments: female cotton rats of 5-7 weeks of age are selected, and are respectively subjected to intramuscular injection and immunization twice at 0 w and 3w, wherein the immunization dose is 45 mug each time, and then nasal drip and poison attack are carried out after the first 7 weeks, and each cotton rat is subjected to nasal drip of 100 mul (2.5X10) ⁵ PFU) RSVA2 strain virus, cotton mice were sacrificed on day 5 after challenge, blood samples and spleen and lung tissue samples of each group were collected for in vitro testing, and the experimental design is shown in fig. 7.

Test 2: serum antibody detection

Serum antibody detection was performed according to the procedure described in test 3 of example 2. As a result, as shown in FIG. 8.A, the FI-RSV (inactivated) group pre-F protein serum antibody titer GMT values after the first 3w and 7w were respectively 20,800, 51,200, whereas the mRNA-4031 vaccine group pre-F protein serum antibody titer GMT values were respectively 332,800 and 819,200, so that the average two groups of values were 10-fold different. As shown in FIG. 8.B, post-F protein serum antibody titers GMT of the FI-RSV and mRNA-4031 vaccine groups after 7W immunization can reach 2,048,000 and 819,200, respectively. The FI-RSV group and mRNA-4031 vaccine group had pre-F/post-F antibody titres of 0.07 and 1, respectively (figure 8.C). Meanwhile, the detection result of the virus neutralization experiment shows that the neutralizing antibody titer GMT value of the cotton mouse serum after 7w of the mRNA vaccine is 37,114, which is obviously higher than that of the FI-RSV inactivated vaccine group (543). In summary, the immune mRNA vaccine group induced higher levels of pre-F protein serum antibody titers and neutralizing antibody titers than the FI-RSV vaccine group.

Test 3: toxin-counteracting protection detection

Nucleic acid load (RT-qPCR) detection of cotton rat lung tissue virus: 1) Tissue harvesting and homogenization: after the cotton rats were sacrificed, lung tissue was aseptically collected, the tissue was weighed, 9 volumes of tissue homogenate (2% BSA) was added, and the mixture was homogenized in a tissue homogenizer at a tissue concentration of 1 mg/. Mu.L after homogenization. 2) Tissue total RNA extraction: mu.L (50 mg) of the homogenate was taken and 1ml of Trizol was added thereto, and the mixture was left at room temperature for 5 minutes to allow the sample to be sufficiently lysed. 0.2ml of phenol chloroform was added to each ml of Trizol, and the mixture was stirred for 15 seconds and left at room temperature for 3 minutes. The upper colorless aqueous phase of total RNA was transferred to a new centrifuge tube by centrifugation at 12,000g for 15 minutes at 4 ℃. 0.5ml of isopropanol was added, mixed several times upside down and precipitated overnight at-20 ℃. The RNA was found to precipitate white at the bottom of the tube by centrifugation at 12,000g for 10 min at 4℃and the supernatant was discarded. 1ml of 75% ethanol was added and mixed upside down. 7,500g of the mixture was centrifuged at 4℃for 5 minutes, and the supernatant was discarded. After the RNA was slightly dried, 30. Mu.l of DEPC water was added for solubilization and frozen at-70 ℃. 3) Preparation of RNA standard: after linearization of the eukaryotic expression plasmid of the RSV L gene, the L gene mRNA was transcribed in vitro using T7 RNA polymerase in vitro transcription reagents. RSV L gene standard purification: mRNA was purified using oligo dT magnetic beads and mRNA concentration was quantified using a spectrophotometer. 4) RT-qPCR detection: one Step qRT-PCR SYBR Green Kit was used to quantify the pneumovirus nucleic acid load with a final primer concentration of 0.5 μm. The One Step qRT-PCR reaction was performed as follows: step one, reverse transcription is carried out at 50 ℃ for 3min. Step two, pre-denaturation, 95 ℃ and 30s. Step three, the reaction is circulated for 40 times at 95 ℃,10s,60 ℃ and 30s. Step four, melting curve, 95 ℃,15s,60 s,95 ℃ and 15s. After the reaction, the viral nucleic acid load of each sample was converted by a standard curve.

The vaccinated cotton rats were challenged with RSVA2 and lung tissue was collected 5d after challenge, and the RT-qPCR quantitated the load of pneumovirus nucleic acid, as shown in figure 9.A, and the immune mRNA vaccine group reduced the nucleic acid load of the cotton rat lung tissue RSV compared to the PBS group. The average pathological scores of lung tissues of each immunized group of cotton rats are shown in a graph 9.B, and by blinding the pathological sections of lung tissues of each group of cotton rats, no obvious pathological changes are found according to the severity scores of 0-4, the pathological changes are most obvious in the score of 4, and the results show that the pathological average scores of NC (blank), PBS, FI-RSV and mRNA vaccine groups are respectively 1, 6.08, 6.50 and 3.75 (graph 9.B).

Test 4: cotton rat lung histopathological scoring

Cotton rat lung histopathology tissue samples from different immune groups were blindly evaluated by kansaier medical test limited, su. Following the histopathological sampling procedure, cotton rat right lung lobes were taken and the tissues were fixed in 10% neutral formalin solution, after which the lung tissues were paraffin embedded, sectioned, hematoxylin and eosin (H & E) stained. The H & E stained slide was blindly evaluated, and the main evaluation indexes include peribronchiolitis (inflammatory cell infiltration around bronchioles), perivascular inflammation (inflammatory cell infiltration around small blood vessels), interstitial pneumonia (inflammatory cell infiltration and alveolar wall thickening), alveolitis (cells in alveolar spaces), and the like. The score was 0-4 based on the severity of pathological section lung tissue injury (from low to high).

By analyzing and evaluating different pathological manifestations of lung tissues of different immune groups after virus attack, detailed lung tissue pathological injury scoring detection results are shown in table 2, and compared with a control PBS group, the cotton mouse pathological lesion degree of an immune inactivated vaccine (FI-RSV) group is higher, so that the immune inactivated vaccine possibly generates a VED effect and aggravated pathological changes of the lung tissues. The mRNA vaccine for immunizing RSV can effectively protect lung tissues of cotton rats to generate slight pathological damage, and has better protection effect compared with an inactivated vaccine.

Table 2: differential pathology scoring of lung tissue

Typical pathological section observations of lung tissue from each group as shown in fig. 10, several lung lobes of the immunized PBS group were seen as slightly thickened alveolar walls, the alveolar spaces were widened, with a small amount of lymphocyte infiltration (blue arrows), a small amount of scattered lymphocyte infiltration (brown arrows) visible in the alveolar space, a large amount of peribronchial lymphofocal infiltration (green arrows), and a large amount of perivascular lymphofocal infiltration (yellow arrows). Several lung lobes of the immunoFI-RSV group showed slight thickening of the alveolar wall, widening of the alveolar space, accompanied by a small amount of lymphocyte or granulocyte infiltration (blue arrow), a small amount of broncholumen and wall visible granulocyte infiltration (green arrow), and a small amount of perivascular lymphocyte focal infiltration (yellow arrow). While the mRNA vaccine group has a few lung lobes with low-power and multiple-frequency slightly thickened alveoli walls, a widened alveoli interval, a small amount of lymphocyte infiltration (blue arrow), a small amount of lymphocyte infiltration around bronchi, and occasional erythrocytes in the cavity (green arrow). Lymphocyte infiltration was seen around a small number of blood vessels (yellow arrows). In conclusion, the immune RSV mRNA vaccine group has obviously reduced pathological damage degree of lung tissues compared with the PBS group and the FI-RSV group, so that the immune RSV vaccine group can improve better immune protection effect compared with the inactivated vaccine group. Therefore, the invention has important development potential for developing RSV vaccine preparation and clinical application based on mRNA technology.

It should be understood that the above examples are illustrative and are not intended to encompass all possible implementations encompassed by the claims. Various modifications and changes may be made in the above embodiments without departing from the scope of the disclosure. Likewise, the individual features of the above embodiments can also be combined arbitrarily to form further embodiments of the invention which may not be explicitly described. Therefore, the above examples merely represent several embodiments of the present invention and do not limit the scope of protection of the patent of the present invention.

Claims (10)

1. Nucleic acids encoding respiratory syncytial virus F protein include at least one of I) to III):

i) A nucleic acid having one or more nucleotide substitutions, deletions or additions in the fragment shown in SEQ ID NO. 6;

II) a nucleic acid which has a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homologous to the nucleotide sequence as shown in SEQ ID No. 6 and which encodes a respiratory syncytial virus F protein;

III) nucleic acids which are partially or completely complementary to any of I) to II).

2. The nucleic acid of claim 1, wherein the nucleic acid comprises at least one of a) to d):

a) Has the sequence shown in SEQ ID NO:1, a nucleotide sequence shown in 1;

b) Has the sequence shown in SEQ ID NO:2, a nucleotide sequence shown in the specification;

c) Has the sequence shown in SEQ ID NO:3, a nucleotide sequence shown in 3;

d) Has the sequence shown in SEQ ID NO:4, a nucleotide sequence shown in figure 4;

e) Has the sequence shown in SEQ ID NO: 5.

3. A ribonucleic acid molecule comprising the nucleic acid of claim 1 or 2, wherein said ribonucleic acid molecule further comprises a 5' -cap structure;

preferably, the ribonucleic acid molecule further comprises a 5' -UTR;

preferably, the ribonucleic acid molecule further comprises a 3' -UTR;

preferably, the ribonucleic acid molecule further comprises PolyA;

preferably, the 5' -cap structure is selected from at least one of dmCAP, mCAP, tmCAP or ARCA;

preferably, the 5' -UTR is a globin nucleotide sequence or a retroviral antigen nucleotide sequence, preferably a nucleotide sequence as set forth in SEQ ID NO:7 or NO: shown as 8;

preferably, the 3' -UTR is a ribosomal protein nucleotide sequence or a globin nucleotide sequence, preferably the sequence as set forth in SEQ ID NO:9 or NO:10 is shown in the figure;

preferably, the PolyA is 20-120 a bases in length.

4. A ribonucleic acid molecule according to claim 3, characterised in that the uracil nucleotide of the ribonucleic acid molecule contains a modifying group;

preferably, the modifying group is selected from one or more of pseudouridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 5-methylcytosine, 2-thiouridine, 5-methoxyuridine or N1-methyladenosine.

5. Use of a nucleic acid according to any one of claims 1-2 or a ribonucleic acid molecule according to any one of claims 3-4 for the preparation of a vaccine for the prevention and treatment of RSV viral infection.

6. A vaccine comprising a ribonucleic acid molecule according to any one of claims 3 to 4;

preferably, the vaccine further comprises a vaccine carrier and an adjuvant.

7. The vaccine of claim 6, wherein the vaccine carrier is a liposome nanoparticle;

preferably, the liposome nanoparticle comprises a cationic lipid, a structural lipid, a phospholipid or a PEG lipid.

8. The vaccine of claim 7, wherein the cationic lipid is selected from one or more of DOTAP, DODMA, dlin-MC3-DMA, ALC-0315 and SM-102;

preferably, the structural lipid is selected from one or more of cholesterol, dihydrocholesterol, lanosterol, beta-phytosterol, campesterol, stigmasterol, brassicasterol, ergosterol, algae sterol, 3β - [ N- (N ', N' -dimethylaminoethyl) carbamoyl ] cholesterol (DC-Chol);

Preferably, the phospholipid is selected from one or more of di-oleoyl phosphatidylethanolamine (DOPE), palmitoyl Oleoyl Phosphatidylcholine (POPC), lecithin phosphatidylcholine (EPC), dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), di-arachidoyl phosphatidylcholine (DAPC), di-behenoyl phosphatidylcholine (DBPC), di (xylosyl) phosphatidylcholine (DLPC), di-oleoyl phosphatidylcholine (DOPC), sphingomyelin, brain amide, di-oleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), phosphatidylethanolamine (POPE), di-oleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal);

preferably, the PEG lipid is selected from one or more of PEG2000-DMG (PEG 2000-dimyristoylglycerol), PEG2000-DPG (PEG 2000-dimyristoylglycerol), PEG2000-DSG (PEG 2000-distearylglycerol), PEG5000-DMG (PEG 5000-dimyristoylglycerol), PEG5000-DPG (PEG 5000-dimyristoylglycerol), PEG5000-DSG (PEG 5000-distearylglycerol), PEG-cDMA (N- [ (methoxypoly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), PEG-C-DOMG (R-3- [ (omega-methoxy-poly (ethylene glycol) 2000) carbamoyl ] -1, 2-dimyristoxypropyl-3-amine), polyethylene glycol (PEG) -Diacylglycerol (DAG), PEG-Dialkyloxypropyl (DAA), PEG-phospholipids, PEG-brain amide (Cer).

9. The vaccine of claim 6, wherein the adjuvant is a salt or an aqueous salt solution; preferably, the salt is selected from at least one of citrate, acetate or phosphate.

10. A method of preparing a vaccine according to any one of claims 6 to 9, comprising the steps of:

dissolving the ribonucleic acid fragment according to any one of claims 3 to 4 in an aqueous adjuvant solution to obtain an aqueous phase component; dissolving a vaccine carrier in an organic solution to obtain an organic phase component;

mixing the aqueous phase component and the organic phase component to obtain a vaccine;

or diluting the organic phase component with adjuvant water solution, purifying and concentrating to obtain vaccine.