CN117417992A - PCR method for identifying cortex lycii radicis - Google Patents

Abstract

The invention relates to the technical field of traditional Chinese medicine identification, in particular to a PCR method for identifying cortex lycii radicis. The method involves a primer pair comprising a forward primer shown as SEQ ID NO.7 and a reverse primer shown as SEQ ID NO. 8. Compared with the prior art, the beneficial effects of the application include: the specificity detection primer pair can be used for accurately identifying the original lycium barbarum, the Ningxia wolfberry and the common blended lycium ruthenicum, and based on the specificity detection primer pair, a specificity identification method of the original lycium barbarum can be constructed, the difficulty that decoction pieces are difficult to identify in morphology is effectively avoided, identification of the original lycium barbarum, the Ningxia wolfberry and the common blended lycium ruthenicum can be realized under the same amplification condition, and identification efficiency is improved. The primer pair and the method for constructing the primer pair are suitable for adulteration and adulteration identification of plants, medicinal materials and decoction pieces.

Description

PCR method for identifying cortex lycii radicis

Technical Field

The invention relates to the technical field of traditional Chinese medicine identification, in particular to a PCR method for identifying cortex lycii radicis.

Background

Cortex Lycii is specified in the Chinese pharmacopoeia 2020 edition: the product is dried root bark of Lycium chinense Mill or Lycium barbarum L. The root is dug in the early spring or after autumn, cleaned, the root skin is peeled off, and the dried root is dried. Sweet and cold in nature. It enters lung, liver and kidney meridians. Is mainly used for cooling blood, removing steam, clearing lung-heat and reducing fire. It is used for treating hectic fever due to yin deficiency, night sweat due to bone steaming, cough due to lung heat, hemoptysis, epistaxis, internal heat and diabetes, and modern pharmacological research shows that cortex Lycii has effects of relieving fever, lowering blood sugar, lowering blood pressure, and regulating immunity. The appearance and the properties of the root bark medicinal materials are similar, and in the sales process, the cortex lycii radicis is very easy to be mixed with other common root bark medicinal materials, such as common mixed and fake products, namely the dried root bark of the lycium ruthenicum (Lycium ruthenicum Murr.) belonging to the same genus. The materials of the lycium ruthenicum are relatively few, the books of traditional Chinese medicine are freshly mentioned from ancient times, and the traditional Chinese medicine book of Chinese pharmacopoeia does not contain the lycium ruthenicum, and although the anthocyanin in the lycium ruthenicum can remove free radicals according to the description on the network, the materials are not clearly recorded, so that the accurate identification of the cortex lycii radicis and the mixed and counterfeit products thereof is necessary.

At present, chinese patent application CN107523639A describes a SNP specific primer for identifying Ningxia wolfberry and an identification method thereof, the specific primer is designed based on SNP loci of Ningxia wolfberry and wolfberry, and identification of Ningxia wolfberry and wolfberry can be carried out through PCR amplification and electrophoresis detection, but the method does not relate to identification of lycium ruthenicum. In addition, chinese patent application CN106282390a describes a rapid identification method of a Single Nucleotide Polymorphism (SNP) of lycium barbarum and lycium barbarum, by performing PCR amplification and sequencing on a sample, analyzing SNP sites in a sequence, if positions 97 and 173 are C, position 200 is G, identifying as the lycium barbarum, if positions 97 and 173 are T, position 200 is a, identifying as the lycium barbarum, the method requires sequencing and comparison of PCR products, and is time-consuming, cumbersome in process, and does not mention SNP sites of lycium ruthenicum. Because the technical proposal does not relate to the identification of lycium ruthenicum, and the adulterated research literature on the cortex lycii is also rarely reported, a molecular identification method with high accuracy and good specificity and capable of rapidly identifying the cortex lycii radicis and the mixed pseudo products thereof is required to be established for guaranteeing the medication safety and clinical curative effect of the traditional Chinese medicine.

In view of this, the present application is specifically proposed.

Disclosure of Invention

One embodiment of the present application provides a specific primer pair that can be used to accurately detect whether the lycium radium is lycium barbarum or lycium barbarum, and identify whether it contains the usual blend lycium ruthenicum. The primer pair of the embodiment comprises a forward primer shown as SEQ ID NO.7 and a reverse primer shown as SEQ ID NO. 8.

In another embodiment of the present application, a kit is provided comprising a primer pair as described above.

In some embodiments, the kit further comprises one or more of DNA extraction reagents, PCR amplification reagents, and amplification product detection reagents.

In some embodiments, the PCR amplification reagent comprises Mg ²⁺ One or more of dntps, DNA polymerase and PCR buffer.

In some embodiments, the PCR amplification reagent is a PCR premix comprising Mg ²⁺ Dntps, DNA polymerase and PCR buffer.

In some embodiments, the amplification product detection reagent comprises one or more of agarose, electrophoresis buffer, and gel loading buffer.

Still another embodiment of the present application provides a method for identifying cortex Lycii, which includes the following steps:

performing PCR amplification on genomic DNA of a sample to be tested by using the primer pair; the method comprises the steps of,

detecting the obtained amplified product, and judging the type of the sample to be detected according to the obtained detection result.

In some embodiments, the method of detection employs agarose gel electrophoresis.

In some embodiments, determining the type of the sample according to the obtained detection result includes:

if the electrophoresis pattern contains 2 DNA fragment bands at a position of 100bp-150bp, the basic source of the sample to be detected is Ningxia wolfberry;

if the electrophoresis pattern contains 1 DNA fragment band at the position of 100bp-150bp, the basic source of the sample to be detected is medlar;

if the electropherogram contains a 98bp DNA fragment band, the sample to be detected contains lycium ruthenicum.

In some embodiments, the sample to be tested is a fresh traditional Chinese medicine, a medicinal material or a decoction piece.

In some embodiments, the PCR amplification satisfies one or more of the following conditions:

(1) Every 50 mu L of PCR reaction system comprises 24 mu L-26 mu L of PCR premix, 0.5 mu L-0.7 mu L of each of the forward primer and the reverse primer with the primer concentration of 8 mu M-12 mu M and 1.8 mu L-2.2 mu L of the genome DNA with the DNA concentration of 20 ng/mu L-100 ng/mu L; the method comprises the steps of,

(2) The procedure for PCR amplification included: pre-denaturation at 94-96 ℃ for 4-6 min; denaturation at 94-96 ℃ for 20s-40s, annealing at 61-62 ℃ for 20s-40s, extension at 71-73 ℃ for 20s-40s for 33-35 cycles; finally, the extension is carried out for 4min to 5min at the temperature of 71 ℃ to 73 ℃.

Compared with the prior art, the beneficial effects of the application include:

the application provides a specific detection primer pair, which can be used for accurately identifying the original lycium barbarum or the common blended lycium ruthenicum, and can be used for constructing a specific identification method of the original lycium barbarum based on the specific detection primer pair, so that the difficulty that decoction pieces are difficult to identify in morphology is effectively avoided, the identification of the original lycium barbarum, the original lycium barbarum and the common blended lycium ruthenicum can be realized under the same amplification condition, and the identification efficiency is improved. The primer pair and the method for constructing the primer pair are suitable for the adulteration and adulteration identification of fresh traditional Chinese medicines, medicinal materials and decoction pieces.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its advantageous effects, the following brief description will be given with reference to the accompanying drawings, which are required to be used in the description of the embodiments. It is obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained from these drawings without inventive effort to a person skilled in the art.

FIG. 1 is a diagram showing the results of primer screening designed in the present application;

FIG. 2 shows the results of primer verification using Chinese patent application CN 107523639A;

FIG. 3 shows the results of various enzyme assays;

FIG. 4 shows the results of investigation at different temperatures;

FIG. 5 is a suitability examination result;

fig. 6 shows the results of preliminary verification of the mix of the cortex lycii radicis and the mix-imitative product.

Detailed Description

The present invention will be described in further detail with reference to the drawings, embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the invention and are not intended to limit the scope of the invention in order that the present disclosure may be more thorough and complete. It will also be appreciated that the present invention may be embodied in many different forms and is not limited to the embodiments and examples described herein, but may be modified or altered by those skilled in the art without departing from the spirit of the invention, and equivalents thereof fall within the scope of the present application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the invention, it being understood that the invention may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing the embodiments and examples only and is not intended to be limiting of the invention.

Terminology

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

the term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).

The terms "plurality", "plural", "multiple", and the like in the present invention refer to, unless otherwise specified, an index of 2 or more in number. For example, "one or more" means one kind or two or more kinds.

As used herein, "a combination thereof," "any combination thereof," and the like include all suitable combinations of any two or more of the listed items.

The "suitable" in the "suitable combination manner", "suitable manner", "any suitable manner" and the like herein refers to the fact that the technical scheme of the present invention can be implemented, the technical problem of the present invention is solved, and the technical effect expected by the present invention is achieved.

In the present invention, "further", "still further", "particularly" and the like are used for descriptive purposes to indicate differences in content but should not be construed as limiting the scope of the invention.

In the present invention, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present disclosure, "one embodiment," "another embodiment," and the like are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or quantity, nor as implying an importance or quantity of a feature being indicated. And are provided for non-exhaustive enumeration of illustrative purposes only, it should be understood that no closed limitation on the number is to be construed.

In the invention, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

In the present invention, a numerical range (i.e., a numerical range) is referred to, and optional numerical distributions are considered to be continuous within the numerical range and include two numerical endpoints (i.e., a minimum value and a maximum value) of the numerical range and each numerical value between the two numerical endpoints unless otherwise specified. Where a numerical range merely refers to integers within the numerical range, including both end integers of the numerical range, and each integer between the two ends, unless otherwise indicated, each integer is recited herein as directly, such as where t is an integer selected from 1 to 10, and where t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Further, when a plurality of range description features or characteristics are provided, these ranges may be combined. In other words, unless otherwise indicated, the ranges disclosed herein are to be understood to include any and all subranges subsumed therein.

The temperature parameter in the present invention is not particularly limited, and may be a constant temperature treatment or may vary within a predetermined temperature range. It should be appreciated that the constant temperature process described allows the temperature to fluctuate within the accuracy of the instrument control. Allows for fluctuations within a range such as + -5 ℃, + -4 ℃, + -3 ℃, + -2 ℃, + -1 ℃.

In the present invention,% (w/w) and wt% each represent weight percent,% (v/v) represents volume percent, and% (w/v) represents mass volume percent.

One embodiment of the present application provides a specific primer pair that can be used to accurately detect whether the lycium radium is lycium barbarum or lycium barbarum, and identify whether it contains the usual blend lycium ruthenicum. The primer pair of the embodiment comprises a forward primer shown as SEQ ID NO.7 and a reverse primer shown as SEQ ID NO. 8.

In another embodiment of the present application, a kit is provided comprising a primer pair as described above.

In some embodiments, the kit further comprises one or more of DNA extraction reagents, PCR amplification reagents, and amplification product detection reagents.

In some embodiments, the PCR amplification reagent comprises Mg ²⁺ One or more of dntps, DNA polymerase and PCR buffer.

In some embodiments, the PCR amplificationThe reagent is PCR premix, and the PCR premix comprises Mg ²⁺ Dntps, DNA polymerase and PCR buffer.

In some embodiments, the amplification product detection reagent comprises one or more of agarose, electrophoresis buffer, and gel loading buffer.

Still another embodiment of the present application provides a method for identifying cortex Lycii, which includes the following steps:

performing PCR amplification on genomic DNA of a sample to be tested by using the primer pair; the method comprises the steps of,

detecting the obtained amplified product, and judging the type of the sample to be detected according to the obtained detection result.

In some embodiments, the method of detection employs agarose gel electrophoresis.

In some embodiments, determining the type of the sample according to the obtained detection result includes:

if the electrophoresis pattern contains 2 DNA fragment bands at a position of 100bp-150bp, the basic source of the sample to be detected is Ningxia wolfberry;

if the electrophoresis pattern contains 1 DNA fragment band at the position of 100bp-150bp, the basic source of the sample to be detected is medlar;

if the electropherogram contains a 98bp DNA fragment band, the sample to be detected contains lycium ruthenicum.

In some embodiments, the sample to be tested is a fresh traditional Chinese medicine, a medicinal material or a decoction piece.

In some embodiments, the PCR amplification satisfies one or more of the following conditions:

(1) Each 50. Mu.L of the PCR reaction system comprises 24. Mu.L-26. Mu.L (e.g., 24. Mu.L, 24.5. Mu.L, 25. Mu.L, 25.5. Mu.L, 26. Mu.L) of PCR premix at a primer concentration of 8. Mu.M-12. Mu.M (e.g., 8. Mu.M, 8.5. Mu.M, 9. Mu.M, 9.5. Mu.M, 10. Mu.M, 10.5. Mu.M, 11. Mu.M, 11.5. Mu.M, 12. Mu.M) of each of the forward and reverse primers of 0.5. Mu.L-0.7. Mu.L (e.g., 0.5. Mu.L, 0.55. Mu.L, 0.6. Mu.L, 0.65. Mu.L, 0.7. Mu.L), the genomic DNA having a DNA concentration of 20 ng/. Mu.L to 100 ng/. Mu.L (e.g., 20 ng/. Mu.L, 25 ng/. Mu.L, 30 ng/. Mu.L, 35 ng/. Mu.L, 40 ng/. Mu.L, 45 ng/. Mu.L, 50 ng/. Mu.L, 55 ng/. Mu.L, 60 ng/. Mu.L, 65 ng/. Mu.L, 70 ng/. Mu.L, 75 ng/. Mu.L, 80 ng/. Mu.L, 85 ng/. Mu.L, 90 ng/. Mu.L, 95 ng/. Mu.L, 100 ng/. Mu.L) is 1.8/. Mu.L to 2.2/. Mu.L (e.g., 1.8/. Mu.L, 1.9/. Mu.L, 2.0/. Mu.L, 2.1/. Mu.L); the method comprises the steps of,

(2) The procedure for PCR amplification included: pre-denatured at 94 ℃ -96 ℃ (94 ℃, 94.5 ℃, 94.6 ℃, 94.7 ℃, 94.8 ℃, 94.9 ℃,95 ℃, 95.1 ℃, 95.2 ℃, 95.3 ℃, 95.4 ℃, 95.5 ℃, 96 ℃) for 4min-6min (e.g., 4min, 4.5min, 4.6min, 4.7min, 4.8min, 4.9min, 5min, 5.1min, 5.2min, 5.3min, 5.4min, 5.5min, 6 min); denaturation of 20s-40s (e.g., 20s, 20.5s, 21s, 21.5s, 22s, 22.5s, 23s, 23.5s, 24s, 24.5s, 25s, 25.5s, 26s, 26.5s, 27s, 27.5s, 28s, 28.5s, 29s, 29.5s, 30s, 30.5s, 31s, 31.5s, 32s, 32.5s, 33s, 33.5s, 34s, 34.5s, 35s, 35.5s, 36s, 36.5s, 37s, 37.5s, 38s, 38.5s, 39s, 39.5s, 40 s) at 94-96 ℃ (94 ℃, 94.5 ℃, 94.6 ℃, 94.9 ℃,95 ℃, 95.1, 95.2, 95, 95.3, 95, 95.5 ℃), annealing at 61-62℃ (e.g., 61℃, 61.1C, 61.2C, 61.3C, 61.4C, 61.5C, 61.6C, 61.7C, 61.8C, 61.9C, 62℃) for 20s-40s (e.g., 20s, 20.5s, 21s, 21.5s, 22s, 22.5s, 23s, 23.5s, 24s, 24.5s, 25 s) 25.5s, 26s, 26.5s, 27s, 27.5s, 28s, 28.5s, 29s, 29.5s, 30s, 30.5s, 31s, 31.5s, 32s, 32.5s, 33s, 33.5s, 34s, 34.5s, 35s, 35.5s, 36s, 36.5s, 37s, 37.5s, 38s, 38.5s, 39s, 39.5s, 40 s), 71-73 ℃ (e.g., 71 ℃, 71.2 ℃, 71.4 ℃, 71.6 ℃, 71.8 ℃,72 ℃, 72.2 ℃, 72.4 ℃, 72.6 ℃, 72.8 ℃, 73 ℃) extends for 20s-40s (e.g., 20s, 20.5s, 21s, 21.5s, 22s, 22.5s, 23s, 23.5s, 24s, 24.5s, 25s, 25.5s, 26s, 26.5s, 27s, 27.5s, 28s, 28.5s, 29s, 29.5s, 30s, 30.5s, 31s, 31.5s, 32s, 32.5s, 33s, 33.5s, 34s, 35s, 35.5s, 36s, 36.5s, 37s, 37.5s, 38s, 39s, 39.5s, 40 s) for a total of 33-35 cycles (e.g., 33, 34, 35 cycles); finally, the mixture is extended at 71-73 ℃ (e.g. 71 ℃, 71.2 ℃, 71.4 ℃, 71.6 ℃, 71.8 ℃,72 ℃, 72.2 ℃, 72.4 ℃, 72.6 ℃, 72.8 ℃ and 73 ℃) for 4-5 min (e.g. 4min, 4.5min, 4.6min, 4.7min, 4.8min, 4.9min and 5 min).

Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to the guidelines given in the present invention, and may be according to the experimental manual or conventional conditions in the art, the conditions suggested by the manufacturer, or the experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

1. Primer list

TABLE 1

Numbering device	Sequence (5 '-3')
		LR-4F(SEQ ID NO.7)	CGCTCGTGGCTGACCTAAAT
LR-4R(SEQ ID NO.8)	CGACGGAGCACAGACGC

2. Sample list

TABLE 2

Numbering device	Species of species	Latin name	Batch of	Remarks
					1	Cortex Lycii (matrimony vine)	Lycium chinense	8	Medicinal material
2	Cortex Lycii (Ningxia matrimony vine)	Lycium barbarum	4	Medicinal material
					3	Cortex Lycii (Lycium ruthenicum Murr)	Lycium ruthenicum	1	Medicinal material

3. Extraction of genomic DNA

Cortex Lycii is extracted by using a Chinese herbal medicine DNA extraction kit (product number: BTN60805-20 times, beijing Bai Oy Lai Bo technology Co., ltd.).

Taking 20mg of medicinal powder, adding 750 mu L of solution A, carrying out vortex oscillation for 1min, standing at 65 ℃ for 30min, centrifuging at 13,000Xg at room temperature for 3min, and transferring the supernatant into a new centrifuge tube. Adding the solution B with equal volume, mixing for 30s upside down, and placing in ice bath for 5min. Centrifuge at 13,000Xg for 3min at room temperature and transfer the supernatant to a new centrifuge tube. 0.2mL of chloroform was added, the mixture was centrifuged at 13,000Xg for 3min at room temperature with vortexing for 30s, and the supernatant was transferred to a new centrifuge tube and the procedure was repeated once more. Adding 0.6-1 times volume of isopropanol, mixing upside down, centrifuging at room temperature for 5min at 13,000Xg for 30s, discarding supernatant, and precipitating micro DNA at the bottom of the tube. Washing the precipitate with 75% ethanol for 1 time, washing with absolute ethanol for 1 time, air drying at room temperature, and dissolving the precipitate with 10-50 μl buffer solution TB to obtain DNA solution.

4. DNA concentration determination

The DNA samples were taken, and the DNA concentrations were determined using a BioSpec-nano micro-UV spectrophotometer while recording OD260/OD230, OD260/OD280, and the concentrations were adjusted to the corresponding concentrations.

5. Specific PCR identification

(1) Primer design

The method comprises the steps of amplifying and sequencing cortex lycii radicis medicinal materials from Lycium barbarum, lycium barbarum and Lycium ruthenicum by adopting ITS2 universal primers, carrying out homologous comparison on the sequencing sequences by using BioEdit software, analyzing specific SNP loci of the Lycium barbarum, lycium ruthenicum and Lycium ruthenicum, designing 4 pairs of primers in Table 3 aiming at 230, 104 and 99 loci in the ITS2 sequence, and synthesizing all the primers by Shanghai chemical company.

TABLE 3 primer information Table

(2) Primer screening

The specific PCR amplification system and procedure designed in the application were established as follows:

TABLE 4 PCR reaction System (50. Mu.L)

System composition	Reaction volume (μL)
		Premix Taq	25
Forward primer (10. Mu. Mol/L)	0.6
		Reverse primer (10. Mu. Mol/L)	0.6
DNA template	2.0
		Sterilizing water	Complement to 50

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, extension at 72℃for 30s, for a total of 35 cycles; finally, the extension is carried out for 5min at 72 ℃.

After the PCR amplification reaction was completed, 10. Mu.L of 6×loading buffer was added to the reaction system, and the mixture was mixed well, 6 to 8. Mu.L of the mixture was spotted on 2.5% agarose gel, and the mixture was electrophoresed at 150V for 25min, developed by GelRed, and the result was observed by a gel imager.

The results are shown in fig. 1 and 2.

In fig. 1: dna maker DL 500;1. ningxia wolfberry cortex lycii radicis; 2. wolfberry cortex lycii radicis; 3. lycium ruthenicum Murr cortex Lycii; n. blank (ddH) ₂ O)。

In fig. 2: M.DNA maker DL 1000,1-2. Lycium barbarum cortex Lycii, 3-4. Ningxia Lycium barbarum cortex Lycii, 5. Lycium ruthenicum Murr cortex Lycii, N.blank (ddH) ₂ O)。

The results show that none of the blank controls has a reaction band, which indicates that the PCR reaction process is pollution-free and the results are reliable. The primer described in CN107523639A can not successfully amplify lycium ruthenicum mill bark, the primer pair designed in the application can specifically amplify lycium ruthenicum mill bark, lycium ruthenicum mill bark and lycium ruthenicum mill bark, 2 strips exist in 100-150bp of lycium ruthenicum mill bark, 1 strip exists in 90-100bp of lycium ruthenicum mill bark, but part of samples are subjected to nonspecific amplification, and can be optimized through the later-stage PCR reaction conditions, so that the primer set can specifically detect lycium ruthenicum mill, lycium ruthenicum mill and lycium ruthenicum mill, and can be used as a specific primer for rapidly identifying the lycium ruthenicum mill bark.

(3) PCR reaction condition optimization

The designed primer is used to screen out the optimal reaction condition from the main influencing factors of annealing temperature and DNA polymerase.

Based on the PCR reaction system and the reaction program in the step (2), only replacing DNA polymerase in the PCR reaction system and the reaction program, wherein the corresponding formed result is shown in figure 3; in fig. 3: m. DNA marker DL500,1-2, wolfberry bark, 3-4, ningxia wolfberry bark, 5, black wolfberry bark and N.

Based on the preferred PCR reaction system of FIG. 3, only the annealing temperature in step (2) was adjusted, and the corresponding results are shown in FIG. 4. In fig. 4: m. DNA marker DL500,1-2, wolfberry bark, 3-4, ningxia wolfberry bark, 5, black wolfberry bark and N.

The experimental result shows that the primer LR-4 has better effect when the DNA polymerase is 2 xTaq and the annealing temperature is 62 ℃, so that the reaction system of the cortex lycii radicis-specific PCR is as follows: 2 XTaq 25. Mu.L, forward and reverse primers (10. Mu.M) each 0.6. Mu.L, template DNA 2.0. Mu.L, sterilized double distilled water was supplemented to 50. Mu.L; the PCR amplification procedure was: pre-denaturation at 95℃for 5min, denaturation at 95℃for 30s, annealing at 62℃for 30s, extension at 72℃for 30s,34 cycles, extension at 72℃for 5min.

(4) Cortex lycii radicis specificity PCR method applicability detection

The applicability of the cortex Lycii specificity PCR method was examined. Selecting 8 batches of wolfberry root-bark medicinal materials, 4 batches of Ningxia wolfberry root-bark medicinal materials, 1 batch of lycium ruthenicum mill bark medicinal materials and 4 batches of mixed DNA samples (DNA mixing ratio 1:1), and amplifying according to the wolfberry root-bark specific PCR system and amplification conditions in the step (3), so as to verify the applicability of the wolfberry root-bark specific PCR method.

The results are shown in FIGS. 5 and 6.

In fig. 5: m. DNA marker DL500,1-8, wolfberry bark, 9-12, ningxia wolfberry bark, 13, black wolfberry bark and N. As shown in FIG. 5, the identification rates of the method on cortex Lycii are 100%, the true positive rates are 100%, the true negative rates are 100%, the false positive rates are 0%, and the false negative rates are 0%.

In fig. 6: m. DNA marker DL500,1. Wolfberry root-bark and Ningxia wolfberry root-bark DNA mixed sample, 2. Wolfberry root-bark and Lycium ruthenicum mill root-bark DNA mixed sample, 3. Ningxia wolfberry root-bark and Lycium ruthenicum mill root-bark DNA mixed sample, 13. Wolfberry root-bark, ningxia wolfberry root-bark and Lycium ruthenicum mill root-bark DNA mixed sample, N. As shown in FIG. 6, at the position of 100-150bp, the wolfberry and lycium ruthenicum mill scale mixed sample, and the wolfberry and lycium ruthenicum mill scale mixed sample can be amplified to obtain corresponding specific strips, but compared with the wolfberry and lycium ruthenicum mill scale, the lycium ruthenicum mill scale in the mixed sample has better amplification efficiency and brighter strips, so that the strip amplification effect of the wolfberry and lycium ruthenicum mill scale is relatively weak, probably the reason that the characteristic strips of the wolfberry in the wolfberry, lycium ruthenicum mill scale and lycium ruthenicum mill scale DNA mixed sample cannot appear. Overall, the method is more suitable for adulteration of two varieties, which shows that the method can be used for specific PCR identification of the cortex lycii radicis-element.

The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for brevity of description, all of the possible combinations of the technical features of the above-described embodiments and examples are not described, however, as long as there is no contradiction between the combinations of the technical features, they should be considered to be within the scope described in the present specification.

The above examples merely represent a few embodiments of the present invention, which facilitate a specific and detailed understanding of the technical solutions of the present invention, but are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Further, it is understood that various changes and modifications of the present invention may be made by those skilled in the art after reading the above teachings, and equivalents thereof fall within the scope of the present application. It should also be understood that, based on the technical solutions provided by the present invention, those skilled in the art obtain technical solutions through logical analysis, reasoning or limited experiments, all of which are within the scope of protection of the appended claims. The scope of the patent is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted as illustrative of the contents of the claims.

Claims (10)

1. A primer pair comprising a forward primer set forth in SEQ ID NO.7 and a reverse primer set forth in SEQ ID NO. 8.

2. A kit comprising the primer pair of claim 1.

3. The kit of claim 2, wherein the kit further comprises one or more of DNA extraction reagents, PCR amplification reagents, and amplification product detection reagents.

4. The kit of claim 3, wherein the PCR amplification reagents comprise Mg ²⁺ One or more of dntps, DNA polymerase and PCR buffer; optionally, the PCR amplification reagent is a PCR premix solution, and the PCR premix solution comprises Mg ²⁺ Dntps, DNA polymerase and PCR buffer.

5. The kit of claim 3 or 4, wherein the amplification product detection reagent comprises one or more of agarose, electrophoresis buffer, and gel loading buffer.

6. The identification method of cortex lycii radicis comprises the following steps:

performing PCR amplification on genomic DNA of a sample to be tested by using the primer pair as set forth in claim 1; the method comprises the steps of,

detecting the obtained amplified product, and judging the type of the sample to be detected according to the obtained detection result.

7. The method for identifying cortex Lycii according to claim 6, wherein the detection method is agarose gel electrophoresis.

8. The method for identifying cortex Lycii according to claim 7, wherein the judging of the kind of the sample to be tested based on the obtained detection result comprises:

if the electrophoresis pattern contains 2 DNA fragment bands at a position of 100bp-150bp, the basic source of the sample to be detected is Ningxia wolfberry;

if the electrophoresis pattern contains 1 DNA fragment band at the position of 100bp-150bp, the basic source of the sample to be detected is medlar;

if the electropherogram contains a 98bp DNA fragment band, the sample to be detected contains lycium ruthenicum.

9. The identification method of cortex Lycii according to claim 7, wherein the sample to be tested is fresh Chinese medicine, medicinal material or decoction piece.

10. The identification method of cortex lycii radicis according to any one of claims 6 to 9, wherein the PCR amplification satisfies one or more of the following conditions:

(1) Every 50 mu L of PCR reaction system comprises 24 mu L-26 mu L of PCR premix, 0.5 mu L-0.7 mu L of each of the forward primer and the reverse primer with the primer concentration of 8 mu M-12 mu M and 1.8 mu L-2.2 mu L of the genome DNA with the DNA concentration of 20 ng/mu L-100 ng/mu L; the method comprises the steps of,

(2) The procedure for PCR amplification included: pre-denaturation at 94-96 ℃ for 4-6 min; denaturation at 94-96 ℃ for 20s-40s, annealing at 61-62 ℃ for 20s-40s, extension at 71-73 ℃ for 20s-40s for 33-35 cycles; finally, the extension is carried out for 4min to 5min at the temperature of 71 ℃ to 73 ℃.