CN117431175B

CN117431175B - Aquatic Lei Fusen bacterium ST172 and application thereof

Info

Publication number: CN117431175B
Application number: CN202311289241.8A
Authority: CN
Inventors: 田梦青; 陈才锭; 余忠臣; 滕林琳; 尚轶
Original assignee: Yunnan Normal University
Current assignee: Yunnan Normal University
Priority date: 2023-10-08
Filing date: 2023-10-08
Publication date: 2024-05-24
Anticipated expiration: 2043-10-08
Also published as: CN117431175A

Abstract

The application discloses aquatic Lei Fusen bacteria and application thereof. The aquatic Lei Fusen bacterium (Leifsonia aquatica) ST172 has a collection number of CGMCC No.27683, can obviously inhibit the growth of phytophthora infestans and/or Alternaria solani hyphae, has high-efficiency prevention and inhibition effects on early blight and late blight of solanaceae plants, and has good application prospects.

Description

Aquatic Lei Fusen bacterium ST172 and application thereof

Technical Field

The application relates to the technical field of microbiology, in particular to aquatic Lei Fusen bacteria ST172 and application thereof.

Background

The potato is rich in nutrition and strong in adaptability, is an important grain and vegetable dual-purpose crop, and is widely planted worldwide. In Chinese agricultural production, the importance of the planting and processing industries of potatoes is increasing. However, due to the topography, soil, climate, management technology and the like, the potato cultivation and growth process is threatened by non-invasive diseases and invasive diseases. Early and late blight are two major fungal diseases that threaten potato yield and quality, and once infected, will cause significant economic losses.

Late blight is caused by phytophthora infestans (P.infestans), and is a first major disease of potatoes, tomatoes, eggplants and other solanaceae plants, and the disease is seriously harmful to potato stems, leaves and tubers, so that the potato stems, the potato tubers and the tubers are rotted. The disease spreads very rapidly in the field, and when proper disease conditions are reached, whole field plants die within a week. In China, it occurs in continuous rainy weather and in years of wet weather. After the stems and the petioles of the potatoes are infected, purple brown lesions appear on the surfaces of the leaves when the potatoes start to attack, the tubers are brown, and the brown lesions gradually spread along with the disease development, so that the whole tubers or petioles are finally rotten, and the planting yield and quality of the potatoes are seriously reduced.

Early blight is a worldwide fungal disease caused by alternaria solani (a. Solani) and can cause infestation of crops such as solanaceae and sinapis. The disease mainly damages the leaves and tubers of potatoes, round or nearly round black brown disease spots are formed after the leaves are infected, and when serious, the leaves are dried up and fall off, and plants are withered and yellow. After the tuber is infected, a dark slightly concave circular or nearly circular disease spot is generated, and the tuber is dried and decayed in a light brown sponge shape under the skin. This disease occurs in potato producing areas in china and around the world, and is a second largest potato disease that is considered to be secondary to late blight, with significant production impact, no harm being inferior to late blight.

The aquatic Lei Fusen bacteria (l.aquatica) is an irregular gram-positive bacillus belonging to the genus Leifsonia. Leifsonia bacteria can degrade various organic matters, mercury and other harmful substances. Aquatic Lei Fusen bacteria have been reported to degrade detergents such as fatty-alkyl sulfates, alkyl ethoxy sulfates and linear-alkylbenzene sulfonates, and literature reports that aquatic Lei Fusen bacteria can be used to produce alcohol dehydrogenases (LsADH). However, there has been no report on the inhibition of pathogenic fungi by Leifsonia bacteria, particularly on biological control of late blight and early blight.

At present, the prevention and treatment of potato early blight and late blight mainly adopts the selection and breeding of resistant varieties and the use of chemical pesticides. In recent years, the selection of disease-resistant varieties to phytophthora infestans resistance variation causes the loss of resistance of the resistant varieties, the breeding period of new resistant varieties is longer, and the excessive use of chemical pesticides represented by cymoxanil and manganese zinc causes the problems of environmental pollution, damage of soil structure and functions, human health and the like. With the promotion of green agriculture, biological control is gradually becoming the first choice in crop pest control. However, due to the high variability in biological characteristics, availability and durability of the biocontrol agents, and the problems of product registration, commercial biocontrol agents are very few and biocontrol agents for controlling late blight are more scarce, so it is important to screen new microorganisms capable of inhibiting pathogenic bacteria and reasonably optimize the screened strains.

Disclosure of Invention

In order to solve the technical problems, the application firstly provides the aquatic Lei Fusen bacteria (Leifsonia aquatica) ST172 with a preservation number of CGMCC No.27683.

The application also provides a biological agent comprising the above-described aquatic Lei Fusen bacteria, a bacterial suspension of the aquatic Lei Fusen bacteria, a metabolite of the aquatic Lei Fusen bacteria, a fermentation broth of the aquatic Lei Fusen bacteria, a filtrate of a cell culture of the aquatic Lei Fusen bacteria, and/or one or more mixtures thereof.

In some embodiments, the above-described biological agents further comprise a carrier, which is a solid carrier and/or a liquid carrier.

In some embodiments, the solid support is a mineral material, a plant material, or a polymeric compound; the mineral material may be at least one of clay, talc kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the plant material can be at least one of corn flour, bean flour and starch; the polymer compound may be polyvinyl alcohol and/or polyglycol; the liquid carrier may be an organic solvent or water; the organic solvent may be decane and/or dodecane.

In some embodiments, the organic solvent is a liquid alkane, vegetable oil, or mineral oil.

In some embodiments, the liquid alkane is decane and/or dodecane.

In some embodiments, the above-described biological formulation further comprises at least one of a surfactant, a binder, a stabilizer, and a pH adjuster, the surfactant may be tween 20, tween 80, or the like.

In some embodiments, the biological agent may be in a variety of dosage forms, such as a liquid, emulsion, suspension, powder, granule, or water dispersible granule.

In some embodiments, the powder is a wettable powder.

The aquatic Lei Fusen bacteria or biological agent of the present application has any one of the following applications 1) to 6):

1) Use of aquatic Lei Fusen bacteria or biological agents for inhibiting phytophthora infestans and/or alternaria solani;

2) The application of aquatic Lei Fusen bacteria or biological agent in preparing phytophthora infestans and/or alternaria solani inhibitor;

3) Use of aquatic Lei Fusen bacteria or biological agent for preventing early blight and/or late blight of Solanaceae plants;

4) Use of aquatic Lei Fusen bacteria or biological agent for inhibiting early blight and/or late blight of Solanaceae plants;

5) The aquatic Lei Fusen bacteria or biological agent is used for preparing the preventive agent for early blight and/or late blight of Solanaceae plants.

6) The use of aquatic Lei Fusen bacteria or biological agent in preparing early blight and/or late blight inhibitor for Solanaceae plants is provided.

In some embodiments, the plant of the family Solanaceae is a plant of the genus Solanum of the family Solanaceae.

In some embodiments, the plant of the family solanaceae is a potato.

The application also provides a method of preventing or inhibiting potato early blight and/or late blight,

The biological agent of the application may be a microbial agent and the metabolite may be an active metabolite.

The application has the following technical effects:

1. The aquatic Lei Fusen strain ST172 can effectively inhibit late blight and early blight germs. The result of the opposite experiment on the in vitro culture medium shows that the aquatic Lei Fusen strain ST172 has strong growth inhibition effect on two pathogenic bacteria at the same time.

2. The aquatic Lei Fusen strain ST172 can effectively prevent and treat plant diseases caused by late blight and/or early blight bacteria, and the incidence rate of the in-vitro leaf early blight and/or late blight of potatoes can be greatly reduced by spraying the strain ST172 bacterial liquid.

3. In order to further verify the effect of the strain aquatic Lei Fusen strain ST172 in inhibiting plant diseases caused by potato late blight and/or early blight bacteria, ST172 bacterial liquid is respectively dripped before and after potato block inoculation of two pathogenic bacteria, and the result shows that the strain ST172 has remarkable effects on prevention and treatment of diseases caused by the late blight and the early blight bacteria.

Preservation description

Strain name: aquatic Lei Fusen bacteria

Latin name: leifsonia aquatica A

Strain number: ST172

Preservation unit name: china general microbiological culture Collection center (China Committee for culture Collection of microorganisms)

The preservation unit is abbreviated as: CGMCC

Deposit unit address: beijing, chaoyang district North Star West way 1,3, national academy of sciences institute of microorganisms, postal code 100101

Preservation date: 2023, 6 and 21 days

Deposit number: CGMCC No.27683.

Drawings

The accompanying drawings are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate the application and together with the embodiments of the application, serve to explain the application.

FIG. 1 shows the growth and colony morphology of aquatic Lei Fusen strain ST172

FIG. 2 is a comparative graph showing the experiment of the aquatic Lei Fusen strain ST172 against late blight and early blight bacteria

FIG. 3 shows the effect of aquatic Lei Fusen strain ST172 on the inhibition of leaf disease caused by late blight and early blight bacteria

FIG. 4 shows the effect of aquatic Lei Fusen strain ST172 on inhibiting potato block disease caused by late blight and early blight bacteria

Detailed Description

The following description of the embodiments of the present application will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present application, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The media used in the examples below were as follows:

TSA medium: 15g of tryptone, 5.0g of soybean peptone, 5.0g of NaCl,15g of agar powder, pH value of 7.0-7.2, 1000mL of distilled water and sterilization at 121 ℃ for 20min.

LB medium: 10g of tryptone, 5.0g of yeast powder, 5.0g of NaC1, 15g of agar powder, pH value of 7.0-7.2, 1000mL of distilled water and sterilization at 121 ℃ for 20min.

PDA medium: 200g of potato, 20g of glucose, 20g of agar, pH value of 7.0-7.2, 1000mL of distilled water and heat sterilization at 121 ℃ for 20min.

Example 1 separation and identification of aquatic Lei Fusen Strain (Leifsonia aquatica) ST172, accession number CGMCC No.27683

1. Isolation of aquatic Lei Fusen Strain ST172

Collecting potato root systems in a potato planting area of Yunnan Da Yao Xian, obtaining single bacterial colonies of each strain by adopting a gradient dilution plating method, preserving glycerol, carrying out molecular biological identification, and screening to obtain aquatic Lei Fusen strain (Leifsonia aquatica) ST172 with a preservation number of CGMCC No.27683.

2. Identification of aquatic Lei Fusen Strain ST172

(1) Morphological identification

The aquatic Lei Fusen strain (Leifsonia aquatica) ST172 thallus is rod-shaped, gram positive bacteria, spore-free, and movable with flagellum around. Colonies formed after 24h on TSA medium were white or pale yellow, rounded, surface protruding, more viscous (FIG. 1).

(2) Molecular characterization

The aquatic Lei Fusen strain (Leifsonia aquatica) ST172 is activated by using a TSA solid culture medium, strain cells are picked from colonies, shake-cultured for 24 hours in a TSB culture solution, and genomic DNA is extracted from the strain cells and is collected and used as a template for PCR reaction. The 16S rDNA universal primer 8F/1492R is used as an amplification primer, wherein 8F: agagttttgatcctggcttag; 1492R: ggttacttgttacgactt.

The amplified product was subjected to agarose gel electrophoresis to obtain a 1393bp DNA fragment, which was sequenced and aligned to known related sequences in the database by BLAST on NCBI website. The comparison result shows that the strain and Leifsonia aquatica DSM 2014 (NR 119082.1) are the same species, so that the ST172 strain provided by the invention can be identified as the aquatic Lei Fusen strain (Leifsonia aquatica).

Example 2 bacteriostatic ability test of aquatic Lei Fusen Strain ST172

The overnight activated strain ST172 was inoculated into a liquid TSB medium and cultured at 30℃and 220rpm for 3 days to give a suspension of ST172 strain. Activating late epidemic bacteria and early epidemic bacteria by using a PDA flat plate, obtaining activated late epidemic bacteria cake and early epidemic bacteria cake by using a puncher with the diameter of 7mm, placing bacterial cake hypha downwards in the center of a new PDA flat plate, dripping 10 mu L of suspension of ST172 strain at a position 2cm away from the pathogenic bacteria cake, dripping equal volume of empty TSB for culture in a blank control, and observing the growth condition of pathogenic bacteria. At least three replicates were set for each test. And when the pathogenic fungi mycelium of the control group grows to be close to the edge of the flat plate, measuring the colony diameter of the pathogenic fungi, and calculating the bacteriostasis rate. Wherein, the antibacterial ratio = [ (control fungus growth diameter-treated fungus diameter)/control fungus growth diameter ] ×100%.

TABLE 1 counter experiments of aquatic Lei Fusen Strain ST172 against early blight bacteria (A. Solani) and late blight bacteria (P. Infestans)

Experimental results: as shown in Table 1 and FIG. 2, the experiment results show that the aquatic Lei Fusen strain ST172 has three times of counter experiments with the early blight bacteria, and the result shows that the aquatic Lei Fusen strain ST172 has obvious inhibition effect on the early blight bacteria, the maximum inhibition rate is 27.67%, and the relative inhibition rate is 24.18%; as a result of carrying out three times of counter experiments on the aquatic Lei Fusen strain ST172 and the late blight bacteria, the aquatic Lei Fusen strain ST172 has obvious inhibition effect on the late blight bacteria, the maximum inhibition rate is 54.53%, and the relative inhibition rate is more than 55%.

Therefore, the aquatic Lei Fusen strain ST172 has obvious antagonism to both the early epidemic disease bacteria and the late epidemic disease bacteria, and can be used as a biocontrol strain.

Example 3 inhibition of aquatic Lei Fusen Strain ST172 against leaf diseases caused by late blight and early blight

The experimental method comprises the following steps: a suspension of strain ST172 was prepared in accordance with the method of example 2. Inoculating late epidemic bacteria and early epidemic bacteria on PDA culture medium, culturing at 25deg.C for 15-25 days, and washing with deionized water to obtain late epidemic original fungus spore suspension and early epidemic original fungus spore suspension. Taking potato leaves with the similar leaf ages, sterilizing the surfaces of the potato leaves with 1% sodium hypochlorite, washing the potato leaves with deionized water, putting the potato leaves into a culture dish of sterilized and moistened absorbent cotton, spraying a bacterial strain ST172 suspension on the surfaces of a treatment group, respectively spraying a blank culture medium and cymoxanil-manganese-zinc with the same volumes on the surfaces of a negative control group and a positive control group, carrying out dark culture at 18 ℃ for 24 hours, respectively dripping 20 mu L of potato late blight and early blight original fungus spore suspension, continuously culturing at 18 ℃ for 7 days, and then observing and recording the disease spot area and the disease incidence grade of the potato leaves, wherein the leaf disease classification standard reference (potato germplasm resource late blight resistance identification and evaluation (roqueen, black dragon river agricultural science, 2012, (12): 11-14)) is as follows:

stage 1: the isolated leaves have no disease spots or sporadic allergic necrotic spots, and the disease spot area is less than 3%;

2 stages: the isolated leaf has a small amount of disease spots, and the area of the disease spots accounts for 3-10% of the area of the leaf;

3 stages: the isolated leaves form moderate lesions, accounting for 10 to 30 percent of the leaf area;

4 stages: the periphery of the disease spots is provided with a chlorosis halo, and more disease spots are visible on the leaves of the visible white mycelium, and the area of the disease spots accounts for 30% -60% of the area of the leaves;

5 stages: the diseased part has obvious white mycelium, the leaves of the isolated body can see a large number of disease spots, the area ratio of the disease spots is more than 60 percent, and the diseased part can see a large number of white mold-shaped objects and is seriously decayed.

The results of the experiments are shown in Table 2 and FIG. 3, after 7 days of inoculation of pathogenic fungi, the diseases caused by early epidemic and late epidemic pathogens on leaves in the negative control group reach 3 grade and 5 grade respectively, the disease grade in the treatment group sprayed with the strain ST172 is 1 grade, and the prevention and treatment effects of the strain ST172 on the leaf diseases caused by the early epidemic and the late epidemic pathogens are superior to that of pesticide cymoxanil-manganese-zinc according to the area of the disease spots.

TABLE 2 control of leaf diseases caused by early blight and late blight by strain ST172

Example 4 test method of inhibition effect of aquatic Lei Fusen strain ST172 on potato block diseases caused by late blight bacteria and early blight bacteria:

1. Prevention experiment

A suspension of strain ST172 was prepared and potato tuber slices were prepared according to the method of example 2. Absorbing 100 mu L of suspension of the strain ST172, uniformly smearing the suspension on the surface of tuber slices, respectively inoculating late epidemic bacteria and early epidemic bacteria bacterial cakes (d=5 mm) which are subjected to activating culture for 5-7 d by a PDA culture medium onto the tuber slices, and culturing for 10 days at 18 ℃ to detect the disease prevention effect;

2. Treatment experiment

In addition, fresh potato tuber slices are taken, firstly, late epidemic bacteria and early epidemic bacteria are respectively inoculated, and after 2 days of culture under the dark condition of 20 ℃, 100 mu L of bacterial liquid is added dropwise, and the culture is continued until the 10 th day, and the treatment effect of diseases is detected.

In both treatment experiments and prevention experiments, the same amount of the cymoxanil, the manganese zinc and the TSB are smeared as positive control and negative control respectively. Observing the disease condition of tubers, recording disease indexes, and evaluating the disease control effect of the compound microbial inoculum. Tuber disease classification standard, reference document "identification and evaluation of resistance to potato germplasm resource late blight" (roqueen, etc., heilongjiang agricultural science 2012, (12): 11-14.) is as follows.

Grade 0, no mycelium grows on tubers;

grade 1 mycelium on tubers was visible, no tissue degradation occurred:

2, mycelium covers half of tuber area, and tissue degradation does not occur;

Grade 3 mycelium covered the entire tuber with no or slight tissue degradation:

and 4, mycelium covers the whole tuber, and the tissue is seriously degraded.

Disease index = [ Σ (number of disease stages x number of blocks of the disease stage)/(total number of surveys x highest number of disease stages) ] x100

Relative protection = [ (negative control disease index-treated disease index)/negative control disease index ] x100%

Experimental results: as shown in table 3, table 4 and fig. 4, the number of disease stages of all potato blocks in the negative control group reached 4 in the prevention experiment and the treatment experiment 10 days after inoculation of the early blight and the late blight, and compared with the negative control group, the disease index of potato blocks coated with the ST172 bacterial liquid and coated with the chemical pesticide of cymoxanil-manganese-zinc was significantly reduced, the relative protection rates of the ST172 bacterial liquid on the early blight prevention and treatment on the potato blocks were 68.75% and 81.25%, respectively, and the relative protection rates of the treatment on the late blight prevention and treatment on the potato blocks were 75%, respectively. Compared with a positive control group coated with the cymoxanil and the manganese zinc, the potato blocks coated with the ST172 bacterial liquid have lower disease index and higher relative protection rate, and the bacterial liquid of the strain ST172 has obviously better control effect on two diseases than the cymoxanil and the manganese zinc.

TABLE 3 control of potato block diseases by strain ST172 against early blight of potato

TABLE 4 control of potato block diseases by strain ST172 against potato late blight bacteria

Although embodiments of the present application have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the application, the scope of which is defined in the appended claims and their equivalents.

Claims

1. A water Lei Fusen bacterium (Leifsonia aquatica), characterized in that: the aquatic Lei Fusen bacteria is ST172, and the registration number of the aquatic Lei Fusen bacteria in the China general microbiological culture Collection center is CGMCC No.27683.

2. A biologic, characterized in that: a bacterial suspension comprising the aquatic Lei Fusen bacteria of claim 1, the aquatic Lei Fusen bacteria, the aquatic Lei Fusen bacteria fermentation broth, and/or one or more mixtures thereof.

3. The biologic of claim 2, wherein: also comprises a carrier, wherein the carrier is a solid carrier and/or a liquid carrier.

4. A biologic according to claim 3, wherein: the solid carrier is mineral material, plant material or polymer compound; the mineral material is at least one of clay, talcum kaolin, montmorillonite, white carbon, zeolite, silica and diatomite; the plant material is at least one of corn flour, bean flour and starch; the high molecular compound is polyvinyl alcohol and/or polyglycol; the liquid carrier is an organic solvent or water; the organic solvent is decane, dodecane, vegetable oil or mineral oil.

5. The biologic of claim 3 or 4, wherein: also included is at least one of a surfactant, a binder, a stabilizer, and a pH adjuster, the surfactant comprising tween 20 and/or tween 80.

6. The biologic of claim 5, wherein: the preparation forms of the biological agent comprise liquid, emulsion, suspending agent, powder, granule or water dispersible granule.

7. The biologic of claim 6, wherein: the powder is wettable powder.

8. The use of any one of the following 1) -6), characterized in that:

1) Use of the aquatic Lei Fusen bacteria of claim 1 or the biological agent of claim 2 for inhibiting phytophthora infestans and/or alternaria solani;

2) Use of the aquatic Lei Fusen bacteria of claim 1 or the biological agent of claim 2 for the preparation of phytophthora infestans and/or alternaria solani inhibitors;

3) Use of the aquatic Lei Fusen bacterium of claim 1 or the biological agent of claim 2 for preventing early blight and/or late blight of solanaceae plants;

4) Use of the aquatic Lei Fusen bacterium of claim 1 or the biological agent of claim 2 for inhibiting early blight and/or late blight of solanaceae plants;

5) Use of the aquatic Lei Fusen bacterium of claim 1 or the biological agent of claim 2 for the preparation of a prophylactic agent for early blight and/or late blight of solanaceae plants;

6) Use of the aquatic Lei Fusen bacterium of claim 1 or the biological agent of claim 2 for the preparation of an early blight and/or late blight inhibitor for solanaceae plants.

9. The use according to claim 8, wherein: the Solanaceae plant is Solanum plant of Solanaceae.

10. The use according to claim 9, wherein: the Solanaceae plant is potato.