CN117447570A - Gene for controlling dynamic elongation of brassica napus pod and application thereof - Google Patents

Abstract

The invention discloses a gene for controlling dynamic elongation of brassica napus and application thereof, comprising a gene BnaA02g12010D, wherein the nucleotide sequence of the gene is shown as SEQ ID NO: 1. The protein encoded by the gene BnaA02g12010D comprises a sequence shown in SEQ ID NO:2, and amino acid sequences in which one or more amino acids are substituted, deleted and/or added, and which express the same functional protein. The invention uses cloning of the BnaA02g12010D gene of the brassica napus and adopts the vector to convert the brassica napus into the gene over-expression plant, and compared with the contrast, the gene over-expression plant shows the phenotype of early bolting and flowering time, faster growth and development and faster elongation rate of the brassica napus, thereby being capable of being used for breeding high-yield and stable-yield brassica napus.

Description

Gene for controlling dynamic elongation of brassica napus pod and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a gene for controlling dynamic elongation of brassica napus pod and application thereof.

Background

As the most widely distributed oil crop in our country, brassica napus (Brassica napus l.) plays an important role in the production and life of people. However, the self-supporting rate of the rapeseed oil in China is less than 40%, and the edible oil safety faces the potential risk brought by higher dependence on imported rapeseeds, so that the improvement of the yield of the rapeseeds has important significance for stabilizing the grain and oil safety in China. Unlike other crops, the leaf and stem of brassica napus in early growth and development serve as photosynthetic source organs for photosynthesis, and the pericarp of the brassica napus becomes a main organ for photosynthesis after flowers are removed, so that 50% -60% of photosynthetic products are provided for the formation of seed yield, and the kerb fruits of the brassica napus are tissue organs which play a vital role in yield.

Studies have shown that the silique (final length) of canola, while providing a large photosynthetic area, also requires greater energy consumption for development of the silique itself, and therefore, in order to produce higher canola yields, it is desirable to control the optimal length of the silique to balance various physiological activities such as photosynthesis, respiration consumption, and transport of photosynthetic products (donetal, 2018). In addition, the gene for regulating the development of the horn fruit can have space-time expression specificity, and can generate different effects on regulating the development of the horn fruit in different periods, and the phenotype of the mature period is difficult to accurately reflect the states of the horn peel and the early stage of the seed. Production practices also indicate that even though the mature stage has a longer final length of the silique, the slow growing silique does not necessarily produce higher seed yields. Thus, a silique with a longer final length in maturity does not necessarily result in higher seed yield, but a material that can be built up faster into the silique morphology (faster rate of silique elongation) may have a certain contribution to yield. However, many researches on rape pod fruits in the prior art are generally based on the final pod fruit length in the mature period, so that research on dynamic elongation of cabbage type rape pod fruits, excavation and utilization of related candidate genes are particularly important for improving rape yield.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a gene for controlling dynamic elongation of brassica napus and application thereof. The gene has the function of controlling dynamic elongation of brassica napus pod, and can be used for improving pod character and increasing rape yield.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

provides a gene for controlling dynamic elongation of brassica napus, which comprises a gene BnaA02g12010D, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1.

The protein encoded by the gene BnaA02g12010D comprises a sequence shown in SEQ ID NO:2, and amino acid sequences in which one or more amino acids are substituted, deleted and/or added, and which express the same functional protein.

The invention also provides an expression vector containing the gene for controlling dynamic elongation of brassica napus.

The invention also provides a host cell, preferably, the host cell is an E.coli cell or an Agrobacterium cell.

The invention also provides application of the gene for controlling dynamic elongation of brassica napus pod, which is used for improving pod properties and increasing rape yield.

The beneficial effects of the invention are as follows:

the invention uses the cloning of the BnaA02g12010D gene of the brassica napus and adopts the vector to convert the brassica napus into the gene over-expression strain, and compared with the contrast, the gene over-expression strain shows early bolting and flowering time, faster growth and development and faster elongation rate of the brassica napus, thereby being capable of being used for breeding high-yield and stable-yield brassica napus.

Drawings

FIG. 1 is a schematic diagram showing the results of the gene amplification test of example 3;

FIG. 2 is a schematic diagram of the result of electrophoresis detection of bacterial liquid products in example 4;

FIG. 3 is a qRT-PCR assay comparison histogram of the transgenic line of example 5;

FIG. 4 is a comparative plot of the phenotype of the transgenic line plants of example 6;

FIG. 5 is a comparison of the phenotype of the transgenic strain of example 7;

FIG. 6 is a graph showing comparison of the yield traits of the transgenic strain of example 7;

FIG. 7 is a graph showing the results of transcriptome sequencing of the transgenic lines of example 8;

FIG. 8 is a comparative histogram of the keratan content of the transgenic line of example 8;

FIG. 9 is a diagram showing cell morphology detection of the pericarp of the transgenic strain of example 8.

Detailed Description

The following description of the embodiments of the present invention is provided to facilitate understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and all the inventions which make use of the inventive concept are protected by the spirit and scope of the present invention as defined and defined in the appended claims to those skilled in the art.

EXAMPLE 1 Whole genome correlation analysis

588 rape lines collected from the world were grown in Chongqing North medium (29℃45'N north latitude, 106℃22' E east longitude, 238.6 m). All field trials followed a random complete block design, 10 plants were planted per row for each material, with a row spacing of 20 cm and a row spacing of 40 cm. During the initial flowering phase, five plants were selected to mark the flowering phase. The whole period of the development of the Horn fruit is divided into three stages, namely 0-10 days, 10-20 days and 20-30 days after the flower development, which are named as A, B and C stages respectively. The Silique Length (SL) was then measured 10, 20 and 30 days after flowers and designated SLA, SLB and SLC. The dynamic elongation length of the kerb fruit (Silique elongation length, SEL) was calculated using the SLA, SLB-SLA and SLC-SLB formulas, named SELA, SELB and SELC.

588 parts of brassica napus are resequenced to obtain 385691 high-quality SNP markers. By collecting phenotype data of the dynamic elongation length (SELA and SELB) of the group material, and using TASSEL software to conduct GWAS analysis under a k+ PCA model; the threshold value of the screening association site is 1/n (n is the number of SNP markers used by GWAS, 385691 in this embodiment); finally, 9 SNPs which are distributed on 5 chromosomes and are related to the dynamic elongation of the synthons are identified. And finally, visualizing the Manhattan diagram manufactured by the GWAS result under the optimal analysis model by using the Haploview.

Example 2 dynamic elongation Property of Horn fruit extreme material transcriptome analysis

Based on the years of field phenotype data of 588 parts of natural population materials, a pair of fruit dynamic development extreme materials (Y5: fruit dynamic elongation faster material; Y8: fruit dynamic elongation slower material) are selected for transcriptome analysis. Material Y5 reaches the final cone length (SL) faster than Y8, while Y8 and Y5 eventually have similar SL (eliminating interference from genes controlling SL). Y5 is extended by 3.3 and 2.5 cm in phase A and B respectively, but Y8 is extended by only 2.5 and 1.8 cm respectively. Overall, Y5 completed 52.1% and 40.1% of the pod length within the a (0-10 days after flowers) and B (10-20 days after flowers), respectively, 13% and 10% faster than Y8.

Total RNA was extracted from 10SP (10-day pericarp after flowers) and 20SP (20-day pericarp after flowers) of the extreme materials Y8 and Y5, including 4 independent samples and a total of 12 libraries (three biological replicates per sample), and sent to beijing norelsen company for transcriptome sequencing. Transcriptome analysis is carried out by using cleardata obtained after quality control filtration of norelgen company, clearreads are compared to Darmor-bzh rape genome by using comparison software HISAT, then FPKM value is calculated by HTseq quantitative analysis to compare the expression level of different genes, and the differential expression genes among different samples are analyzed and screened by using a DESeq2 gene screening method according to the standard that the difference multiple is more than or equal to 2 and the Q-value is less than or equal to 0.05. It was found that 3015 and 4152 differentially expressed genes were identified between materials Y8 and Y5 in 10SP and 20SP, respectively. The results of GO enrichment analysis of these differentially expressed genes showed that most are enriched in phytohormone signaling, carbon metabolism, amino acid biosynthesis, starch and sucrose metabolic pathways.

A total of 4 candidate genes which can control dynamic elongation of brassica napus pod were obtained using GWAS in combination with RNA-Seq analysis, including: bnaA02g10900D, bnaA02g11100D, bnaA02g11440D and BnaA02g12010D. But only BnaA02g12010D showed significant spatiotemporal expression specificity in 53 ZS11 tissues: expression in leaves and pericarps is extremely higher than in root, flower organs and seed tissues.

EXAMPLE 3 cloning of BnaA02g12010D Gene

cDNA of tissue parts such as flowers, stems, leaves, pericarps and seeds of YC24 materials are mixed to be used as a cloning template; YC24 is a high-yield material selected from 320 parts of cabbage type rape natural colony materials planted in Chongqing and Yunnan by southwest university in 2012-2013 and 2013-2014.

Designing a cloning primer OE-12010-F/R, wherein the sequence of an upstream primer OE-12010-F is CACCATGGCTGCTTCCTCCTCCTCCTTC, and the sequence of a downstream primer OE-12010-R is GAGAGTGTTCCTCAAGAACTGTACAACAAAGT; PCR amplification of the cloned templates was performed, PCR amplification system (50. Mu.L): cDNA template 2. Mu.L, upstream and downstream primers 1. Mu.L, 5X FastPfu Fly Buffer. Mu.L, 2.5mM dNTPs 4. Mu.L, transStart FastPfu DNA polymerase 1. Mu.L, ddH ₂ O31. Mu.L. The PCR amplification procedure was: pre-denaturation at 95℃for 2min; denaturation at 95℃for 20s, annealing at 56℃for 20s, extension at 72℃for 4kb/min for 35 cycles; extending for 5min at 72 ℃.

The amplified products were detected by electrophoresis using 1% agarose gel, the detection results are shown in FIG. 1, and the electrophoresis detection of the target gene obtained was free from bands.

EXAMPLE 4 construction and transformation of Gene expression vectors

The amplification product of example 3 was ligated to entry vector pENTR/D-TOPO, transferred into E.coli, and then PCR-identified using M13F/R primer and full-size gold EasyTaq PCR SuperMix, wherein the sequence of the upstream primer M13F was GTAAAACGACGGCCAG; the sequence of the downstream primer M13R is CAGGAAACAGCTATGAC.

PCR amplification System (25. Mu.L): 2. Mu.L of amplified product, 0.5. Mu.L of each of the upstream and downstream primers, 2X EasyTaq PCR SuperMix 12.5.12.5. Mu.L, ddH ₂ O9.5. Mu.L. The PCR amplification procedure was: pre-denaturation at 94℃for 10min; denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 1kb/min for 35 cycles; extending for 10min at 72 ℃.

And (3) carrying out electrophoresis detection on the bacterial liquid product after PCR amplification, wherein the detection result is shown in figure 2, and the PCR detection of the target gene is free from impurity bands as shown in figure 2. The gene sequence is shown in SEQ ID NO: 1.

The bacterial liquid with correct sequencing is cultured to proper concentration overnight, and proper amount is stored at-80 ℃, then the Plasmid of the vector is extracted into the door by using a root Mini Plasmid Kit, and finally the concentration is measured and stored at-20 ℃ for standby.

The entry vector plasmid and the expression vector pEarley Gate 101 are connected by using a Gateway LR Clonase II Enzyme Mix kit, then the recombinant expression vector is transformed into GV3101 agrobacterium competent cells according to the agrobacterium transformation flow, the resuscitated bacterial liquid is centrifuged and the redundant supernatant is discarded, and the residual bacterial body is resuspended and then coated on a YEB plate culture medium (containing kanamycin, kan; rifampin, raf; streptomycin, str) for culture until a proper colony is formed.

Example 5 transformation of Brassica napus and identification of positive homozygous lines

Cabbage type rape was transformed by the Wuhan Bo far Biotechnology Co.Ltd using the expression vector plasmid of example 4, the transformation acceptor was medium double 11 (ZS 11).

PCR identification was performed on transgenic seedlings after transformation using three pairs of Bar-F/R, F35S3ND/Gene-R, gene-F/RPA3ND primers. And (3) carrying out qRT-PCR verification on positive rape, finally selecting transgenic rape with remarkably different expression quantity, continuously planting, and harvesting selfed seeds according to a single plant until positive homozygous transgenic lines are obtained in the T3 generation, wherein the transgenic lines are named as OE#1, OE#2 and OE#3 respectively.

The qRT-PCR detection results of the three selected homozygous lines and ZS11 are shown in FIG. 3, and the expression level of BnaA02g12010D in the three transgenic lines is obviously increased relative to ZS11 and reaches 7.1 times, 6.8 times and 9 times respectively.

Example 6 detection of yield-related traits in transgenic lines

The morphology of each line of rape was photographed at the seedling stage, the flowering stage and the maturing stage, respectively, to obtain plant phenotype comparison charts as shown in fig. 4a to 4 c. As can be seen from fig. 4a-4c, the three transgenic lines grew more than ZS11. In the mature period, 5 rapes with normal growth vigor are respectively selected from ZS11 and three transgenic lines for property investigation, wherein the property investigation comprises the following steps: plant height, main inflorescence length, main inflorescence angular fruit number, branch number, single plant angular fruit number and seed yield. Wherein, the plant height is the height between the highest position of the main inflorescence of the rape and the ground; the length of the main inflorescence is the length between the highest part of the main inflorescence of the rape and the first branch from top to bottom; the number of the horned fruits of the main inflorescence is the number of the horned fruits containing seeds on the main inflorescence; the branch number is the branch number of growing effective fruits; the number of the single plant horns is the effective number of the whole plant; the seed yield is the weight of all seeds of the single rape after sun drying.

The trait data of rape are shown in FIG. 4, and in FIG. 4, 4d-4i are comparative bar graphs of plant height (4 d), main inflorescence length (4 e), main inflorescence pod number (4 f), branch number (4 g), single plant pod number (4 h) and seed yield (4 i) in sequence.

As can be seen from fig. 4d-4g, the three transgenic lines were significantly improved in plant height, main inflorescence length and main inflorescence silique number compared to ZS11. The plant height of the control ZS11 was only 170.2 cm on average, whereas the three overexpressing lines were 185.2, 183.2 and 187 cm, respectively, with very significant differences. Furthermore, the major inflorescence length of the three over-expressed lines increased by 9.8% over ZS11, which resulted in a significant difference in the quantitative trait of major inflorescence cones. However, there was no difference in the number of branches between the overexpressing strain and ZS11.

As can be seen from fig. 4h, the number of single pod of ZS11 was on average 394, and the three overexpressing lines were 452, 459.2 and 471.2, respectively, among the three factors affecting the yield of oilseed rape, but the differences did not reach significance. As can be seen from FIG. 4i, the over-expressed lines eventually harvested 34.9g, 35.2g and 35.6g of seed yield, respectively, above 29.5g of control. It was shown that over-expression of BnaA02g12010D increased the individual seed yield by 19.2%.

Example 7 determination of dynamic elongation Length of Kernel of transgenic Strain and detection of Kernel-related Properties

And 5 rapes with orderly and consistent growth vigor are respectively selected from control and over-expression strains in the flowering period, and the flowering period is marked on a main inflorescence by using knitting wool. The length of 3-4 normally growing fruits around each marker was measured 10d, 20d, 30d, 40d after flowering, respectively. The measurement results are shown in fig. 5, wherein fig. 5a is a real-time comparison chart of the fruit length; FIG. 5b is a dynamic elongation length vs. histogram of the silique; FIG. 5c is a final length vs. histogram of the siliques; fig. 5d is a corner fruit volume contrast histogram.

As can be seen from fig. 5a-5d, the average elongation of the three over-expressed strain carob fruits was 7.5cm at the 0-10 day post-flowers stage, with significant differences compared to ZS11 of 5.5 cm; at the stage of 10-20 days after flowers, the elongation length of the cones of the ZS11 and the over-expressed strains is 2.2 cm and 3.7cm respectively; in contrast, the horn of ZS11 exhibited longer elongation than the overexpressing strain during 20-40 days after flowers. Correspondingly, the over-expressed strain completed 66.5% of the pod length 0-10 days after flowers, significantly higher than ZS11 (58%). The elongation rate of the horn at 32.3% of the overexpressing strain was also higher than 23.8% of ZS11 during 10-20 days after flowers. The difference in dynamic elongation of the siliques resulted in the final length of the siliques of the over-expressed lines (average 11.4 cm) being 20% longer than ZS11 (9.4 cm). Furthermore, the horn volume of the over-expressed strain was increased by 40% over the control. From this, it is clear that the elongation rate of the fruits of the over-expressed strain is significantly faster than ZS11, i.e. the elongation of the fruits of the transgenic strain is greater for 0-10 days and 10-20 days after flowers, the fruits form faster, and the photosynthetic area increases faster.

When the plant is mature, respectively counting the related yield traits of the fruits of each plant line, including SPS (SPS) of the fruit grain number per corner and TSW (TSW); the statistical result is shown in fig. 6, wherein fig. 6a is a fruit grain real-shot comparison chart, fig. 6b is a fruit grain number per corner comparison histogram, and fig. 6c is a thousand grain weight character comparison histogram; the number of the seeds of each corner is the average value of the number of seeds of each corner of 10 normal development corner fruits on the main inflorescence; thousand kernel weight trait is the weight of 1000 seeds of 10 normally developing cones on the main inflorescence.

As can be seen from fig. 6a-6c, the number of fruit pieces per corner and thousand kernel weight traits of the three transgenic lines were all improved relative to ZS 11: the overexpressing lines possessed 27, 26.2 and 26.5 seeds per pod, respectively, whereas ZS11 contained only 24.4. Furthermore, the transgenic lines were 15% higher in thousand kernel weight than the control ZS11.

In conclusion, the transgenic rape with the BnaA02g12010D gene over-expressed has faster pod elongation rate than ZS11, and the BnaA02g12010D can further regulate and control two pod-related traits (SPS and TSW) affecting the yield of the rape by regulating pod elongation.

Example 8 transcriptome sequencing and physicochemical and cytological detection of transgenic lines of Horn fruit

The differential expression genes in 10 days horn fruits after the flowers of the over-expression ZS11 material (typical silique, high-yield material planted in large areas in China) are compared by adopting transcriptome sequencing analysis, and the detection result is shown in figure 7. As can be seen from FIG. 7a, 2585 differentially expressed genes were identified in total; as can be seen from FIG. 7b, most of the genes (10.19%) were enriched in the phytohormone signaling pathway (ko 04075) in the KEGG enrichment assay. Furthermore, as can be seen from fig. 7c, most of the differentially expressed genes were enriched in GO enrichment analysis for jasmonic-mediated signaling pathways in biological processes (GO 2000022). As can be seen from fig. 7d, many negative regulatory factors of the jasmonic acid signaling pathway (including bnac01.Jaz3, bnac02. Jaz6, bnac 0.jaz6, bnac06.jaz6, bnac 07.jaz9, bnac02.jaz9, and bnac 10.jaz 10) have significantly higher expression levels in the over-expressed lines. On the other hand, it is widely believed that auxin plays an important role in promoting pod length by increasing the cell size of canola. In particular, the former reports that a gene BnaA09.ARF18 related to an auxin signal pathway can control the length of the fruits by participating in regulating the content of auxin and further affecting the elongation of cells. In this example, it can be seen from FIG. 7e that the homologous gene BnaC04.ARF in the C04 chromosome is significantly down-regulated in BnaA02g12010D over-expressed strain.

In order to detect whether the genes of the JA and IAA signal paths are involved in regulating the JA and IAA contents, the contents of ZS11 and two hormones of the over-expressed strain Hordeum vulgare (IAA) and Jasmonic Acid (JA) are measured, and the specific steps are as follows:

respectively taking ZS11 and the horn fruits of 5d after the overexpression lines are bloomed, selecting single plants which are consistent in growth vigor and have no diseases, mixing and sampling, respectively grinding the horn fruits into powder in liquid nitrogen, and weighing a proper amount of samples in a glass test tube; the following steps are respectively and sequentially carried out: adding isopropanol-water-hydrochloric acid mixed extract; adding 8 mu L of internal standard solution, and oscillating for 30min at low temperature; adding dichloromethane, and oscillating for 30min at low temperature; centrifuging at 13000r/min for 5min at 4deg.C, and collecting the lower organic phase; blow-drying the organic phase with nitrogen under the condition of avoiding light, and then re-dissolving with methanol (0.1% formic acid); centrifuging at 4deg.C for 10min, collecting supernatant, filtering with 0.22 μm filter membrane, and detecting by liquid chromatography-tandem mass spectrometry. The whole process is carried out on ice.

The results of the test are shown in FIG. 8, wherein FIG. 8a is a graph of Jasmonic Acid (JA) relative expression level versus histogram, and FIG. b is a graph of auxin (IAA) relative expression level versus histogram, and as can be seen from FIG. 8, the JA content in the over-expressed strain is lower than ZS11, but the IAA content is higher than ZS11.

To investigate whether changes in hormone content affect the cell morphology of the pericarp, we performed dynamic cytological observations of the pericarp 10, 20 and 30 days after flowers of the over-expressed strain and ZS11 material: the pericarp was peeled off with forceps, and the pericarp tissue of appropriate size was cut off with scissors in the middle, placed on a stage to which a conductive adhesive was attached, and observed with a HITACHISEMSU3500 scanning electron microscope. The temperature of the cold stage is set to be minus 20 ℃, the voltage is set to be 3.0-5.0kV according to the state of the sample, and the cells on the surface of the pericarp are observed under the magnification of 300 x.

The detection result is shown in FIG. 9, wherein FIG. 9a shows the pericarpCell-live comparison; FIG. 9b is a cell number comparison histogram; fig. 9c is a comparison histogram of cell size, and as can be seen from fig. 9a-9b, the over-expressed strain had 102.4 and 28.2 cell numbers 10 days and 20 days after flower, respectively, whereas ZS11 contained only 87.4 and 20.6 cells, respectively. As can be seen from FIG. 9c, the cell sizes of ZS11 (1779.2 and 4326um in 10 and 20 days after flowers, respectively) ² ) Significantly greater than the overexpressing strain (994 and 3120um ² ) However, in the 30-day-old pericarp after flowers, the cell size of the over-expressed strain was 7742um ² 4406um greater than ZS11 ² . Therefore, it is presumed that BnaA02g12010D might promote cell proliferation by affecting JA content in the early stage, thereby affecting elongation of cells in the pericarp, whereas auxin plays an important role in promoting cell enlargement in the later stage.

Taken together, the over-expressed strain of BnaA02g12010D showed a faster elongation rate with significantly longer pod lengths than ZS11 after flowering, 10D, 20D, 30D and 40D; the analysis of the expression pattern shows that the expression quantity of BnaA02g12010D in the cornel is obviously higher than that of other parts, and the scanning electron microscope observation and hormone content detection of the cornel in each period show that the rapid elongation of the cornel of the over-expression BnaA02g12010D strain mainly influences the early cell number and the later cell size by regulating and controlling the contents of JA and IAA. It is shown that the gene can promote division and enlargement of rape pod skin cells at the same time, and finally, the pod elongation rate is accelerated. The formation of rape seed yield mainly comes from photosynthesis of the corncob peel, and the development of the seeds is closely related to the development of the corncob peel, so that the rapid development of the corncob peel can further influence the development of the seeds and the formation of the yield. Investigation of the character of transgenic rape pod with over-expression BnaA02g12010D shows that the seed number and thousand kernel weight of each pod of the transgenic strain are improved relative to ZS11.

The result of the property investigation of the transgenic plant in the mature period shows that although the difference in branch number does not reach the difference significance, the transgenic plant has significant improvement in plant height, main inflorescence length and main inflorescence angular fruit number compared with ZS11, which proves that BnaA02g12010D has the function of mainly regulating and controlling the dynamic elongation of the angular fruit and can promote the overall growth and development of the plant.

Claims (6)

1. A gene for controlling dynamic elongation of brassica napus, which is characterized by comprising a gene BnaA02g12010D, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1.

2. A protein encoded by the gene BnaA02g12010D of claim 1, comprising the sequence set forth in SEQ ID NO:2, and amino acid sequences in which one or more amino acids are substituted, deleted and/or added, and which express the same functional protein.

3. An expression vector comprising the gene of claim 1.

4.A host cell comprising the expression vector of claim 3.

5. The host cell of claim 4, wherein the host cell is an E.coli cell or an Agrobacterium cell.

6. Use of a gene according to claim 1 for controlling dynamic elongation of brassica napus in improving the properties of the brassica napus and increasing the yield of brassica napus.