CN117482076A

CN117482076A - Application of methionine compound in preparation of PCSK9 inhibitor

Info

Publication number: CN117482076A
Application number: CN202311590334.4A
Authority: CN
Inventors: 李国兵; 胡长鹏; 张蓉; 周胡悦; 袁成沙; 唐勤; 刘吴毅; 胡敏; 杨蒙蒙
Original assignee: Second Affiliated Hospital Army Medical University
Current assignee: Second Affiliated Hospital Army Medical University
Priority date: 2023-11-24
Filing date: 2023-11-24
Publication date: 2024-02-02

Abstract

The invention relates to the technical field of PCSK9 inhibitors, in particular to application of methionine compounds in preparation of PCSK9 inhibitors. The invention designs PCSK9 promoter fusion expression plasmid in the early stage from the regulation of PCSK9 gene expression, completes the screening of small molecular drugs of a large-scale new drug discovery high-throughput screening library, finally discovers that a compound with a methionine structure can effectively inhibit PCSK9 gene transcription in an in vitro cell experiment, and verifies in an animal experiment that the compound can effectively reduce LDL-C level in mouse serum, inhibit the growth of a transplanted tumor, prolong the survival period of a tumor-bearing mouse, and simultaneously has no obvious toxic or side effect. Therefore, the methionine compound can be used as a small molecule inhibitor of PCSK9 protein, can block the combination of the PCSK9 protein and a low-density lipoprotein receptor, can be widely applied to medical use or non-medical use, and has wide application and popularization prospects.

Description

Application of methionine compound in preparation of PCSK9 inhibitor

Technical Field

The invention relates to the technical field of PCSK9 inhibitors, in particular to application of methionine compounds in preparation of PCSK9 inhibitors.

Background

Cardiovascular and cerebrovascular diseases are the leading cause of death worldwide, while atherosclerosis and hyperlipidemia are the central factors responsible for cardiovascular and cerebrovascular diseases. In primary and secondary prevention of cardiovascular and cerebrovascular diseases, lowering serum low density lipoprotein cholesterol (LDL C) can effectively control hyperlipidemia and atherosclerosis, and further reduce risk of cardiovascular event. Under normal physiological conditions, the Low Density Lipoprotein Receptor (LDLR) on the surface of hepatocytes will bind LDL-C and transport LDL-C to intracellular degradation as blood passes through the liver, after which LDLR will return to the surface of hepatocytes to bind more circulating LDL C particles, further reducing plasma LDL-C levels. Proprotein convertase subtilisin 9 (Proprotein Convertase Subtilisin/kexin Type 9, pcsk 9) is a serine protease secreted by hepatocytes and has been reported in recent years to be an important molecule leading to elevated LDL-C in the blood. It prevents the recirculation of LDLR to the surface of liver cells, mainly by binding to LDLR, thus leading to the inability of LDL-C in serum to be degraded, LDL-C accumulation, further leading to atherosclerosis and cardiovascular and cerebrovascular disease. Thus, the development of PCSK9 inhibitors may reduce serum LDL-C levels. Currently, two injection formulations of the PCSK9 inhibitor, namely the a Li Xiyou monoclonal antibody and the Elol You Shan antibody, are marketed for the treatment of primary hypercholesterolemia, mixed dyslipidemia and atherosclerosis cardiovascular diseases.

Currently, the PCSK9 inhibitor injection on the market has antibody medicines of allo You Shan antibody and Li Xiyou monoclonal antibody, and an RNA interference medicine of Enkexi; the oral preparation enters clinical trial stage and has antisense oligonucleotide AZD8233 for targeted inhibition of PCSK9 mRNA translation and protein synthesis in liver cells and small molecule polypeptides NNC0385-0434 and MK-0616 which can be taken orally. The PCSK9 inhibitors are biological medicines, and have various defects such as complex purification process, high production cost, high selling price and high transportation and storage requirements; the injection preparation is inconvenient to use, has poor patient compliance, can easily cause organisms to produce drug antibodies by monoclonal antibodies and polypeptide drugs, increases the risk of side effects, has extremely unstable antisense oligonucleotide and has large individual difference of curative effects. Compared with the antibody or polypeptide medicine, the small molecule medicine has the advantages of no immunogenicity, higher oral bioavailability, low development cost, low transportation and storage requirements and the like, so that the development of the small molecule inhibitor of PCSK9 has great clinical value. However, since the binding region of PCSK9 and LDLR is flat and smooth, there is no effective domain for drug binding, development of a small molecule inhibitor for blocking binding of PCSK9 and LDLR has been an industrial problem, and no small molecule inhibitor of PCSK9 is currently marketed.

Disclosure of Invention

The invention aims to provide an application of methionine compounds in preparation of PCSK9 inhibitors, so as to solve the technical problem of lack of small molecule inhibitors of PCSK9 in the prior art.

In order to achieve the above purpose, the invention adopts the following technical scheme:

use of methionine compounds in the preparation of PCSK9 inhibitors.

Further, the methionine compound is selected from at least one of compounds represented by the following formulas (1) - (13):

further, the PCSK9 inhibitor includes at least one of methionine compounds and pharmaceutically acceptable salts, hydrates, clathrates, solvates, isomers, prodrugs of methionine compounds.

Further, the PCSK9 inhibitor is supported on a carrier or mixed with an excipient.

Further, the PCSK9 inhibitor is administered orally or parenterally; parenteral administration includes subcutaneous, intravenous and intramuscular injections.

Further, the methionine compounds are useful for treating PCSK 9-mediated diseases or disorders; the PCSK 9-mediated disease or disorder is one of a disease with elevated serum low density lipoprotein cholesterol, an atherosclerotic cardiovascular disease, a solid tumor, and a tumor of the blood system.

Further, methionine compounds are useful in diseases where serum low density lipoprotein cholesterol is elevated: statin treatment of serum low density lipoprotein cholesterol elevated patients with fasting serum low density lipoprotein cholesterol still greater than 2.6mmol/L or 100mg/dL for 28 days or more;

the methionine compounds are suitable for use in atherosclerotic cardiovascular diseases: according to the regulations of the 2023 edition of Chinese blood lipid management guidelines, the extremely high risk group of atherosclerosis cardiovascular diseases is treated by statin drugs for 28 days or more, and the fasting serum low density lipoprotein cholesterol is still more than 1.8mmol/L or 70 mg/dL; patients with atherosclerosis and cardiovascular diseases at high risk for 28 days or more, with fasting serum low density lipoprotein cholesterol still greater than 1.4mmol/L or 55 mg/dL;

according to the 2023 edition of Chinese blood lipid management guidelines, for patients suffering from diseases with elevated serum low density lipoprotein cholesterol and atherosclerosis cardiovascular diseases, therapeutic means for lowering serum low density lipoprotein cholesterol are required, and corresponding medicines are used. The technical scheme verifies that the methionine compound has the effect of reducing serum low density lipoprotein cholesterol, so that the methionine compound can be used for the treatment scheme.

The methionine compounds are suitable for use in solid tumors and hematological tumors: solid tumors or blood system tumors with the serum PCSK9 content of more than or equal to 200 ng/mL.

For tumor treatment, partial cancer patients have the condition of up-regulating the expression level of PCSK9 protein, so that the tumor-resistant immunosuppression is caused, and meanwhile, the metabolic disorder of serum low-density lipoprotein cholesterol is caused, so that the life quality of the patients is influenced. For cancer patients (solid tumors and hematological tumors) that exhibit an up-regulation of PCSK9 protein expression, treatment with PCSK9 inhibitors may be used. The proposal research discovers that the methionine compound is an effective PCSK9 inhibitor, can be applied to the medical scene, can inhibit the PCSK9 protein amount and realize the cancer treatment effect of the methionine compound, and can improve the life quality of patients from two aspects. In particular to solid tumor or blood system tumor patients with serum PCSK9 content more than or equal to 200ng/mL, and the use of methionine compounds has practical significance especially because of immunosuppression and serious lipid metabolism disorder caused by over high PCSK9 protein expression in the patients. In the population, there are individuals who do not naturally express PCSK9, or in which case the expression of PCSK9 is low in cancer patients, and in this case, there is no need to treat such cancers with methionine compounds. Therefore, the screening of the serum PCSK9 content only uses methionine compounds for cancer treatment under the condition of higher serum PCSK9 content, so that the treatment efficiency and symptomatic drug delivery are ensured.

Further, the methionine compound is used in combination with a drug for preventing or treating hyperlipidemia and related metabolic diseases or cancers;

drugs for preventing or treating hyperlipidemia and related metabolic diseases or cancers include, but are not limited to, the following:

(1) Hypolipidemic agent: statin (e.g., lovastatin, simvastatin, pravastatin, mevastatin, fluvastatin, atorvastatin, cerivastatin, rosuvastatin and pitavastatin, etc.), cholesterol absorption inhibitors (e.g., ezetimibe, etc.), fibrates (e.g., clofibrate, bezafibrate, fenofibrate, etc.), bile acid absorbents (e.g., including colestyramine, colestipol, colesevelam hydrochloride, etc.), ACL inhibitors (Bempedoic acid, etc.), ANGPTL3 inhibitors (Evinacumab, etc.), PCSK9 inhibitors (ibrutin You Shan antibody, al Li Xiyou mab, infliximab, AZD8233, NNC0385-0434, MK-0616, etc.), microsomal triglyceride transfer protein inhibitors (Lomitapide, etc.).

(2) Antidiabetic agents: insulin, metformin, glucosidase inhibitors (e.g., acarbose, voglibose, miglitol, etc.), pparγ agonists (e.g., pioglitazone and rosiglitazone, etc.), pparα/γ dual agonists, sulfonylureas (e.g., glibenclamide, glimepiride, gliclazide, gliquidone, etc.), dipeptidyl peptidase IV (DPP-4) inhibitors (e.g., sitagliptin, vildagliptin, saxagliptin, alogliptin, flugliptin, etc.), glucagon-like peptide-1 (GLP-1) agonists (e.g., semaglutin, exenatide, benazelutide, risperidin, liraglutide, du Latang peptides, rocetade, etc.), gliptins (e.g., repaglinide, glinide, milraglan, etc.), SGLT2 inhibitors (e.g., dapagliflozin, engline, kagliptin, ai Tuoge, lu Gelie, etc.), glycogen agonists (e.g., GPR-1), GPR-120 inhibitors (e.g., GPR-120), glucokinase inhibitors, etc.

(3) Anti-nonalcoholic fatty liver disease drug: including metformin, a Farnesyl X Receptor (FXR) agonist (e.g., obeticholic acid, ASC42, TERN-101, tropifexor, nidufexor, cilofexor, etc.), a PPAR agonist (e.g., saroglitazar, elafibranor, lanifibranor, etc.), a fibroblast growth factor 21 (Fgf 21) analog (Efruxifermin, aalafermin, etc.), a GLP-1 agonist (e.g., semaglutide, etc.), a bile acid transporter (IBAT) inhibitor (e.g., elobixibat, etc.), an apoptosis-signal-regulating kinase-1 (ASK 1) inhibitor (e.g., selosertib, etc.), a stearoyl-CoA desaturase 1 (SCD 1) inhibitor (e.g., aramchol, etc.), a CCR5R blocker (e.g., cenicrivic, etc.), a thyroid hormone receptor beta (THR-beta) agonist (e.g., resmetirom, etc.), a fatty acid synthase inhibitor (e.g., denifanstat, etc.).

(4) Weight-reducing medicine: including orlistat, lorcaserin, GLP-1 agonists (e.g., semaglutin, exenatide, benalalutide, risperidin, liraglutide, du Latang peptide, locetaide, etc.).

(5) Anticancer drug: chemotherapeutic agents (e.g., cyclophosphamide, cisplatin, oxaliplatin, carboplatin, busulfan, thiotepa, mitomycin, methotrexate, pemetrexed, fluorouracil, gemcitabine, cytarabine, doxorubicin, epirubicin, irinotecan, topotecan, etoposide, taxanes, vinblastine, eribulin, asparaginase); small molecule targeting agents (EGFR inhibitors: gefitinib, erlotinib, icotinib, octenib, ametinib, vomertinib, etc., ALK inhibitors: crizotinib, aletinib, loratidine, etc., MEK inhibitor Qu Meiti, etc., HER2 inhibitor lapatinib, pyroltinib, nelatinib, etc., PARP inhibitor olaparib, etc., nilaparil, fluzopanib, etc., mTOR inhibitor everolimus, etc., HDAC inhibitor cetirizine, etc., BCR-ABL inhibitor imatinib, dasatinib, nilotinib, prantinib, etc., MET inhibitor sivanadib, carbamatinib, etc., RET inhibitor pratinib, BRAF inhibitor dabrafenib, vitamin Mo Feini, encorafenib, etc., CDK4/6 inhibitor gua Bai Xili, abbe, etc., NTRK inhibitor lapatinib, etc., entitinib, etc., BTK inhibitor evertinib, zetimib, etc., inhibitor ceritinib, etc., PI3K inhibitor alpelitinib, etc., vascular anti-gftinib, 35, nilotinib inhibitor, amitinib, etc., forward protein such as well as, alternative, etc., such as, alternative 1, alternative, etc., alternative 1, alternative, etc.; antibody targeting drugs (Anti-HER 2: trastuzumab, pertuzumab, ZW25, KN026, etc., anti-EGFR: cetuximab, nituzumab, etc., anti-VEGF: bevacizumab, ramucirumab, human endostatin, etc., anti-CD20: rituximab, etc., anti-CD38: up Lei Tuoyou mab, anti-CD19-CD3: blinatemomab, etc., anti-EGFR-MET: JNJ-372, etc., anti-DLL4-VEGF: naviciximab, etc.); immune checkpoint inhibitors (Anti PD1: na Wu Liyou mab, palbociclib mab, terep Li Shan mab, xindi Li Shan mab, tirelib mab, kari Li Zhushan mab, etc., anti-PDL1: attiriey mab, duvali You Shan mab, shu Geli mab, avermectin, etc., anti-CTLA4: ipilimumamab, etc., anti-LAG3: ruila Li Shan mab, etc., anti-TIGIT: MK-7684A, etc., anti-PD1/CLTA4: KN046, xmAb20717, cadonilimab, etc., anti-PD-1/TIM 3: RO-7121661, etc., anti-PD1/CD27: CDX-527, etc., anti-PD-1/FB: JS201, anti-PD1/PDL1: reozalimab, IB, etc., anti-PD-Inemt 1/VEGF: KN046, xmAb20717, cadonimimab, etc., anti-PD-1/VEGF: J2, etc.; immunomodulators (e.g., thalidomide, lenalidomide, thymulin, retinoic acid, etc.); antibody-drug coupling agents (vitamin b tuximab, U3-1402, enmetrastuzumab, etc.); hormones (tamoxifen, toremifene, letrozole, anastrozole, enzalutamide, bicalutamide, abiraterone, etc.); cell therapy (CAR-T, CAR-NK, etc.).

Further, the methionine compound is used for inhibiting transcription of PCSK9 gene or down regulating the expression level of PCSK9 protein.

The scheme also provides the application of methionine compounds in preparing medicines for reducing serum low density lipoprotein cholesterol, or antitumor medicines, or medicines for activating tumor immunity.

The principle of the technical scheme is adopted:

the invention starts from regulating PCSK9 gene expression, designs PCSK9 promoter fusion tdTomato expression plasmid in the early stage, completes the large-scale new drug discovery of a high-flux screening library for small molecule drug screening, finally discovers that a compound with a methionine structure can effectively inhibit PCSK9 gene transcription in an in vitro cell experiment, verifies that the compound is used as a PCSK9 inhibitor in an animal experiment body, can effectively reduce LDL-C level in mouse serum, inhibit the growth of a transplantation tumor, prolong the survival period of a tumor-bearing mouse, and simultaneously does not see that the mouse has obvious toxic and side effects. Therefore, the methionine compounds shown in the formulas (1) - (13) can be widely used as small molecule inhibitors of PCSK 9.

The efficacy studies of methionine in the prior art are as follows: methionine, also known as methionine, is one of the essential amino acids constituting the human body. It has been reported that the addition of food containing 0.1% (w/w) methionine can inhibit weight gain in mice caused by high fat diet and reduce serum cholesterol and triglyceride levels; however, the addition of methionine to foods at 0.2% (w/w) and higher had no effect on weight gain, serum cholesterol and triglyceride levels due to high fat diet (Chiba, et al plos one, 2016). Methionine addition to food intake has also been reported to result in increased serum cholesterol, LDL-C, triglycerides in mice (Jin et al front cardiova Med,2021;Hirche et al.British Journal of Nutrition,2006). Thus, the effect of methionine on blood lipids is still controversial.

In terms of cancer treatment, methionine-deficient diets have been reported to inhibit colon cancer engraftment growth, and are more pronounced in immunocompetent mice, and to produce synergistic antitumor activity with anti-PD1 therapy (Li et al glut, 2023). Methionine deficiency results in a arrest of the tumor cell cycle in the G2 phase, causing DNA damage, which is effective in inhibiting tumor growth (Wanders, et al Nutrients 2020). Methionine deficient diets inhibit glioma growth and extend survival in mice (Golbourn et al, nat Cancer, 2022). However, there are many reports on the contrary, methionine is reported to be critical for both tumor and T cell functions and viability, methionine deficiency can lead to the competition of tumor cells and T cells for methionine in the tumor microenvironment, resulting in the loss of T cell functions and death, and the supplementation of tumor patients with methionine can restore T cell viability, inhibiting tumor growth (Bian et al Nature 2020). Methionine addition increases H3K79 methylation and AMPK expression, thereby decreasing PD1 expression on CD4 cells, enhancing T cell anti-tumor immunity (Pandit et al Nature Commun, 2023). Methionine deficiency can also reduce tumor cell sensitivity to chemotherapy (Najim et al anticancer res 2009). Methionine deficiency in diet can reduce the abundance of T cells in colon cancer in mice, resulting in accelerated tumor progression, and methionine addition to diet can significantly inhibit colon cancer engraftment tumor growth and produce synergistic anti-tumor effects with anti-PD1 (Ji et al, nat metanolism, 2023). Thus, whether methionine promotes tumor progression or has an anti-tumor effect is controversial, and the molecular mechanism behind it is not clear.

Thus, the effect of methionine on serum cholesterol, the therapeutic effect on tumors, and the effect of activating antitumor immunity are not clear at present. The prior art reports on the effect of methionine are various, and the effect of methionine can be positive or negative. These inconsistent prior art reports pose a technical hurdle for further use of methionine. In the technical scheme, the effect of the methionine compound on the expression regulation of the PCSK9 gene is discovered through high-throughput screening, the action mechanism of the methionine compound is further defined, and the methionine compound can be further applied as a PCSK9 inhibitor.

There is no report of small molecule inhibitors of PCSK9 in the prior art. In the aspect of basic scientific research, only siRNA, shRNA and Crispr/gRNA technology can be selected to knock down or knock out PCSK9, but the methods have the problems of complex operation, high price, poor reproducibility and the like, and the development of small molecule inhibitors can greatly facilitate PCSK9 inhibition experiments in scientific research application. In the aspect of medical application, in view of the correlation of PCSK9 with hyperlipidemia and related metabolic diseases and the correlation of PCSK9 with cancers, development of small molecule inhibitors thereof is expected to provide potential new modes and medicaments for clinical treatment. Therefore, the invention further carries out large-scale drug screening aiming at the PCSK9 inhibitor, and discovers the application clinical application of methionine compounds in reducing serum low density lipoprotein cholesterol, resisting tumor and activating tumor immunity. In particular to a patient with cancer, which can pathologically screen out solid tumor or blood tumor with PCSK9 high expression, and the preparation taking the medicine of the patent claim as a core component is used for treatment.

Drawings

FIG. 1 is a map of a promoter fusion tdTomato expression plasmid of the PCSK9 gene of example 1.

FIG. 2 is a drug screening flow of example 1.

FIG. 3 shows the results of WB experiments after treatment of cells with different compounds including the compound of formula (2) in example 3.

FIG. 4 shows the results of qRT-PCR experiments after treatment of cells with compounds of formula (2) at different concentrations according to example 3.

FIG. 5 is a graph showing the results of in vivo evaluation experiments of the effect of the compound of formula (2) on LDL-C in example 4.

FIG. 6 shows the results of biochemical blood tests for the compound of formula (2) in example 5.

FIG. 7 is the results of HE staining section study for the compound of formula (2) of example 5.

FIG. 8 shows the results of evaluation of in vivo antitumor effect against the compound of formula (2) in example 6.

FIG. 9 shows the evaluation results of the activated antitumor immunity against the compound of formula (2) in example 7.

Fig. 10 is a WB experiment result of the expression of PCSK9 protein after the Crispr-Cas9 method knockout of PCSK9 gene of comparative example 1.

FIG. 11 shows the WB assay results after treatment of cells with different concentrations of the compound of formula (2) according to comparative example 1.

FIG. 12 is a graph showing the cytotoxicity of the CCK8 method of comparative example 1.

Detailed Description

The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto. Unless otherwise indicated, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents and the like used are all commercially available. The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated.

The terms and phrases used herein have the following meanings.

The term "pharmaceutically acceptable salt" refers to salts of the compounds of any one of the claims of the present invention, prepared from the compounds found herein to have a particular substituent with a relatively non-toxic acid or base. Pharmaceutically acceptable (i.e., non-toxic, physiologically acceptable, suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic response, or other problems or complications) salts are preferred, although other salts are useful, such as in isolation or purification steps of the preparation process. The term "salt" as used herein refers to salts formed with inorganic or organic acids and bases, either acidic or basic, and the possible formation of zwitterionic ("inner salts") is included within the scope of the term "salt". When the compounds of the present invention contain relatively acidic functional groups, base addition salts may be obtained by contacting neutral forms of such compounds with a sufficient amount of a base in pure solution or in a suitable inert solvent. When the compounds of the present invention contain relatively basic functional groups, the acid addition salts may be obtained by contacting the neutral form of such compounds with a sufficient amount of an acid in pure solution or in a suitable inert solvent. Pharmaceutically acceptable salts of the invention can be synthesized from the parent compound containing an acid or base by conventional chemical methods. In general, the preparation of such salts is as follows: prepared via reaction of these compounds in free acid or base form with a stoichiometric amount of the appropriate base or acid in water or an organic solvent or a mixture of both. Generally, nonaqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.

Certain compounds of the present invention may contain basic fragments that may form salts with various organic or inorganic acids. Typical acids that can form salts include: hydroxyethanesulfonic acid, ethoxybenzoic acid, sulfamic acid, amino acids (e.g., arginine), hemisulfuric acid, phenylpropionic acid (e.g., 3-phenylpropionic acid), benzenesulfonic acid, benzoic acid, phenylacetic acid, mandelic acid, malonic acid, propionic acid, oxalic acid, acetic acid (e.g., acetic acid, trihaloacetic acid), tannic acid, butyric acid, sulfanilic acid, p-toluenesulfonic acid, polygalacturonic acid, diglycolic acid, fumaric acid, pantothenic acid, fumaric acid, glycerophosphoric acid, heptanoic acid, glutamic acid, pectic acid, persulfuric acid, succinic acid, cyclopentanepropionic acid, sulfonic acid, adipic acid, caproic acid, toluenesulfonic acid such as p-toluenesulfonic acid, methanesulfonic acid, tartaric acid, ascorbic acid, picric acid, phthalic acid, phosphoric acid, dihydrogen phosphate, monohydrogen phosphate, thiophenol thiocyanate, sulfuric acid (e.g., formed with sulfuric acid), bisulfate, maleic acid, naphthalene sulfonic acid (e.g., 2-naphthalene sulfonic acid), citric acid, boric acid, malic acid, glucoheptonic acid, gluconic acid, hydroxyethanesulfonic acid (e.g., 2-hydroxyethanesulfonic acid), light theaic acid, light ethanesulfonic acid, hydrogen australic acid, hydroiodic acid, bicarbonate, hydrobromic acid, lactic acid, lactobionic acid, dodecylsulfonic acid, dodecylsulfuric acid, dodecanoic acid, dithianic acid, salicylic acid, carbonic acid, bicarbonate, aspartic acid, nitric acid, suberic acid, pivalic acid, phosphorous acid, nitrous acid, nicotinic acid, fumaric acid, edetic acid, glycolic acid, acetic acid, ethane disulfonic acid, ethane sulfonic acid, isobutyric acid, stearic acid, alginic acid, camphor, camphorsulfonic acid, and the like.

Certain compounds of the present invention may contain acidic moieties that may form salts with various organic or inorganic bases. Typical bases that can form salts include: ammonium salts, alkali metals (e.g., calcium, magnesium, sodium, lithium, potassium), sea bamine, amino acids (arginine, lysine), basic nitrogen-containing groups, N-methyl-D-glucamine, t-butylamine, dicyclohexylamine, organic amines, benzathines, N-methyl-D-glucamides, small molecule alkyl halides (e.g., chlorides, bromides and iodides of methyl, ethyl, propyl and butyl), long chain halides (e.g., chlorides, bromides and iodides of decyl, dodecyl, tetradecyl and tetradecyl), dialkyl sulfates (e.g., diethyl, dibutyl, dipentyl sulfate, dimethyl), aralkyl halides (e.g., benzyl, phenyl bromide), and the like.

The term "prodrug": refers to a compound that undergoes metabolic or chemical conversion by a chemical process to produce a compound, salt, or other form of a compound of the invention as referred to herein, in the treatment of a related disorder. In general, prodrugs have metabolically cleavable groups and are rapidly converted in vivo to the parent compound, for example, by hydrolysis in blood, and typically include ester and amide analogs of the parent compound. Certain compounds of the invention may exist in unsolvated forms or solvated forms, as well as hydrated forms, and are encompassed within the scope of the present invention.

The term "isomer": the compounds of the present invention may exist in specific geometric or stereoisomeric forms, including racemates, diastereomers, geometric isomers, individual isomers, cis and trans isomers, (L) -isomers, (D) -isomers, (R) -enantiomers, (S) -enantiomers, diastereomers, as well as racemic mixtures and other mixtures thereof (mixtures of isomers may vary in the ratio of isomers, all ratios of isomer mixtures being within the scope of the present invention.

The term "vector": refers to any formulation carrier or medium capable of delivering an effective amount of the compounds of the present invention, common carriers include water, oil, minerals, cream base, ointment base, lotion base, nanoparticles, micelles, nanoplatelets, and the like. Such matrices may include suspending agents, viscosity enhancers, transdermal enhancers, and the like. The preparation is capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhalant, ointment, suppository or patch, etc.

The term "excipient": refers to the carrier, diluent and/or medium required to formulate an effective pharmaceutical composition.

The term "hydrate": refers to the solvent molecule being a solvate of water.

The term "disorder": refers to a disease, disorder, or affliction.

Isotopically-labeled compounds of the present invention, for example, isomers, pharmaceutically acceptable salts, diastereomers, are also within the scope of the present invention, and may be found in one or more ofThe atoms constituting the compound containing isotopes of atoms, such as carbon, nitrogen, hydrogen, oxygen, phosphorus, sulfur, fluorine and chlorine isotopes, e.g. ₃ H、 ₂ H、 ₁₁ C、 ₁₃ C、 ₁₄ C、 ₁₅ N、 ₁₈ O、 ₁₇ O、 ₃₁ P、 ₃₂ P、 ₃₅ S、 ₁₈ F、 ₃₆ Cl, and the like.

Example 1

The PCSK9 promoter fusion tdTomato expression plasmid is designed and constructed, the plasmid expression sequence is shown in figure 1, the plasmid is packaged with slow virus to infect human liver cancer HepG2 cells, and a stable expression cell line is obtained. The construction of the cell lines described above is performed using conventional methods of the prior art and will not be described in detail herein. The promoter sequence of the PCSK9 gene is shown as SEQ ID NO. 1.

SEQ ID NO.1(5’→3’)：

AAGTTTCTGAGGTTGGAGAAGGTAGCCAGGGAGCATAAAAGTGAGTTCTATCTACTCATTCAGTCTATGAGGGGAAGGCAATGGCTAGAAAAGCATTTTGAGGGACAGTAAAAGTGGCATTTTTAGAGGGAGGAAGCCTTGAGGATGCTTGTGGGGTGAAGGGAAAGAATAACTCAGGAAGAGGCATTTAGGGATAAGAGGAGGAGAGGAGATAGTGGAGGTAGGTGATCCCTGCGGAGGCCAGATTGGGGCAGGGGAGTGTCAGCTGAGTATAAGAGGATGGTCCCCTCTGCCCTGAAGGAGGAAGGCAGGAGGGGAAAAGGATGGGTGTTGACCCAGAAAGCACTTGTGGTGGAGGGGAGGCCCCAGAAGAGGCTTCTGACTTACCCTGATTGCTGGTACCTCTCAGGGGAGCTGGCTGCTTATTTGCTGGCCAGGGTGTGGGGGAACCCATTTGAGAAGAGGGAGAAGGTGACACAATTCCTTTGGGCAACTTATGGGAGGGGTAATTGGTGAGGGATGAAAGCCCTGCCAAGTGGCAGGAGGCCCAGCTGGGGCTGCCCCTCATAAGAGTGCAGTGGAGGATATGGGATGAGAAGTGACTGCCCCTCTGGTTCCATCTGTCGCAGAGCCCAGGGTGCTTCCTTCCTCCCCCACCTCCCTCAGAACACACCCACTGCATGCTGGACAGCAGCCCCCTTCCTGGGCCTGGGGACATCCATGTCCCTCTGTGCACAGGCTTCATCATTCTCTGGGTGCACGGTAACGACCCCGGTAGGTGAGAGGCCAAGGTCCCAAAGGGGAGCAGCAGGGAAAGTTAGCTCCCATCTATTCTTGCTCCAGGGGAGGCCTTTGATGAGGAAGCTGCCAAAAGCACATTGCAAATACAATTCCAATTACAGGCAACAGGAAGGAGAACCACCTCTGCCACCTCTGTCAGCAAACCATGAGCTCCTACTCTGTGCTGCGATGGCGGGCTCGATGGGGATAACTCTGACCTTACCTCATGGAGTCACTGTCAACCCACTGGTTGCACTGTCTTTGTGCACTGGCTCTCTGGAGTGAGGTCTTTGCAAACAAAGTGGAAAGAGCATCAACTTTGGACTCCAGCACCTAGATTCAGAGCAGGCCATTTCACTCGGAATCTGCTGTGCATCTGCAAGGGAGGATCATAAATTCGCCTTTGTTTCTTCCCAGTATCGACAGCCCTTCCAGAAAGAGCAAGCCTCATGTCATGCCACATGTACAATCTGAGGCCAGGAGCTCTCTTTCCCCTTTTCATCCTCCTGCCTGGTACACAATAGGTGTTTACTGGATGCTTGTCCAGTTGATTTCTTGAACATGGTGTGTAAAAGGAATCTTTGCAAATTGAATCTTCTGGAAAGCTGAGCTTGTGCCTACCATAGAATTCTGAATGTACCTATATGACGTCTTTGCAAACTTAAAACCTGAATCTTTGTAGTATAAATCCCTTGAAATGCATGTAGGCTGGACATCAAAAGCAAGCAATCTCTTCAAGGAGCAGCTAGTTGGTAAGGTCAGTGTGCAGGGTGCATAAAGGGCAGAGGCCGGAGGGGGTCCAGGCTAAGTTTAGAAGGCTGCCAGGTTAAGGCCAGTGGAAAGAATTCGGTGGGCAGCGAGGAGTCCACAGTAGGATTGATTCAGAAGTCTCACTGGTCAGCAGGAGACAAGGTGGACCCAGGAAACACTGAAAAGGTGGGCCCGGCAGAACTTGGAGTCTGGCATCCCACGCAGGGTGAGAGGCGGGAGAGGAGGAGCCCCTAGGGCGCCGGCCTGCCTTCCAGCCCAGTTAGGATTTGGGAGTTTTTTCTTCCCTCTGCGCGTAATCTGACGCTGTTTGGGGAGGGCGAGGCCGAAACCTGATCCTCCAGTCCGGGGGTTCCGTTAATGTTTAATCAGATAGGATCGTCCGATGGGGCTCTGGTGGCGTGATCTGCGCGCCCCAGGCGTCAAGCACCCACACCCTAGAAGGTTTCCGC。

Large scale drug screening was performed using the above cell lines (see fig. 2 for schematic experimental flow chart) which were seeded into 96-well plates at 99 μl/well. Dissolving the medicine with dimethyl sulfoxide to obtain mother solution of the compound to be tested at 1mM/L, adding 1 μl/well into each well plate, slowly mixing with horizontal shaking table for 3min, and culturing in incubator for 24 hr. Further, the cell holes with reduced red light are recorded by microscopic observation, and the holes with unchanged or increased red light are discharged; meanwhile, the cell state is observed, red light is reduced, abnormal morphology holes are considered to be cell death caused by drug toxicity, the drug concentration is reduced by 10 times to 1 mu M/L final concentration, verification is further carried out, and the cell holes with reduced red light are recorded. Through long-time multi-round screening, methionine parent structure compounds can effectively reduce red light expression, and the compounds can be combined with a promoter of a PCSK9 gene to influence the regulation and expression of the promoter on a downstream gene. Further, we verify against methionine parent structure compounds (the drug list is shown in table 1), and find that the compounds can reduce red light expression, and are considered as potential transcription inhibitors of PCSK9 genes.

Table 1: list of methionine parent structural classes of compounds

/>

Example 2

Based on the above screening results, the present invention further performed qPCR assays on the drugs in table 1 above to detect their actual effect on PCSK9 mRNA transcription. Human liver cancer HepG2 cells (5×10) ⁵ And then inoculated in 6-well plates, cultured overnight, added with the compound of Table 1 (10. Mu.M/L final concentration), control wells were added with the same volume of solvent (dimethyl sulfoxide), after 48 hours of treatment, cells were collected, washed 2 times with PBS, and cell clusters were extracted with RNAiso PLUS/trizol (takara # 9109). Adding 1mL RNAiso Plus,1mL gun heads into the cell mass, blowing until no obvious mass exists, and standing at room temperature (15-30 ℃) for 5min;200 mu L/tube of newly opened chloroform is added into each tube, the centrifugal tube cover is closed, the solution is shaken for 15s until the solution is milky white, and the solution is stood for 5min at room temperature; centrifuging at 12,000g for 15min at 4 ℃; the samples were divided into three layers: colorless supernatant (containing RNA), middle albumin layer (mostly DNA) and colored lower organic phase. Transfer the supernatant to another fresh centrifuge tube (no aspiration of white middle layer); adding 500 μl of isopropanol into the supernatant, gently turning over for several times (shaking without severe shaking to avoid RNA cleavage), and standing at room temperature for 10min; centrifuging at 4deg.C for 10min at 12,000g to obtain RNA precipitate, carefully sucking to remove supernatant, and removing precipitate; adding 1mL of ethanol with the concentration of 75%, and slightly upside down washing the bottom of a centrifuge tube or a flick tube to suspend the sediment; centrifuging at 4deg.C for 5min at 7,500g, and discarding supernatant carefully; opening the cover of the centrifugal tube, and drying the precipitate at room temperature for 5-10min; after the precipitate was dried, 30. Mu.L of RNase-free water was added to dissolve the precipitate; measuring the mRNA concentration by Nanodrop, adding gDNA eraser and matched buffer into the same amount of mRNA, and incubating for 5min at room temperature to remove residual DNA fragments; further test using HiScript IIOne Step qRT-PCR SYBR Green Kit The kit (Vazyme #Q221-01) was subjected to reverse transcription and qPCR detection to clarify the effect of the compounds in Table 1 on PCSK9 gene transcription at a concentration of 10. Mu.M/L. The experimental results are shown in Table 2.

Table 2: effect of qPCR clearly screened methionine compound on PCSK9 transcription inhibition

Numbering device	Inhibition ratio (%)	Numbering device	Inhibition ratio (%)
				(1)	46.5％	(8)	46.3％
(2)	59.9％	(9)	40.3％
				(3)	41.2％	(10)	22.8％
(4)	53.8％	(11)	34.8％
				(5)	39.3％	(12)	22.5％
(6)	50.3％	(13)	32.5％
				(7)	38.3％	——	——

Example 3

qPCR and western blot were performed on the compound represented by formula (2) (compound 2), and it was clear whether the compound had a quantitative effect on the transcriptional and protein expression inhibition of HepG2 cells. HepG2 cells (5×10) ⁵ And) were inoculated in 6-well plates, cultured overnight, added with the compound represented by the formula (2) at different concentrations (0.01,0.05,0.1,0.5,1,5, 10, 100. Mu.M/L final concentration), and treated with the same volume of solvent (dimethyl sulfoxide) for 24 hours or 48 hours, respectively, in control wells. After reaching the time point, the cells were scraped off, centrifuged at 2000rpm, the medium was discarded, washed 2 times with PBS, and a part of the cells was subjected to qPCR to examine the effect of the compound on PCSK9mRNA expression as in example 2.

In WB assay (with actin as reference), the inhibitory effect of the compounds of formula (2) on PCSK9 protein (the drug dose is 10. Mu.M/L) was studied using rhamnose (mallotriose), cefotaxime sodium (rapamycin), plumbagin (Plumbum) and chlorhexidine hydrochloride (HCl) as controls. After 24 hours, cells are lysed by using a cell lysate containing a protease inhibitor PMSF, residues such as nuclei and the like at the bottom are removed by centrifugation at 13000rpm, the protein concentration of each sample is measured by using a BCA protein concentration detection kit (Beyotime#P0010), the same number of protein samples are taken, 1/5 volume of Loading buffer (Beyotime#P0015) is added, denaturation treatment is carried out for 10 minutes at 95 ℃, high-speed centrifugation is carried out to bottom steam, the steam is loaded onto SDS/PAGE,80/120V voltage is carried out to the gel front, wet transfer is carried out for 3 hours to PVDF membrane, 5% milk is sealed for 1 hour at room temperature, after membrane cutting according to PCSK9 and action molecular weight, a shaking table is added for incubation overnight at 4 ℃, washing for 3 times at 1 XTST for 10 minutes/time, then corresponding secondary antibody is added for incubation for 2 hours at room temperature for 3 times, washing for 15 minutes/time by using ECL hypersensitive substrate exposure, and the strip is subjected to image J software measurement results show that the test result of the PCSK9 has the most remarkable effect of inhibiting the expression of the PCSK 9.

More specifically, figure 3 shows WB images of PCSK9 protein expression after treatment of cells with different drugs; FIG. 4 shows the variation in PCSK9mRNA expression (24 h and 48h treatment) following treatment of cells with different concentrations of Compound 2 (Compound 2), corresponding data are detailed in Table 3.

Table 3: relative expression of PCSK9mRNA after 24h and 48h of Compound 2 (Compound 2) treatment of cells at different concentrations

Example 4

An in vivo evaluation experiment for the serum low density lipoprotein cholesterol (LDL-C) lowering effect was performed on the compound (compound 2) of formula (2). Dissolving the medicine in DMSO in advance, wherein the concentration of the mother solution is 20mg/mL; before use, the mother solution is as follows: corn oil = 1:19 to 1mg/mL. 10 Balb/C mice at 7 weeks of age are randomly divided into 2 groups, the administration group adopts compound 2 (5 mg/kg/day) for daily intraperitoneal injection, the control group adopts the same volume of solvent for injection, and after continuous administration for one month, the mice are anesthetized, blood is collected and sample blood is sent for biochemical detection, and the LDL-C content in serum is clear. The results of the experiment are shown in FIG. 5 (see Table 4 for experimental data), and it can be seen that the compound of formula (2) is effective in reducing LDL-C concentration in mouse serum, with statistical differences.

Table 4: detection result of LDL-C content (mmol/L) in mouse serum

Numbering device	Control group	Compound 2
			1	0.53	0.36
2	0.55	0.42
			3	0.47	0.41
4	0.45	0.39
			5	0.51	0.38

Example 5

The compound of formula (2) (compound 2) was evaluated for in vivo safety. Experiment 14 Balb/c mice at 7 weeks of age were randomly divided into 2 groups, and the compound of formula (2) was dissolved in DMSO as in example 4, followed by mother liquor: corn oil = 1:19 to 1mg/mL, daily intraperitoneal injections were made using a therapeutic dose of 5mg/kg/day, and the control group was intraperitoneally injected with the same volume of solvent. After one month of continuous administration, the mice were anesthetized, sampled and biochemically inspected for serum hepatotoxic markers: glutamic-pyruvic transaminase (AST), glutamic-pyruvic transaminase (ALT); renal toxicity markers: creatinine (CREA), UREA (UREA); cardiac toxicity markers: lactate Dehydrogenase (LDH), creatine Kinase (CK); after blood collection, heart, liver, spleen, lung and kidney were harvested, fixed with 10% formalin and sectioned for HE staining. The results of biochemical blood tests are shown in FIG. 6 (data are shown in Table 5), and HE staining images are shown in FIG. 7. It can be seen that the therapeutic dose of compound 2 does not cause the increase of each toxicity index, but has potential liver and kidney protection effect, can obviously reduce the serum content of AST, CERA, UREA, and does not have obvious substantial changes of each organ. Compound 2 was shown to have excellent safety at therapeutic doses.

Table 5:

example 6

An in vivo antitumor effect evaluation was performed on the compound (compound 2) of the formula (2). Experiment 14 Balb/c mice at 8 weeks of age were subcutaneously inoculated with liver cancer H22 cells (1X 10) ⁶ Cells/100 μl/day), randomly divided into 2 groups, and 10 days after inoculation, compound 2 (5 mg/kg/day) was injected intraperitoneally into the experimental group, and the control group was intraperitoneally injected with the same volume of solvent. Tumor volumes were monitored every other day and transplanted tumor volumes were calculated as follows: (length. Times. Width) ² )/2. Setting the volume of the transplanted tumor to be more than 2000mm according to the regulations of the ethical committee of animals ³ For ethical death end point, after 16 days of drug treatment, the volume of transplanted tumor of control group mice is mostly more than 2000mm ³ All mice were photographed with isoflurane anesthetized mice, euthanized, transplanted tumors were dissected off and photographed and weighed, and a mouse survival curve was drawn. The results are shown in FIG. 8, where Compound 2 is shown inCan effectively inhibit the growth of transplanted tumor under the treatment dosage, prolong the survival time of mice, and has statistical difference.

Example 7

The compound of formula (2) (compound 2) was evaluated for activating antitumor immunity. On the basis of example 6, the mouse engraftment tumor was peeled off and ground to a 70 μm screen, and mononuclear lymphocytes were isolated by Ficoll density gradient centrifugation. After erythrocyte lysis, anti-CD45, anti-CD3, anti-CD8, anti-CD4, anti-NK1.1 are used for cell labelling, and nti-IFNγ and anti-GZMB are used for detecting immune cell activation status (IFNγ is pro-inflammatory factor for regulating immune reaction; GZMB is granzyme produced by T cells or NK cells for mediating killing of infected cells and malignant cells), anti-PD1 is used for detecting inhibitory immune checkpoint expression (PD 1 is programmed death receptor 1 and is an immunosuppressive molecule), anti-FOXP3 is used for labelling Treg cells, and anti-CD44 and anti-CD62L are used for identifying central memory T cells (Central Memory T cell, tcm, CD 44) ⁺ CD62L ⁺ ) And effector memory T cells (Effective Memory T Cell, tem, CD44 ⁺ CD62L ^- ). The results of the experiment are shown in FIG. 9, and it can be seen that compound 2 treatment can increase CD45 in the transplanted tumor ⁺ (leukocyte common antigen), CD3 ⁺ (mature T lymphocytes), CD8 ⁺ (suppressor/killer T lymphocytes), CD4 ⁺ (T helper cells), NK cell ratio; increase of IFNgamma ⁺ CD8 ⁺ 、GZMB ⁺ CD8 ⁺ Cells, IFN gamma ⁺ CD4 ⁺ 、GZMB ⁺ CD4 ⁺ Cells, GZMB ⁺ NK cell ratio; reducing PD1 expression on CD4 and CD8 cells; increasing central memory CD8 ⁺ T cells and effector memory CD8 ⁺ T cell ratio. The compound 2 can activate CD8+ T, CD4+T and NK cells in vivo in mice, increase the formation of memory cells and improve the anti-tumor effect of immune cells.

Comparative example 1

(1) Crispr-Cas9 Gene knockout experiments

In PCSK9 inhibition effect study, crispr-Cas9 was used to construct from PCSK9 exon sequencesPCSK9 knocked-out gRNA1 (GGTGCTAGCCTTGCGTTCCG, SEQ ID NO. 2) and gRNA2 (TCTTGGTGAGGTATCCCCGG, SEQ ID NO. 3). HepG2 cells (5×10) ⁵ And) were inoculated in 6-well plates, cultured overnight, and PCSK9 knockout plasmids were transfected into HepG2 cells (or H22 cells) using liposome transfection reagent Lipo 8000. The cells were replaced with fresh complete medium 24 hours after infection, puromycin was added and screened until all control cells died, i.e. the minimum toxic concentration at which to act on cells transfected with plasmid for at least 48 hours, and monoclonal was selected to construct stable cell lines. WB verifies the efficiency of the two Crispr-Cas9 gene knockout methods, and detects the PCSK9 expression level by screening the monoclonal construction stable cell line, and the experimental result is shown in figure 10. Meanwhile, hepG2 cells were treated for 48 hours with different concentrations of the compound of formula (2), and PCSK9 expression was detected, and the experimental results are shown in FIG. 11.

The graph shows that the gene knockout of the HepG2 cell and the H22 cell can obviously inhibit the expression of PCSK9 protein in the HepG2 cell and the H22 cell. In the technical field, a gene knockout method is generally used to reduce the expression level of a target protein, and is used to construct an in vitro cell model of a certain target gene deletion, so as to research related action mechanisms, or pathological development processes, or perform drug screening. For example, PCSK9 protein is related to low-density lipoprotein cholesterol metabolism, and knockdown treatment of PCSK9 protein can establish a cell model of low-density lipoprotein cholesterol metabolic disorder, and further study on molecular mechanisms of pathological development is conducted. Among them, the Crispr-Cas9 system is a common gene knockout means. However, the gene knockout process is very cumbersome, requiring various sequence designs prior to the experiment, plasmid transfection procedures during which cells are subsequently screened to determine cell lines in which the gene of interest was successfully knocked out. Therefore, the conventional means for inhibiting the expression of a certain gene are complicated, and the workload of scientific researchers is increased.

The compound of the formula (2) can also effectively inhibit the expression quantity of PCSK9 protein, and can be seen in experimental data in the figure. The expression amount of PCSK9 protein is changed in a trend depending on the concentration of the compound of formula (2), the concentration of the drug is increased, and the gray value of WB bands of PCSK9 protein is decreased, that is, the expression amount of PCSK9 protein is decreased. After the HepG2 cell is treated by 10 mu M/L of the compound of the formula (2) for 48 hours, the gray scale of the band (relative gray scale value, with a blank control of 1) can be reduced from 1 to 0.35, the effect of down-regulating the PCSK9 protein is ideal, and the difference between the effect of down-regulating the protein of the Crispr-Cas9 method (gRNA 1 or gRNA 2) is small. Considering the convenience of using small molecule inhibitors, even if the method adopting the scheme is slightly worse than the Crispr-Cas9 method in the down-regulation degree of PCSK9 protein, the inhibition method of the scheme is worth popularizing and applying. The inventors have further tried to treat HepG2 cells with 100 μm/L of the compound of formula (2) to obtain WB bands with further reduced relative gray scale, indicating that the expression level of PCSK9 protein was further suppressed and the relative gray scale value was close to that of Crispr-Cas9 method (gRNA 1). In practice, the degree of inhibition of the target gene can be adjusted by controlling the treatment concentration of the compound. Compared with the gene knockout mode of the Crispr-Cas9 method, the method can regulate and control the expression quantity (or inhibition rate) of the PCSK9 protein according to actual demands, and the expression quantity of a target gene cannot be controlled to be changed within a certain range after the gene is knocked out by the traditional method. Therefore, the inhibitor adopting the scheme can be used for basic research, can control the expression quantity of the PCSK9 protein more flexibly, and can be used for further researching the molecular action mechanism and the pathological development mechanism.

In the prior art, a small molecular compound inhibitor of PCSK9 does not exist, and the scheme reports that a methionine parent structure compound can be used as an inhibitor for the first time, so that the expression quantity of PCSK9 protein is effectively reduced. The new findings simplify the research process, and researchers can directly use methionine parent structural compounds to treat cells, inhibit PCSK9 protein expression, further establish a related cell model for reducing PCSK9 protein expression, research related action mechanisms and carry out drug screening. The methionine parent structure compound of the scheme is used as a PCSK9 inhibitor and an effective basic research reagent, so that the scheme can shorten the time required by basic research, accelerate research, lighten the workload of scientific researchers and has ideal application value in basic research.

(2) Security verification

CCK8 experiments validated knockdown PCSK9 cells and studied proliferation of compounds including formula (2). 500 cells per well were plated in clean sterile 96-well plates, one set of 3 duplicate wells per cell set for 1 day for 4 sets (4 days). Absorbance values were measured at 24 hours (day 1), 48 hours (day 2), 72 hours (day 3), 96 hours (day 4), respectively: after the medium in the wells was aspirated, the medium was washed with PBS, and 10. Mu.L of CCK8 reagent+90. Mu.L of medium was mixed uniformly per well, and 100. Mu.L of medium per well was added to each well, and the 96-well plates were placed in a cell incubator for reaction for 1 hour. Absorbance values were measured at 450 nm. The result shows that the compound of the formula (2) can effectively inhibit PCSK9mRNA and protein expression, has good dose-effect relationship, and has no killing effect on cells.

The foregoing is merely exemplary of the present invention, and specific technical solutions and/or features that are well known in the art have not been described in detail herein. It should be noted that, for those skilled in the art, several variations and modifications can be made without departing from the technical solution of the present invention, and these should also be regarded as the protection scope of the present invention, which does not affect the effect of the implementation of the present invention and the practical applicability of the patent. The protection scope of the present application shall be subject to the content of the claims, and the description of the specific embodiments and the like in the specification can be used for explaining the content of the claims.

Claims

1. Use of methionine compounds in the preparation of PCSK9 inhibitors.

2. Use of methionine compounds according to claim 1 for the preparation of PCSK9 inhibitors, characterized in that: the methionine compound is at least one selected from compounds represented by the following formulas (1) - (13):

3. use of methionine compounds according to claim 2 for the preparation of PCSK9 inhibitors, characterized in that: the PCSK9 inhibitor comprises methionine compounds and at least one of methionine compounds in pharmaceutically acceptable salts, hydrates, clathrates, solvates, isomers and prodrugs.

4. Use of methionine compounds according to claim 3 for the preparation of PCSK9 inhibitors, characterized in that: the PCSK9 inhibitor is supported on a carrier or mixed with an excipient.

5. The use of methionine compounds according to claim 4 for preparing PCSK9 inhibitors, characterized in that: the PCSK9 inhibitor is orally administered or parenterally administered; parenteral administration includes subcutaneous, intravenous and intramuscular injections.

6. Use of methionine compounds according to any one of claims 1-5 for the preparation of PCSK9 inhibitors, characterized in that: the methionine compounds are useful for treating PCSK 9-mediated diseases or disorders; the PCSK 9-mediated disease or disorder is one of a disease with elevated serum low density lipoprotein cholesterol, an atherosclerotic cardiovascular disease, a solid tumor, and a tumor of the blood system.

7. Use of methionine compounds according to claim 6 for the preparation of PCSK9 inhibitors, characterized in that:

the methionine compounds are suitable for use in diseases of elevated serum low density lipoprotein cholesterol: statin treatment of serum low density lipoprotein cholesterol elevated patients with fasting serum low density lipoprotein cholesterol still greater than 2.6mmol/L or 100mg/dL for 28 days or more;

8. Use of methionine compounds according to any one of claims 1-5 for the preparation of PCSK9 inhibitors, characterized in that: the methionine compound is used for being combined with a medicament for preventing or treating hyperlipidemia and related metabolic diseases or cancers;

(1) Hypolipidemic agent: statin, cholesterol absorption inhibitor, fibrate, bile acid absorber, ACL inhibitor, ANGPTL3 inhibitor, PCSK9 inhibitor, microsomal triglyceride transfer protein inhibitor;

Statin drugs include, but are not limited to, lovastatin, simvastatin, pravastatin, mevastatin, fluvastatin, atorvastatin, cerivastatin, rosuvastatin and pitavastatin; cholesterol absorption inhibitors include, but are not limited to ezetimibe; fibrates include, but are not limited to, clofibrate, bezafibrate, fenofibrate; bile acid absorbents include, but are not limited to, cholestyramine, colestipol, and colesevelam hydrochloride; ACL inhibitors include, but are not limited to, bevacizidine; ANGPTL3 inhibitors include, but are not limited to, evergreen Su Shan antibodies; PCSK9 inhibitors include, but are not limited to, allo You Shan antibodies, al Li Xiyou mab, infliximab, AZD8233, NNC0385-0434, MK-0616, microsomal triglyceride transfer protein inhibitors including, but not limited to lometapa;

(2) Antidiabetic agents: insulin, metformin, a glucosidase inhibitor, a ppary agonist, a ppara/y dual agonist, sulfonylureas, dipeptidyl peptidase IV inhibitors, glucagon-like peptide-1 type agonists, glinide hypoglycemic agents, SGLT2 inhibitors, glucokinase agonists, glycogen phosphorylase inhibitors, GPR120 agonists, GPR40 agonists, PTP1B inhibitors, glucose-6-phosphatase inhibitors;

Glucosidase inhibitors include, but are not limited to, acarbose, voglibose, miglitol; pparγ agonists include, but are not limited to, pioglitazone and rosiglitazone; sulfonylureas include, but are not limited to, glibenclamide, glimepiride, gliclazide, gliquidone; dipeptidyl peptidase IV inhibitors include, but are not limited to, sitagliptin, vildagliptin, saxagliptin, alogliptin, compound gliptin, linagliptin; glucagon-like peptide-1 type agonists include, but are not limited to, semaglutin, exenatide, benazelutide, lisaglutin, liraglutide, du Latang peptide, and locetanol; the glinide hypoglycemic agents include, but are not limited to, repaglinide, nateglinide, mitiglinide; SGLT2 inhibitors include, but are not limited to dapagliflozin, engagliflozin, canagliflozin, ai Tuoge gliflozin, lu Gelie; glucokinase agonists include, but are not limited to, spingliptin;

(3) Anti-nonalcoholic fatty liver disease drug: metformin, a farnesyl ester X receptor agonist, a PPAR agonist, a fibroblast growth factor 21 analogue, a GLP-1 agonist, a bile acid transporter inhibitor, an apoptosis signal-regulating kinase-1 inhibitor, a stearoyl-coa desaturase 1 inhibitor, a CCR5R blocker, a thyroid hormone receptor beta agonist, a fatty acid synthase inhibitor;

Farnesyl ester X receptor agonists include, but are not limited to obeticholic acid, ASC42, tert-101, tropifexor, nidufexor, cilofexor; PPAR agonists include, but are not limited to Saroglitazar, elafibranor, lanifibranor; fibroblast growth factor 21 analogs include, but are not limited to Efruxifermin, aalafermin; GLP-1 agonists include, but are not limited to, semaglutin; bile acid transporter inhibitors include, but are not limited to, elobixibat; inhibitors of apoptosis signal-modulating kinase-1 include, but are not limited to, selonsertib; inhibitors of stearoyl-coa desaturase 1 include, but are not limited to, armchol; CCR5R blockers include, but are not limited to Cenicriviroc; thyroid hormone receptor beta agonists include, but are not limited to, resepirom; fatty acid synthase inhibitors include, but are not limited to, denifanstat;

(4) Weight-reducing medicine: orlistat, lorcaserin, GLP-1 class agonists;

GLP-1 agonists include, but are not limited to, semaglutin, exenatide, benalundin, risinatide, liraglutide, du Latang peptide, and loconamide;

(5) Anticancer drug: chemotherapeutic agents, small molecule targeting agents, antibody targeting agents, immune checkpoint inhibitors, immune modulators, antibody-drug coupling agents, hormonal agents, and cell therapies;

Chemotherapeutic agents include, but are not limited to, cyclophosphamide, cisplatin, oxaliplatin, carboplatin, busulfan, thiotepa, mitomycin, methotrexate, pemetrexed, fluorouracil, gemcitabine, cytarabine, doxorubicin, epirubicin, irinotecan, topotecan, etoposide, taxanes, vinblastine, eribulin, asparaginase;

small molecule targeting agents include, but are not limited to, EGFR inhibitors, ALK inhibitors, MEK inhibitors, HER2 inhibitors, PARP inhibitors, mTOR inhibitors, HDAC inhibitors, BCR-ABL inhibitors, MET inhibitors, RET inhibitors, BRAF inhibitors, CDK4/6 inhibitors, NTRK inhibitors, BTK inhibitors, JAK inhibitors, PI3K inhibitors, anti-vascular multi-kinase inhibitors, PDGFR/c-Kit inhibitors, protease inhibitors, FGFR2 inhibitors, IDH1 inhibitors, nuclear transport protein inhibitors;

EGFR inhibitors include, but are not limited to, gefitinib, erlotinib, icotinib, octenib, ametinib, and vomitinib; ALK inhibitors include, but are not limited to, crizotinib, aletinib, loratidine; MEK inhibitors include, but are not limited to, trimetinib; HER2 inhibitors include, but are not limited to, lapatinib, pyroltinib, nilatinib, tocatinib; PARP inhibitors include, but are not limited to, olapari, nilaparib, and fluxapari; mTOR inhibitors include, but are not limited to, everolimus; HDAC inhibitors include, but are not limited to, sidamamine; BCR-ABL inhibitors include, but are not limited to, imatinib, dasatinib, nilotinib, and plaitinib; MET inhibitors include, but are not limited to, cermetini, carbamazepine; RET inhibitors include, but are not limited to, platinib; BRAF inhibitors include, but are not limited to, dabrafenib, vitamin Mo Feini, encorafenib; CDK4/6 inhibitors include, but are not limited to, gua Bai Xili, abeli; NTRK inhibitors include, but are not limited to, larotinib, emtrictinib; BTK inhibitors include, but are not limited to, ibutenib, zebutinib; JAK inhibitors include, but are not limited to, pontinib; PI3K inhibitors include, but are not limited to, alpelinib; anti-vascular multi-kinase inhibitors include, but are not limited to, an Luoti ni, apatinib, lenvatinib, axitinib, sunitinib, cabotinib, regorafenib, sorafenib; PDGFR/c-Kit inhibitors include, but are not limited to, imatinib, nilotinib, avatinib; protease inhibitors include, but are not limited to bortezomib, ifenprodil Sha Zuo meters; FGFR2 inhibitors include, but are not limited to, pemigatinib; IDH1 inhibitors include, but are not limited to, ivosidenib; inhibitors of nuclear transport proteins include, but are not limited to, selinexor;

Antibody targeting drugs include, but are not limited to, anti-HER2, anti-EGFR, anti-VEGF, anti-CD20, anti-CD38, anti-CD19-CD3, anti-EGFR-MET, anti-DLL4-VEGF;

Anti-HER2 includes, but is not limited to trastuzumab, pertuzumab, ZW25, KN026; anti-EGFR includes, but is not limited to, cetuximab, nituzumab; anti-VEGF includes, but is not limited to, bevacizumab, ramucirumab, human endostatin; anti-CD20 includes, but is not limited to rituximab; anti-CD38 includes, but is not limited to, up to Lei Tuoyou mab; anti-CD19-CD3 includes, but is not limited to, blinatemomab; anti-EGFR-MET includes, but is not limited to JNJ-372; anti-DLL4-VEGF includes, but is not limited to, navicixizumab;

immune checkpoint inhibitors include, but are not limited to, anti-PD1, anti-PDL1, anti-CTLA4, anti-LAG3, anti-TIGIT, anti-PD1/CLTA4, anti-PD-1/TIM-3, anti-PD1/CD27, anti-PDL1/TGFB, anti-PD1/PDL1, anti-PD-1/VEGF, anti-PD-1/HER2;

AntiPD1 includes, but is not limited to, na Wu Liyou mAb, pabolizumab, terlipressin Li Shan, xindi Li Shan mAb, tirelizumab, carrilizumab; anti-PDL1 includes, but is not limited to, atilizumab, divaline You Shan antibody, shu Geli mab, avermectin; anti-CTLA4 includes, but is not limited to, ipilimumab; anti-LAG3 includes, but is not limited to, rila Li Shan antibody; anti-TIGIT includes, but is not limited to MK-7684A; anti-PD1/CLTA4 includes, but is not limited to KN046, xmAb20717, cadonilimab; anti-PD-1/TIM-3 includes, but is not limited to RO-7121661; anti-PD1/CD27 includes, but is not limited to CDX-527; anti-PDL1/TGFB includes, but is not limited to JS201; anti-PD1/PDL1 includes, but is not limited to Reozalimab, IB1318; anti-PD-1/VEGF includes but is not limited to Ivonesscimab; anti-PD-1/HER2 includes, but is not limited to, fidasimtmaab;

Immunomodulators include, but are not limited to, thalidomide, lenalidomide, thymus peptide, retinoic acid;

antibody-drug conjugates include, but are not limited to, vitamin b tuximab, U3-1402, enmeltrastuzumab;

hormonal agents include, but are not limited to, tamoxifen, toremifene, letrozole, anastrozole, enzalutamide, bicalutamide, abiraterone;

cell therapies include, but are not limited to, CAR-T, CAR-NK.

9. Use of methionine compounds according to any one of claims 1-5 for the preparation of PCSK9 inhibitors, characterized in that: the methionine compound is used for inhibiting transcription of PCSK9 gene or down regulating the expression level of PCSK9 protein.

10. The application of methionine compounds in preparing medicines for reducing serum low density lipoprotein cholesterol, or antitumor medicines, or medicines for activating tumor immunity.