CN117417869B - Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol - Google Patents

Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol Download PDF

Info

Publication number
CN117417869B
CN117417869B CN202311745283.8A CN202311745283A CN117417869B CN 117417869 B CN117417869 B CN 117417869B CN 202311745283 A CN202311745283 A CN 202311745283A CN 117417869 B CN117417869 B CN 117417869B
Authority
CN
China
Prior art keywords
cellulose
johnsonii
flavobacterium
butanediol
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311745283.8A
Other languages
Chinese (zh)
Other versions
CN117417869A (en
Inventor
李春艳
邹小鹏
武博文
杨根基
张硕
臧海莲
苗蕾
成毅
徐诚蛟
陈泽旭
卢霞
焦婷
兰依航
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northeast Agricultural University
Original Assignee
Northeast Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northeast Agricultural University filed Critical Northeast Agricultural University
Priority to CN202311745283.8A priority Critical patent/CN117417869B/en
Publication of CN117417869A publication Critical patent/CN117417869A/en
Application granted granted Critical
Publication of CN117417869B publication Critical patent/CN117417869B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/22—Processes using, or culture media containing, cellulose or hydrolysates thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P39/00—Processes involving microorganisms of different genera in the same process, simultaneously
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/20—Flavobacterium

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a strain of Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol, and belongs to the technical field of production of 2, 3-butanediol. The invention provides a cooling-resistant cellulose degradation Flavobacterium johnsoniiFlavobacterium johnsoniae) W24H, deposited in China general microbiological culture Collection center (China Committee) for culture Collection of microorganisms, at the address: the preservation date of Beijing city, the morning sun district, north Chen Xili No. 1, 3 is: 2023, 10, 19, deposit No.: CGMCC No.28667. The invention constructs the over-expressed endoglucanase gene by taking the flavobacterium johnsonii W24H as the chassis microorganismcelB75The recombinant flavobacterium johnsonii and the Raoult HC6 are co-cultured at low temperature, cellulose is synchronously saccharification and fermentation, and 2, 3-butanediol is produced, so that cellulose biomass resources are directly converted into energy materials.

Description

Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol
Technical Field
The invention relates to the technical field of 2, 3-butanediol production, in particular to a strain of Flavobacterium johnsonii W24H and application thereof in 2, 3-butanediol production.
Background
2, 3-butanediol is widely applied to a plurality of fields of chemical industry, food, fuel, aerospace and the like, has higher calorific value (27,200 kJ/kg) which is equivalent to that of ethanol (29,100 kJ/kg), can be used as a fuel additive, and can be used as a mild humectant and bactericide for the industries of food, cosmetics and medicine.
In the existing production method of 2, 3-butanediol, the raw materials (commercial hexose or pentose) are expensive in biorefinery production of 2, 3-butanediol, so that the production cost is high, and the development of green recycling economy is not facilitated. The use of agricultural waste-straw (cellulose) for direct fermentation to produce 2, 3-butanediol has obvious economic cost advantages, and has the following defects: on the one hand, cellulose is the most abundant carbohydrate in straw, and various metabolites can be produced in the process of decomposing cellulose by microorganisms, but most of cellulose is fermentable sugar and cannot be further converted into biological energy. On the other hand, the traditional cellulose hydrolysis method and the traditional cellulose hydrolysis method have low fermentation efficiency, high cost and high energy consumption in the biorefinery process, so that the economic cost and the environmental cost are high, and the energy of cellulose biomass is not facilitated.
The low-temperature biorefinery technology is produced in low-energy consumption and simple equipment, is beneficial to reducing the total energy consumption and cost investment, is the development direction of future biorefinery under the low-carbon economic background, and is the key for promoting low-temperature biorefinery by developing cold-resistant strain resources and proper strain compatibility at present.
Disclosure of Invention
The invention aims to provide a strain of Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol. The invention constructs the over-expressed endoglucanase gene by taking the flavobacterium johnsonii W24H as the chassis microorganismcelB75The recombinant flavobacterium johnsonii and the Raoul HC6 are co-cultured at low temperature, cellulose is synchronously saccharification and fermentation, and the Raoul HC6 uses cellulose saccharification liquid as a substrate to produce 2, 3-butanediol, so that cellulose biomass resources are directly converted into energy materials.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a strain of cold-resistant cellulose degradation Flavobacterium johnsoniiFlavobacterium johnsoniae) W24H, the strain is preserved in China general microbiological culture Collection center (China Committee) for culture Collection of microorganisms, and the address is: the preservation date of Beijing city, the morning sun district, north Chen Xili No. 1, 3 is: 2023, 10, 19, deposit No.: CGMCC No.28667.
The invention also provides an application of the flavobacterium johnsonii W24H in degrading cellulose at a low temperature, wherein the temperature of the flavobacterium johnsonii W24H in degrading cellulose is 15-25 ℃.
The invention also provides an endoglucanase gene derived from the Flavobacterium johnsonii W24HcelB75The endoglucanase genecelB75The nucleotide sequence of (2) is shown as SEQ ID NO. 5.
The invention also provides a recombinant plasmid, which comprises the endoglucanase genecelB75。
The invention also provides a recombinant flavobacterium johnsonii W24H-celB75The recombinant plasmid is introduced into the F.johnsonii W24H to obtain the recombinant F.johnsonii W24H-celB75。
The invention also provides a method for producing 2, 3-butanediol, wherein the flavobacterium johnsonii W24H is combined with Raoult HC6, and cellulose is degraded to produce 2, 3-butanediol; or, the recombinant F.johnsonii W24H-celB75The Raoult bacteria HC6 are combined to degrade cellulose to produce 2, 3-butanediol;
the preservation number of the Raoult bacteria HC6 is CGMCC No.20607.
Preferably, the method specifically comprises the following steps: the F.johnsonii W24H or the recombinant F.johnsonii W24H-celB75Mixing with the Raoult bacteria HC6, activating, washing, re-suspending to obtain mixed bacterial liquid, inoculating in cellulose culture medium, and fermenting.
Preferably, the Flavobacterium johnsonii W24H or recombinant Flavobacterium johnsonii W24H-celB75The biomass ratio of the Raoult bacteria HC6 is (0.5-2): (0.5-2); the activating culture medium is LB liquid culture medium; the activation temperature is 15-25 ℃, the rotating speed is 150-200 rpm, and the time is 10-14 h.
Preferably, the OD of the mixed bacterial liquid 600 1.9 to 2.1; the inoculation amount of the mixed bacterial liquid is 4-8% of the volume of the cellulose culture medium; the fermentation temperature is 15-25 ℃, the rotating speed is 150-200 rpm, and the time is 4-10 d.
Preferably, the cellulose culture medium is a cellulose liquid culture medium or a cellulose solid culture medium;
the cellulose liquid culture medium takes water as a solvent and comprises the following components in concentration: 12.0-18.0 g/L of cellulose and K 2 HPO 4 1.0~3.0 g/L，(NH 4 ) 2 SO 4 1.2~1.6 g/L，MgSO 4 ･7H 2 O 0.2~1.0 g/L，CaCl 2 0.2~0.5 g/L，FeSO 4 ･7H 2 O 3.0~6.0 mg/L，MnSO 4 1.5~2.0 mg/L，ZnCl 2 1.5~2.0 mg/L，CoCl 2 1.5~2.0 mg/L；
The cellulose solid culture medium is prepared by adding agar with the mass percentage of 1-3% on the basis of the cellulose liquid culture medium.
The invention provides a strain of Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol. The invention screens a strain of cold-resistant cellulose degradation flavobacterium johnsonii W24H, adopts the gene manipulation technology to lead the key endoglucanase gene of the straincelB75Over-expression is carried out in the original bacteria, recombinant Flavobacterium johnsonii for efficiently degrading cellulose is constructed, the recombinant Flavobacterium johnsonii is used for saccharification and fermentation of cellulose, raoul bacteria HC6 (CGMCC No. 20607) which can be used for producing 2, 3-butanediol by utilizing fermentation sugar and is obtained through earlier-stage screening is combined, a co-culture system of cold-resistant cellulose degrading bacteria and 2, 3-butanediol producing bacteria is constructed, cellulose in corn straw is used as a raw material, cellulose fermentation and saccharification are carried out, and cellulose saccharification liquid is used as a substrate to produce 2, 3-butanediol.
The invention has the following beneficial effects: the method for producing 2, 3-butanediol belongs to a low-temperature biorefinery technology, allows microorganisms to ferment at a lower temperature, has low requirements on a temperature control system of professional equipment, can enable biological fermentation operation to be more dispersed through a simple fermentation tank device, and is beneficial to reducing energy consumption cost of fermentation. Meanwhile, the low-temperature biological refining can inhibit the activity of other microorganisms except the fermentation strain, thereby being beneficial to reducing the pollution risk of mixed bacteria and reducing the generation of byproducts. The invention produces the 2, 3-butanediol by co-culture under the low temperature condition, improves the utilization of straw biomass resources and the synthesis efficiency of biological energy, is beneficial to directly converting cellulose biomass resources into energy substances, can assist the green development of the cellulose biomass resources to clean energy, and provides a new thought for assisting the recycling of agricultural solid wastes and the rapid development of low-carbon circulation green conversion of agricultural economy.
Drawings
FIG. 1 is a colony morphology of Flavobacterium johnsonii W24H.
FIG. 2 is a diagram showing the bacterial morphology of Flavobacterium johnsonii W24H after gram staining.
FIG. 3 is a phylogenetic tree of a similar strain of F.johnsonii W24H based on the 16S rDNA sequence.
FIG. 4 is a graph showing the results of a filter paper disintegration test.
FIG. 5 is a graph showing the results of infrared spectroscopic analysis of degradation products of F.johnsonii W24H cellulose.
FIG. 6 is a graph showing the change in fermentable sugar and glucose content over time of degradation by Flavobacterium johnsonii W24H for cellulose degradation.
FIG. 7 shows endoglucanase genes in F.johnsonii W24HcelB75Electrophoresis detection result diagram of PCR amplification products.
FIG. 8 is a diagram showing the result of electrophoresis detection of the linear plasmid pBBR 1.
FIG. 9 is a recombinant F.johnsonii W24H-celB75Is a colony morphology map of (a).
FIG. 10 shows the wild-type bacterium W24H and recombinant F.johnsonii W24H-celB75In (a)celB75Graph of the change in the relative expression amount of gene with time.
FIG. 11 shows a wild-type bacterium W24H and a recombinant F.johnsonii W24H-celB75A plot of biomass over time.
FIG. 12 shows the wild-type bacterium W24H and recombinant F.johnsonii W24H-celB75Graph of endoglucanase activity over time.
Fig. 13 is an external appearance pattern of solid cellulose extracted from corn stalks.
FIG. 14 is a graph showing the results of infrared spectroscopic analysis of solid cellulose extracted from corn stover with commercially available CMC-Na.
FIG. 15 shows a combination of W24H+HC6 and W24H-celB75Graph of reducing sugar content over time during combined fermentation of +h6.
FIG. 16 shows a combination of W24H+HC6 and W24H-celB75Graph of 2, 3-butanediol content over time during combined +hc6 fermentation.
FIG. 17 shows a combination of W24H+HC6 and W24H-celB75Graph of 2, 3-butanediol conversion over time during the combined +hc6 fermentation.
Preservation description
Flavobacterium johnsonii (Fr.) KummerFlavobacterium johnsoniae) W24H, deposited in China general microbiological culture Collection center (China Committee) for culture Collection of microorganisms, at the address: the preservation date of Beijing city, the morning sun district, north Chen Xili No. 1, 3 is: 2023, 10, 19, deposit No.: CGMCC No.28667.
Raoult fungusRaoultella sp.) HC6 deposited in China general microbiological culture Collection center (China Committee for culture Collection) at the following address: the preservation date of Beijing city, the morning sun district, north Chen Xili No. 1, 3 is: 09/07/2020, accession number: CGMCC No.20607.
Detailed Description
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
This example provides Flavobacterium johnsoniiFlavobacterium johnsoniae) The identification process of W24H comprises the following specific steps:
(1) Identification of cold-resistant cellulose degrading bacteria W24H
The embodiment separates a strain of high-efficiency cold-resistant cellulose degradation bacteria W24H from low-temperature corn straw compost, inoculates the strain on a sodium carboxymethyl cellulose solid culture medium by a streak method, cultures 7 d at 15 ℃, and the colony morphology is shown in figure 1; the strain is identified as gram-negative bacteria by gram staining, and has a thin rod shape, and the strain morphology under an optical microscope is shown in figure 2. The strains were subjected to physiological and biochemical analysis according to the general bacterial System identification handbook, and the analysis results are shown in Table 1.
TABLE 1 physiological and biochemical characteristics of cold resistant cellulose degradation strains
And (3) carrying out combined molecular biology identification, wherein the strain W24H whole genome DNA is used as a template, and bacterial 16S rDNA universal primers are used for amplifying the strain 16S rDNA sequences, and the primer sequences are shown in table 2. The PCR amplification system is as follows: 4. mu L dNTP mix, 10 mu L5 XPrimeSTAR Buffer,1 mu L27F primer, 1 mu L1492R primer, 0.5 mu L PrimeSTAR HS DNA,1 mu L Polymerase DNA, ddH 2 O is supplemented to 50 mu L. The PCR reaction procedure was: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30 s, annealing at 55℃for 30 s, extension at 72℃for 30 s,30 cycles, extension at 72℃for 10 min, and retention at 4 ℃.
TABLE 2 16S rDNA Universal primer sequences
And after the PCR reaction is completed, taking 5.0 mu L of reaction products, detecting the reaction products by using 1.0% agarose gel electrophoresis, and observing and analyzing the reaction products by using a gel imaging system. The PCR amplified products were sent to Shanghai Biotechnology Co.Ltd for purification and sequencing, and the sequences were assembled by DNAMAN software. After the sequencing result is compared by NCBI database, adopting a MEGA 7.0 in-software adjacency method to construct a phylogenetic tree of the strain to be tested, analyzing the relationship between cold-resistant cellulose degradation bacteria W24H, and the result shows that the strain W24H and the strainFlavobacterium johnsoniaeThe homology of strain UW101 is 100%, and the phylogenetic tree is shown in FIG. 3.
The strain W24H is named as Flavobacterium johnsonii @ andFlavobacterium johnsoniae) W24H and is preserved in China general microbiological culture Collection center (China Committee for culture Collection), and the preservation date is: 2023, 10, 19, deposit No.: CGMCC No.28667.
(2) Verification of ability of cold-resistant cellulose degradation to degrade cellulose of Flavobacterium johnsonii W24H
The filter paper disintegration test is adopted to observe the effect of degrading the filter paper by the Flavobacterium johnsonii W24H, and the capacity of degrading cellulose by the Flavobacterium johnsonii W24H is evaluated by taking the disintegration degree of the filter paper as an index.
Adding 3 pieces of 1 cm ×6 cm filter paper (filter paper is soaked in distilled water 12H to elute soluble carbon source substances such as starch) into enzyme-producing liquid culture medium, and inoculating 5% (v/v) of Flavobacterium johnsonii W24H bacterial suspension (with bacterial concentration of OD) 600 =2.0), the same amount of distilled water was inoculated as a blank (CK), and after mixing, the filter strip was incubated at 15 ℃ for 3 d, and the morphological change of the filter strip was observed. After 3 d, the degradation of the two groups of filter paper strips is shown in FIG. 4, wherein the CK group is the disintegration effect of the filter paper in distilled water, and the 24H group is the degradation effect of Flavobacterium johnsonii W24H on the filter paper. It can be seen that F.johnsonii W24H has degraded the filter paper into a paste, and only a portion of the filter paper chips in the bottle indicate that it has a strong cellulose degrading ability.
The formula of the enzyme-producing liquid culture medium is as follows: CMC-Na 15.0 g, K 2 HPO 4 2.0 g，(NH 4 ) 2 SO 4 1.4 g，MgSO 4 ･7H 2 O 0.5 g，CaCl 2 0.3 g，FeSO 4 ･7H 2 O 5.0 mg，MnSO 4 1.6 mg，ZnCl 2 1.7 mg，CoCl 2 1.7 mg, distilled water 1.0L, pH 7.0, and sterilization at 121℃for 20 min.
(3) Infrared spectroscopic analysis of Flavobacterium johnsonii W24H cellulose degradation products
The change in functional group structure of the degradation product of cellulose of strain W24H was analyzed by Fourier transform infrared spectroscopy (FTIR).
Flavobacterium johnsonii W24H was inoculated into LB medium, cultured at 15℃for 12H, and centrifuged at 8000 rpm for 5min to collect the cells. After three times of cleaning by sterile water, the bacteria solution is resuspended to the concentration of OD 600 Bacterial solutions were inoculated in an amount of 3% (v/v) to CMC-Na medium and incubated at 15 ℃ for 12 d, sampled every 3 d, and used as control CK for sample No. 0d. After freeze-drying the sample in a freeze-dryer overnight, it was ground into powder in an agate mortar. Scanning detection is carried out by using FTIR, and the detection range is 500-4000 cm -1 Resolution of 4 cm -1 。
LB medium: 5.0 g yeast powder, 10.0 g g peptone, 10.0 g NaCl, 1L distilled water, pH 7.0, and sterilizing at 121 ℃ for 30 min.
Sodium carboxymethylcellulose (CMC-Na) medium: CMC-Na 15.0 g, K 2 HPO 4 2.0 g，(NH 4 ) 2 SO 4 1.4 g，MgSO 4 ･7H 2 O 0.5 g，CaCl 2 0.3 g，FeSO 4 ･7H 2 O 5.0 mg，MnSO 4 1.6 mg，ZnCl 2 1.7 mg，CoCl 2 1.7 mg, distilled water 1.0L, pH 7.0, and sterilization at 121℃for 20 min.
The FTIR results are shown in fig. 5, and it can be seen that the cellulose and degradation product structure changed greatly with degradation of CMC-Na by strain W24H. Therein, 3427.90 cm -1 The strong absorption peak is-OH group, and the stretching vibration of the-OH group is increased after the strain W24H degrades cellulose with the increase of time, which is probably due to the fact that the strain W24H degrades CMC-Na to generate alcohol substances; 2919 cm -1 The peak value of the strain W24H represents the vibration of-CH 3, and the vibration of the peak value of the-CH 3 is gradually weakened in the process of degrading CMC-Na by the strain W24H, so that the strain W24H promotes the gradual decomposition of polysaccharide macromolecular substances; 1115.27 cm -1 And 1062.04 cm -1 The absorption spectra of the strain W24H are formed by C-O-C and C=O stretching vibration, and the stretching vibration amplitude of the C-O-C and the C=O is increased along with the proceeding of CMC-Na biodegradation reaction, so that aldehyde substances are gradually generated in the process of degrading cellulose by the strain W24H. In addition, 1024 cm -1 The peak value at 1 represents the stretching of C-O bond in cellulose, which shows that sugar substances such as glucose are generated as the degradation of cellulose is gradually increased; 899 cm -1 The vibration peak at this point is the C-H in the cellulose, and the peak vibration enhancement over time indicates that the cellulose is gradually degrading. In conclusion, the strain W24H has obviously changed chemical conformation of CMC-Na in the process of degrading cellulose, and gradually generates small molecular substances such as acids, alcohols, saccharides and the like, which indicates that the strain W24H has stronger cellulose decomposition capability.
(4) Detection of ability of Flavobacterium johnsonii W24H to produce fermentable sugar
The content of the fermentable sugar and the glucose produced by degrading the cellulose by the flavobacterium johnsonii W24H is respectively measured by a dinitrosalicylic acid method (DNS) and a High Performance Liquid Chromatography (HPLC), and the capacity of the flavobacterium johnsonii W24H for producing the fermentable sugar and the glucose is evaluated.
Flavobacterium johnsonii W24H was inoculated into LB medium, cultured at 15℃for 12H, and centrifuged at 8000 rpm for 5min to collect the cells. After three times of cleaning by sterile water, the bacteria solution is resuspended to the concentration of OD 600 Bacterial solutions were inoculated in an amount of 3% (v/v) into CMC-Na liquid medium, incubated at 15 ℃ for 8d, samples were taken every 1 d, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. 3.0mL of supernatant is incubated in a water bath at 30 ℃ for 60 min, 2.0 mL of DNS reagent is immediately added into each test tube to terminate the reaction, after shaking and mixing, the mixture is boiled for 5min and cooled to room temperature, 15 mL distilled water is added to fix the volume to 20 mL, the light absorption value of fermentable sugar is measured at 540 nm, and the content of fermentable sugar is measured.
3.0mL of the supernatant was subjected to high performance liquid chromatography to determine the glucose content.
3, 5-dinitrosalicylic acid (DNS) reagent formulation: 6.3 g of 3, 5-dinitrosalicylic acid and 21.0 g of NaOH are weighed and dissolved in 500 mL distilled water, heating and dissolving are carried out (the heating temperature is not higher than 50 ℃), 182.0 g potassium sodium tartrate, 5.0 mL phenol and 5.0 g sodium sulfite are added after complete dissolution, stirring and dissolving are carried out, the volume is fixed to 1.0L, and the mixture is stored in a brown bottle in a dark place for use after 7 d is placed.
Conditions for High Performance Liquid Chromatography (HPLC): 2.0 mM sulfuric acid was used as the mobile phase at a flow rate of 0.8 mL/min, column temperature of 55℃and sample loading of 10. Mu.L.
As shown in FIG. 6, it was found that the content of fermentable sugars gradually increased with time, reaching a peak at 7. 7 d and being 5.87 g/L. Furthermore, as the degradation time was prolonged, the cellulose was converted to glucose by strain W24H, and the cumulative amount thereof was increased continuously, reaching 2.62 g/L at 7 th d. However, at 8 th d, the glucose content was reduced, indicating that strain W24H can utilize glucose as a nutrient to promote strain growth. Subsequently, the glucose accumulation increased again, and then at 10. 10d, the maximum yield reached 3.02 g/L. In conclusion, strain W24H produces a large amount of soluble sugars by saccharification of cellulose, hopefully imparting higher value to the bioconversion of cellulose.
Example 2
In this example, a endoglucanase gene was isolated from F.johnsonii W24HcelB75And construct recombinant F.johnsonii W24H-celB75The specific process is as follows:
(1) Endoglucanase genecelB75Cloning
The primer sequences were designed using the strain W24H whole genome DNA as a template and using SnapGene software and on-line primer design software In-Fusion Cloning Primer Design Tool v 1.0.0 (https:// www.takarabio.com/learning centers/cloning/primer design and other tools), as shown In Table 3, and after PCR amplification, the PCR products were gel-electrophoretically verified, as shown In FIG. 7, wherein lane M represents DL5000 DNA Marker and lane 1 represents DL5000 DNA MarkercelB75PCR products of the genes. The gel was recovered and purified and stored at-20 ℃.
The PCR amplification system is as follows: 4. mu L dNTP mix, 10 mu L5 XPrimeSTAR Buffer,1 mu L cellB 75-F primer, 1 mu L cellB 75-R primer, 0.5 mu L L PrimeSTAR HS DNA,1 mu L Polymerase DNA, ddH 2 O is supplemented to 50 mu L. The PCP reaction procedure was: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30 s, annealing at 55℃for 30 s, extension at 72℃for 30 s,30 cycles, extension at 72℃for 10 min, and retention at 4 ℃.
TABLE 3 Table 3celB75Gene PCR amplification primer
Strain W24H endoglucanase Gene from Shanghai Biotechnology CocelB75The sequence of which is shown in SEQ ID NO.5 (number: W24H-05075 Endoglucanase):
ATGATTAAGTTAAAAACAAATTTAATTACACCAGCTCTTTTATTAATCTGTTGTTTCTCGCAGGCACAGTTTGTAAAAGAACATGGTCGGTTAAGTGTTTTAGGAACTCAATTGGTAGATCAAAACAATCAGCCAATAGTGCTGCGTGGTTTAAGTTTTGGCTGGCATAGTATGTGGCCTAGATTTTACAATGAAAAAGCAGTAAGCTGGCTGAAAAAAGATTTTAAATGCAATGTGGTTCGCGCCGCAATGGGAATTGAACTTGGAGAATACTCCTATATTAAAGATCCGAAGTTTTCAAAAGAAAAAATAGAAGCTGTTATAAACGGTGCTATAAAATCAGATATATATGTAATTATCGATTGGCACAGTCATAATATCAACCTTAAAGAGGCAAAAGATTTTTTTGCCGAGATGTCTAAAAAATATGCCAAGTATCCTAATATTATATATGAGATATTTAATGAACCCGATTATGAAACCTGGTGGGAAGTGAAAACCTACTCTGAGGAAGTAATACGCGTTATTAGAGAAAATGATCCAAATAATATTATTTTGGTTGGAAGTCCGCATTGGGATCAGGATGTTGACCTTCCGGCAGAAGATCCAATTTTAGGATACAATAATATAATGTATACCATGCATTTTTATGCAGCAACACATGGTAAAGATTTAAGAGATAAAACAGATAAAGCAATAAAAAGAGGTCTGCCGATTTTTATTTCAGAATCAGCAGGAATGGAAGCTTCTGGAGACGGGCCGCTAAATGTAAAAGCCTGGCAGGAATATATTGACTGGATGGAAGCTAAAAAACTCAGCTGGATTACCTGGTCAGTTTCTGATAAAGACGAAACTTGTTCTATTCTGAAAAAATCAGCAAAATCTGAAGGGAAGTGGAAAGATGAAGATTTAAAAGAATCTGGAATAGAGGTTAGAGAGTTTTTAAGAAAATATAATAATCAAGAGTG。
(2) Recombinant plasmid pBBR1-celB75Construction
Will contain pBBR1MCS-2 expression plasmidE. coli DH5 alpha coating on a substrate containingKanaRIn the LB medium of (A), pBBR1MCS-2 expression plasmids were extracted using a plasmid extraction kit purchased from Northenan Biotech Co., ltd. Taking 16 mu L pBBR1MCS-2 expression plasmid and 1.0 mu L BamHIRestriction endonuclease, 1.0 [ mu ] LkpnIRestriction enzymes and 2.0 mu L of enzyme digestion buffer solution are evenly mixed, and then are digested at 35 ℃ for 1 h to obtain a linear plasmid pBBR1, and gel electrophoresis is verified, as shown in FIG. 8, wherein a lane M represents a DL5000 DNA Marker, and a fragment in a lane 2 frame represents the plasmid pBBR1 for linearization. The linear plasmid pBBR1 was recovered and purified and stored at-20 ℃.
According to the ligation reaction system in Table 4, the linear plasmid pBBR1 (Vector), step (1), was ligatedcelB75Gene PCR product (DNA), in-Fusion Snap Assembly Master Mix, ddH 2 O is evenly mixed and is connected in a metal bath at 50 ℃ for 15 min to obtain recombinant plasmid pBBR1-celB75. pBBR1-celB75Competence ofE. coliDH5 alpha is mixed and then incubated on ice for 30 min, and after heat shock 45 s, the culture medium is cultured in LB medium for 1 h. Will contain recombinant plasmid pBBR1-celB75A kind of electronic deviceE. coliDH5 alpha in the presence ofKanaROn a resistant solid plate, the positive clones were picked up for sequencing by the biological company Limited and positive grams Long Zibao were stored at-80 ℃.
TABLE 4 ligation reaction System
(3) Competent preparation of Strain W24H
The strain W24H was inoculated into LB medium, and after 12H activation culture at 15℃was performed, the strain was centrifuged at 6000 rpm for 5 minutes to collect the cells. Cells were slowly rinsed with 10% glycerol containing 50M sorbitol, incubated on ice for 30 min, repeated 5 times, competent cells were collected in 1.5 mL EP tubes, 100 μl of 10% glycerol was added, and stored at-80 ℃.
(4) Recombinant F.johnsonii W24H-celB75Construction of (3)
Extracting recombinant plasmid pBBR1 from the positive clone of step (2) using plasmid extraction kit from Novain Biotech Co., ltdcelB75. Taking 10 mu L of recombinant plasmid pBBR1-celB75Slowly mixing the recombinant plasmid with 100 mu L of W24H competent cells, and introducing the recombinant plasmid into the W24H competent cells by using an electrotransport device after ice bath for 30 min to obtain recombinant F.johnsonii W24H-celB75. Recombinant F.johnsonii W24H-celB75Is coated on a container containingKanaRCulturing overnight at 25deg.C on a solid plate with resistance, picking positive clones, extracting genome, performing gel electrophoresis, and preserving at-80deg.C. Recombinant F.johnsonii W24H-celB75The morphology of colonies on the plates is shown in FIG. 9.
Example 3
In this example, F.yoelii W24H-celB75Is verified. The specific process is as follows:
(1) Detection of strainscelB75Expression level of Gene
Wild strain of Flavobacterium johnsonii W24H and recombinant Flavobacterium johnsonii W24HcelB75Inoculating to LB medium, culturing at 25deg.C for 12 h, centrifuging at 8000 rpm for 5min, and collecting thallus. After three washes with sterile water, the bacteria solution was resuspended to OD 600 Bacterial solutions were inoculated into cellulose liquid medium and glucose liquid medium in an amount of 5% (v/v), respectively, cultured in 9 d, 4 mL bacterial suspensions were taken daily, and centrifuged at 8000 rpm for 2 min to collect bacterial cells for RNA extraction. Wherein the glucose liquidThe strains in the medium were control groups of 3 replicates each. The RT-qPCR primers are shown in Table 5, and the reaction procedure is: 94. pre-denaturation at 2 min at 94℃for 15 s, annealing/extension at 60℃for 30 s,40 cycles, melting curve was machine defaults.
Cellulose liquid medium: cellulose 15.0 g, K 2 HPO 4 2.0 g，(NH 4 ) 2 SO 4 1.4 g，MgSO 4 ･7H 2 O 0.5 g，CaCl 2 0.3 g，FeSO 4 ･7H 2 O 5.0 mg，MnSO 4 1.6 mg，ZnCl 2 1.7 mg，CoCl 2 1.7 mg, distilled water 1.0L, pH 7.0.
Glucose liquid medium: glucose 15.0 g, K 2 HPO 4 2.0 g，(NH 4 ) 2 SO 4 1.4 g，MgSO 4 ･7H 2 O 0.5 g，CaCl 2 0.3 g，FeSO 4 ･7H 2 O 5.0 mg，MnSO 4 1.6 mg，ZnCl 2 1.7 mg，CoCl 2 1.7 mg, distilled water 1.0L, pH 7.0.
TABLE 5 RT-qPCR primers
As a result of the examination, as shown in FIG. 10, it can be seen that the strains W24H and W24H-celB75Endoglucanases of (2)celB75The relative expression level of the gene tends to be increased and then decreased. W24H-celB75Endoglucanases of (2)celB75The relative expression levels of the genes are higher than W24H, and the relative expression levels of the genes are higher than W24H at 5 d and celB75The relative expression quantity of the gene is highest, compared with the strain W24HcelB75The relative expression quantity of the gene is improved by 1.35 times, which indicates that the gene is over-expressedcelB75Gene lifting in strain W24HcelB75Relative expression levels of genes.
(2) Detecting the biomass and enzyme activity of the strain, and evaluating W24H-celB75Is not limited in its cellulose decomposing ability
Wild strain W24H and recombinant F.johnsonii W24H-celB75Inoculating in LB medium, culturing at 25deg.C for 12 h, and isolating at 8000 rpmAnd (5) heart for 5min, and collecting thalli. After three washes with sterile water, the bacteria solution was resuspended to OD 600 =2.0, inoculating the bacterial liquid in an amount of 5% (v/v) to a cellulose liquid culture medium, sampling every 1 d, centrifuging at 12000 rpm for 10 min, collecting supernatant, detecting biomass and enzyme activity of the strain, and evaluating W24H-celB75Is a cellulose decomposing ability of the above-mentioned polymer.
As shown in FIG. 11, the strains W24H and W24H-celB75All grow well, the biomass of the strain is in a trend of rising and then falling, and the growth speed of the strain W24H in the previous 4 d is obviously higher than that of the strain W24H-celB75After 5 th d, strain W24H-celB75The growth rate of the strain W24H was accelerated, the peak of the highest biomass of the strain W24H was 0.481, and the strain W24H-celB75The biomass peak of (2) reaches 0.579. Strain W24H-celB75The initial low biomass relative to the wild strain W24H is probably due to the strain W24H-celB75Through molecular transformation, the strain bears plasmid metabolic pressure, so that the strain grows slowly; as biomass accumulates, more polysaccharide material is produced, which is beneficial to the strain W24H-celB75Is a growth metabolism of (a) in the plant.
As shown in FIG. 12, the endoglucanase activity was also significantly changed. Strains W24H and W24H-celB75The endoglucanases in the (a) have the tendency of ascending and descending, and reach the maximum value at the 6 th d, namely 5.57U/mL and 6.76U/mL respectively. Compared with the strain W24H, the strain W24H-celB75The endoglucanase activity of (2) was improved by 1.21-fold. The above results indicate that the expression is over-expressedcelB75The gene helps to improve the cellulose degradation capacity of the strain W24H.
Example 4
This example provides a recombinant F.johnsonii W24H-celB75The method for producing 2, 3-butanediol by degrading cellulose by combining Raoult bacteria HC6 (CGMCC No. 20607) comprises the following steps:
(1) Extraction of cellulose from corn straw
2.0 percent g corn stalk powder is taken to be soaked in NaOH solution with the mass percent of 5 percent, stirred at the temperature of 0 ℃ for 72 h, and filtered to obtain precipitate. The residue was washed with ultrapure water to a pH of 7.0 and dried in an oven at 65 ℃. The dried filter residue was immersed in deionized water for 2 h and then transferred to formic acid: acetic acid: deionized water = 3:5:2 (v: v: v) in a mixed solution, refluxing 2.5. 2.5 h at 60 ℃. The precipitate was washed until the pH of the filtrate was 7.0, and the filtrate was colorless transparent liquid free of irritating odor, and the residue was collected and dried at 65℃to obtain solid cellulose, as shown in FIG. 13. The solid cellulose has a microfibrous structure.
(2) Characterization of extract Structure
The structural characteristics of the solid cellulose of step (1) were examined and compared with commercially available CMC-Na using Fourier transform infrared spectroscopy (FTIR). After freeze-drying the sample in a freeze-dryer overnight, it was ground into powder in an agate mortar. Scanning detection is carried out by using FTIR, and the detection range is 500-4000 cm -1 Resolution of 4 cm -1 。
The FTIR spectrum analysis results are shown in fig. 14, wherein the solid cellulose is extracted from corn stalks, and CK is commercially available CMC-Na. Solid cellulose extracted from straw is structurally different from commercial sodium carboxymethyl Cellulose (CK), 3427.90 cm -1 The strong absorption peak at the position is an-OH group, and compared with CK, the stretching vibration of the cellulose-OH absorption peak in the straw is enhanced, which indicates that the straw cellulose is possibly polymerized by a large amount of cellobiose. 2919 cm -1 The peak value of (2) represents the stretching vibration of-CH 3, and compared with CK, the vibration intensity of-CH 3 in straw cellulose is increased, so that more polysaccharide substances exist in cellulose extracted from straw; 1115.27 cm -1 And 1062.04 cm -1 The absorption bands at the position are C-O-C and C=O stretching vibration respectively, and compared with CK, the stretching vibration of 2 functional groups in the straw cellulose is enhanced, which means that the extracted cellulose structure is more complex. In addition, 1024 cm -1 And 899 cm -1 The vibration peaks at the position represent C-O stretching and C-H in cellulose respectively, the peak value of cellulose extracted from straw is obviously higher than CK, and the six-carbon sugar content of straw cellulose is presumed to be rich. From the above results, it is known that cellulose extracted from straw has a lower polymerization degree, a more complex structure and a higher polysaccharide content.
(3) Strain W24H or W24H-celB75Co-culture with Raoul HC6
Through early laboratory researches, raoult HC6 can be used for producing 2, 3-butanediol by using fermentable sugar. To enhance the conversion efficiency of cellulose to 2, 3-butanediol, W24H, W H-celB75Respectively mixing with HC6 strain, and inoculating into LB liquid medium for activation. Wherein, the biomass ratio of the strain is 1:1, activation 12 h at 25℃and 160 rpm. The activated bacterial liquid is centrifuged at 8000 rpm for 10 min. After the cells were washed 3 times with sterile water, the cells were resuspended to OD with sterile water 600 Obtain W24+HC6 mixed bacterial liquid and W24HcelB75+HC6 mixed bacterial liquid.
The mixed bacterial solutions were inoculated into the cellulose liquid medium prepared from the solid cellulose of step (1) in an inoculum size of 5% (v/v), and cultured at 20℃and 160 rpm for 10d.
(4) Detection of fermentation product content
To examine the synthetic yields of reducing sugars and 2, 3-butanediol in the different treatment groups described above, fermentation broths were collected at 0d, 1 d, 2 d, 3 d, 4 d, 5 d, 6 d, 7 d, 8d, 9 d and 10d, respectively, and after centrifugation at 8000 rpm for 5min, the supernatants were filtered with 0.45 μm aqueous membranes. The reducing sugar and 2, 3-butanediol content in the fermentation broth were detected separately using dinitrosalicylic acid (DNS) and High Performance Liquid Chromatography (HPLC). And 2, 3-butanediol with concentration gradient of 1.0 mg/mL, 2.0 mg/mL, 3.0 mg/mL, 4.0 mg/mL and 5.0 mg/mL is used as a standard substance, a standard curve is drawn, and the yield of 2, 3-butanediol in fermentation broths of different treatment groups is calculated.
As shown in FIG. 15, it can be seen that the yield of reducing sugar peaked at 3 d with the gradual increase of time, the combination of W24H+HC6 and W24H-celB75The yields of the combined reducing sugars of +HC6 were 167.8 mg/g and 228.7 mg/g, respectively. W24H-celB75The +HC6 combination was increased 1.36-fold, indicating strain W24H-celB75The capability of generating reducing sugar in a synergistic way with the bacterial strain HC6 is enhanced, and the biosynthesis of 2, 3-butanediol is facilitated.
Detection of the W24H+HC6 combination and W24H-celB752, 3-butanediol content in combined +HC6 fermentation brothThe amount was measured and the conversion was calculated. The results of the detection of the 2, 3-butanediol content are shown in FIG. 16, and the results of the calculation of the 2, 3-butanediol conversion are shown in FIG. 17. It can be seen that the 2, 3-butanediol in both groups gradually accumulated over time and stabilized after the 4 th d. Wherein the highest yield of the 2, 3-butanediol combined by the W24H and the HC6 is 2.08 g/L, and the conversion rate is 0.139 g/g; and W24H-celB75The highest yield of 2, 3-butanediol for the +HC6 combination was 3.33 g/L and the conversion was 0.222 g/g. W24H-celB75The yield of the 2, 3-butanediol combined by +HC6 is improved by 1.60 times, and the method is more suitable for the conversion of straw cellulose resources. In contrast, W24H-celB75The +HC6 combination takes straw cellulose as a raw material to replace commercial monosaccharide, so that the fermentation cost is reduced and the resource utilization of straw biomass is promoted; in addition, W24H-celB75The +HC6 combination allows the fermentation process to be carried out at a lower temperature, reduces the requirements of biological fermentation on professional equipment and energy consumption, and is more beneficial to the conversion of boosting energy and the development of low-carbon recycling economy.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (8)

1. Flavobacterium johnsonii strain capable of resisting cold cellulose degradationFlavobacterium johnsoniae) W24H, the strain is preserved in China general microbiological culture Collection center (China Committee) for culture Collection of microorganisms, and the address is: the preservation date of Beijing city, the morning sun district, north Chen Xili No. 1, 3 is: 2023, 10, 19, deposit No.: CGMCC No.28667.
2. Use of flavobacterium johnsonii W24H according to claim 1 for degrading cellulose at low temperature, wherein the temperature at which flavobacterium johnsonii W24H degrades cellulose is 15-25 ℃.
3. Recombinant F.johnsonii W24H-cellB 75, wherein the recombinant plasmid is introduced into F.johnsonii W24H according to claim 1 to obtain the recombinant F.johnsonii W24H-cellB 75;
the recombinant plasmid comprises endoglucanase gene celB75 from Flavobacterium johnsonii W24H of claim 1; the nucleotide sequence of the endoglucanase gene cellB 75 is shown as SEQ ID NO. 5.
4. A method for producing 2, 3-butanediol, which is characterized in that the flavobacterium johnsonii W24H combined with Raoulet bacteria HC6 is adopted to degrade cellulose to produce 2, 3-butanediol; or, the recombinant Flavobacterium johnsonii W24H-cellB 75 combined with Raoult bacteria according to claim 3Raoultella sp.) HC6, degrading cellulose to produce 2, 3-butanediol;
the preservation number of the Raoult bacteria HC6 is CGMCC No.20607.
5. The method according to claim 4, characterized in that it comprises in particular: mixing the Flavobacterium johnsonii W24H or the recombinant Flavobacterium johnsonii W24H-cellB 75 with the Raoult bacterium HC6, activating, washing, resuspending to obtain a mixed bacterial solution, inoculating the mixed bacterial solution into a cellulose culture medium, and fermenting.
6. The method according to claim 5, wherein the ratio of biomass of Flavobacterium johnsonii W24H or recombinant Flavobacterium johnsonii W24H-cellB 75 to Raoult HC6 at the time of mixing is (0.5-2): (0.5-2); the activating culture medium is LB liquid culture medium; the activation temperature is 15-25 ℃, the rotating speed is 150-200 rpm, and the time is 10-14 h.
7. The method according to claim 6, wherein the mixed bacterial liquid has an OD 600 1.9 to 2.1; the inoculation amount of the mixed bacterial liquid is 4-8% of the volume of the cellulose culture medium; the temperature of the fermentation is 15-25 ℃, the rotating speed is 150-200 rpm, and the time is 4-10 d.
8. The method of claim 7, wherein the cellulose medium is a cellulose liquid medium or a cellulose solid medium;
the cellulose liquid culture medium takes water as a solvent and comprises the following components in concentration: 12.0-18.0 g/L of cellulose, K 2 HPO 4 1.0～3.0g/L，(NH 4 ) 2 SO 4 1.2～1.6g/L，MgSO 4 ·7H 2 O 0.2～1.0g/L，CaCl 2 0.2～0.5g/L，FeSO 4 ·7H 2 O 3.0～6.0mg/L，MnSO 4 1.5～2.0mg/L，ZnCl 2 1.5～2.0mg/L，CoCl 2 1.5～2.0mg/L；
The cellulose solid culture medium is prepared by adding agar with the mass percentage of 1-3% on the basis of the cellulose liquid culture medium.
CN202311745283.8A 2023-12-19 2023-12-19 Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol Active CN117417869B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311745283.8A CN117417869B (en) 2023-12-19 2023-12-19 Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311745283.8A CN117417869B (en) 2023-12-19 2023-12-19 Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol

Publications (2)

Publication Number Publication Date
CN117417869A CN117417869A (en) 2024-01-19
CN117417869B true CN117417869B (en) 2024-04-09

Family

ID=89532887

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311745283.8A Active CN117417869B (en) 2023-12-19 2023-12-19 Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol

Country Status (1)

Country Link
CN (1) CN117417869B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090116241A (en) * 2008-05-06 2009-11-11 고려대학교 산학협력단 Flavobacterium sp. strain gse09, an antagonistic rhizobacterium for controlling phytophthora blight of pepper
KR20140006331A (en) * 2012-07-03 2014-01-16 한국과학기술원 Production of ginsenoside rd and ginsenoside f2 using novel ginsenside glycosidase derived from flavobacterium johnsoniae
CN109593677A (en) * 2018-12-24 2019-04-09 沈阳农业大学 Low temperature resistant degraded cellulose composite bacteria agent and its preparation method and application
WO2021101937A1 (en) * 2019-11-20 2021-05-27 Novozymes Bioag A/S Pseudomonas isolates and uses thereof
CN112899179A (en) * 2020-08-10 2021-06-04 浙江省农业科学院 Low-temperature-resistant efficient crop decomposition bacterial liquid and preparation method and application thereof
CN116249764A (en) * 2020-04-15 2023-06-09 巴斯德研究所 Bacterial strain for use as a probiotic, composition thereof, deposited strain and method for identifying a probiotic bacterial strain

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090116241A (en) * 2008-05-06 2009-11-11 고려대학교 산학협력단 Flavobacterium sp. strain gse09, an antagonistic rhizobacterium for controlling phytophthora blight of pepper
KR20140006331A (en) * 2012-07-03 2014-01-16 한국과학기술원 Production of ginsenoside rd and ginsenoside f2 using novel ginsenside glycosidase derived from flavobacterium johnsoniae
CN109593677A (en) * 2018-12-24 2019-04-09 沈阳农业大学 Low temperature resistant degraded cellulose composite bacteria agent and its preparation method and application
WO2021101937A1 (en) * 2019-11-20 2021-05-27 Novozymes Bioag A/S Pseudomonas isolates and uses thereof
CN116249764A (en) * 2020-04-15 2023-06-09 巴斯德研究所 Bacterial strain for use as a probiotic, composition thereof, deposited strain and method for identifying a probiotic bacterial strain
CN112899179A (en) * 2020-08-10 2021-06-04 浙江省农业科学院 Low-temperature-resistant efficient crop decomposition bacterial liquid and preparation method and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Isolation and Identification of Cellulolytic Bacteria from the Gut of Three Phytophagus Insect Species";Rajib Kumar Shil et al.;《Braz. Arch. Biol. Technol.》;20141231;第57卷(第6期);第927-932页 *
"约氏黄杆菌研究进展";吴清云 等;《生命科学研究》;20140228;第18卷(第1期);第60-65页 *
McBride,M.J. et al.."Flavobacterium johnsoniae UW101, complete genome, GenBank: CP000685.1".《GenBank》.2014,第1-2页. *

Also Published As

Publication number Publication date
CN117417869A (en) 2024-01-19

Similar Documents

Publication Publication Date Title
Cao et al. Single-step bioconversion of lignocellulose to hydrogen using novel moderately thermophilic bacteria
CN101250496B (en) Acetone-butanol clostridium strain and uses thereof
CN110218676B (en) Clostridium butyricum and application thereof
CN104164395A (en) Clostridium beijerinckii for hydrogen generation via fermentation as well as fermentation method and application of clostridium beijerinckii
CN111484954A (en) Pseudomonas nigricans for producing alginate lyase
CN114107139B (en) Smoke tube bacterium F21 and application thereof in cellulase production
CN111909881B (en) Bacillus pumilus capable of producing feruloyl esterase and application thereof
CN111548959B (en) Klebsiella pneumoniae and application thereof
Bender et al. Characteristics and adaptability of some new isolates of Clostridium thermocellum
CN105802892A (en) Stenotrophomonas maltophilia for producing keratinase and application of stenotrophomonas maltophilia
CN117229979A (en) Extended microbubble strain for producing algin lyase and application thereof
CN108913629B (en) Bacterium for producing cellulase, preparation method and application thereof
CN117417869B (en) Flavobacterium johnsonii W24H and application thereof in production of 2, 3-butanediol
CN103146776A (en) Method for producing indigo pigment with bacillus subtilis
CN103468606B (en) Klebsiella oxytoca and application thereof in allitol production
CN112094762B (en) Corynebacteria vinifera strain and application thereof
CN115851501A (en) Bacillus, microbial preparation, culture method and application
CN106929425B (en) High-temperature-resistant acidic thermoascus thermophilus cellulase, and preparation method and application thereof
JPH0358715B2 (en)
CN111909875A (en) Persimmon gluconacetobacter and application thereof
CN110358687A (en) One plant of gibberella for producing D pantoic acid lactone hydrolase and application, fermentation process
CN110257439A (en) A method of bio-ethanol is prepared using enzymatic treatment algal polysaccharides
CN108587958A (en) One bacillus amyloliquefaciens and its application
CN109182185A (en) The ethyl alcohol production Zymomonas mobilis strain and its separating screening method of the low pH of one plant of tolerance and application
KR20140067947A (en) A novel thermostable yeast pichia guilliermondii y-2 and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant