CN117451993A - Kit for diagnosing syphilis and evaluating curative effect - Google Patents

Kit for diagnosing syphilis and evaluating curative effect Download PDF

Info

Publication number
CN117451993A
CN117451993A CN202310822028.2A CN202310822028A CN117451993A CN 117451993 A CN117451993 A CN 117451993A CN 202310822028 A CN202310822028 A CN 202310822028A CN 117451993 A CN117451993 A CN 117451993A
Authority
CN
China
Prior art keywords
syphilis
lisa
kit
nluc
pbs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310822028.2A
Other languages
Chinese (zh)
Inventor
柯吴坚
熬彩玲
冷欣颖
朱芮
黄丽霞
吴嘉欣
黄南轩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dermatology Hospital Of Southern Medical University Guangdong Provincial Dermatology Hospital Guangdong Skin Disease Prevention Center China Leprosy Control Research Center
Original Assignee
Dermatology Hospital Of Southern Medical University Guangdong Provincial Dermatology Hospital Guangdong Skin Disease Prevention Center China Leprosy Control Research Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dermatology Hospital Of Southern Medical University Guangdong Provincial Dermatology Hospital Guangdong Skin Disease Prevention Center China Leprosy Control Research Center filed Critical Dermatology Hospital Of Southern Medical University Guangdong Provincial Dermatology Hospital Guangdong Skin Disease Prevention Center China Leprosy Control Research Center
Priority to CN202310822028.2A priority Critical patent/CN117451993A/en
Priority to ZA2023/07046A priority patent/ZA202307046B/en
Publication of CN117451993A publication Critical patent/CN117451993A/en
Pending legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/571—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses for venereal disease, e.g. syphilis, gonorrhoea
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/20—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/20—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a method for cloning sequences of Tp15, tp17 and Tp47 into a pNLF1-N vector containing NanoLuc (Nluc) luciferase genes. The recombinant plasmid was expressed in Hela cells to produce nluc-antigen fusion proteins. White microplates coated with protein G bind to primary antibodies of rabbit or human serum. The nluc-antigen fusion protein was then used as a secondary antibody to bind specific IgG antibodies directed against TP15, TP17 or TP47 antigens. The light units were measured in a photometer using Nano-Glo luciferase assay reagents to reflect antibody levels. The diagnostic value of LISA against syphilis was evaluated. The results of LISA were compared with the results of TPPA, which served as a reference method. In addition, it was examined whether the LISA test can evaluate the effect of syphilis treatment by detecting TP15, TP17 and TP47 antibodies. Serial serum samples of 3 rabbits infected with treponema pallidum in the treatment and control groups, respectively, were analyzed. Meanwhile, 110 paired follow-up serum samples are collected for 55 syphilis patients in the same venereal disease clinic, and the effectiveness of LISA in monitoring the syphilis treatment effect is evaluated.

Description

Kit for diagnosing syphilis and evaluating curative effect
Technical Field
The invention relates to the field of biological medicine and disease detection, in particular to a reagent kit for diagnosing syphilis and evaluating curative effect.
Background
Syphilis is a chronic, systemic spread disease (STD) caused by treponema pallidum (Tp). It is one of the most common sexually transmitted diseases in the world. Although penicillin is effective in treating syphilis, the incidence of the disease has been continuously rising worldwide in recent years. The world health organization (Shiwei organization) reports that there are 630 ten thousand new cases of syphilis in the group of 15-49 years worldwide in 2016. According to the data of the european disease prevention and control center (ECDC), reported cases of syphilis have steadily increased since 2010. In the united states, new cases of syphilis have increased annually since 2009, with 39.68 cases per 10 thousands of people in 2019. In the united kingdom, the public health department (PHE) reports that the annual number of confirmed cases of infectious syphilis has increased from 2648 in 2010 to 7982 in 2019. In China, new syphilis cases have risen from 11336 in 1995 to 438199 in 2016. Thus, early accurate diagnosis of syphilis is critical to reducing morbidity.
Currently, laboratory diagnosis of syphilis relies mainly on two widely used serological tests, non-treponema pallidum test (NTT) and treponema pallidum test (TT). These tests are mainly used for diagnosis of syphilis but cannot be used for evaluating the effect of treatment. However, recent studies have explored the dynamics of treponema antibody levels as a means of assessing therapeutic response. For example, one study found that Western Blot detection of TP17 and TP47 antibodies in previously treated syphilis samples was quite weak in response and could be used to monitor the therapeutic effects of syphilis. However, more studies are required to examine the correlation between treponema antibody level changes and therapeutic effects. This can be accomplished by conducting a quantitative TT test on paired follow-up serum samples from patients with syphilis.
Currently, laboratory diagnosis of syphilis relies mainly on NTT and TT. NTTs include rapid plasma reactive protein assay (RPR), venereal disease research laboratory assay (VDRL), and toluidine red athermal serum assay (TRUST). However, NTT may lead to false positives in the case of connective tissue and autoimmune diseases, malignant tumors, intravenous drug inhalation, and the like. NTT has other drawbacks, including 1, when pre-treatment NTT titers are low (less than 1:4), the effectiveness of the treatment cannot be assessed, as a 4-fold decrease cannot occur; 2, post-treatment titers may not decrease, resulting in "serum rapid" results, causing undue treatment and unnecessary examination, increasing the psychological burden of the patient. TT is a series of diagnostic tests for detecting syphilis. Some of these tests include fluorescent spirochete antibody absorption (FTA-ABS), treponema Pallidum Particle Agglutination (TPPA), treponema Pallidum Hemagglutination Assay (TPHA), treponema pallidum enzyme immunoassay (TP-EIA), and Treponema pallidum chemiluminescent immunoassay (TP-CIA). These tests are mainly used for diagnosis of syphilis but cannot be used for evaluating the effect of treatment.
In summary, to date, we have not yet completed a diagnostic method for syphilis. Therefore, there is a need to develop an accurate, efficient, interference-free detection method for accurately diagnosing syphilis.
Disclosure of Invention
In order to solve the defects in the prior art, the invention aims to provide a kit for diagnosing and evaluating the curative effect, and a luciferase immunosorbent assay (LISA) is used for detecting specific IgG aiming at three high-immunogenicity antigens TP15, TP17 and TP47 in serum of a patient with syphilis, and the LISA-TP47 is a good method for diagnosing the syphilis instead of TPPA and can realize curative effect monitoring.
In order to achieve the above object, the present invention adopts the following technical scheme:
a kit for diagnosis and efficacy of treatment of syphilis comprising: recombinant plasmids cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes, a DNA purification kit, a Hela cell transfection reagent, an ELISA microwell plate coated with protein G, a washing buffer, a blocking agent, rabbit or human serum, a nluc antigen cell crude extract and a nano luciferase assay reagent.
The sequence of Tp0171 of the syphilis diagnosis and efficacy evaluation kit is as follows:
ATGGTGAAAAGAGGTGGCGCGTTCGCGCTGTGTCTTGCGGTGTTGCTTGGGGCGTGTTCATTTAGTTCTATCCCGAATGGCACGTACCGGGCGACGTATCAGGATTTTGATGAGAATGGTTGGAAGGACTTTCTCGAGGTTACTTTTGATGGTGGCAAGATGGTGCAGGTGGTTTACGATTATCAGCATAAAGAAGGGCGGTTTAAGTCCCAGGACGCTGACTACCATCGGGTCATGTATGCATCCTCGGGCATAGGTCCTGAAAAGGCCTTCAGAGAGCTCGCCGATGCTTTGCTTGAAAAGGGTAATCCCGAGATGGTGGATGTGGTCACCGGTGCAACTGTTTCTTCCCAGAGTTTCAGGAGGTTGGGTGCTGCGCTTCTGCAGAGTGCGCGGCGCGGCGAGAAGGAAGCCATTATTAGCAGG SEQ ID NO.01，
tp043 sequences such as:
ATGAAAGGATCTGTCCGCGCGCTGTGCGCGTTCCTTGGTGTTGGAGCGCTCGGTAGCGCTTTGTGTGTCTCGTGCACAACCGTGTGTCCGCACGCCGGGAAGGCCAAAGCGGAAAAGGTAGAGTGCGCGTTGAAGGGAGGTATCTTTCGGGGTACGCTACCTGCGGCCGATTGCCCGGGAATCGATACGACTGTGACGTTCAACGCGGATGGCACTGCGCAAAAGGTAGAGCTTGCCCTTGAGAAGAAGTCGGCACCTTCTCCTCTTACGTATCGCGGTACGTGGATGGTACGTGAAGACGGAATTGTCGAACTCTCGCTTGTGTCCTCGGAGCAATCGAAGGCACCGCACGAGAAAGAGCTGTACGAGCTGATAGACAGTAACTCCGTTCGCTACATGGGCGCTCCCGGCGCAGGAAAGCCTTCAAAGGAGATGGCGCCGTTTTACGTGCTCAAAAAAACAAAGAAA SEQ ID NO.02，
the sequence of Tp0574 is as follows:
GTGAAAGTGAAATACGCACTACTTTCTGCCGGAGCGCTGCAGTTGTTGGTTGTAGGCTGTGGCTCGTCTCATCATGAGACGCACTATGGCTATGCGACGCTAAGCTATGCGGACTACTGGGCCGGGGAGTTGGGGCAGAGTAGGGACGTGCTTTTGGCGGGTAATGCCGAGGCGGACCGCGCGGGGGATCTCGACGCAGGCATGTTCGATGCAGTTTCTCGCGCAACCCACGGGCATGGCGCGTTCCGTCAGCAATTTCAGTACGCGGTTGAGGTATTGGGCGAAAAGGTTCTCTCGAAGCAGGAGACCGAAGACAGCAGGGGAAGAAAAAAGTGGGAGTACGAGACTGACCCAAGCGTTACTAAGATGGTGCGTGCCTCTGCGTCATTTCAGGATTTGGGAGAGGACGGGGAGATTAAGTTTGAAGCAGTCGAGGGTGCAGTAGCGTTGGCGGATCGCGCGAGTTCCTTCATGGTTGACAGCGAGGAATACAAGATTACGAACGTAAAGGTTCACGGTATGAAGTTTGTCCCAGTTGCGGTTCCTCATGAATTAAAAGGGATTGCAAAGGAGAAGTTTCACTTCGTGGAAGACTCCCGCGTTACGGAGAATACCAACGGCCTTAAGACAATGCTCACTGAGGATAGTTTTTCTGCACGTAAGGTAAGCAGCATGGAGAGCCCGCACGACCTTGTGGTAGACACGGTGGGTACCGGTTACCACAGCCGTTTTGGTTCGGACGCAGAGGCTTCTGTGATGCTGAAAAGGGCTGATGGCTCTGAGCTGTCGCACCGTGAGTTCATCGACTATGTGATGAACTTCAACACGGTCCGCTACGACTACTACGGTGATGACGCGAGCTACACCAATCTGATGGCGAGTTATGGCACCAAGCACTCTGCTGACTCCTGGTGGAAGACAGGAAGAGTGCCCCGCATTTCGTGTGGTATCAACTATGGGTTCGATCGGTTTAAAGGTTCAGGGCCGGGATACTACAGGCTGACTTTGATTGCGAACGGGTATAGGGACGTAGTTGCTGATGTGCGCTTCCTTCCCAAGTACGAGGGGAACATCGATATTGGGTTGAAGGGGAAGGTGCTGACCATAGGGGGCGCGGACGCGGAGACTCTGATGGATGCTGCAGTTGACGTGTTTGCCGATGGACAGCCTAAGCTTGTCAGCGATCAAGCGGTGAGCTTGGGGCAGAATGTCCTCTCTGCGGATTTCACTCCCGGCACTGAGTACACGGTTGAGGTTAGGTTCAAGGAATTCGGTTCTGTGCGTGCGAAGGTAGTGGCCCAG SEQ ID NO.03。
the kit for diagnosing and evaluating the curative effect of the syphilis comprises the following components: recombinant plasmids cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes, DNA purification reagents, hela cell transfection reagents, ELISA microwell plates coated with protein G, washing buffer, blocking agents and nano luciferase assay reagents.
The Tp0171, tp0435 and Tp0574 gene sequences of the kit for diagnosing and evaluating the curative effect of the syphilis have EcoRI and XbaI cutting sites.
The kit for diagnosing and evaluating the curative effect of the syphilis is characterized in that the recombinant plasmid is an EcoRI-XbaI-cut pNLF1-N vector cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes.
The kit for diagnosing and evaluating the curative effect of the syphilis has the fluorescent gene of Nluc luciferase gene.
The kit for diagnosing syphilis and evaluating curative effect is characterized in that recombinant plasmids are purified by using a DNA purification kit, and Hela cells are transfected by using Lipofectamine 3000.
In the kit for diagnosing and evaluating the curative effect of the syphilis, 5 mug/mL of protein G is adopted by an ELISA microwell plate coated with the protein G, and a buffer solution is 0.01M PBS.
In the kit for diagnosing and evaluating the curative effect of the syphilis, the washing buffer solution is 0.01M PBS containing 0.05% Tween 20.
The kit for diagnosing and evaluating the curative effect of the syphilis comprises 2-5% of skim dry milk as a sealing agent.
The kit for diagnosing syphilis and evaluating curative effect comprises the following nano luciferase assay reagent: 50. Mu.L of nano-luciferase assay reagent was added to each well.
A method of detecting Tp15, tp17 and Tp47 antibody levels as described above, comprising the steps of:
step one, obtaining Tp0171, tp0435 and Tp0574 gene sequences from GenBank ID: AE 000520.1;
cloning the sequence onto EcoRI-XbaI-cut pNLF1-N vector containing Nluc luciferase gene, and verifying the Nluc-antigen fusion protein through DNA sequencing to obtain recombinant plasmid;
step three, purifying the recombinant plasmid by using a DNA purification kit, and transfecting Hela cells by using Lipofectamine 3000;
step four, after 48 hours, the cells are lysed, and the lysate contains Nluc-TP15/Nluc-TP17/Nluc-TP47 fusion protein and is preserved at the temperature of-80 ℃ for standby without further purification;
step five, in order to detect TP15, TP17 and TP47 antibodies, an Elisa microplate coated with 5 μg/mL protein G was placed in 0.01M PBS and incubated overnight at 4 ℃;
step six, washing 5 times with PBS-T, blocking with 5% dry skim milk at 37 ℃ for 1 hour, then washing 5 times with PBS-T, adding 50 mu L of rabbit or human serum into the plate, and incubating at 37 ℃ for 1 hour; the PBS-T is 0.01M PBS containing 0.05% Tween-20; the rabbit or human serum is diluted by 2% NFDM, and the volume ratio after dilution is that of the rabbit or human serum: skim dry milk = 1:100;
step seven, after PBS-T is washed for 5 times, 50 mu L of nluc antigen cell crude extract is added to each well, and the mixture is incubated for 0.5h at 37 ℃; after PBS-T is washed for 5 times, 50 mu L of nano luciferase assay reagent is added to each well;
measuring Light Units (LU) in 2 hours by using a photometer, recording the results of the parallel repeated test of each sample, recording the average value of the results as a coarse LU, and dividing the coarse LU by the average LU of the negative control to be expressed as RLU;
the performance of the LISA test was evaluated by subject work signature (ROC) analysis, comparing the area under the subject work signature curve (AUC), using the maximum approximate log index to determine the optimal threshold, calculated as: sensitivity + specificity-100%; calculating the Confidence Intervals (CIs) of sensitivity, specificity, positive Predictive Value (PPV) and Negative Predictive Value (NPV) of the ROC analysis to be 95%;
correlation between LISA and TPPA test results was analyzed by Shi Bier mann-scale correlation assay, antibody levels were expressed as geometric mean ± Standard Deviation (SD), and differences between the two groups were compared using T-test; in paired follow-up samples, the median percentage of antibody level changes detected by LISA detection for TP15, TP17 and TP47 was calculated using hodgkin-leiman estimation and stratified by changes in RPR titers; analyzing and testing the relation between the change of the serum anti-TP 15, TP17 and TP47 antibody levels (LISA detection) and the change of RPR titer by adopting a Schbi-Kalman grade correlation assay;
statistical analysis was performed using SPSS 25.0 and MedCalc software, with p-value <0.05 statistically significant as the difference.
The application of the syphilis diagnosis and efficacy evaluation kit can be used for diagnosing syphilis.
The application of the syphilis diagnosis and efficacy evaluation kit can be used for monitoring efficacy.
The invention has the advantages that:
LISA-Tp47 has good sensitivity in syphilis diagnosis, LISA-Tp15 and LISA-Tp17 have higher specificity in syphilis diagnosis, the performance of the LISA-Tp is equivalent to that of TPPA detection, the LISA has the advantage of automation while realizing the replacement of TPPA for syphilis diagnosis, the potential of automation is realized, repeated manual pipetting steps are eliminated, labor force can be reduced, more accurate results can be provided through spectrophotometry reading, and subjective interpretation and report differences are avoided;
the present invention finds that detecting Tp15, tp17 and Tp47 antibody levels by LISA also has unexpected effects and can be used to monitor the effectiveness of syphilis treatment.
Term interpretation:
TPPA means: aggregation of treponema pallidum particles;
RLU refers to: relative light units;
LISA means: luciferase immunoadsorption test;
PPV means: positive predictive value;
NPV refers to: negative predictive value;
CI refers to: confidence interval;
S/CO refers to signal-to-cutoff, signal to cutoff;
IQR, quartile range;
RPR, rapid plasma reactive assay.
Drawings
FIG. 1 is a flow chart of the detection method of the present invention;
FIG. 2 is an ROC curve analysis of diagnostic efficacy of 261 subjects LISA-TP15, LISA-TP17, LISA-TP47 in the present experiments (AUC of LISA-TP17 is 0.992 (95% CI: 0.973-0.999), AUC of LISA-TP15 is 0.971 (95% CI: 0.942-0.988), P-value is 0.015, AUC of LISA-TP47 is 0.995 (95% CI: 0.977-1.000), and AUC of LISA-TP15 is 0.971 (95% CI: 0.942-0.988), P-value is 0.023);
FIG. 3 is a study of the correlation of serum TPPA titers of 258 subjects in the experiments of the invention with LISA-TP15, LISA-TP17 and LISA-TP47RLU levels (three serum samples were excluded from the analysis because they lacked the maximal dilution of TPPA);
FIG. 4 is a graph of the antibody titers of LISA-TP15, LISA-TP17, LISA-TP47, TPPA and RPR in New Zealand white rabbit treponema pallidum infection in the experiments of the present invention (log transformed data are expressed as mean.+ -. Standard deviation; treatment groups were injected with 20 ten thousand units of BPG on day 14 post infection; student's t test was used to compare differences in antibody levels between the two groups; p < 0.05; p < 0.01);
fig. 5 is LISA and RPR assays of TP15, TP17 and TP47 antibody responses in paired serum samples before and after treatment of 55 non-neural syphilis or neural syphilis patients in the present invention experiments (detection of Wilcoxon paired markers versus differences in antibody levels before and after treatment,..p < 0.001).
Detailed Description
The invention is described in detail below with reference to the drawings and the specific embodiments.
A method of detecting Tp15, tp17 and Tp47 antibody levels comprising the steps of:
step one, obtaining Tp0171, tp0435 and Tp0574 gene sequences from GenBank ID: AE 000520.1;
cloning the sequence onto EcoRI-XbaI-cut pNLF1-N vector containing Nluc luciferase gene, and verifying the Nluc-antigen fusion protein through DNA sequencing to obtain recombinant plasmid;
step three, purifying the recombinant plasmid with a DNA purification kit (tengen Biotech, china) and transfecting Hela cells using Lipofectamine 3000 (Invitrogen, USA);
step four, after 48 hours, the cells are lysed, and the lysate contains Nluc-TP15/Nluc-TP17/Nluc-TP47 fusion protein and is preserved at the temperature of-80 ℃ for standby without further purification (as shown in figure 1);
step five, to detect TP15, TP17 and TP47 antibodies, elisa microplates (corning, usa) coated with 5 μg/mL protein G (Genscript co., china) were placed in 0.01M PBS and incubated overnight at 4 ℃;
step six, washing 5 times with PBS-T, blocking with 5% skim dry milk (NFDM) at 37℃for 1 hour, then washing 5 times with PBS-T, adding 50. Mu.L of rabbit or human serum (1:100, diluted with 2% NFDM) to the plate, and incubating at 37℃for 1 hour; the PBS-T is 0.01M PBS containing 0.05% Tween-20;
step seven, after PBS-T is washed for 5 times, 50 mu L of nluc antigen cell crude extract is added to each well, and the mixture is incubated for 0.5h at 37 ℃; after 5 washes of PBS-T, 50. Mu.L of Nano-Glo Luciferase assay reagent (Promega, USA) was added to each well.
Step eight, light Units (LU) were measured using a photometer (Tecan infinite M200 PRO, switzerland) over 2 hours, the results of each sample parallel repeat test were recorded, the average of the results was recorded as a coarse LU, and the coarse LU divided by the average LU of the negative control was expressed as RLU (as shown in fig. 1).
To evaluate the performance of the LISA test, a subject operating characteristic (ROC) analysis was performed and the area under the subject operating characteristic curve (AUC) was compared, and the best threshold was determined using the maximum approximate log index, calculated as: sensitivity + specificity-100%; calculating the Confidence Intervals (CIs) of sensitivity, specificity, positive Predictive Value (PPV) and Negative Predictive Value (NPV) of the ROC analysis to be 95%; in addition, correlation between LISA and TPPA test results was analyzed by Shi Bier mann scale correlation assay, antibody levels were expressed as geometric mean ± Standard Deviation (SD), and differences between the two groups were compared using a Student's T-test; in paired follow-up samples, the median percentage of antibody level changes detected by LISA detection for TP15, TP17 and TP47 was calculated using hodgkin-leiman estimation and stratified by changes in RPR titers; analyzing and testing the relation between the change of the serum anti-TP 15, TP17 and TP47 antibody levels (LISA detection) and the change of RPR titer by adopting a Schbi-Kalman grade correlation assay;
statistical analysis was performed using SPSS 25.0 and MedCalc software, with p-value <0.05 statistically significant as the difference.
Experiment one, verify the detection specificity of the kit of the invention:
the experimental object: there were 261 study participants, 161 of whom were TPPA positive from a venereal clinic, 40 of whom were TPPA negative from the same clinic, and 60 of whom were TPPA negative healthy blood donors. The venereal disease outpatient participants were male-based (69.2%), mid-age 31 years (IQR 25-45 years). However, 60 (23.0%) healthy blood donors lack basic information on sex, age, RPR titer, etc.
LISA-TP15, LISA-TP17 and LISA-TP47 were compared with the diagnostic effects of TPPA on syphilis, and the performance of the demographic and clinical characterization evaluation LISA of 261 subjects is shown in Table 1.
TABLE 1
TABLE 2
Remarks: 261 subjects were evaluated in this study. TPPA titer is more than or equal to 1:80 and is positive. The optimal cut-off values for LISA-TP15, LISA-TP17 and LISA-TP47 were determined using the subject operating characteristic (ROC) curve. The sensitivity and specificity of LISA-TP15, LISA-TP17 and LISA-TP47 were compared using the McNemar test.
With reference to TPPA, all three experiments performed well in the subject operating profile analysis (AUC > 0.95). The AUC of both LISA-TP17 and LISA-TP47 was significantly better than LISA-TP15 (LISA-TP 17:0.992[ 0.973-0.999 ], p=0.015; LISA-TP47:0.995[0.977-1.000], p=0.023; as shown by ROC curve analysis of the diagnostic effects of LISA-TP15, LISA-TP17, LISA-TP47 of fig. 2, it was shown from the de long test result that the AUC of both LISA-TP17 and LISA-TP47 was significantly higher than that of LISA-TP15.LISA-TP17 by 0.992 (95% CI: 0.973-0.999), that of LISA-TP15 by 0.971 (95% CI: 0.942-0.988), that of LISA-TP47 by 0.995 (95% CI: 0.977-1.000), and that of LISA-TP47 by 0.942.1.942.
The sensitivity of the LISA-TP47 diagnosis of syphilis is 98.8%, the specificity is 98.0%, the PPV is 98.8%, and the NPV is 98.0%, which are equivalent to TPPA. The sensitivity of LISA-TP47 was significantly higher than that of LISA-TP15 (98.8% [95.6-99.8] vs91.9% [86.6-95.6], P=0.003). The diagnostic effect of LISA-TP15, LISA-TP17 and LISA-TP47 in parallel or serial (sequential) assays with a sensitivity of 99.4%, a specificity of 97.0%, a PPV of 98.2% and a NPV of 99.0% was not significantly better than LISA-TP47 alone (99.4% vs 98.8%, P=1.000, and compared to LISA-TP15, LISA-TP17 and LISA-TP47 in 261 subjects) is shown in Table 4.
TABLE 4 Table 4
Remarks: in this study, one parallel test (considered positive if any of the labels is positive, otherwise considered negative) is denoted "a n b", while one consecutive test (considered positive only if all labels are positive, otherwise considered negative) is denoted "a n b". Since the specificity was 100% and the PPV variance in the continuous (sequential) assay was 0, 95% CI could not be calculated.
LISA-TP15 and LISA-TP17 have a specificity of 99.0% for diagnosis of syphilis. The cut-off points were adjusted to 2 signal pairs cut-off (S/CO), and the specificity of LISA-TP15, LISA-TP17, LISA-TP47 could reach 100%, as the accuracy of LISA-TP15, LISA-TP17 and LISA-TP47 at different thresholds for syphilis diagnosis was evaluated in 261 participants, and the results are shown in Table 3.
TABLE 3 Table 3
Experiment two, relationship between LISA and TPPA
Serum TPPA titers from 258 subjects were studied for correlation with LISA-TP15, LISA-TP17 and LISA-TP47RLU levels using the Schbi-Kalman-scale correlation assay, and the experimental results are shown in FIG. 3. 3 out of 261 serum samples were not included because of the lack of TPPA results to obtain maximum dilution. The results show that the relative light unit levels of LISA-TP15 (rs=0.89, p < 0.0001), LISA-TP17 (rs=0.91, p < 0.0001), LISA-TP47 (rs=0.93, p < 0.0001) in serum have a strong correlation with serum TPPA titer. The correlation of LISA-TP47 with TPPA was significantly better than the correlation of LISA-TP15 with TPPA (p=0.0027). Whereas the correlation of LISA-TP47 with TPPA was not significantly different from the correlation of LISA-TP17 with TPPA (p= 0.1293).
Experiment three, analysis of titre of Tp-infected rabbit syphilis antibody
The purpose of the experiment is as follows:
to assess whether LISA detected changes in TP15, TP17 and TP47 spirochete antibody levels could be used as a surrogate for TRUST, we used a series of serum samples of TP-infected new zealand white rabbits before and after benzathine G treatment.
The experimental process comprises the following steps:
samples taken from Tp infected new zealand white rabbits: 6 adult male New Zealand white rabbits (3 months of age, 3kg of body weight) were selected and randomly divided into two groups: treatment group (n=3) and untreated control group (n=3). Prior to infection, each rabbit was screened using TPPA and TRUST to exclude treponema pallidum infection with syphilis rabbits. The treponema pallidum can be bred only after the blood serum reaction is negative through TPPA and TRUST screening. Tp Nichols strain was inoculated into male New Zealand white rabbits (3 months old, 3kg body weight) for propagation in testes. New Zealand white rabbits were inoculated with 2mL of the treponema suspension and maintained at 18 ℃. When new zealand white rabbits developed orchitis and serum samples detected TPPA positive, testes of infected rabbits were excised. After collection of the spirochete suspension, 2mL of the suspension was re-injected into the testes of new rabbits and the relevant samples were collected using the same method as described above. After collection of the treponema suspension, 6 male New Zealand white rabbits (3 months old, 3kg body weight, negative for TPPA and TRUST test results) were injected intradermally with 0.1mL (107/mL) of the treponema suspension at 10 sites on their backs. Three rabbits in the treatment group were treated with 200,000u BPG by intramuscular injection on days 14 and 21 post-infection. Challenge experiments using the Nichols Tp strain and antimicrobial treatment were previously described. Serum samples were collected from each rabbit periodically, once every 2 days from day 8 to day 26 post-infection, and once every 5 days from day 26 to day 51 post-infection, for TRUST, TPPA, LISA-TP15, LISA-TP17 and LISA-TP47 tests.
Experimental results: FIG. 4 shows treponema antibody and non-treponema antibody titres during Tp infection in New Zealand white rabbits and after BPG treatment. In the treatment group, the levels of treponema pallidum antibodies detected by LISA-TP17, LISA-TP47, TPPA gradually increased after infection, but began to decrease after BPG treatment and eventually tended to stabilize. While treponema pallidum antibody levels detected by LISA-TP15 in the treatment group were on an ascending trend after BPG treatment. RPR titers of control and experimental groups also increased before decreasing (or becoming negative). There was no significant difference between the control and treated groups in LISA-TP15, TPPA and RPR. Taking LISA-TP17 as an example, there was no statistical significance for the differences between the control and treatment groups at 26 days post-infection and for the differences between day 26 and day 51 post-infection. LISA-TP47 showed significant differences only on day 41.
Experiment four, relation between drop of serum TP15, TP17 and TP47 antibody levels and change of RPR titer before and after treatment of syphilis patients.
The treatment effect of demographic and clinical characteristic evaluation of the total collection of 110 paired follow-up samples of 18 non-NS patients and 37 NS patients and 55 syphilis patients is shown in Table 5, and LISA and RPR detection results of TP15, TP17 and TP47 antibody responses in paired serum samples of the 55 non-neural syphilis or neural syphilis patients before and after treatment are shown in FIG. 5; detecting differences in antibody levels before and after treatment using a Wilcoxon paired-pair signature rank test, p <0.001; the median changes in serum LISA-TP15, LISA-TP17 and LISA-TP47 antibody levels of 51 subjects after syphilis treatment are evaluated based on the changes in RPR titer as shown in Table 6, and the experimental results of the correlation between the changes in serum TP15, TP17 and TP47 antibody levels after 55 cases of syphilis treatment and the serum RPR titer are shown in Table 7:
TABLE 5
TABLE 6
Remarks: 102 paired follow-up samples from 17 syphilis patients and 34 NS patients were analyzed. However, 4 patients with a 2 or 4-fold increase in RPR titer after treatment were excluded due to the small sample size.
TABLE 7
Analysis of results: as can be seen from fig. 5, the pre-treatment serum TP15, TP17, TP47 antibody levels were significantly higher than post-treatment RPR titers. From Table 6, it can be seen that the Hodgman-Leman estimates indicate that the RPR titer decreases, with a greater decrease in the median serum antibody levels corresponding to the LISA assays of TP15, TP17 and TP 47. No change in participants, 2-fold reduction (dilution 1), 4-fold reduction (dilution 2), or 8-fold reduction (dilution 3 or more) in RPR titer median of TP15 antibody levels after treatment was reduced by 17.53%, 31.34%, 48.62% and 72.79%, respectively; the median RPR titer at TP17 antibody level was reduced by 8.84%, 17.00%, 28.37% and 50.57%, respectively; the median RPR titer at the TP47 antibody level was reduced by 22.25%, 29.79%, 51.75% and 70.28%, respectively. Table 7 shows that serum TP15 antibody levels decreased (rs=0.44, p <0.001; rs=0.63, p < 0.001), TP17 (rs=0.33, p=0.01, rs=0.61, p < 0.001), TP47 (rs=0.53, p <0.001; rs=0.63, p < 0.001) were significantly correlated with baseline RPR titers and serum RPR titers changes before and after treatment.
Summary of the experiment: the TP15, TP17 and TP47 antibodies detected by LISA can be used for evaluating the treatment effect of syphilis. In the rabbit infection model, we observed a gradual rise in the levels of treponema antibody detected by ELisa-Tp17, LISA-Tp47 and TPPA following infection Tp in the control group. However, after BPG treatment, the levels of these spirochete antibodies began to drop and eventually tended to stabilize in the BPG treated group. Furthermore, we have found a correlation between the percent change in anti-TP 15, TP17 and TP47 antibodies and the change in RPR titer before and after treatment of patients with syphilis. The median decreases in TP15, TP17 and TP47 antibody levels by 48.62%, 28.37% and 51.75%, respectively, in participants with 4-fold decrease in RPR titer after treatment. These results indicate that these antibody levels are likely to be used to observe the therapeutic effects clinically.
Taken together, our method shows that LISA-TP47 has good sensitivity in syphilis diagnosis, while LISA-TP15 and LISA-TP17 have higher specificity in syphilis diagnosis, and the performance of the LISA-TP is equivalent to that of TPPA test; LISA may replace TPPA for syphilis patients and blood donors. Furthermore, we found that detection of antibody levels for TP15, TP17 and TP47 with LISA can be used to monitor the effectiveness of syphilis treatment.
The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be appreciated by persons skilled in the art that the above embodiments are not intended to limit the invention in any way, and that all technical solutions obtained by means of equivalent substitutions or equivalent transformations fall within the scope of the invention.

Claims (14)

1. A kit for diagnosis and efficacy assessment of syphilis comprising: recombinant plasmids cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes.
2. The syphilis diagnosis and efficacy assessment kit according to claim 1, characterized in that,
the sequence of Tp0171 is as follows:
ATGGTGAAAAGAGGTGGCGCGTTCGCGCTGTGTCTTGCGGTGTTGCTTGGGGCGTGTTCATTTAGTTCTATCCCGAATGGCACGTACCGGGCGACGTATCAGGATTTTGATGAGAATGGTTGGAAGGACTTTCTCGAGGTTACTTTTGATGGTGGCAAGATGGTGCAGGTGGTTTACGATTATCAGCATAAAGAAGGGCGGTTTAAGTCCCAGGACGCTGACTACCATCGGGTCATGTATGCATCCTCGGGCATAGGTCCTGAAAAGGCCTTCAGAGAGCTCGCCGATGCTTTGCTTGAAAAGGGTAATCCCGAGATGGTGGATGTGGTCACCGGTGCAACTGTTTCTTCCCAGAGTTTCAGGAGGTTGGGTGCTGCGCTTCTGCAGAGTGCGCGGCGCGGCGAGAAGGAAGCCATTATTAGCAGG SEQ ID NO.01，
the sequence of Tp043 is as follows:
ATGAAAGGATCTGTCCGCGCGCTGTGCGCGTTCCTTGGTGTTGGAGCGCTCGGTAGCGCTTTGTGTGTCTCGTGCACAACCGTGTGTCCGCACGCCGGGAAGGCCAAAGCGGAAAAGGTAGAGTGCGCGTTGAAGGGAGGTATCTTTCGGGGTACGCTACCTGCGGCCGATTGCCCGGGAATCGATACGACTGTGACGTTCAACGCGGATGGCACTGCGCAAAAGGTAGAGCTTGCCCTTGAGAAGAAGTCGGCACCTTCTCCTCTTACGTATCGCGGTACGTGGATGGTACGTGAAGACGGAATTGTCGAACTCTCGCTTGTGTCCTCGGAGCAATCGAAGGCACCGCACGAGAAAGAGCTGTACGAGCTGATAGACAGTAACTCCGTTCGCTACATGGGCGCTCCCGGCGCAGGAAAGCCTTCAAAGGAGATGGCGCCGTTTTACGTGCTCAAAAAAACAAAGAAA SEQ ID
NO.02，
the sequence of Tp0574 is as follows:
GTGAAAGTGAAATACGCACTACTTTCTGCCGGAGCGCTGCAGTTGTTGGTTGTAGGCTGTGGCTCGTCTCATCATGAGACGCACTATGGCTATGCGACGCTAAGCTATGCGGACTACTGGGCCGGGGAGTTGGGGCAGAGTAGGGACGTGCTTTTGGCGGGTAATGCCGAGGCGGACCGCGCGGGGGATCTCGACGCAGGCATGTTCGATGCAGTTTCTCGCGCAACCCACGGGCATGGCGCGTTCCGTCAGCAATTTCAGTACGCGGTTGAGGTATTGGGCGAAAAGGTTCTCTCGAAGCAGGAGACCGAAGACAGCAGGGGAAGAAAAAAGTGGGAGTACGAGACTGACCCAAGCGTTACTAAGATGGTGCGTGCCTCTGCGTCATTTCAGGATTTGGGAGAGGACGGGGAGATTAAGTTTGAAGCAGTCGAGGGTGCAGTAGCGTTGGCGGATCGCGCGAGTTCCTTCATGGTTGACAGCGAGGAATACAAGATTACGAACGTAAAGGTTCACGGTATGAAGTTTGTCCCAGTTGCGGTTCCTCATGAATTAAAAGGGATTGCAAAGGAGAAGTTTCACTTCGTGGAAGACTCCCGCGTTACGGAGAATACCAACGGCCTTAAGACAATGCTCACTGAGGATAGTTTTTCTGCACGTAAGGTAAGCAGCATGGAGAGCCCGCACGACCTTGTGGTAGACACGGTGGGTACCGGTTACCACAGCCGTTTTGGTTCGGACGCAGAGGCTTCTGTGATGCTGAAAAGGGCTGATGGCTCTGAGCTGTCGCACCGTGAGTTCATCGACTATGTGATGAACTTCAACACGGTCCGCTACGACTACTACGGTGATGACGCGAGCTACACCAATCTGATGGCGAGTTATGGCACCAAGCACTCTGCTGACTCCTGGTGGAAGACAGGAAGAGTGCCCCGCATTTCGTGTGGTATCAACTATGGGTTCGATCGGTTTAAAGGTTCAGGGCCGGGATACTACAGGCTGACTTTGATTGCGAACGGGTATAGGGACGTAGTTGCTGATGTGCGCTTCCTTCCCAAGTACGAGGGGAACATCGATATTGGGTTGAAGGGGAAGGTGCTGACCATAGGGGGCGCGGACGCGGAGACTCTGATGGATGCTGCAGTTGACGTGTTTGCCGATGGACAGCCTAAGCTTGTCAGCGATCAAGCGGTGAGCTTGGGGCAGAATGTCCTCTCTGCGGATTTCACTCCCGGCACTGAGTACACGGTTGAGGTTAGGTTCAAGGAATTCGGTTCTGTGCGTGCGAAGGTAGTGGCCCAG SEQ ID NO.03。
3. the kit for diagnosis and efficacy assessment of syphilis according to claim 1, comprising: recombinant plasmids cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes, DNA purification reagents, hela cell transfection reagents, ELISA microwell plates coated with protein G, washing buffer, blocking agents and nano luciferase assay reagents.
4. The kit for diagnosing and assessing the efficacy of a treatment of syphilis according to claim 2, wherein said Tp0171, tp0435 and Tp0574 gene sequences have EcoRI and XbaI cleavage sites.
5. The kit for diagnosing and evaluating the curative effect of syphilis according to claim 1, wherein the recombinant plasmid is an EcoRI-XbaI-cut pNLF1-N vector cloned with Tp0171, tp0435 and Tp0574 gene sequences and fluorescent genes.
6. The kit for diagnosing and evaluating the efficacy of treatment of syphilis according to claim 5, wherein said fluorescent gene is the Nluc luciferase gene.
7. The kit for diagnosis and treatment of syphilis according to claim 1, wherein the recombinant plasmid is purified by using a DNA purification kit and Hela cells are transfected with Lipofectamine 3000.
8. The kit for diagnosing and evaluating the curative effect of syphilis according to claim 1, wherein the ELISA microwell plate coated with the protein G adopts 5 mug/mL of protein G and the buffer solution is 0.01M PBS.
9. The kit of claim 1, wherein the wash buffer is 0.01M PBS containing 0.05% tween 20.
10. The kit for diagnosing and evaluating the efficacy of treatment of syphilis according to claim 1, wherein said blocking agent is 2-5% skim dry milk.
11. The kit for diagnosing and evaluating the curative effect of syphilis according to claim 1, wherein the nano luciferase assay reagent is added in the following amount: 50. Mu.L of nano-luciferase assay reagent was added to each well.
12. A method of detecting Tp15, tp17 and Tp47 antibody levels according to claim 1, comprising the steps of:
step one, obtaining Tp0171, tp0435 and Tp0574 gene sequences from GenBank ID: AE 000520.1;
cloning the sequence onto EcoRI-XbaI-cut pNLF1-N vector containing Nluc luciferase gene, and verifying the Nluc-antigen fusion protein through DNA sequencing to obtain recombinant plasmid;
step three, purifying the recombinant plasmid by using a DNA purification kit, and transfecting Hela cells by using Lipofectamine 3000;
step four, after 48 hours, the cells are lysed, and the lysate contains Nluc-TP15/Nluc-TP17/Nluc-TP47 fusion protein and is preserved at the temperature of-80 ℃ for standby without further purification;
step five, in order to detect TP15, TP17 and TP47 antibodies, an Elisa microplate coated with 5 μg/mL protein G was placed in 0.01M PBS and incubated overnight at 4 ℃;
step six, washing 5 times with PBS-T, blocking with 5% dry skim milk at 37 ℃ for 1 hour, then washing 5 times with PBS-T, adding 50 mu L of rabbit or human serum into the plate, and incubating at 37 ℃ for 1 hour; the PBS-T is 0.01M PBS containing 0.05% Tween-20; the rabbit or human serum is diluted by 2% NFDM, and the volume ratio after dilution is that of the rabbit or human serum: skim dry milk = 1:100;
step seven, after PBS-T is washed for 5 times, 50 mu L of nluc antigen cell crude extract is added to each well, and the mixture is incubated for 0.5h at 37 ℃; after PBS-T is washed for 5 times, 50 mu L of nano luciferase assay reagent is added to each well;
measuring Light Units (LU) in 2 hours by using a photometer, recording the results of the parallel repeated test of each sample, recording the average value of the results as a coarse LU, and dividing the coarse LU by the average LU of the negative control to be expressed as RLU;
the performance of the LISA test was evaluated by subject work signature (ROC) analysis, comparing the area under the subject work signature curve (AUC), using the maximum approximate log index to determine the optimal threshold, calculated as: sensitivity + specificity-100%; calculating the Confidence Intervals (CIs) of sensitivity, specificity, positive Predictive Value (PPV) and Negative Predictive Value (NPV) of the ROC analysis to be 95%;
correlation between LISA and TPPA test results was analyzed by Shi Bier mann-scale correlation assay, antibody levels were expressed as geometric mean ± Standard Deviation (SD), and differences between the two groups were compared using T-test; in paired follow-up samples, the median percentage of antibody level changes detected by LISA detection for TP15, TP17 and TP47 was calculated using hodgkin-leiman estimation and stratified by changes in RPR titers; analyzing and testing the relation between the change of the serum anti-TP 15, TP17 and TP47 antibody levels (LISA detection) and the change of RPR titer by adopting a Schbi-Kalman grade correlation assay;
statistical analysis was performed using SPSS 25.0 and MedCalc software, with p-value <0.05 statistically significant as the difference.
13. The use of a syphilis diagnosis and efficacy assessment kit according to claim 1, characterized in that said syphilis diagnosis and efficacy assessment kit is useful for diagnosing syphilis.
14. The use of a syphilis diagnosis and efficacy assessment kit according to claim 1, characterized in that said syphilis diagnosis and efficacy assessment kit is used for monitoring efficacy.
CN202310822028.2A 2023-07-06 2023-07-06 Kit for diagnosing syphilis and evaluating curative effect Pending CN117451993A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202310822028.2A CN117451993A (en) 2023-07-06 2023-07-06 Kit for diagnosing syphilis and evaluating curative effect
ZA2023/07046A ZA202307046B (en) 2023-07-06 2023-07-13 Syphilis diagnosis and therapeutic effect evaluation kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310822028.2A CN117451993A (en) 2023-07-06 2023-07-06 Kit for diagnosing syphilis and evaluating curative effect

Publications (1)

Publication Number Publication Date
CN117451993A true CN117451993A (en) 2024-01-26

Family

ID=89584272

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310822028.2A Pending CN117451993A (en) 2023-07-06 2023-07-06 Kit for diagnosing syphilis and evaluating curative effect

Country Status (2)

Country Link
CN (1) CN117451993A (en)
ZA (1) ZA202307046B (en)

Also Published As

Publication number Publication date
ZA202307046B (en) 2024-02-28

Similar Documents

Publication Publication Date Title
Jarius et al. Cerebrospinal fluid findings in aquaporin-4 antibody positive neuromyelitis optica: results from 211 lumbar punctures
Ljøstad et al. CSF B–lymphocyte chemoattractant (CXCL13) in the early diagnosis of acute Lyme neuroborreliosis
Long et al. Aquaporin 4 antibodies in the cerebrospinal fluid are helpful in diagnosing Chinese patients with neuromyelitis optica
EP2880446A1 (en) Biomarkers for diagnosing and/or monitoring tuberculosis
Iannetta et al. T-cell responses to SARS-CoV-2 in multiple sclerosis patients treated with ocrelizumab healed from COVID-19 with absent or low anti-spike antibody titers
Coad et al. Simultaneous measurement of antigen-induced CXCL10 and IFN-γ enhances test sensitivity for bovine TB detection in cattle
KR20190082100A (en) Method for diagnosing a bornavirus infection
KR20180094487A (en) An improved assay for the diagnosis of peanut allergy
Long et al. Development of a cell-based assay for the detection of anti-aquaporin 1 antibodies in neuromyelitis optica spectrum disorders
Alsayb et al. Prolonged humoral and cellular immunity in COVID-19-recovered patients
WO2023040026A1 (en) Immunochromatographic detection reagent strip and kit comprising same, and applications of both
WO2014185145A1 (en) Biomarker for psychiatric and neurological disorders
EA030721B1 (en) Method for determining the status of tuberculosis infection in an individual
US20200378966A1 (en) Multiplexed assay kits for evaluation of systemic lupus erythematosus
EP3701264B1 (en) Method and means for diagnosing autoimmune hepatitis using autoantibody markers
JP6687391B2 (en) Method of measuring sample for determining the presence of rheumatoid arthritis (RA)
CN113748342A (en) Biomarkers
CN117451993A (en) Kit for diagnosing syphilis and evaluating curative effect
BR112016005745B1 (en) BIOMARKERS FOR TUBERCULOSIS
JP7489228B2 (en) SARS-CoV-2 derived nucleocapsid fragment and method and kit for detecting anti-SARS-CoV-2 antibodies using said fragment
CN113985035A (en) Application of chemokine CCL28 as marker in preparation of Sjogren syndrome diagnostic reagent
Wutte et al. Laboratory diagnosis of Lyme neuroborreliosis is influenced by the test used: comparison of two ELISAs, immunoblot and CXCL13 testing
US7919256B2 (en) Method for detecting Borna disease virus infection
CN112285360A (en) Application of I-309 in preparation of primary sicca syndrome diagnostic reagent or kit
Matsunaga et al. Long-term follow-up of production of IgM and IgG antibodies against SARS-CoV-2 among patients with COVID-19

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination