CN117413183A

CN117413183A - Systems and methods for biomolecule retention

Info

Publication number: CN117413183A
Application number: CN202280034599.3A
Authority: CN
Inventors: 图拉尔·阿克塞尔; 马库斯·伯恩斯; 斯蒂芬·亨德里克斯; 埃尔维斯·伊克瓦; 皮埃尔·尹德穆勒; 萨迪·英格尔; 克里斯蒂娜·英曼; 帕拉格·马利克; 托里·伊莉丝·林克; 陈智明; 郝鹏宇; 钱虹吉
Original assignee: Nordilus Subsidiary
Current assignee: Nordilus Subsidiary
Priority date: 2021-03-11
Filing date: 2022-03-10
Publication date: 2024-01-16

Abstract

Compositions, systems, and methods for displaying analytes, such as biomolecules, are described. The presentation of the analyte is achieved by coupling the analyte to a presentation molecule configured to associate with a surface or interface. Analyte arrays may be formed from the described systems for use in assays and other methods.

Description

Systems and methods for biomolecule retention

Cross Reference to Related Applications

The present application claims priority from U.S. provisional application number 63/159,500 filed on day 3, month 11 of 2021 and U.S. provisional application number 63/256,761 filed on day 10, month 18 of 2021, each of which is incorporated herein by reference in its entirety.

Background

Analytes and other molecules can be formed into structured or ordered arrays for various purposes, including for analytical techniques and other chemical purposes. For example, biomolecules may be patterned into single molecule arrays for purposes such as sequencing or molecular identification. The high efficiency of analyte deposition on a single molecule array may benefit from methods of preparing the analyte and preparing the surface or interface on which the analyte is to be deposited.

Disclosure of Invention

In one aspect, provided herein is a composition comprising: a Structured Nucleic Acid Particle (SNAP), the structured nucleic acid particle comprising (i) a display moiety configured to be coupled to an analyte, (ii) a capture moiety configured to be coupled to a surface, and (iii) a multifunctional moiety comprising a first functional group and a second functional group, wherein the multifunctional moiety is coupled to the structured nucleic acid particle, and wherein the first functional group is coupled to the display moiety, and wherein the second functional group is coupled to the capture moiety.

In another aspect, provided herein is a composition comprising: a structured nucleic acid particle and a multifunctional moiety, wherein the multifunctional moiety is coupled to the SNAP, and wherein the multifunctional moiety is configured to form a continuous linker from a surface to an analyte.

In another aspect, provided herein is a Structured Nucleic Acid Particle (SNAP) complex comprising two or more SNAP, wherein each SNAP of the two or more SNAP is independently selected from the group consisting of a display SNAP, a utility SNAP, or a combination thereof, wherein the display SNAP comprises a display moiety configured to couple with an analyte, wherein the utility SNAP comprises a capture moiety configured to couple with a surface, and wherein the two or more SNAP are coupled to form the SNAP complex.

In another aspect, provided herein is a Structured Nucleic Acid Particle (SNAP) composition, the SNAP complex comprising: a surface-containing material and two or more SNAP, wherein each SNAP of the two or more SNAP is independently selected from the group consisting of a display SNAP, a utility SNAP, or a combination thereof, wherein the display SNAP comprises a display portion configured to couple with an analyte, wherein the two or more SNAP are coupled to a surface, and wherein a first SNAP of the two or more SNAP is coupled to a second SNAP of the two or more SNAP, thereby forming a SNAP complex.

In another aspect, provided herein is a composition comprising: a) an analyte, b) a display SNAP, and c) one or more SNAP selected from the group consisting of a display SNAP, a utility SNAP, and a combination thereof, wherein the display SNAP comprises a display portion configured to couple with an analyte, wherein the display SNAP is coupled with the analyte, and wherein the display SNAP is coupled with the one or more SNAP, thereby forming a SNAP complex.

In another aspect, provided herein is a structured nucleic acid particle composition comprising: a) a material comprising a surface, b) an analyte, c) a display SNAP and one or more SNAP selected from the group consisting of a display SNAP, a utility SNAP, and a combination thereof, wherein the display SNAP comprises a display portion configured to couple with the analyte, wherein the display SNAP is coupled with the one or more SNAP, thereby forming a SNAP complex, and wherein the SNAP complex is coupled with the surface.

In another aspect, provided herein is an array comprising: a) A plurality of SNAP complexes, and b) a material comprising a surface, wherein each SNAP complex of the SNAP complexes is coupled to the surface, wherein each SNAP complex of the plurality of SNAP complexes is coupled to one or more other SNAP complexes of the plurality of SNAP complexes, and wherein each SNAP complex of the plurality of SNAP complexes comprises two or more SNAP independently selected from the group consisting of display SNAP, utility SNAP, and combinations thereof.

In another aspect, provided herein is a method of forming an array, the method comprising: a) providing a plurality of SNAP complexes, b) coupling each SNAP complex of the plurality of SNAP complexes with one or more additional SNAP complexes from the plurality of SNAP complexes, and c) coupling each SNAP complex of the plurality of SNAP complexes with a surface, wherein each SNAP complex comprises a display SNAP and one or more utility SNAP, and wherein each SNAP complex comprises a coupling moiety coupled with the surface, thereby forming an array.

In another aspect, provided herein is a composition comprising: a) A structured nucleic acid particle, wherein the structured nucleic acid particle comprises: i) Maintaining the components; ii) a display moiety comprising a coupling group configured to couple an analyte, wherein the display moiety is coupled to the retention component, and iii) a capture moiety configured to couple to a surface, wherein the capture moiety comprises a plurality of first surface-interacting oligonucleotides, and wherein each first surface-interacting oligonucleotide of the plurality of first surface-interacting oligonucleotides comprises a first nucleic acid strand coupled to the retention component and a first surface-interacting moiety, wherein the first surface-interacting moiety is configured to form a coupling interaction with a surface-linking moiety, wherein the capture moiety is prevented from contacting the display moiety by the retention component, and b) an analyte comprising a complementary coupling group configured to couple to the display moiety of the structured nucleic acid particle.

In another aspect, provided herein is a composition comprising: a) A structured nucleic acid particle, wherein the structured nucleic acid particle comprises: i) Maintaining the components; ii) a display moiety coupled to the retention component; and iii) a capture moiety coupled to the retention component, wherein the capture moiety comprises a plurality of oligonucleotides, and wherein each oligonucleotide of the plurality of oligonucleotides comprises a surface-interacting moiety, and b) a solid support comprising a coupled surface, wherein the surface comprises a surface-linking moiety, and wherein a surface-interacting moiety of the plurality of surface-interacting moieties is coupled to a surface-linking moiety, wherein the display moiety is prevented from contacting the surface by the retention component.

In another aspect, provided herein is a method of identifying a polypeptide, the method comprising: a) providing a SNAP composition as set forth herein, wherein the polypeptide is coupled to the display moiety, b) contacting the solid support with a plurality of detectable affinity reagents, c) detecting the presence or absence of binding of a detectable affinity reagent of the plurality of detectable affinity reagents to the polypeptide, d) optionally repeating steps b) -c) with a second plurality of detectable affinity reagents, and e) identifying the polypeptide based on the presence or absence of binding of one or more affinity reagents.

In another aspect, provided herein is a method of sequencing a polypeptide, the method comprising: a) providing a SNAP composition as set forth herein wherein said polypeptide is coupled to said display portion, b) removing terminal amino acid residues of said polypeptide by Edman-type degradation reaction, c) identifying terminal amino acid residues, and d) repeating steps b-c) until an amino acid residue sequence has been identified for said polypeptide.

In another aspect, provided herein is a single analyte array comprising: a) A solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is resolvable at a single analyte resolution, wherein each address comprises a coupling surface, and wherein each coupling surface comprises one or more surface-linking moieties, b) a plurality of structured nucleic acid particles, wherein each structured nucleic acid particle comprises a coupling moiety, wherein the coupling moiety comprises a plurality of oligonucleotides, wherein each oligonucleotide of the plurality of oligonucleotides comprises a surface-interacting moiety, wherein each structured nucleic acid particle of the plurality of structured nucleic acid particles is coupled to an address of the plurality of addresses by binding of the surface-interacting moiety of the plurality of oligonucleotides to the surface-linking moiety of one or more complementary oligonucleotides, and wherein a structured nucleic acid particle of the plurality of structured nucleic acid particles comprises a display moiety comprising a coupling site to the analyte.

In another aspect, provided herein is a single analyte array comprising: a) A solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is distinguishable from each other address by a single analyte resolution, and wherein each address is separated from each adjacent address by one or more void regions, and b) a plurality of analytes, wherein a single analyte of the plurality of analytes is coupled to an address of the plurality of addresses, wherein each address of the plurality of addresses comprises no more than one single analyte, wherein each single analyte is coupled to a coupling surface of the address by a nucleic acid structure, and wherein the nucleic acid structure blocks the single analyte from contacting the coupling surface.

In another aspect, provided herein is a nucleic acid nanostructure comprising at least 10 coupled nucleic acids, wherein the nucleic acid nanostructure comprises: a) A dense region comprising a high internal complementarity, wherein the high internal complementarity comprises at least 50% double stranded nucleic acid and at least 1% single stranded nucleic acid, and wherein the dense region comprises a display moiety, wherein the display moiety is coupled to or configured to be coupled to a target analyte; and b) a permeable region comprising low internal complementarity, wherein the low internal complementarity comprises at least about 50% single stranded nucleic acid, and wherein the permeable region comprises a coupling moiety, wherein the coupling moiety forms a coupling interaction with a solid support or is configured to form a coupling interaction with a solid support.

In another aspect, provided herein is a nucleic acid nanostructure comprising: a) A compact structure, wherein the compact structure comprises a scaffold strand and a first plurality of staple (staple) oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a plurality of adjacent tertiary structures connected by single stranded nucleic acid regions of the scaffold, and wherein the relative positions of adjacent tertiary structures in the plurality of adjacent tertiary structures are position constrained; and b) a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to the scaffold strands of the dense structure, wherein the permeable structure comprises at least 50% single stranded nucleic acids, and wherein the permeable structure has an anisotropic three-dimensional distribution around at least a portion of the dense structure.

In another aspect, provided herein is a nucleic acid nanostructure comprising: a) A compact structure, wherein the compact structure comprises a scaffold strand and a first plurality of staple oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single-stranded regions of the scaffold strand, wherein the relative positions of the adjacent tertiary structures are subject to positional constraints, and wherein the compact structure comprises an effective surface area; and b) a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to the scaffold strands of the dense structure, and wherein the permeable structure comprises at least 50% single stranded nucleic acids; and wherein (i) the effective surface area of the nucleic acid nanostructure is greater than the effective surface area of the dense structure, or ii) the ratio of the effective surface area to the volume of the nucleic acid nanostructure is greater than the ratio of the effective surface area to the volume of the dense structure.

In another aspect, provided herein is a nucleic acid nanostructure comprising a plurality of nucleic acid strands, wherein each nucleic acid strand of the plurality of nucleic acid strands hybridizes to another nucleic acid strand of the plurality of nucleic acid strands to form a plurality of tertiary structures, and wherein a nucleic acid strand of the plurality of nucleic acid strands comprises a first nucleotide sequence that hybridizes to a second nucleic acid strand of the plurality of nucleic acid strands, wherein a nucleic acid strand of the plurality of nucleic acid strands further comprises a second nucleotide sequence of at least 100 consecutive nucleotides, and wherein at least 50 nucleotides of the second nucleotide sequence are single stranded.

In another aspect, provided herein is a composition comprising: a) A solid support comprising a plurality of sites; and b) a plurality of Structured Nucleic Acid Particles (SNAP), wherein each SNAP is coupled to or configured to be coupled to an analyte, and wherein each SNAP of the plurality of SNAP is coupled to a site of the plurality of sites, wherein the plurality of sites comprises a first subset comprising a first number of sites and a second subset comprising a second number of sites, wherein each site of the first subset comprises two or more coupled SNAP, wherein each site of the second subset comprises one and only one coupled SNAP, and wherein a ratio of the number of sites of the first subset to the number of sites of the second subset is less than a ratio predicted by poisson distribution.

In another aspect, provided herein is an analyte array comprising: a) A solid support comprising a plurality of sites; and b) a plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure is coupled to an analyte of interest, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites, wherein at least 40% of the sites of the plurality of sites comprise one and only one analyte of interest.

In another aspect, provided herein is a composition comprising: a) A solid support comprising sites configured to couple nucleic acid nanostructures; and b) a nucleic acid nanostructure, wherein the nucleic acid nanostructure is coupled to the site, wherein the nucleic acid nanostructure is coupled to an analyte of interest; and wherein the nucleic acid nanostructure is configured to prevent contact between the target analyte and the solid support.

In another aspect, provided herein is a composition comprising: a) A solid support comprising sites configured to couple nucleic acid nanostructures, wherein the sites comprise a surface area; and b) a nucleic acid nanostructure, wherein the nucleic acid nanostructure is coupled to the site, wherein the nucleic acid nanostructure is coupled to or configured to be coupled to an analyte of interest; wherein the nucleic acid nanostructure comprises a total effective surface area in an unbound configuration, wherein the nucleic acid nanostructure comprises a dense structure having an effective surface area, wherein the effective surface area of the dense structure in the unbound configuration is less than 50% of the surface area of the site, and wherein the unbound configuration comprises nucleic acid nanostructures uncoupled from the site.

In another aspect, provided herein is a method of coupling a nucleic acid nanostructure to an array site, the method comprising: a) Contacting an array comprising sites with a nucleic acid nanostructure, wherein the sites comprise a plurality of surface-linking moieties, and wherein the nucleic acid nanostructure comprises a plurality of capture moieties; b) Coupling the nucleic acid nanostructure to the site in an initial configuration, wherein the initial configuration does not include a stable configuration, and wherein the nucleic acid nanostructure is coupled by coupling a capture moiety of the plurality of capture moieties to a surface-linking moiety of the plurality of surface-linking moieties; c) Uncoupling the capture moiety of the plurality of capture moieties from the surface-attachment moiety of the plurality of surface-attachment moieties; and d) changing the nucleic acid nanostructure from an initial configuration to a stable configuration, wherein each capture moiety of the plurality of capture moieties is coupled to a surface-connecting moiety of the plurality of surface-connecting moieties.

In another aspect, provided herein is a method of forming a multiplexed analyte array, the method comprising: a) Contacting an array comprising a plurality of sites with a first plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures is coupled to one analyte of interest of a first plurality of analytes of interest; b) Contacting an array comprising the plurality of sites with a second plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures is coupled to one analyte of interest of a second plurality of analytes of interest; c) Depositing a first plurality of nucleic acid nanostructures at a first subset of the plurality of sites; and d) depositing a second plurality of nucleic acid nanostructures at a second subset of sites of the plurality of sites, wherein the first subset of sites and the second subset of sites comprise a random spatial distribution.

In another aspect, provided herein is a nanostructure comprising: a) A compact nucleic acid structure comprising a scaffold strand hybridized to a first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridizes to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single-stranded regions of the scaffold strand, and wherein the relative positions of the adjacent tertiary structures are position-constrained; b) A permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides hybridized to the scaffold strand; and c) a solid support comprising surface-attached oligonucleotides, wherein the surface-attached oligonucleotides are attached to the surface of the solid support, and wherein the surface-attached oligonucleotides hybridize to the structurally-permeable staple oligonucleotides.

In another aspect, provided herein is a method of coupling a nucleic acid nanostructure to an array, the method comprising: a) Contacting a solid support with a nucleic acid nanostructure, wherein the solid support comprises an oligonucleotide attached to a surface of the solid support, and wherein the nucleic acid nanostructure comprises: i) A compact nucleic acid structure comprising a scaffold strand hybridized to a first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridizes to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single stranded regions of the scaffold strand, and wherein the relative positions of the adjacent tertiary structures are position constrained; and ii) a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides hybridized to the scaffold strand; and b) hybridizing the surface-attached oligonucleotides to staple oligonucleotides of the second plurality of staple oligonucleotides.

In another aspect, provided herein is a method of preparing an array of analytes, the method comprising: a) Providing an array comprising a plurality of sites, wherein each site comprises a surface-linked oligonucleotide; b) Contacting the array with a plurality of analytes, wherein each analyte is coupled to a nucleic acid nanostructure, wherein each nucleic acid nanostructure comprises a plurality of surface-coupled oligonucleotides; and c) coupling one and only one nucleic acid nanostructure to a site of the plurality of sites, wherein coupling the nucleic acid nanostructure comprises hybridizing a surface-attached oligonucleotide of the site to a surface-coupled oligonucleotide of the nucleic acid nanostructure.

In another aspect, provided herein is an array of analytes of interest, the array comprising: a) A solid support comprising a plurality of sites, wherein each site comprises a surface-linked oligonucleotide; b) A plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure is configured to couple to an analyte, wherein each nucleic acid nanostructure comprises a plurality of surface-coupled oligonucleotides, wherein each surface-coupled oligonucleotide does not comprise self-complementarity, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites by hybridization of a surface-coupled oligonucleotide to a surface-attached oligonucleotide; and c) a plurality of target analytes, wherein each target analyte is coupled to one of the plurality of nucleic acid nanostructures.

Incorporated by reference

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Drawings

The novel features of the invention are set forth in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

FIG. 1A illustrates an angular offset of two faces of a Structured Nucleic Acid Particle (SNAP) according to some embodiments. FIG. 1B illustrates the angular offset of two faces of SNAP, according to some embodiments.

FIG. 2A depicts two sets of tertiary structures in SNAP, according to some embodiments. FIG. 2B shows a cross-section of SNAP with multiple facets, according to some embodiments. Fig. 2C depicts two sets of tertiary structures in SNAP according to some embodiments. FIG. 2D shows a cross-section of SNAP with multiple facets, according to some embodiments.

Fig. 3A shows SNAP comprising a multifunctional moiety according to some embodiments. Fig. 3B shows a linking moiety of a multifunctional moiety according to some embodiments. Fig. 3C shows SNAP comprising a multifunctional moiety coupled to a solid support according to some embodiments. Figure 3D shows an analyte coupled to a solid support through a multifunctional moiety according to some embodiments.

Fig. 4A, 4B, 4C, 4D, 4E, 4F, 4G, and 4H illustrate SNAP coupled to a surface according to some embodiments.

5A, 5B, 5C, and 5D illustrate SNAP with different capture plane conformations according to some embodiments.

Fig. 6 depicts a square-shaped SNAP according to some embodiments.

Fig. 7A shows a multifunctional moiety comprising an alkyl group according to some embodiments. FIG. 7B shows a multifunctional moiety comprising a modified oligonucleotide according to some embodiments.

Fig. 8A, 8B, 8C, and 8D illustrate SNAP comprising a multifunctional moiety according to some embodiments.

Fig. 9A, 9B, 9C, 9D, 9E, and 9F illustrate methods of coupling an analyte to a surface according to some embodiments.

10A, 10B, 10C, and 10D depict SNAP comprising two multifunctional moieties according to some embodiments.

11A, 11B, 11C, and 11D illustrate SNAP comprising a multifunctional moiety according to some embodiments.

12A, 12B, and 12C show SNAP composites including tile-shaped SNAPs according to some embodiments.

13A, 13B, 13C, and 13D depict different SNAP symmetries according to some embodiments.

Fig. 14A and 14B illustrate three-dimensional SNAP conformations, according to some embodiments.

Fig. 15A and 15B show different orientations of coupled SNAP, according to some embodiments.

Fig. 16A and 16B depict a three-dimensional SNAP composite according to some embodiments.

17A, 17B, and 17C illustrate an array formed from SNAP complexes according to some embodiments.

18A, 18B, and 18C illustrate an array formed from SNAP complexes according to some embodiments.

19A and 19B depict SNAP complexes formed at interfaces according to some embodiments.

FIG. 20 depicts a method of separating analyte fractions onto different SNAP species, according to some embodiments.

FIGS. 21A and 21B show SNAP-protein conjugate deposition on a patterned array.

FIG. 22 illustrates an array containing multiple categories of SNAPs, according to some embodiments.

23A and 23B illustrate an array containing multiple categories of SNAPs according to some embodiments.

FIG. 24 illustrates an array containing multiple categories of SNAPs, according to some embodiments.

25A, 25B, and 25C depict SNAP complexes on surfaces that include surface roughness according to some embodiments.

26A, 26B, and 26C depict multiple SNAP complexes at a single binding site according to some embodiments.

FIGS. 27A and 27B illustrate arrays containing patterned binding sites according to some embodiments.

Fig. 28A and 28B illustrate SNAP complexes coupled to a patterned surface according to some embodiments.

Fig. 29 depicts a three-dimensional SNAP complex according to some embodiments.

FIGS. 30A, 30B, 30C and 30D show HPLC data for purification of SNAP-protein conjugates.

FIG. 31 presents a schematic view of a 5-tile DNA origami SNAP, according to some embodiments.

32A, 32B, 32C, 32D, 32E and 32F show fluorescence confocal scanning microscope image data of SNAP deposition.

Figure 33 plots SNAP deposition under different solvent conditions.

34A, 34B and 34C show fluorescence confocal scanning microscope image data of SNAP deposition.

Fig. 35 plots SNAP deposition under different solvent conditions.

36A and 36B illustrate a scheme for generating SNAP in accordance with some embodiments.

Fig. 37A and 37B depict SNAP comprising fully structured and partially structured regions according to some embodiments.

38A and 38B depict SNAP comprising multivalent moieties in the interior volume region according to some embodiments.

39A and 39B depict SNAP comprising chemically modified interior volume regions according to some embodiments.

FIGS. 40A, 40B, and 40C illustrate various configurations of SNAP containing multiple surface interaction moieties in contact with a coupling surface comprising multiple surface attachment moieties, according to some embodiments.

Fig. 41A and 41B illustrate different distributions of surface interaction moieties on capture moieties of SNAP according to some embodiments.

Fig. 42 depicts a scheme for providing multiple surface-attached moieties to a solid support for the purpose of facilitating binding interactions with SNAP, according to some embodiments.

FIG. 43 shows the detection of double His-12 SNAP on an oligonucleotide coated surface by a His-12 peptide SNAP array with a B1 aptamer probe.

FIG. 44 shows the detection of single His-12 SNAP on an oligonucleotide coated surface by a His-12 peptide SNAP array via a B1 aptamer probe.

FIG. 45 shows a comparison of His-12 detection by B1 aptamer probe for SNAP on APTMS coated and oligonucleotide-containing surfaces.

FIG. 46 shows fluorescence imaging data for unpatterned SNAP arrays formed on glass surfaces containing oligonucleotides at different surface concentrations and different SNAP concentrations.

Fig. 47 shows fluorescence imaging data for an unpatterned SNAP array formed by direct conjugation of SNAP to an azide-containing surface.

FIG. 48 depicts the difference between effective surface area and footprint (footprint) of a nucleic acid according to some embodiments.

49A, 49B, 49C, 49D, and 49E illustrate aspects of nucleic acid structure and conformation according to some embodiments.

FIGS. 50A, 50B, 50C, 50D, 50E, and 50F illustrate steps of a method for forming a multiplexed single analyte array according to some embodiments.

FIG. 51 illustrates a nucleic acid nanostructure comprising a scaffold strand and a plurality of staple oligonucleotides, according to some embodiments.

52A, 52B, 52C, 52D, 52E, 52F, 52G, and 52H depict various configurations of nucleic acid nanostructures comprising dense structures and permeable structures according to some embodiments.

53A, 53B, 53C, 53D, and 53E illustrate various configurations of nucleic acid nanostructures comprising permeable structures configured to form multivalent binding interactions, according to some embodiments.

54A, 54B, and 54C illustrate methods for forming nucleic acid nanostructures with permeable structures according to some embodiments.

55A, 55B, 55C, and 55D illustrate methods for forming multivalent binding interactions between a nucleic acid nanostructure and a solid support according to some embodiments.

FIGS. 56A, 56B, and 56C depict various configurations of nucleic acid nanostructures comprising permeable structures that form multivalent binding interactions with a solid support, according to some embodiments.

Fig. 57 illustrates conformational changes of nucleic acid nanostructures due to surface binding interactions according to some embodiments.

58A, 58B, and 58C illustrate methods of reconfiguring a binding configuration of a nucleic acid nanostructure coupled to an array site, according to some embodiments.

Fig. 59A and 59B show atomic force microscope images of nucleic acid nanostructures. FIGS. 59C and 59D depict various measurements of nucleic acid nanostructure yields and sizes.

FIGS. 60A, 60B, 60C, and 60D depict various configurations of array sites comprising two or more types of coupled surface moieties according to some embodiments.

FIGS. 61A, 61B, 61C, 61D, and 61E illustrate steps of a method for coupling nucleic acid nanostructures to a solid support using unreacted functional groups, according to some embodiments.

62A, 62B, and 62C illustrate a method of forming an array configured to produce a multiplexed analyte array according to some embodiments. Fig. 62D and 62E illustrate a method of depositing two or more types of analytes to form a multiplexed array according to some embodiments.

FIG. 63 shows a plurality of sites of an array containing various defects or disruptions, according to some embodiments.

FIG. 64 depicts an array of analytes formed by a non-photolithographic method, according to some embodiments.

FIG. 65 illustrates a method of forming an array of analytes via charge-mediated interactions, according to some embodiments.

66A, 66B, 66C, and 66D illustrate various shapes and morphologies of array features formed in accordance with some embodiments.

FIG. 67A shows a schematic diagram of a functionalized array site according to some embodiments. Fig. 67B illustrates fluorescence microscopy characterization of an array formed by photolithographic patterning. Fig. 67C shows atomic force microscope data of surface roughness of array sites formed by photolithographic patterning. Fig. 67D and 67E plot data for average array site diameter and site spacing for an array formed by photolithographic patterning.

FIG. 68 shows fluorescence microscopy images of cycles of binding and stripping of fluorescent-labeled oligonucleotides from functional nucleic acids.

FIGS. 69A, 69B, 69C and 69D show fluorescence microscopy images of multiplexed arrays during functional acid binding and stripping of fluorescently labeled oligonucleotides to structured nucleic acid particles.

FIG. 70 shows fluorescence microscopy images of an array comprising functional nucleic acids of different nucleotide sequence lengths during binding and stripping of fluorescently labeled oligonucleotides.

Detailed Description

Ordering of molecules on the nanoscale is a critical issue for many technologies, including analytical and biological analytical methods, catalysis and biocatalysis, microfluidics and nanofluidics, and microelectronics and nanoelectronics. A particular object is a method of aligning molecules at a surface or interface, wherein the length scale of the surface features or surface irregularities is generally close to the length scale of the molecules to be aligned at the surface or interface. For example, single molecule analysis techniques are of interest for many biological applications including genomics, transcriptomics and proteomics. The formation of a single analyte biomolecule array may be limited by nanoscale and/or single molecule effects that may alternately cause limited or excessive deposition of biomolecules at binding sites on the single analyte array. For example, defects in nano-scale fabrication of solid surfaces may create sites with abnormal binding properties, creating localized defects in the array patterning. Likewise, given a sufficiently large molecular sample, thermodynamic effects (e.g., entropy) and/or kinetic effects (e.g., slow dissociation) can cause unintended phenomena (e.g., molecular co-localization) at the array site. Thus, in forming a single analyte array, it is important to prepare a consistent surface or interface and carefully control the deposition of molecules at the surface or interface.

For many single analyte, array-based technologies, it is preferable to form a substantially uniform array, including both single analytes present at substantially all array sites of a single analyte array (i.e., array site occupancy >0 analytes) and having no more than one single analyte per array site of a single analyte array (i.e., array site occupancy = 1 analyte). The uniformity of a single analyte array may increase as the poisson-like probability distribution narrows around the array site occupancy value of 1 analyte. Thus, such a narrowed array formation method that facilitates probability mass functions around the 1 analyte array site occupancy value is preferred for the formation of single analyte arrays.

Intermediate particles provide a potential method for controlling deposition of molecules on surfaces or interfaces. Particularly useful intermediate particles have tunable properties that allow the intermediate particles to selectively interact with a surface or interface while advantageously displaying analytes and other molecules on the surface or interface. The surface can be easily patterned using nano-fabrication techniques to create sites or addresses that are uniquely configured to capture the particles set forth herein. In this way, the surface may be patterned with an array of sites configured to capture a plurality of particles. By using a plurality of particles, each of which is attached to a different analyte, an array of different analytes can be formed on a surface in a predetermined pattern that is suitable for a desired analytical assay, such as the analytical methods set forth herein. An exemplary intermediate particle is a Structured Nucleic Acid Particle (SNAP), such as a nucleic acid paper break. The tunability of such particles results from the helical nature of the tertiary structure of the nucleic acid. During rotation of a single helix, the nucleic acid helix can orient the coupled ligand in almost any direction over the full 360 ° of orientation (aspect). Thus, the structured nucleic acid particles can be engineered to display attached molecules at specific locations and orientations on the particles, allowing multiple attached molecules to be optimally separated and positioned for optimal effect. Other nucleic acid nanostructures may similarly be used as intermediate particles for displaying analytes on a surface.

Described herein are structured nucleic acid particles and systems thereof that can be used to facilitate the formation of single molecule arrays of analytes and other molecules. In a particular configuration, the structured nucleic acid particles comprise a number of structural features that increase the specificity of the coupling interactions at the surface or interface or decrease the sensitivity of the particles to imperfections or irregularities at the surface or interface, allowing for the formation of a more uniform single molecule array. In particular, provided herein are systems comprising structured nucleic acid particles and a solid support, the complementary chemistry of which facilitates controlled deposition of a single analyte array. Each structured nucleic acid particle can be coupled to one or more target analytes, allowing for the formation of a uniform array of analytes on a surface or interface. For example, the target analyte may be a nucleic acid, protein, metabolite, or other target for analytical characterization. In another example, the analyte may be a reagent for synthetic methods such as synthesis of nucleic acids, proteins, small molecules, candidate therapeutic agents, non-biological polymers, and the like.

Also described herein are complexes that can be formed by coupling of a plurality of structured nucleic acid particles. The complex may increase the efficiency and control of analyte or molecule presentation at a surface or interface by increasing binding interactions with surface binding sites and/or reducing the likelihood of unwanted co-deposition of the analyte or molecule at a single location on the surface or array. In some configurations, the structured nucleic acid complexes may be configured to form self-assembled or self-patterned arrays for displaying analytes or other molecules.

Definition of the definition

As used herein, the term "nucleic acid nanostructure" or "nucleic acid nanoparticle" synonymously refers to a single-or multi-stranded polynucleotide molecule comprising a dense three-dimensional structure. The dense three-dimensional structure may optionally have a characteristic tertiary structure. An exemplary nucleic acid nanostructure is a Structured Nucleic Acid Particle (SNAP). SNAP may be configured to have an increased number of interactions between regions of a polynucleotide strand, a smaller distance between the regions, an increased number of bends in the strand, and/or sharper bends in the strand, as compared to the same nucleic acid molecule in a random coil or other unstructured state. Alternatively or additionally, the dense three-dimensional structure of the nucleic acid nanostructure may optionally have a characteristic quaternary structure. For example, a nucleic acid nanostructure can be configured to have an increased number of interactions between polynucleotide strands or a smaller distance between strands than the same nucleic acid molecule in a random coil or other unstructured state. In some configurations, the tertiary structure of a nucleic acid nanostructure (i.e., the helical twist or orientation of a polynucleotide strand) can be configured to have a higher density than the same nucleic acid molecule in a random coil or other unstructured state. Nucleic acid nanostructures may include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide Nucleic Acid (PNA), other nucleic acid analogs, and combinations thereof. The nucleic acid nanostructures may have naturally occurring or engineered secondary, tertiary or quaternary structures. The structured nucleic acid particles may comprise at least one of the following: i) A moiety configured to couple an analyte to a nucleic acid nanostructure, ii) a moiety configured to couple a nucleic acid nanostructure to another object, such as another SNAP, a solid support, or a surface thereof, iii) a moiety configured to provide a chemical or physical property or feature to a nucleic acid nanostructure, or iv) a combination thereof. Exemplary SNAP may include nucleic acid nanospheres (e.g., DNA nanospheres), nucleic acid nanotubes (e.g., DNA nanotubes), and nucleic acid paper folding (e.g., DNA paper folding). SNAP may be functionalized to include one or more reactive handles or other moieties. SNAP may comprise one or more incorporated residues containing a reactive handle or other moiety (e.g., modified nucleotide).

As used herein, the term "primary structure," when used in reference to a nucleic acid, refers to the sequence of residues of a single stranded nucleic acid. As used herein, the term "secondary structure," when used in reference to a nucleic acid, refers to base pairing interactions within a single nucleic acid polymer or between two polymers. Secondary structures may include multiple strands of nucleic acid formed by self-complementarity of individual oligonucleotides, such as stems, loops, projections, and linkages. As used herein, the term "tertiary structure," when used in reference to a nucleic acid, refers to the three-dimensional conformation of the nucleic acid, such as the overall three-dimensional shape of a single-stranded nucleic acid or a multi-stranded nucleic acid.

As used herein, the term "precursor," when used in reference to a structure of a nucleic acid, refers to a structure containing two or more structural elements (e.g., single-stranded nucleic acid, double-stranded nucleic acid, nucleic acid strand containing both double-and single-stranded nucleic acid, non-nucleic acid portion, etc.) having spatial degrees of freedom (e.g., translation, rotation, vibration, bending, etc.) to facilitate contact of the two or more structural elements with another molecule. The other molecule may be, for example, a molecule having a molecular weight greater than 0.5, 1, 5, 10 or more kilodaltons. Optionally, each of the two or more structural elements may move in concert with the movement of the nucleic acid. Optionally, for unbound nucleic acids comprising a plurality of non-interacting overhangs comprising an impermeable structure, if the nucleic acid is rotated, each overhang will rotate, but the free end of each overhang can move independently of the movement of the other free ends of the other overhangs. The spatial degrees of freedom of the nucleic acid structural elements (e.g., the spatial degrees of freedom include movement beyond natural thermal or brownian motion of the nucleic acid structure) can be evaluated for natural and/or random spatial variations in the nucleic acid structure. The first structural element of the permeable structure may have a spatial degree of freedom with respect to the second structural element in one spatial dimension, two spatial dimensions, or three spatial dimensions. As set forth herein, the permeable structure may be characterized as comprising a chemical characteristic that is different from the dense structure of the nucleic acid, such as a greater or lesser mass diffusivity to a small or large molecule, a greater or lesser hydrophobicity, a greater or lesser hydrophilicity, a greater or lesser binding strength or specificity to another nucleic acid, a greater or lesser likelihood of binding to a solid support, a greater or lesser binding strength or specificity to a solid support, or a combination thereof. The permeable structure may comprise a different feature or configuration when bound to another entity (e.g., solid support, second nucleic acid). In some configurations, the permeable structure may satisfy one or more of the following when combined with the second entity: i) Each of the two or more structural elements moves in unison with movement of the nucleic acid, ii) each of the two or more structural elements has a reduced spatial degree of freedom relative to the unbound configuration, and iii) each of the two or more structural elements has at least one spatial degree of freedom (e.g., translation, rotation, vibration, bending, etc.) relative to each other of the two or more structural elements. For example, for a nucleic acid coupled to a solid support by a permeable structure comprising a plurality of non-interacting overhangs, each overhang may be coupled to a complementary moiety on the solid support such that the nucleic acid and its permeable structure are co-located on the solid support, but each overhang may possess an independent ability to disrupt existing interactions with complementary surface moieties and form new interactions with different complementary surface moieties.

As used herein, the term "residue," when used in reference to a polymer, refers to a monomer unit of the polymer structure. When used in reference to a nucleic acid, a residue may refer to a nucleotide, nucleoside, or synthetic, modified or non-natural analog thereof. When used in reference to a polypeptide, a residue may refer to an amino acid or a synthetic, modified or non-natural analogue thereof.

As used herein, the term "type" or "kind," when used in reference to a molecule, refers to a molecule having a unique, distinguishable chemical structure. As used herein, the term "SNAP type" refers to SNAP having a unique, distinguishable primary structure, e.g., as compared to other SNAP. Two SNAP belong to the same class if they possess the same primary, secondary or tertiary structure. SNAP variants are species that differ from each other. For example, members of a "one type of SNAP" may have a unique, distinguishable structure common to the members, as compared to other SNAP's lacking the unique, distinguishable structure. SNAP types can be identified, for example, by common shape and/or conformation, number of coupling sites, or type of coupling site.

As used herein, the terms "click reaction", "click reaction" or "bioorthogonal reaction" refer to a single-step, thermodynamically favored conjugation reaction utilizing a biocompatible reagent. Click reactions may be configured to not utilize toxic or biocompatible reagents (e.g., acids, bases, heavy metals) or to not produce toxic or biocompatible byproducts. Click reactions may utilize aqueous solvents or buffers (e.g., phosphate buffered solutions, tris buffered solutions, saline buffered solutions, MOPS, etc.). The click reaction may be thermodynamically favored if it has a negative reaction Gibbs free energy, e.g., the Gibbs free energy of the reaction is less than about-5 kilojoules per mole (kJ/mol), -10kJ/mol, -25kJ/mol, -50kJ/mol, -100kJ/mol, -200kJ/mol, -300kJ/mol, -400kJ/mol, or less than-500 kJ/mol. Exemplary bio-orthogonal reactions and click reactions are described in detail in WO 2019/195633A1 (which is incorporated herein by reference in its entirety). Exemplary click reactions may include metal catalyzed azide-alkyne cycloaddition reactions, strain-promoted azide-nitrone cycloaddition reactions, strained alkene reactions, thiol-ene reactions, diels-Alder reactions, retro-electron demand Diels-Alder reactions, [3+2] cycloaddition reactions, [4+1] cycloaddition reactions, nucleophilic substitution reactions, dihydroxylation reactions, thiol-alkyne reactions, light click reactions, nitrone dipolar cycloaddition reactions, norbornene cycloaddition reactions, oxanorbornadiene cycloaddition reactions, tetrazine ligation reactions, and tetrazole light click reactions. Exemplary functional groups or reactive handles for performing click reactions may include alkenes, alkynes, azides, epoxides, amines, thiols, nitrones, isonitriles, isocyanides, aziridines, active esters, and tetrazines. Other well known click conjugation reactions with complementary bioorthogonal reaction species may be used, for example, wherein a first click component comprises a hydrazine moiety and a second click component comprises an aldehyde or ketone group, and wherein the product of such a reaction comprises a hydrazone functionality or equivalent.

As used herein, the term "array" refers to a population of molecules or analytes attached to unique identifiers such that the analytes can be distinguished from one another. As used herein, the term "unique identifier" refers to a solid support (e.g., a particle or bead), a spatial address in an array, a tag, a label (e.g., a luminophore), or a barcode (e.g., a nucleic acid barcode) that is attached to an analyte and that is different from other identifiers in one or more steps of a process. The process may be an analytical process, such as a method for detecting, identifying, characterizing, or quantifying an analyte. The attachment to the unique identifier may be covalent or non-covalent (e.g., ionic bonding, hydrogen bonding, van der waals forces, etc.). The unique identifier may be exogenous to the analyte, e.g., synthetically attached to the analyte. Alternatively, the unique identifier may be endogenous to the analyte, e.g., attached to or associated with the analyte in its natural environment. The array may include different analytes, each attached to a different unique identifier. For example, the array may includeDifferent molecules or analytes, each located at a different location on the solid support. Alternatively, the array may comprise separate solid supports, each as an address carrying a different molecule or analyte, wherein the different molecules or analytes may be identified based on the position of the solid support on the surface to which the solid support is attached or based on the position of the solid support in a liquid, such as a liquid stream. The molecules or analytes of the array may be, for example, nucleic acids (such as SNAP), polypeptides, proteins, peptides, oligopeptides, enzymes, ligands or receptors (such as antibodies), functional fragments of antibodies, or aptamers. The addresses of the array may optionally be optically observable, and in some configurations, adjacent addresses may be optically distinguishable when detected using the methods or apparatus set forth herein. As used herein, the terms "address," "binding site," and "site," when used in reference to an array, mean the location in the array where a particular molecule or analyte is present. The address may contain only one molecule or analyte, or it may contain a population (i.e. a collection of molecules) of several molecules or analytes of the same kind. Alternatively, the address may comprise a population of different kinds of molecules or analytes. The addresses of the array are typically discrete. The discrete addresses may be consecutive or they may have gaps between each other. Arrays useful herein can have addresses separated by, for example, less than 100 microns, 10 microns, 1 micron, 500nm, 100nm, 10nm, or less. Alternatively or additionally, the array may have addresses separated by at least 10nm, 100nm, 500nm, 1 micron, 5 microns, 10 microns, 50 microns, 100 microns, or more. Addresses may each have an area of less than 1 square millimeter, 500 square microns, 100 square microns, 25 square microns, 1 square micron, or less. The array may include at least about 1x10 ⁴ 1x10 ⁵ 1x10 ⁶ 1x10 ⁸ 1x10 ¹⁰ 1x10 ¹² One or more addresses.

As used herein, the term "solid support" refers to a substrate that is insoluble in aqueous liquids. Optionally, the substrate may be rigid. The substrate may be non-porous or porous. The substrate may optionally beIs capable of absorbing liquid (e.g., due to porosity), but is generally (but not necessarily) sufficiently rigid that the substrate does not substantially expand upon absorption of liquid and does not substantially contract upon removal of liquid by drying. Non-porous solid supports are generally impermeable to liquids or gases. Exemplary solid supports include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene, and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, teflon) ^TM Cyclic olefins, polyimides, etc.), nylon, ceramic, resin, zeonor ^TM Silica or silica-based materials (including silicon and modified silicon), carbon, metals, metal oxides (e.g., zirconia, titania, alumina, etc.), inorganic glass, fiber bundles, gels, and polymers.

As used herein, the terms "group" and "moiety" are intended to be synonymous when used to refer to a molecular structure. The term refers to a component or portion of a molecule. Unless otherwise indicated, these terms do not necessarily indicate relative sizes of components or portions as compared to the remainder of the molecule. The group or moiety may contain one or more atoms. As used herein, the term "display moiety" refers to a component or moiety of a molecule that is configured to couple the molecule to an analyte or that couples the molecule to an analyte. As used herein, the term "capture moiety" refers to a component or moiety of a molecule that is configured to couple the molecule to a solid support, surface, or interface or that couples the molecule to a solid support, surface, or interface. As used herein, the term "coupling moiety" refers to a component or portion of a molecule that is configured to couple the molecule to a second molecule or that couples the molecule to a second molecule. As used herein, the term "utility moiety" refers to a component or portion of a molecule that is configured to provide functionality or structure to the molecule or that provides functionality or structure to the molecule. The functionality or structure may be a new functionality or structure not provided by the display portion, capture portion or coupling portion of the molecule; or it may be a modification (e.g., inhibition or activation) of the structure or function provided by the display portion, capture portion, or coupling portion of the molecule.

As used herein, the term "face" refers to a portion of a molecule, particle, or complex (e.g., SNAP or SNAP complex) that contains one or more portions having substantially similar orientation and/or function. For example, a substantially rectangular or square SNAP may have a coupling face comprising one or more coupling moieties, each coupling moiety having a substantially similar orientation to each other coupling moiety (e.g., oriented at about 180 ° to a display moiety configured to couple with an analyte). In another example, spherical nanoparticles may have a coupling face comprising a plurality of coupling moieties that are constrained to coupling of the hemisphere of the particle (i.e., a plurality of coupling moieties that have similar functions but different orientations). In some cases, a face may be defined by an imaginary plane, with respect to which a portion or portion of which may have spatial proximity or angular orientation when the plane is in contact with a point or portion of a molecule, particle, or complex. Portions thereof or portions thereof may have a spatial separation of no more than about 100 nanometers (nm), 90nm, 80nm, 70nm, 60nm, 50nm, 40nm, 30nm, 25nm, 20nm, 15nm, 10nm, 9nm, 8nm, 7nm, 6nm, 5nm, 4nm, 3nm, 2nm, 1nm, 0.5nm, 0.1nm, or less than 0.1nm from an imaginary plane defining the face of the molecule, particle, or complex. Portions thereof or portions thereof may have an angular orientation of no more than about 90 °, 85 °, 80 °, 75 °, 70 °, 65 °, 60 °, 55 °, 50 °, 45 °, 40 °, 35 °, 30 °, 25 °, 20 °, 15 °, 10 °, 5 °, 1 ° or less than 1 ° relative to a normal vector to the imaginary plane.

As used herein, the terms "analyte" and "target analyte," when used in reference to a structured nucleic acid particle, refer to a molecule, particle, or complex of molecules or particles coupled to a display portion of the structured nucleic acid particle. The analyte may comprise a target of an analytical method (e.g., sequencing, identification, quantification, etc.) or may comprise a functional element, such as a binding ligand or a catalyst. The analyte may comprise a biological molecule, such as a polypeptide, polysaccharide, nucleic acid, lipid, metabolite, enzyme cofactor, or a combination thereof. The analyte may comprise a non-biological molecule such as a polymer, metal oxide, ceramic, semiconductor, mineral, or a combination thereof. As used herein, the term "sample analyte" refers to an analyte derived from a sample collected from a biological or non-biological system. The sample analyte may be purified or unpurified. As used herein, the term "control analyte" refers to an analyte that is provided as a positive or negative control for comparison to a sample analyte. The control analyte may be derived from the same source as the sample analyte or from a different source than the sample analyte. As used herein, the term "standard analyte" refers to an analyte that is known or characterized as provided as a physical or chemical reference to a process. The standard analyte may comprise the same type of analyte as the sample analyte or may be different from the sample analyte. For example, a polypeptide analyte process may utilize a polypeptide standard analyte having known characteristics. In another example, a polypeptide analyte process may utilize a non-polypeptide standard analyte having known characteristics. As used herein, the term "inert analyte" refers to an analyte that has no intended function in a process or system.

As used herein, the term "linker," "linking group," or "linking moiety" refers to a molecule or chain of molecules configured to attach a first molecule to a second molecule. The linker, linking group or linking moiety may be configured to provide a chemical or mechanical property, such as hydrophobicity, hydrophilicity, charge, polarity, rigidity or flexibility, to the region separating the first molecule from the second molecule. The linker, linking group or linking moiety may comprise two or more functional groups that facilitate coupling of the linker, linking group or linking moiety to the first and second molecules. The linker, linking group or linking moiety may include multifunctional linkers, such as homobifunctional linkers, heterobifunctional linkers, homomultifunctional linkers and heteromultifunctional linkers. The molecular chain may be characterized by a minimum size, for example, of at least about 100 daltons (Da), 200Da, 300Da, 400Da, 500Da, 600Da, 700Da, 800Da, 900Da, 1 kilodaltons (kDa), 2kDa, 3kDa, 4kDa, 5kDa, 10kDa, 15kDa, 20kDa, or greater than 20kDa. Alternatively or additionally, the molecular chain may be characterized by a maximum size, such as, for example, no more than about 20kDa, 15kDa, 10kDa, 5kDa, 4kDa, 3kDa, 2kDa, 1kDa, 900Da, 800Da, 700Da, 600Da, 500Da, 400Da, 300Da, 200Da, 100Da, or less than 100Da. Exemplary molecular chains may include polyethylene glycol (PEG), polyethylene oxide (PEO), alkane chains, fluorinated alkane chains, dextran, and polynucleotides.

As used herein, the terms "reversible" and "reversibility" are used to refer to the chemical or physical coupling of two entities (e.g., molecules, analytes, functional groups, or moieties) that have a substantial likelihood of uncoupling under one or more conditions of use. Reversibility may consist of thermodynamic reversibility, kinetic reversibility, or a combination thereof. The reversible coupling of the first entity and the second entity may be characterized by a temporary change in structure or function of the first entity and/or the second entity when coupled to each other. The reverse coupling may optionally restore the structure or function of the first entity and/or the second entity to the same state prior to the temporary change. The context of determining reversibility may include the detection of the possibility of reverse coupling given the particular space, time and physical environment in which the two coupled molecules are located. For example, in a population of one million streptavidin-biotin conjugate pairs, the number of detectable reverse couplings can be predicted thermodynamically, however, if the detection time scale is on the order of seconds or minutes, slow kinetic reversal of the binding reaction may render such uncoupling undetectable above detection noise. In this context, streptavidin-biotin coupling will be described as irreversible. For systems that undergo multiple processes, the context of reversibility may be process dependent. For example, measurable uncoupling of the coupled molecule may occur during storage for several months, but subsequent processes using the coupled molecule may occur within several minutes. In this context, coupled molecules may be coupled reversibly in storage, but irreversibly coupled in utilization. The measurement of reversibility may include the use of quantitative measurements such as equilibrium constants or kinetic binding rates and/or dissociation rates. Reversibility can be measured directly by equilibrium determination. Reversibility may change with changes in the chemical system, such as changes in temperature or solvent composition. Reversible coupling may include metastable coupling, which remains coupled until the physical environment changes. For example, complementary nucleic acids can remain stably coupled at 20 ℃, but can be rapidly uncoupled above 75 ℃. Reversible coupling may remain coupled for a period of at least about 1 second(s), 1 minute (min), 5min, 10min, 15min, 30min, 1 hour (hr), 2hr, 3hr, 4hr, 5hr, 6hr, 12hr, 18hr, 1 day, 1 week, 1 month, 6 months, 1 year, or more than 1 year. Alternatively or additionally, the reversible coupling may become uncoupled within a period of no more than about 1 year, 6 months, 1 month, 1 week, 1 day, 18hr, 12hr, 6hr, 5hr, 4hr, 3hr, 2hr, 1hr, 30min, 15min, 10min, 5min, 1s, or less than 1 second.

As used herein, the terms "irreversible" and "irreversible" are used to refer to the chemical or physical coupling of two entities (e.g., molecules, analytes, functional groups, or moieties) that have the potential to remain coupled under one or more conditions of use. A system that is determined to be irreversible as described above may be described as irreversible. For example, an irreversible coupling of a first entity to a second entity may be characterized by a permanent change in the structure or function of the first entity and/or the second entity after coupling to each other. Uncoupling may result in a substantial change in the structure or function of the corresponding entity or entities, as compared to the structure or function of the entity or entities prior to coupling. Reversible coupling may remain coupled for a period of at least about 1 second(s), 1 minute (min), 5min, 10min, 15min, 30min, 1 hour (hr), 2hr, 3hr, 4hr, 5hr, 6hr, 12hr, 18hr, 1 day, 1 week, 1 month, 6 months, 1 year, or more than 1 year.

As used herein, the term "affinity reagent" refers to a molecule or other substance that is capable of specifically or reproducibly binding to a binding partner or other substance. Binding may optionally be used to identify, track, capture, alter or affect binding partners. The binding partner may optionally be greater than, less than or equal to the size of the affinity reagent. The affinity reagent may form a reversible or irreversible interaction with the binding partner. The affinity reagent may be bound to the binding partner covalently or non-covalently. The affinity reagent may be configured to perform chemical modifications (e.g., ligation, cleavage, ligation, etc.) that produce a detectable change in the larger molecule, allowing the interaction that occurs to be observed. Affinity reagents may include chemically reactive affinity reagents (e.g., kinases, ligases, proteases, nucleases, etc.) and chemically non-reactive affinity reagents (e.g., antibodies, antibody fragments, aptamers, darpins, peptide aptamers (pepamers), etc.). The affinity reagent may comprise one or more known and/or characterized binding components or binding sites (e.g., complementarity determining regions) that mediate or facilitate binding to the binding partner. Thus, the affinity reagent may be monovalent or multivalent (e.g., divalent, trivalent, tetravalent, etc.). Affinity reagents are typically non-reactive and non-catalytic and therefore do not permanently alter the chemical structure of the materials to which they bind in the methods set forth herein.

As used herein, the terms "protein" and "polypeptide" are used interchangeably to refer to a molecule or analyte comprising two or more amino acids linked by peptide bonds. A polypeptide may refer to a peptide (e.g., a polypeptide having less than about 200, 150, 100, 75, 50, 40, 30, 20, 15, 10, or less than about 10 linked amino acids). A polypeptide may refer to a naturally occurring molecule, or an artificial or synthetic molecule. A polypeptide may include one or more unnatural, modified amino acids or non-amino acid linkers. The polypeptide may contain D-amino acid enantiomers, L-amino acid enantiomers or both. The polypeptide may be modified naturally or synthetically, such as by post-translational modification.

As used herein, the term "detectable label" refers to a moiety of an affinity reagent or other substance that provides a detectable feature. The detectable feature may be, for example, an optical signal such as absorption of radiation, luminescence or fluorescence emission, luminescence or fluorescence lifetime, luminescence or fluorescence polarization, or the like; rayleigh and/or mie scattering; binding affinity for ligand or receptor; magnetic properties; an electrical characteristic; a charge; quality; radioactivity, etc. The labeling component may be a detectable chemical entity conjugated or capable of being conjugated to another molecule or substance. Exemplary molecules that can be conjugated to the labeling component include affinity reagents or binding partners. The labeling component may generate a signal (e.g., fluorescent, luminescent, radioactive) that is detected in real-time. The labeling component may generate a signal that is detected off-line (e.g., a nucleic acid barcode) or in a time-resolved manner (e.g., time-resolved fluorescence). The marker component may produce a signal having a characteristic frequency, intensity, polarity, duration, wavelength, sequence, or fingerprint. Exemplary labels include, but are not limited to, fluorophores, luminophores, chromophores, nanoparticles (e.g., gold, silver, carbon nanotubes), heavy atoms, radioisotopes, mass labels, charge labels, spin labels, receptors, ligands, nucleic acid barcodes, polypeptide barcodes, polysaccharide barcodes, and the like.

As used herein, the term "nucleic acid paper folding" refers to a nucleic acid construct comprising an engineered secondary, tertiary or quaternary structure. The nucleic acid fold may include DNA, RNA, PNA, LNA, other nucleic acid analogs, modified or unnatural nucleic acids, or combinations thereof. Nucleic acid paper folding may comprise a plurality of oligonucleotides that hybridize by sequence complementarity to create an engineered structure of paper folding particles. The nucleic acid break can comprise segments of single-stranded or double-stranded nucleic acids, or a combination thereof. The nucleic acid break may comprise one or more tertiary structures of the nucleic acid, such as A-DNA, B-DNA, C-DNA, L-DNA, M-DNA, Z-DNA, etc. The nucleic acid break can comprise single stranded nucleic acids, double stranded nucleic acids, multiple stranded nucleic acids, or a combination thereof. Exemplary nucleic acid paper folding structures may include nanotubes, nanowires, cages, tiles, nanospheres, blocks, and combinations thereof.

As used herein, the term "nucleic acid nanospheres" refers to spherical or spherical nucleic acid structures. The nucleic acid nanospheres may comprise oligonucleotide concatemers arranged in a spherical structure. The nucleic acid nanospheres may comprise one or more oligonucleotides, including oligonucleotides comprising self-complementary nucleic acid sequences. The nucleic acid nanospheres can comprise palindromic nucleic acid sequences. The nucleic acid nanospheres may include DNA, RNA, PNA, LNA, other nucleic acid analogs, modified or unnatural nucleic acids, or combinations thereof.

As used herein, the term "oligonucleotide" refers to a molecule comprising two or more nucleotides linked by phosphodiester bonds or analogs thereof. The oligonucleotides may comprise DNA, RNA, PNA, LNA, other nucleic acid analogs, modified nucleotides, non-natural nucleotides, or combinations thereof. An oligonucleotide may include a limited number of binding nucleotides, such as less than about 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 15, 10, or less than 5 nucleotides. The oligonucleotide may comprise a linking group or moiety at a terminal or intermediate position. For example, an oligonucleotide may comprise two nucleic acid strands joined by an intermediate PEG molecule. In another example, an oligonucleotide may comprise a cleavable linker (e.g., a photocleavable linker, an enzymatically cleavable linker, a restriction site, etc.) linking two portions of the oligonucleotide. The terms "polynucleotide" and "nucleic acid" are used synonymously herein with the term "oligonucleotide".

As used herein, the term "scaffold" refers to a molecule or molecular complex having a structure that couples two or more entities to each other. The scaffold may form the structural basis for coupling the binding component and/or the labeling component to the detectable probe. The scaffold may comprise a plurality of attachment sites that allow coupling or conjugation of the detectable probe component to the scaffold. The scaffold attachment site may include a functional group, an active site, a binding ligand, a binding receptor, a nucleic acid sequence, or any other entity capable of forming a covalent or non-covalent attachment with a binding component, a labeling component, or other detectable probe component. The scaffold may comprise an oligonucleotide molecule that serves as the main building block of the nucleic acid paper folding. The scaffold may comprise single stranded nucleic acids, double stranded nucleic acids, or a combination thereof. The scaffold may be a circular oligonucleotide or a linear (i.e., non-circular) oligonucleotide. The scaffold may be derived from a natural source, such as a bacterial or viral genome (e.g., plasmid DNA or phage genome). The circular scaffold may be formed by ligation of non-circular nucleic acids. A scaffold may comprise a specific number of nucleotides, for example, at least about 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10000, or more than 10000 oligonucleotides. The scaffold may comprise organic or inorganic particles or nanoparticles. The scaffold may comprise a coating or layer applied to the particles or nanoparticles that allows for the attachment of the detectable label component.

As used herein, the term "two-dimensional projection" refers to an area or shape occupied by projecting a three-dimensional structure onto a planar two-dimensional surface without substantial geometric or spatial distortion. For example, a two-dimensional projection of a sphere onto a planar two-dimensional surface will create a circular area on the surface with a diameter equal to the diameter of the sphere. The two-dimensional projection may be formed from any reference coordinate system (frame of reference), including a reference coordinate system orthogonal to any surface of the three-dimensional structure. Many three-dimensional structures are capable of producing projections of different sizes or shapes from a reference coordinate system. Thus, the maximum two-dimensional projection of a three-dimensional structure refers to the maximum area or shape that results from all reference frames of the three-dimensional structure; the minimum two-dimensional projection of a three-dimensional structure refers to the minimum area or shape that results from all reference frames of the three-dimensional structure; and the average two-dimensional projection of the three-dimensional structure refers to the average area or shape resulting from all reference frames of the three-dimensional structure.

As used herein, the term "effective surface area," when used in reference to a nucleic acid, refers to the surface area of a two-dimensional projection of the nucleic acid or a portion thereof when the nucleic acid is not bound to the surface (e.g., dissolved or suspended in a fluid medium). As used herein, the term "footprint," when used in reference to a nucleic acid, refers to the surface area of a two-dimensional projection of the nucleic acid or a portion thereof when the nucleic acid is bound to a surface (e.g., coupled to a solid support). Fig. 48 depicts the difference between the effective surface area and the footprint of a nucleic acid. In the unbound configuration, the two-dimensional projection of nucleic acid 4810 onto surface 4800 will have a length l ₁ A proportional surface area that is substantially the same as the distance between the two ends of unbound nucleic acid 4810. In the binding configuration, the coupling of the nucleic acid 4810 to the surface 4800 increases the distance between the ends of the nucleic acid, thereby increasing the surface area of the two-dimensional projection of the nucleic acid on the surface 4800. Thus, the nucleic acid has a larger occupancy than its effective surface areaArea.

As used herein, the term "offset" refers to the spatial difference in orientation between two lines (two-dimensional) or surfaces (three-dimensional). The offset may include a distance offset and/or an angular offset. Fig. 1A and 1B depict examples of angular offsets of different two-dimensional shapes (which may be two-dimensional projections of a three-dimensional structure). The isosceles triangle 100 of fig. 1A has an angular offset of 120 ° between the first face 110 and the second face 120, the relative orientations of which are depicted by orthogonal vectors a and a'. The rectangle 130 of fig. 1B has an angular offset of 180 ° between the first face 110 and the second face 120, the relative orientations of which are depicted by orthogonal vectors a and a'.

As used herein, the term "binding specificity" refers to the tendency of an affinity agent to preferentially interact with a binding partner, affinity target or target moiety relative to other binding partners, affinity targets or target moieties. The affinity reagent may have calculated, observed, known or predicted binding specificity for any possible binding partner, affinity target or target moiety. Binding specificity may refer to the selectivity for a single binding partner, affinity target, or target moiety in a sample over the selectivity for at least one other analyte in the sample. Furthermore, binding specificity may refer to the selectivity of a binding partner, affinity target or subset of target moieties in a sample over the selectivity of at least one other analyte in the sample.

As used herein, the term "binding affinity" or "affinity" refers to the strength or degree of binding between an affinity agent and a binding partner, affinity target or target moiety. In some cases, the binding affinity of the affinity reagent to the binding partner, affinity target, or target portion may be as small as nearly zero or virtually zero. The binding affinity of an affinity agent to a binding partner, affinity target or target moiety may be defined as "high affinity", "medium affinity" or "low affinity". The binding affinity of an affinity reagent for a binding partner, affinity target or target moiety can be quantified as "high affinity" if the interaction has a dissociation constant of less than about 100nMForce ", if the interaction has a dissociation constant between about 100nM and 1mM, is quantified as" medium affinity ", and if the interaction has a dissociation constant greater than about 1mM, is quantified as" low affinity ". Binding affinity can be described in terms known in the biochemical arts, such as equilibrium dissociation constant (K _D ) Equilibrium binding constant (K) _A ) Binding rate constant (k) _on ) Dissociation rate constant (k) _off ) Etc. See, e.g., segel, enzyme kinetic, john Wiley and Sons, new York (1975), which is incorporated herein by reference in its entirety.

As used herein, the term "hybridization," when used in reference to binding, may refer to the following affinity reagent properties: 1) Binding to a plurality of binding partners due to the presence of a specific affinity target or target moiety, regardless of the background of binding of the affinity target or target moiety; or 2) binding to multiple affinity targets or target moieties in the same or different binding partners; or 3) a combination of both properties. With respect to the first form of binding confounding, "binding context" may refer to a local chemical environment surrounding an affinity target or target portion, such as flanking, adjacent or nearby chemical entities (e.g., for a polypeptide epitope, flanking amino acid sequences, or non-contiguous amino acid sequences adjacent or nearby with respect to the epitope). With respect to binding the confounding second form, the definition may refer to an affinity agent or probe that binds to a structurally or chemically related affinity target or target moiety, despite differences between the affinity targets or target moieties. For example, an affinity agent can be considered to be promiscuous if it has binding affinity to a trimeric peptide sequence having the form WXK (where W is tryptophan, K is lysine, and X is any possible amino acid). Additional concepts related to binding confusion are discussed in WO 2020106889A1, which is incorporated herein by reference in its entirety.

As used herein, the term "binding probability" refers to the probability that interaction of an affinity agent with a binding partner and/or affinity target can be observed in a particular binding context. The binding probability may be expressed as a discrete number, such as a value N (e.g., 0.4) or a percentage value (e.g., 40%) in the range of 0.ltoreq.N.ltoreq.1, a matrix of discrete numbers, or as a mathematical model (e.g., a theoretical or empirical model). The probability of binding may include one or more factors including binding specificity, the likelihood of localizing the affinity target, and the likelihood of binding long enough to detect a binding interaction. The overall binding probability may include the binding probability when all factors have been weighted against the binding context.

As used herein, the term "binding context" may refer to the environmental conditions under which affinity reagent-binding partner interactions are observed. The combined background may be a constant condition or a condition that varies within a certain range. Environmental conditions may include any factor that may affect the interaction between the affinity reagent and the binding partner, such as temperature, fluid properties (e.g., ionic strength, polarity, pH), relative concentration, absolute concentration, fluid composition, binding partner conformation, affinity reagent conformation, and combinations thereof.

As used herein, the term "tunable," when used in reference to a structured nucleic acid particle, refers to a specific, precise, and/or rational location of a component or an attachment site for a component having an assembly or structure. An adjustable retention component may refer to the ability to couple or conjugate a probe component at or within a specific site or region of the retention component structure, or to create an attachment site for coupling or conjugation of a probe component at a specific site or region of the retention component structure. As used herein, "tunable" refers to the property of a probe component or a retention component having an adjustable structure or architecture.

As used herein, the term "functional group" refers to a group of atoms in a molecule that imparts chemical properties on the molecule such as reactivity, polarity, hydrophobicity, hydrophilicity, solubility, and the like. The functional group may contain an organic moiety or may contain an inorganic atom. Exemplary functional groups may include alkyl, alkenyl, alkynyl, phenyl, halide, hydroxy, carbonyl, aldehyde, acyl halide, ester, carboxylate, carboxyl, alkoxycarboyl, methoxy, 32 peroxyhydroxy, ether, hemiacetal, hemiketal, acetal, ketal, orthoester, epoxide, carboxylic anhydride, carboxamide, amine, ketimine, aldimine, imide, azide, azo, cyanate, isocyanate, nitrate, nitrile, isonitrile, nitrosooxy, nitro, nitroso, oxime, pyridyl, carbamate, mercapto, sulfide, disulfide, sulfinyl, sulfonyl, sulfinyl, sulfo, thiocyanate, isothiocyanate, thiocarbonyl, thioester, thioxy, phosphino, phosphonyl, phosphonate, phosphate, boronyl, borate, and boride functional groups.

As used herein, the term "functionalized" refers to any material or substance that has been modified to include functional groups. The functionalized material or substance may be naturally or synthetically functionalized. For example, the polypeptide may be naturally functionalized with phosphate, oligosaccharide (e.g., glycosyl phosphatidyl inositol, or phosphoglycosyl), nitrosyl, methyl, acetyl, lipid (e.g., glycosyl phosphatidyl inositol, myristoyl, or prenyl), ubiquitin, or other naturally occurring post-translational modifications. The functionalized material or substance may be functionalized for any given purpose, including changing chemical properties (e.g., changing hydrophobicity or changing surface charge density) or changing reactivity (e.g., being capable of reacting with a moiety or reagent to form a covalent bond with the moiety or reagent).

Except in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein are to be understood as being modified in all instances by the term "about". As used herein, the term "about" when used in conjunction with a percentage may represent a change of up to ±5% of the value referenced. For example, about 90% may represent from 85% to 95%. In some cases, "about" may represent a variation of up to ±4%, ±3%, ±2%, ±1%, ±0.5% or less of the referenced value. As used herein, the term "substantially," when used in reference to a measurable amount or property, refers to an amount or property having a value within ±10% of the reference value. For example, if the first value is within ±10% of the second value, the first value may be substantially the same as the second value. In another example, the shape may be substantially square if the side length ratio of the rectangle is in the range between 0.90 and 1.10. In some cases, "substantially" may mean that the value of the amount or property is within a range of up to ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.5% or less of the reference value.

As used herein, the term "attached" or "coupled" refers to a state in which two substances are joined, fastened, adhered, connected, or bound to each other. The attachment may be covalent or non-covalent. For example, the particles may be attached or coupled to the protein by covalent or non-covalent bonds. Similarly, a first nucleic acid may be attached or coupled to a second nucleic acid by hybridization or Watson-Crick base pairing. Covalent bonds are characterized by the sharing of electron pairs between atoms. Noncovalent bonds are chemical bonds that do not involve sharing of electron pairs and may include, for example, hydrogen bonds, ionic bonds, van der waals forces, hydrophilic interactions, adhesion, adsorption, and hydrophobic interactions.

The term "comprising" is intended herein to be open-ended, including not only the recited elements, but also any additional elements.

As used herein, the term "each/every (each)" when used in reference to a collection of items is intended to identify individual items in the collection, but does not necessarily refer to each (event) item in the collection. An exception may occur if the explicit disclosure or context clearly indicates otherwise.

Nucleic acid constructs

Provided herein are nucleic acids useful in forming an array of analytes that allow interrogation of analytes of the array with a single analyte resolution. The nucleic acids set forth herein may be characterized as having an adjustable two-dimensional or three-dimensional structure that facilitates one or more features selected from the group consisting of: i) Displaying the analyte in an orientation that facilitates interrogation of the analyte at a single analyte resolution; ii) maximizing the possibility of coupling to the solid support or its surface at sites configured to bind nucleic acids; iii) Maximizing the possibility of coupling to sites on the solid support or its surface in a controlled and/or non-random manner; iv) minimizing the possibility of coupling to the solid support or its surface at sites already occupied by another nucleic acid; and v) minimizing the possibility of coupling to the solid support or its surface at addresses that are not configured to bind nucleic acids. In some configurations, a nucleic acid can have all of the above-described features, as set forth herein. In other configurations, two or more nucleic acids may be complexed, wherein the nucleic acid complex has all of the above-described features.

Nucleic acids useful for organizing individual parts in a single analyte system are described herein. As set forth herein, a nucleic acid may be characterized by one or more of the following: i) Comprising a display portion configured to couple an analyte to a nucleic acid or to couple an analyte to a nucleic acid; ii) comprises a capture moiety configured to couple the nucleic acid to the solid support or a surface thereof, or to couple the nucleic acid to the solid support or a surface thereof; iii) Comprising a coupling moiety configured to couple a second molecule to a nucleic acid or to couple a second molecule to a nucleic acid; and iv) comprises a utility moiety that modifies a physical and/or chemical property of the nucleic acid. In some cases, the nucleic acid is a nucleic acid nanostructure or a Structured Nucleic Acid Particle (SNAP).

As set forth herein, a nucleic acid can comprise a naturally occurring nucleic acid structure, such as a naturally occurring primary structure (e.g., a naturally occurring single-stranded nucleotide sequence, single strand of a plasmid, etc.), a naturally occurring secondary structure (e.g., a naturally occurring a-DNA, B-DNA, Z-DNA, or double-stranded helical structure), a naturally occurring tertiary structure (e.g., a nucleic acid comprising a folded paper structural nucleosome, chromatin, etc.). As set forth herein, a nucleic acid may comprise a synthetic, artificial, or engineered nucleic acid structure. In some configurations, the nucleic acid can comprise a nucleic acid nanostructure, wherein the nucleic acid nanostructure comprises a dense three-dimensional structure. The nucleic acid nanostructure may comprise one or more structures that are not known in naturally occurring nucleic acids. The nucleic acid nanostructure can comprise one or more structures having a characterizable property that is different from the same characterizable property of a naturally occurring nucleic acid (e.g., a higher or lower average sustained length over a nucleic acid strand comprising N nucleotides, a larger or smaller radius of curvature of a nucleic acid strand comprising at least 75% double-stranded nucleic acid, a shorter or longer distance between two discrete regions of the nucleic acid strand, a temporal change in any of the foregoing properties, etc.).

The compositions and methods set forth herein will generally be exemplified with reference to nucleic acid nanostructures or SNAP; however, it should be understood that the illustrated methods and compositions may be extended to other nucleic acids, such as those set forth herein.

It is also understood that nucleic acid structures are described with respect to average spatial and/or temporal configurations. As set forth herein, nucleic acid structures may be in dynamic state with respect to common physical phenomena (e.g., thermal motion, intermolecular collisions, externally applied forces, intramolecular vibrations, intramolecular bending, intramolecular rotation, etc.) that cause spatial and/or temporal changes in nucleic acid configuration. Quantitative descriptions of nucleic acid structures may include spatial and/or temporal variations, depending on the dynamic nature of the molecular structure as understood in the art.

Aspects of nucleic acid structure: nucleic acid nanostructures (such as SNAP) may comprise various structures or structural motifs that produce higher order structures or geometries. For example, the concatemerized Rolling Circle Amplification (RCA) product may produce a spherical nanosphere structure having a spike-like structure (i.e., a nanoscale sea urchin-like structure) at the outer boundary where the single stranded concatemerized nucleic acid forms nearly 180 ° turns. In another example, SNAP may comprise DNA origami particles comprising a scaffold single-stranded nucleic acid hybridized to a plurality of oligonucleotides that shape the scaffold strand into an overall tertiary structure. Regions of tertiary structure may be joined by certain oligonucleotides of the plurality of oligonucleotides to pattern the scaffold into regular or irregular shapes, such as tiles, discs, triangles, torus, cubes, pyramids, cylinders, tubes, and other more complex two-dimensional or three-dimensional structures.

A nucleic acid nanostructure (such as SNAP) may comprise one or more facets that provide structural features and/or perform functions to the nucleic acid nanostructure. Nucleic acid nanostructures (such as SNAP) may comprise one or more of the following: 1) A display surface; 2) A capture surface; 3) A coupling surface; and 4) utility surfaces. The display face may comprise a capture moiety that couples the nucleic acid nanostructure to the analyte or is configured to couple the nucleic acid nanostructure to the analyte. The capture surface may comprise a capture moiety that couples the nucleic acid nanostructure to a surface or interface or is configured to couple the nucleic acid nanostructure to a surface or interface. The coupling face may comprise a coupling moiety that couples the first nucleic acid nanostructure with the second nucleic acid nanostructure or is configured to couple the first nucleic acid nanostructure with the second nucleic acid nanostructure. The utility face may comprise utility moieties that provide additional utility to the nucleic acid nanostructure (e.g., SNAP), such as providing structure, providing stability, altering interactions (e.g., attraction or repulsion, steric hindrance, etc.) between the nucleic acid nanostructure and another entity (e.g., a second nucleic acid nanostructure, surface, etc.), or altering physical properties of the nucleic acid nanostructure (e.g., the utility moieties may comprise electrical, magnetic, or optical materials, etc.). Nucleic acid nanostructures (such as SNAP) may comprise a face with more than one function. For example, the coupling face may also comprise a utility face. In another example, the presentation surface may also include a utility surface or a capture surface. Nucleic acid nanostructures (such as SNAP) may comprise a face composed of one or more other types of faces. For example, the display surface may comprise a portion or region that serves as a utility surface comprising a steric blocking (steric blocking) group (e.g., PEG, PEO, dextran, etc.). In some configurations, the multi-functional surface may be counted as a single surface. For example, a cube-like SNAP may comprise about six different facets, where each of the six facets comprise one or more functions, e.g., a show facet and a utility facet on one of the six sides.

A nucleic acid nanostructure (such as SNAP) may comprise one or more faces that provide functionality to the nucleic acid nanostructure. A facet may comprise a side or portion of a nucleic acid nanostructure that has a similar orientation or two-dimensional projection onto a hypothetical planar surface. Fig. 2A-2D depict examples of facets of simplified structures similar to those that may be encountered on nanostructures (such as SNAP).Fig. 2A shows two shorter tertiary structures 210 and 212 (e.g., DNA double helices) connected by a first steering joint 215. Two shorter tertiary structures 210 and 212 are connected to longer tertiary structures 220 and 222, which are connected by a third steering joint 225. The two shorter tertiary structures 210 and 212 are connected to the two longer tertiary structures 220 and 222 by a second steering joint 230. The two shorter tertiary structures 210 and 212 and the two longer tertiary structures 220 and 222 are oriented coplanar. Functional group R ₁ 、R ₂ 、R ₃ And R is ₄ Extending outwardly from the tertiary structure in a particular orientation that extends outwardly from the plane in which the tertiary structure is located. The imaginary plane P is placed orthogonally to the four tertiary structures and intersects. Fig. 2B depicts a cross-sectional view of the tertiary structure taken at plane P. Regarding the tertiary structure of the display functional group, the functional group R is shown ₁ 、R ₂ 、R ₃ And R is ₄ Is used for the relative position of the two parts. The structure depicted in FIG. 2A may be composed of four facets S ₁ 、S ₂ T and B are defined as shown in FIG. 2B. The surface represents the tertiary structure on the free surface S ₁ 、S ₂ Projections on an imaginary plane defined by B and T. Due to some degrees of freedom in the location of functional groups and/or moieties that can extend from the tertiary structure, and the size and length of the functional groups or moieties, the surface can extend beyond the tertiary structure in surface S ₁ 、S ₂ Simple orthographic projection on B or T. In some cases, the functional groups or moieties that extend from the nucleic acid nanostructure may be considered to be located in two or more faces of the nucleic acid nanostructure. In other cases, the functional groups or moieties that extend from the nucleic acid nanostructure may be considered to lie within a single plane of the nucleic acid nanostructure. The face to which the functional group or moiety is assigned may be defined by the utility or purpose of the functional group or moiety. For example, a portion having a rigid chain located near two different faces may be assigned to a single face because the orientation caused by the rigid chain is such that the portion cannot functionally reach the other face. Due to the alignment and coplanar geometry of the tertiary structure, if expanded, the surface S ₁ And S is ₂ Will meet orthogonally with faces B and T. In some cases (e.g. cylindrical or tubular Structure), one face may contain a total azimuth or orientation of at most 360 °.

FIGS. 2C-2D depict the locations of nucleic acid nanostructure faces of multiple tertiary structures that are not coplanar. Fig. 2C shows two shorter tertiary structures 210 and 212 (e.g., DNA double helices) connected by a first steering joint 215. Two shorter tertiary structures 210 and 212 are connected to longer tertiary structures 220 and 222, which are connected by a third steering joint 225. The two shorter tertiary structures 210 and 212 are connected to the two longer tertiary structures 220 and 222 by a second steering joint 230. Two shorter tertiary structures 210 and 212 are positioned below the longer tertiary structures 220 and 222. The imaginary reference plane P' generally defines a mirror symmetry plane with respect to the tertiary structure. Fig. 2D depicts the projection of tertiary structure onto plane P'. For the nucleic acid nanostructure depicted in fig. 2C, two faces D and B may be defined. If expanded, the faces will intersect, although due to the opposing geometry, the intersection will not occur orthogonally.

Nucleic acid nanostructures (such as SNAP) may have a specific number of facets. The nucleic acid nanostructure can have at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 facets. Additionally or alternatively, the nucleic acid nanostructure can have no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 facets. The number of facets of the nucleic acid nanostructure can be selected to match the functionality of the nucleic acid nanostructure. For example, SNAP configured to couple an analyte to a solid support may require at least 2 facets (display and coupling facets), adding additional facets (e.g., utility facets) based on other design considerations.

A nucleic acid nanostructure (such as SNAP) may comprise two or more faces, each of which has a different utility. The nucleic acid nanostructure may comprise one or more utilities selected from the group consisting of: 1) A presentation surface coupled or configured to couple an analyte; 2) A capture surface coupled or configured to be coupled to a surface; 3) Coupling or configured to couple the first nucleic acid nanostructure to a coupling face of the second nucleic acid nanostructure; and 4) a utility face that provides any additional utility (e.g., space enclosure). In some configurations, the nucleic acid nanostructure can comprise a first utility (e.g., a display surface comprising a display portion), and the second surface can comprise a second utility (e.g., a capture surface comprising a capture portion). In other configurations, two or more faces may have the same utility (e.g., two or more show faces), but one of the two or more faces may contain a different utility (e.g., capture face). In some configurations, the nucleic acid nanostructures can comprise the same two or more utilities on two or more sides (e.g., two opposite sides that serve as display and capture sides).

Nucleic acid nanostructures, such as SNAP, may comprise structural symmetry, for example, according to an axis of symmetry (i.e., rotational symmetry) or plane of symmetry (i.e., reflective symmetry). The tertiary structure of the nucleic acid nanostructure may comprise structural symmetry, e.g., according to an axis of symmetry (e.g., aligned with the centerline of the helical structure). The plurality of tertiary structures as a whole may comprise structural symmetry, for example according to an axis or plane of symmetry. The face of the nucleic acid nanostructure may be oriented with respect to an axis of symmetry or plane of symmetry of the nucleic acid nanostructure or one of a plurality of tertiary structures forming the nucleic acid nanostructure. For example, for the cross-section shown in FIG. 2B, the top surface T may be oriented at 0 with respect to an axis of symmetry coaxial with any of the four tertiary structures, while the surface S ₁ B and S ₂ May be oriented at 90 °, 180 ° and 270 °, respectively. For nucleic acid nanostructures (e.g., SNAP) comprising a first tertiary structure and a second tertiary structure, the orientation of a first side (e.g., display side, capture side, coupling side, or utility side) or the orientation of a second side (e.g., display side, capture side, coupling side, or utility side) can be defined relative to the axis of symmetry of the first tertiary structure or the axis of symmetry of the second tertiary structure. In some configurations, the orientation of the first face may be the same as the orientation of the second face (e.g., the face having the display and capture utility). Based on average spatial bits perpendicular to the defined first plane The angular offset between the first vector of the plane of placement and the second vector of the plane perpendicular to the plane defining the average spatial position of the second face may determine the orientation of the first face with respect to the orientation of the second face. In other configurations, the orientation of the first face may be offset from the orientation of the second face by at least about 90 °. In other configurations, the orientation of the first face may be offset from the orientation of the second face by about 180 °. The nucleic acid nanostructure can comprise a first face and a second face that are angularly offset by at least about 10 °, 20 °, 30 °, 40 °, 50 °, 60 °, 70 °, 80 °, 90 °, 100 °, 110 °, 120 °, 130 °, 140 °, 150 °, 160 °, 170 °, 180 °, 190 °, 200 °, 210 °, 220 °, 230 °, 240 °, 250 °, 260 °, 270 °, 280 °, 290 °, 300 °, 310 °, 320 °, 330 °, 340 °, 350 °, or more than 350 °. Alternatively or additionally, the nucleic acid nanostructure may comprise a first face and a second face that are angularly offset by no more than about 360 °, 350 °, 340 °, 330 °, 320 °, 310 °, 300 °, 290 °, 280 °, 270 °, 260 °, 250 °, 240 °, 230 °, 220 °, 210 °, 200 °, 190 °, 180 °, 170 °, 160 °, 150 °, 140 °, 130 °, 120 °, 110 °, 100 °, 90 °, 80 °, 70 °, 60 °, 50 °, 40 °, 30 °, 20 °, 10 °, or less than 10 °.

A nucleic acid nanostructure, such as SNAP, may comprise a plurality of tertiary or quaternary structures that at least partially enclose or substantially enclose an interior volume region. The nucleic acid nanostructures may have a three-dimensional structure, such as a pyramid, a shell, a cylinder, a disk, a sphere, a cube (e.g., a cube or rectangular cube) or a block that contains an interior volume region. The interior volume region may be a three-dimensional volume within the nucleic acid nanostructure that is large enough to contain the analyte or other molecules set forth herein. The nucleic acid nanostructure can be configured to comprise an interior volume region, wherein the interior volume region comprises a utility surface, such as a display surface or a capture surface. The utility portion may be displayed within the interior volume region. For example, the presentation moiety may be presented within an interior volume region of SNAP such that the analyte is at least partially coupled within the interior volume region. In another example, the capture moiety may be displayed within the interior volume region of SNAP such that a complementary portion of the surface must at least partially enter the interior volume region to couple with the capture moiety (see fig. 38A and 38B).

In some configurations, an interior volume region can be created in a nucleic acid nanostructure (e.g., SNAP) to control interactions between the nucleic acid nanostructure and other entities. The interior volume region may comprise one or more moieties that alter the chemical properties (e.g., hydrophobicity, hydrophilicity, reactivity, polarity, solubility, etc.) of the interior volume region to differ from the chemical properties of the surrounding nucleic acid nanostructure. Fig. 39A depicts SNAP 3910 comprising an interior volume region 3920 containing a capture moiety comprising a reactive group 3925 and a plurality of hydrophobic molecules 3928 surrounding the reactive group 3925. SNAP may be in contact with surface 3930, which includes a plurality of hydrophilic groups 3932 terminating with complementary reactive groups 3935 and a plurality of hydrophobic groups 3938 terminating with complementary reactive groups 3935. As shown in fig. 39B, the hydrophobic nature of interior volume region 3920 may increase the likelihood that SNAP 3910 will deposit and couple to surface 3930 in a region comprising a plurality of hydrophobic groups 3938.

In some configurations, an interior volume region can be created in a nucleic acid nanostructure (e.g., SNAP) to control interactions that portions within the interior volume region may participate in. The orientation of the portions within the interior volume region may be controlled to increase, decrease, or otherwise control the orientation in which interactions may occur. A portion may be displayed within the interior volume in a manner that limits or controls the size of entities that may interact with the portion. Fig. 38A depicts SNAP 3810 comprising an interior volume region 3820 comprising a coupled multivalent binding moiety (e.g., streptavidin, avidin) 3830. The coupled multivalent binding moiety 3830 is oriented within the interior volume region 3830 such that only one binding site 3835 is available for participating in binding interactions with an entity 3830 that includes a complementary binding group (e.g., biotin) 3835 that is configured to couple with the binding site 3835. As shown in fig. 38B, the coupled multivalent binding moiety 3830 is essentially monovalent due to its orientation within the interior volume region 3820, thereby forming only one binding interaction with the entity 3840.

The nucleic acid nanostructure may comprise a first tertiary domain and a second tertiary domain that are oriented with respect to each other by one or more nucleic acid strands that form a connecting strand (e.g., a staple oligonucleotide) between the first tertiary domain and the second tertiary domain. The connecting strand may comprise single-stranded, double-stranded, partially double-stranded or multi-stranded nucleic acid. In some configurations, the nucleic acid nanostructure can comprise a first oligonucleotide having a first nucleic acid sequence and a second nucleic acid sequence that hybridizes to a complementary sequence of the second oligonucleotide to form a first tertiary domain and a second tertiary domain, wherein the first nucleic acid sequence and the second nucleic acid sequence of the first oligonucleotide are separated by a linker nucleic acid sequence comprising a single-stranded linker strand between the first tertiary domain and the second tertiary domain. For example, the first oligonucleotide may be a staple that hybridizes to the scaffold nucleic acid to form a first tertiary domain and a second tertiary domain in a nucleic acid paper folding structure.

The nucleic acid nanostructure may comprise a first tertiary domain and a second tertiary domain, wherein the relative angular orientation or spatial separation of the two domains is controlled by one or more connecting chains. The angular orientation and/or spatial separation of the first tertiary domain and the second tertiary domain can be adjusted based on the spatial position of the nucleotides within the helical structure of the domains. Each complete double-stranded nucleic acid helix typically contains 10 to 11 nucleotide base pairs. Thus, the initial angle of extension of the ligation strand can be adjusted by the nucleotide position within the helix. The structural tunability of nucleic acid nanostructures can also be obtained by varying the length of the connecting strands and varying the separation distance between successive connecting strands. Fig. 49A-49E depict orientations that control the orientation of tertiary structures in nucleic acid nanostructures. Fig. 49A depicts a top view of a portion of a nucleic acid nanostructure comprising a first oligonucleotide 4910 (e.g., a scaffold strand) and a second oligonucleotide 4920 (e.g., a staple oligonucleotide), wherein the second oligonucleotide 4920 hybridizes to the first oligonucleotide 4910 to form a first tertiary domain 4930 and a second tertiary domain 4932, which are linked by a connecting strand comprising a single-stranded nucleic acid sequence of the second oligonucleotide 4920. FIGS. 49B-49C depict the difference in the initial orientation of the connecting strand of the second oligonucleotide 4920 as seen with respect to the helical axes of the first and second tertiary domains 4930 and 4932, as determined by the nucleotide position within a one-turn helix. Fig. 49B depicts a configuration in which the initial orientations of the connecting links are not coplanar, while fig. 49C depicts a configuration in which the initial orientations of the connecting links are coplanar. Furthermore, for a fixed length of the connecting strand, the difference in the initial orientation of the connecting strand may affect the separation distance or the amount of separation distance variation between two adjacent tertiary structural domains, for example, as shown in fig. 49B and 49C. FIGS. 49D-49E show possible relative positions of tertiary structural domains based on the orientation of the connecting chains, as shown in FIGS. 49B-49C, respectively. Fig. 49D depicts a skewed orientation between the first tertiary domain 4930 and the second tertiary domain 4932, while fig. 49E depicts a coplanar orientation between the first tertiary domain 4930 and the second tertiary domain 4932, each of which results from the positioning of the second oligonucleotide 4920 from a component of a double stranded nucleic acid of a ligation strand to a nucleotide of a single stranded nucleic acid.

The position of the connecting strand may influence the conformation of the first tertiary domain relative to the second tertiary domain in the nucleic acid nanostructure. For example, to configure the first and second tertiary domains in a substantially coplanar orientation (i.e., minimal angular offset between the two tertiary domains), consecutive connecting strands can be placed about an odd number of helical half turns apart (e.g., about 1, 3, 5, 7, 9, etc. half turns apart or about 6, 16, 27, 37, 48, etc. nucleotides apart). Alternatively, to configure the first tertiary domain and the second tertiary domain in a skewed orientation (i.e., a measurable angular offset between the two tertiary structures)The domains, the continuous connecting strand may be placed at positions other than the half turn of the helix, or may be placed at random or varying positions, including the half turn of the helix and positions other than the half turn of the helix. For example, consecutive ligation strands may be separated by about an even number of helix half-turns (e.g., about 2, 4, 6, 8, 10, etc. half-turns or about 11, 21, 31, 41, 52, etc. nucleotides apart) or fractional helix half-turns other than half-turns (e.g., 3/4 turns, 1) ³ / ₄ Turn, 2 ¹ / ₄ Rotate, etc.). In some configurations, it may be preferable to produce a nucleic acid nanostructure comprising a substantially planar structure, wherein the planar structure comprises a plurality of coplanar tertiary structures. For example, the nucleic acid nanostructure may comprise a capture surface that is substantially planar to increase electrostatic interactions between the capture surface and the planar surface of the solid support. In other configurations, it may be preferable to produce nucleic acid nanostructures comprising non-planar structures comprising multiple tertiary structures, such as curved surfaces or corrugated surfaces. For example, the nucleic acid nanostructures may comprise a capture surface comprising a corrugated texture to increase electrostatic interactions between the capture surface and the roughened surface of the solid support.

The nucleic acid nanostructure can comprise one or more features or configurations that deviate from the features or configurations of naturally occurring nucleic acids. As set forth herein, a nucleic acid nanostructure may comprise one or more non-natural nucleic acid structures that increase the tunability of the nanostructure for one or more purposes, such as coupling and/or display of analytes and coupling of the nanostructure to a solid support or surface thereof. Nucleic acid nanostructures may be characterized by the presence of one or more non-natural nucleic acid structures, including but not limited to: i) More than the number of oligonucleotides hybridized to a given nucleic acid strand of the same length and sequence, ii) an increase in the bulk and/or area density of nucleotide packing within the nanostructure or component structure thereof as compared to a natural nucleic acid of the same or similar sequence content, iii) an increase in the sharpness of nucleic acid strand bending as compared to a naturally occurring nucleic acid of the same sequence or length, iv) a decrease in the separation distance between discrete regions of nucleic acid strands within the nanostructure as compared to a naturally occurring nucleic acid of the same sequence or length, v) a decrease in the degree of sequence complementarity within the nanostructure as compared to a naturally occurring nucleic acid occupying a similar volume in solution, vi) a greater mechanical rigidity of nucleic acid strands in the nanostructure as compared to the mechanical rigidity of a naturally occurring nucleic acid of the same sequence or length, and vii) combinations thereof.

As set forth herein, a nucleic acid nanostructure can comprise more complex oligonucleotides or nucleic acid strands than are known to exist in a natural nucleic acid system (such as a natural nucleic acid system having the same mass as the nucleic acid nanostructure). Naturally occurring nucleic acids are predominantly nucleic acid strands (e.g., chromosomal DNA, plasmid strands) having partially or fully complementary strands. Naturally occurring nucleic acids can be distinguished by complete or near complete complementarity of hybridized nucleic acid strands. Naturally occurring nucleic acids can be further distinguished by relatively small numbers of nucleic acid strands that are simultaneously complexed by hybridization between each nucleic acid strand in a nucleic acid complex. For example, a naturally occurring holliday linker (Holliday junction) structure will typically comprise hybridization of four nucleic acid strands, each strand of a linker complex having a high degree of sequence complementarity with the other two strands of the complex. Naturally occurring nucleic acids typically require additional proteins to complex multiple nucleic acid strands (e.g., chromosomal kinetochore, 3 nucleic acid complexes formed by RNA polymerase during gene transcription, RNA strands and two complementary DNA strands, etc.). In contrast, as set forth herein, a nucleic acid nanostructure may comprise a greater number of composite nucleic acid oligonucleotides or nucleic acid strands than are known to exist in natural nucleic acid systems. For example, a nucleic acid nanostructure can comprise at least 10, 25, 50, 100, 150, 200, or more than 200 composite oligonucleotides or nucleic acid strands, wherein each oligonucleotide or nucleic acid strand hybridizes to at least one other oligonucleotide or nucleic acid strand of the nucleic acid nanostructure. In some configurations, the nucleic acid nanostructure may also be characterized by the absence of a non-nucleic acid structural element (e.g., polypeptide, protein, polymer, nanoparticle) configured to link a first oligonucleotide or nucleic acid strand to a second oligonucleotide or nucleic acid strand.

As set forth herein, a nucleic acid nanostructure can comprise an increased volume and/or area density of nucleotide stacks within the nanostructure or component structures thereof relative to a naturally occurring nucleic acid, such as a naturally occurring nucleic acid having the same mass, nucleotide sequence, or sequence length as the nucleic acid nanostructure. Naturally occurring nucleic acids generally achieve bulk nucleotide density by helical crimping of double-stranded nucleic acids and supercoiling of helical nucleic acids into a dense structure. However, to achieve a stack of double-stranded nucleic acids with a strand curvature exceeding the sustained length of the double-stranded nucleic acid, naturally occurring nucleic acids are typically complexed with a protein (e.g., histone) that concentrates the helical nucleic acid into a supercoiled structure. In contrast, a nucleic acid nanostructure can comprise a volumetric nucleotide density that exceeds that of a naturally occurring nucleic acid. Nucleic acid nanostructures can achieve greater volumetric nucleotide densities than naturally occurring nucleic acids by increased bending and/or curvature of the nucleic acid structures and/or closer proximity of the helical structures within the nucleic acid nanostructures. In some configurations, the nucleic acid nanostructure can achieve a greater volumetric nucleotide density than a naturally occurring nucleic acid in the absence of non-nucleic acid structural elements (e.g., polypeptides, proteins, polymers, nanoparticles) configured as a concentrated nucleic acid structure.

As set forth herein, a nucleic acid nanostructure can comprise an increased degree of nucleic acid bending relative to the length of the sequence and/or the degree of secondary structuring relative to a naturally occurring nucleic acid, such as a naturally occurring nucleic acid having the same nucleotide sequence or mass as the nucleic acid nanostructure. Naturally occurring double-stranded nucleic acids have a large duration that makes it impossible for any portion of the double-stranded nucleic acid to approach, for example, within about 10 nanometers of any other portion, in the absence of a structure-altering group (e.g., histone). Even if single-stranded nucleic acids are present in naturally occurring nucleic acids, it is unlikely that the two parts of the tertiary structure will approach each other within, for example, about 10 nanometers due to electrostatic repulsion of the negatively charged polynucleotide backbone. Furthermore, in the absence of unifying elements (e.g., histones, linked nucleic acids), it is not possible for the two tertiary structures to remain stably oriented in a compact configuration in naturally occurring nucleic acids. In contrast, as set forth herein, a nucleic acid nanostructure may comprise a sharply-curved nucleic acid structure that increases the proximity of a helical structure by segmenting double-stranded nucleic acids with single-stranded nucleic acid sequences. Adjacent helical structures may be held in close proximity by linking nucleic acid strands that spatially and/or temporally stabilize the proximity and orientation of adjacent helical structures relative to each other. As set forth herein, a nucleic acid nanostructure can be further distinguished from naturally occurring nucleic acid due to the presence of stable (i.e., spatially and/or temporally invariant) bends in the nucleic acid strand comprising the two segmented regions of the helical structure, e.g., bends of at least 90 ° to 180 ° relative to the length of a single-stranded nucleic acid segment (e.g., no more than 50, 40, 30, 25, 20, 15, or 10 nucleotides) of the nucleic acid strand separating the two segmented regions of the helical structure. Alternatively or additionally, as set forth herein, a nucleic acid nanostructure can be further distinguished from a naturally occurring nucleic acid in that there is a stable (i.e., spatially and/or temporally invariant) bend in the nucleic acid strand comprising two segmented regions of the helical structure, e.g., a bend of at least 90 ° to 180 ° relative to the secondary degree of structuring of the nucleic acid nanostructure (e.g., comprising at least about 80%, 85%, 90%, or 95% base pairing nucleotides relative to the total nucleotide content).

As set forth herein, a nucleic acid nanostructure may comprise a reduced separation distance between adjacent nucleic acid structures within the nanostructure relative to a naturally occurring nucleic acid, such as a naturally occurring nucleic acid having the same mass, nucleotide sequence, or sequence length as the nucleic acid nanostructure. Adjacent helical (e.g., tertiary) structures may remain in a time and/or space stable configuration at distances of, for example, less than about 10, 9, 8, 7, 6, 5, 4, 3, or 2 nanometers. Due to structural strain introduced by electrostatic repulsion of adjacent polynucleotide strands, close proximity of adjacent helical structures in a nucleic acid nanostructure is not possible. Due to the presence of one or more linked nucleic acid strands that stabilize the nucleic acid structure, the nucleic acid nanostructure may be able to achieve close spatial proximity of the helical structure and sharp bend angles of the nucleic acid strands.

As set forth herein, a nucleic acid nanostructure can comprise a low degree of sequence complementarity relative to the total amount of nucleic acid relative to a naturally occurring nucleic acid, such as a naturally occurring nucleic acid having the same mass, nucleotide sequence, or sequence length as the nucleic acid nanostructure. Naturally occurring nucleic acid strands will typically hybridize to complementary nucleic acid strands having the same sequence length. In addition to replication or alignment errors, co-hybridized strands can be expected to have near complete sequence complementarity, resulting in a nearly complete hybridized structure in a stable configuration. In contrast, as set forth herein, a nucleic acid nanostructure can comprise a plurality of single stranded nucleic acids within the nanostructure. Single-stranded nucleic acids within a nucleic acid nanostructure can be characterized as being spatially and/or temporally stable, in contrast to naturally occurring nucleic acids, in which single-stranded nucleic acids often form and do not form transiently throughout the structure of the nucleic acid due to various biological processes. As set forth herein, a nucleic acid nanostructure can comprise a stable fraction of single stranded nucleic acids, as measured by the percentage of unpaired nucleotides within the nanostructure. In some configurations, the nucleic acid nanostructure can comprise a dense region that is predominantly double-stranded nucleic acid and a permeable region that is predominantly single-stranded nucleic acid. In a particular configuration, the nucleic acid nanostructure can comprise a dense region of predominantly double-stranded nucleic acid and a permeable region of predominantly single-stranded nucleic acid, wherein the permeable region comprises a greater total amount of nucleotides than the dense region. The nucleic acid nanostructure can comprise a spatially and/or temporally stable fraction of single stranded nucleic acid, as measured by unpaired nucleotides, such as at least about 5%, 10%, 20%, 30%, 40%, 50%, 60% or more than 60% single stranded nucleic acid.

As set forth herein, a nucleic acid nanostructure may comprise greater mechanical rigidity relative to the amount of single stranded nucleic acid within the nanostructure when compared to a naturally occurring nucleic acid (such as a naturally occurring nucleic acid having the same mass, nucleotide sequence, or sequence length as the nucleic acid nanostructure). For example, single-stranded nucleic acid strands within a linear double-stranded nucleic acid will generally produce reduced rigidity within the double-stranded nucleic acid, as evidenced by an increase in relative movement between the ends of the nucleic acid. An increase in the amount of single-stranded nucleic acid within a linear double-stranded nucleic acid is expected to further decrease the amount of rigidity of the nucleic acid. In contrast, a nucleic acid nanostructure may comprise greater rigidity on a spatial and/or temporal basis relative to the total single stranded nucleic acid content, as set forth herein, relative to a naturally occurring nucleic acid having the same single stranded nucleic acid content. The increased rigidity may be due to the linked strands of the nucleic acid structure being stabilized relative to each other within the nucleic acid nanostructure.

Nucleic acid configuration: described herein are nucleic acid nanostructures, such as SNAP. Nucleic acid nanostructures can be used for a variety of purposes, including displaying molecules or analytes at a surface or interface (such as a solid support or phase boundary). The described nucleic acid nanostructures (such as SNAP) may comprise a variety of primary, secondary, tertiary, or quaternary structures that produce dense nucleic acid particles of various geometries that add utility to the nanostructure. Any given nucleic acid nanostructure can provide one or more functions, including displaying a molecule or analyte (displaying SNAP) or performing other nanostructure-related utility (utility SNAP). Nucleic acid nanostructures (such as utility SNAP) may perform the following functions: such as coupling a molecule or analyte to a surface or interface (capturing SNAP), coupling a nucleic acid nanostructure to another nucleic acid nanostructure (coupling SNAP), providing other structural utility to a nucleic acid nanostructure or complex thereof (structural SNAP), or a combination thereof. In some configurations, the nucleic acid nanostructure can comprise a display SNAP, a utility SNAP, or a combination thereof. For example, a nucleic acid nanostructure (e.g., SNAP) can be configured to couple with an analyte and a solid support such that the nucleic acid nanostructure is both a display nanostructure and a utility nanostructure.

The nucleic acid nanostructure (such as SNAP) may comprise a display surface comprising a display portion. The presentation moiety may be configured to couple the analyte by a suitable interaction, such as covalent bond, non-covalent interaction, electrostatic interaction or magnetic interaction. The presentation moiety may comprise one or more functional groups, ligands, or other moieties configured to couple to an analyte. The display portion may comprise a residue of a nucleic acid or may comprise a functional group, ligand or moiety coupled thereto. The display portion may also comprise one or more secondary, tertiary or quaternary structures positioned within the display surface. Nucleic acid nanostructures (such as SNAP) may comprise a capture surface comprising a capture moiety. The capture moiety may be configured to couple to the surface by a suitable interaction, such as covalent bond, non-covalent interaction, electrostatic interaction, or magnetic interaction. The capture moiety may comprise one or more functional groups, ligands, or other moieties configured to couple to a surface. The capture moiety may also comprise one or more secondary, tertiary or quaternary structures positioned within the capture plane.

The display portion may comprise two or more of a plurality of tertiary structures. The capture moiety may comprise two or more capture tertiary structures of the plurality of tertiary structures. In some configurations, a display tertiary structure of the two or more display tertiary structures may comprise a capture tertiary structure of the two or more capture tertiary structures. For example, in fig. 2B, the face T may comprise a display portion and the face B may comprise a capture portion, wherein the four tertiary structures belong to both portions. In other configurations, the two or more display tertiary structures do not comprise any capture tertiary structures of the two or more capture tertiary structures. For example, in fig. 2D, the presentation portion may comprise two tertiary structures associated with face D, and the capture portion may comprise two tertiary structures associated with face B. In some configurations, the two or more capture tertiary structures do not comprise any of the two or more display tertiary structures.

Nucleic acid nanostructures (such as SNAP) may comprise multiple nucleic acid strands, which are molecules that separate from each other without breaking covalent bonds. For example, SNAP may comprise a nucleic acid molecule that forms a scaffold chain and a plurality of staple oligonucleotide molecules that hybridize to the scaffold chain. In some configurations, the scaffold strand may comprise one oligonucleotide of a plurality of oligonucleotides, wherein the oligonucleotide is coupled to a greater number of oligonucleotides in the plurality of oligonucleotides than any other oligonucleotides in the plurality of oligonucleotides. The scaffold strands may comprise linear, branched or circular polynucleotides. In some configurations, the nucleic acid nanostructure may comprise two or more scaffold chains, such as about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more scaffold chains, wherein each chain is optionally a separate molecule from the other chains of the nucleic acid nanostructure. A nucleic acid nanostructure having two or more scaffold chains may comprise a first scaffold chain linked to a second scaffold chain by one or more oligonucleotides of a plurality of oligonucleotides hybridized to the first and second scaffold chains. The first strand may be linked to the second strand by a number of a plurality of oligonucleotides, e.g., at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or more than 50% of the oligonucleotides in the plurality of oligonucleotides. Alternatively or additionally, the first scaffold strand may be linked to the second scaffold strand by at least about 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less than 1% of the oligonucleotides of the plurality of oligonucleotides.

A nucleic acid scaffold may comprise a continuous nucleic acid strand, with or without complementary oligonucleotides, that is a circular or linked strand (i.e., the scaffold strand has no 5 'or 3' ends). In some configurations, the scaffold chain is derived from a natural source, such as a viral genome or bacterial plasmid. In other configurations, the stent chains may be engineered, rationally designed, or synthesized in whole or in part. The scaffold strand may comprise one or more modified nucleotides. The modified nucleotides may provide binding sites for attaching additional components, such as affinity reagents or detectable labels. The modified nucleotides may be used as binding sites for additional components (e.g., binding components or labeling components) before, during, or after assembly of the nucleic acid nanostructure (such as SNAP). The modified nucleotide may include a linking group or a reactive handle (e.g., a functional group configured to perform a click reaction). In some configurations, the nucleic acid scaffold may comprise a single strand of the M13 viral genome. The size of the scaffold chains may vary depending on the desired size of the nucleic acid nanostructure. The scaffold strands may comprise a length of at least about 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9500, 10000, or more than 10000 nucleotides. Alternatively or additionally, the scaffold strand may comprise a length of up to about 10000, 9500, 9000, 8800, 8600, 8400, 8200, 7800, 7600, 7400, 7200, 7000, 6800, 6600, 6400, 6200, 6000, 5800, 5600, 5400, 5200, 5000, 4500, 4000, 3500, 3000, 2500, 2000, 1500, 1000 or less than 1000 nucleotides.

A nucleic acid nanostructure (such as SNAP) may comprise a plurality of staple oligonucleotides. The staple oligonucleotides may comprise any oligonucleotide that hybridizes to or is configured to hybridize to a nucleic acid scaffold, other staples, or a combination thereof. The staple oligonucleotides may be modified to include additional chemical entities such as binding components, labeling components, chemically reactive groups or handles or other groups (e.g., polyethylene glycol (PEG) moieties). Staple oligonucleotides may comprise linear or circular nucleic acids. The staple oligonucleotides may comprise one or more single stranded regions, double stranded regions, or a combination thereof. For example, the staple oligonucleotides may hybridize to or be configured to hybridize to the rack strand or one or more other staples by complementary base pair hybridization (e.g., watson-Crick hybridization). Staple oligonucleotides can hybridize to other nucleic acids by complementary base pair hybridization or ligation. The staple oligonucleotides may be configured to act as primers for complementary nucleic acid strands, and, for example, using a scaffold, staple, or other strand as a template, the primer staples may be extended by an enzyme (e.g., polymerase) to form an extended region of double-stranded nucleic acid. In some cases, the primer need not hybridize to the template upon extension. For example, the primer may be extended by: the addition of one or more nucleotides by terminal transferase without template, the addition of one or more oligonucleotides by ligase without template, or the addition of nucleotides or oligonucleotides by non-enzymatic chemical reaction without template. The staple oligonucleotides may include one or more modified nucleotides. The modified nucleotide may include a linking group or a reactive handle (e.g., a functional group configured to perform a click-type reaction).

The staple oligonucleotides may be of any length, depending on the design of SNAP. May be provided by a software package, such as cadnan No ² Design of staple oligonucleotides by ATHENA or DAEDALUS. The staple oligonucleotides can have a length of at least about 10, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 nucleotides. Alternatively or additionally, the staple may have no more than about 5000, 4500, 4000, 3500, 3000, 2500, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350,300, 250, 200, 150, 100, 50, 25, 10 or less than 10 nucleotides in length.

The staple may comprise a first nucleotide sequence and a second nucleotide sequence, wherein the first nucleotide sequence hybridizes to a first complementary sequence, and wherein the second nucleotide sequence hybridizes to a second complementary sequence. In some configurations, a staple can comprise a first nucleotide sequence and a second nucleotide sequence, wherein the first nucleotide sequence hybridizes to a first complementary sequence, wherein the second nucleotide sequence hybridizes to a second complementary sequence, and wherein the first nucleotide sequence is linked to the second nucleotide sequence through a linking moiety (e.g., a linker, an intermediate single-stranded nucleotide sequence, an intermediate double-stranded nucleotide sequence, an intermediate nucleotide sequence that is not configured to be coupled to a complementary nucleotide sequence, etc., as set forth herein). In some configurations, the staple can comprise a first nucleotide sequence and a second nucleotide sequence, wherein the first nucleotide sequence hybridizes to a first complementary sequence of the scaffold strand, and wherein the second nucleotide sequence hybridizes to a second complementary sequence of the scaffold strand. In a particular configuration, the first and second complementary sequences of the scaffold strand may be discontinuous such that the two complementary sequence regions are separated by a third region of the scaffold strand. The staple may comprise a first nucleotide sequence and a second nucleotide sequence, wherein the first nucleotide sequence hybridizes to a first complementary sequence, and wherein the second nucleotide sequence does not hybridize to a second complementary sequence (e.g., overhang). The first nucleotide sequence or the second nucleotide sequence of the staple oligonucleotide may comprise a sequence length of at least about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides. Alternatively or additionally, the first nucleotide sequence or the second nucleotide sequence of the staple oligonucleotide may comprise a sequence length of no more than about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or less than 3 nucleotides. As set forth herein, the sequence length of the nucleotide sequence of the staple oligonucleotide can be selected to provide a hybridized nucleic acid containing the staple oligonucleotide at a particular melting temperature.

The staple oligonucleotides may include one or more modified nucleotides. The modified nucleotide may provide a binding site for attaching additional components, such as a binding component or a labeling component. Modified nucleotides may increase the stability of the oligonucleotide to chemical degradation, such as Locked Nucleic Acids (LNA). The modified nucleotides may be used as binding sites for additional components before, during or after assembly of the nucleic acid nanostructure (such as SNAP). The staple oligonucleotides may include at least about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more than 100 modified nucleotides. Alternatively or additionally, the staple oligonucleotides may include no more than about 100, 75, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 modified nucleotides.

As set forth herein, a nucleic acid nanostructure can comprise a plurality of nucleic acids, wherein each nucleic acid of the plurality of nucleic acids hybridizes to one or more other nucleic acids of the plurality of nucleic acids. In some configurations, the nucleic acid nanostructure can comprise at least 5 nucleic acids, wherein each of the at least 5 nucleic acids is coupled to one or more other nucleic acids of the at least 5 nucleic acids. The plurality of nucleic acids of the nucleic acid nanostructure may comprise a scaffold chain, wherein the scaffold chain is characterized by one or more of the following features: i) Comprising the longest nucleotide sequence of the plurality of nucleic acids, and ii) configured to hybridize to a greater number of other nucleic acids of the plurality of nucleic acids. The plurality of nucleic acids of the nucleic acid nanostructure may further comprise one or more staple oligonucleotides, wherein the staple oligonucleotides are characterized by one or more of the following features: i) Comprising two or more non-contiguous nucleotide sequences configured to hybridize to one or more other nucleic acids (e.g., one or more regions of a scaffold chain, a scaffold chain and a second staple oligonucleotide, a second staple oligonucleotide and a third staple oligonucleotide, etc.), ii) comprising two or more non-contiguous nucleotide sequences configured to form two or more secondary and/or tertiary structures when hybridized to one or more other nucleic acids, ii) comprising one or more nucleotide sequences not configured to hybridize to other nucleic acids, and iii) comprising one or more nucleotide sequences configured to constrain the position, orientation, and/or movement of a first secondary and/or tertiary nucleic acid structure relative to a second secondary and/or tertiary nucleic acid structure.

Fig. 51 shows a schematic diagram of a nucleic acid nanostructure comprising a scaffold chain 5101 and a plurality of staple oligonucleotides, wherein the staple oligonucleotides have a variety of structural and/or functional roles. The nucleic acid nanostructure comprises a plurality of structural staple oligonucleotides each having one or more of the following properties: i) Combined with the scaffold chain 5101 to form one or more tertiary structures, and ii) form a linked single-stranded nucleic acid that positions and orients two or more tertiary structures of the nucleic acid nanostructure with respect to each other. The structural staple oligonucleotides include: 1) a nucleic acid 5104 that binds to a scaffold chain 5101 to form a tertiary structure region, 2) a nucleic acid 5107 that binds to a scaffold chain 5101 at two nucleotide sequences to form a substantially 180 ° bend in a nucleic acid nanostructure and links two tertiary structures formed by binding a nucleic acid 5107 to a scaffold chain 5101 by a linked chain comprising a single-stranded nucleotide sequence of the nucleic acid 5107, 3) a nucleic acid 5108 that binds to a scaffold chain 5101 at three non-contiguous nucleotide sequences to form at least 3 tertiary structures and 2 substantially 180 ° bends in a nucleic acid nanostructure, and 4) a nucleic acid 5109 that each comprises a first sequence complementary to a scaffold chain 5101 and a second sequence complementary to another nucleic acid 5109 to form 3 tertiary structures and 1 substantially 180 ° bend in a nucleic acid nanostructure. The nucleic acid nanostructure may also comprise a non-nucleic acid structural element 5110, such as a nucleic acid binding protein (e.g., histone) or nanoparticle, wherein the non-nucleic acid structural element 5110 forms or stabilizes a portion of a two-dimensional and/or three-dimensional structure of the nucleic acid nanostructure. The nucleic acid nanostructure further comprises a plurality of functional staple oligonucleotides, each of the structural staple oligonucleotides having one or more of the following properties: i) Combined with the scaffold chain 5101 to form one or more tertiary structures, and ii) modifying the nucleic acid nanostructure to provide additional chemical and/or physical properties to the nucleic acid nanostructure. Functional staple oligonucleotides include: 1) a nucleic acid 5102 that binds to a scaffold chain 5101 to form a tertiary structure and comprises a portion 5103 (e.g., a terminal ligand, a non-terminal ligand, a terminal functional group, a non-terminal functional group, a modified nucleotide, a non-nucleic acid polymer, etc.), 2) a nucleic acid 5105 that binds to a scaffold chain 5101 to form a tertiary structure and comprises a detectable label 5106 (e.g., a fluorophore, a nucleic acid barcode, a peptide barcode, etc.), 3) a pendent nucleic acid 5111 that binds to a scaffold chain 5101 to form a tertiary structure and comprises unconjugated terminal residues or nucleotide sequences, 4) a pendent nucleic acid 5112 that comprises two unconjugated terminal residues or nucleotide sequences and an intermediate nucleotide sequence that binds to a scaffold chain 5101 to form a tertiary structure, and 5) a pendent nucleic acid 5113 that comprises two terminal nucleotide sequences that bind to a scaffold chain 5101 to form a tertiary structure and an intermediate nucleotide sequence that depends from a nucleic acid nanostructure (comprising one or more conjugated oligonucleotides 5114 that provide a single-stranded portion of the tertiary structure to the nucleic acid 5113).

Nucleic acid nanostructures (such as SNAP) may include nucleic acid paper folding. Thus, a nucleic acid nanostructure may include one or more nucleic acids having a tertiary or quaternary structure, such as spheres, cages, tubes, boxes, tiles, blocks, trees, pyramids, wheels, combinations thereof, and any other possible structure. Examples of such structures formed with DNA origami are set forth in Zhao et al Nano lett.11,2997-3002 (2011), which is incorporated herein by reference. In some configurations, a nucleic acid nanostructure (such as SNAP) can comprise a scaffold strand and a plurality of staple oligonucleotides, wherein the scaffold strand is a single continuous nucleic acid strand and the staple oligonucleotides are configured to be fully or partially bound to the scaffold strand. Examples of DNA origami structures formed using a continuous rack chain and several staple chains are set forth in the following documents: rothemund Nature 440:297-302 (2006) and U.S. Pat. Nos. 8,501,923 and 9,340,416, each of which is incorporated herein by reference. Nucleic acid nanostructures comprising one or more nucleic acids (e.g., as found in folded paper or nanosphere structures) may comprise single-stranded nucleic acid regions, double-stranded nucleic acid regions, or a combination thereof. In some configurations, the nucleic acid nanostructures can comprise nucleic acid folds and nucleic acid structures other than nucleic acid folds. For example, the nucleic acid break may be coupled to one or more single stranded nucleic acids, wherein the one or more single stranded nucleic acids do not form any secondary and/or tertiary structure. In an advantageous configuration, the nucleic acid fold may comprise a tile structure. A tile structure of nucleic acid folded paper may refer to a structure having an average thickness that is significantly less than a characteristic dimension (e.g., side length, side width, maximum diameter, average diameter, etc.). For example, the aspect ratio between the characteristic dimension and the average thickness of the nucleic acid folded tile structure may be at least about 2:1, 3:1, 4:1, 5:1, 10:1, 20:1, or more than 20:1. Alternatively or additionally, the aspect ratio between the characteristic dimension and the average thickness of the tile structure may be no more than about 20:1, 10:1, 5:1, 4:1, 3:1, 2:1, or less than 2:1. The tile structure may have a shape such as a substantially rectangular tile, a substantially square tile, a substantially triangular tile, a substantially circular tile, a substantially elliptical tile, or a substantially polygonal tile. The tiles may comprise one or more faces that are substantially planar. The tiles may include one or more faces that are substantially non-planar (e.g., curved, corrugated, etc.).

A nucleic acid nanostructure, such as SNAP, may comprise two or more utility surfaces formed by hybridization of a scaffold strand to a plurality of staple oligonucleotides. Hybridization of multiple staple oligonucleotides to a scaffold strand can form multiple tertiary nucleic acid structures in a nucleic acid nanostructure. In some configurations, the plurality of tertiary structures can include a first tertiary structure that belongs to a first utility surface (e.g., a display surface) and a second tertiary structure that belongs to a second utility surface (e.g., a capture surface). Two tertiary structures in a nucleic acid nanostructure (e.g., SNAP) may be oriented with respect to each other with respect to an axis of symmetry or plane of symmetry. The two tertiary structures in a nucleic acid nanostructure can be oriented with respect to each other with respect to the symmetry axis or symmetry plane of one or both tertiary structures (such as the coaxial symmetry axis of a nucleic acid duplex). In some configurations where the first tertiary structure and the second tertiary structure belong to different utility planes, the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure are coplanar. For configurations where the first tertiary structure and the second tertiary structure belong to different utility planes, the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure may not be coplanar. In some configurations where the first tertiary structure and the second tertiary structure belong to different utility planes, the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure may intersect. In some configurations where the first tertiary structure and the second tertiary structure belong to different utility planes, the symmetry axis of the first tertiary structure and the symmetry axis of the second tertiary structure may not intersect. The symmetry characteristics of a nucleic acid nanostructure (e.g., SNAP) can be determined in terms of the average size, shape, or configuration of the nucleic acid nanostructure. Small variations in feature localization (e.g., due to helical and tertiary structures of the nucleic acid nanostructure or due to temporal variations caused by environmental conditions (e.g., brownian motion, fluid shear, electromagnetic forces, etc.) may result in small differences between two opposing sides of the nucleic acid nanostructure designed to have a symmetrical structure. Nucleic acid nanostructures may be considered symmetrical if two symmetry features lie within about 10% of the intended location with respect to the symmetry axis or symmetry plane.

The nucleic acid nanostructure composition (e.g., SNAP composition) may also comprise a molecule or analyte. Optionally, the molecule or analyte is a non-nucleic acid molecule or analyte, respectively. In some configurations, the displayed portion of the nucleic acid nanostructure can be coupled to a molecule or analyte. For example, after each SNAP of a plurality of SNAP has been coupled to a molecule or analyte, the plurality of SNAP may be deposited on an array. In other configurations, the displayed portion of the nucleic acid nanostructure need not be coupled to a molecule or analyte. For example, a plurality of SNAP may be deposited on an array before each SNAP of the plurality has been coupled to a molecule or analyte. In some configurations, the molecule or analyte may comprise a biomolecule selected from the group consisting of a polypeptide, a polysaccharide, a nucleic acid, a lipid, a metabolite, an enzyme cofactor, and combinations thereof. In some configurations, the molecule or analyte may comprise a non-biological particle selected from the group consisting of a polymer, a metal oxide, a ceramic, a semiconductor, a mineral, and combinations thereof.

The nucleic acid nanostructure composition (e.g., SNAP composition) can comprise a linker configured to couple an entity (e.g., SNAP, analyte, coupling surface, etc.) to a moiety (e.g., surface interaction moiety, display moiety, capture moiety, surface attachment moiety, etc.). The linker may have a size of at least about 100Da, 500Da, 1kDa, 5kDa, 10kDa, 20kDa, 25kDa, 50kDa, 100kDa, 250kDa, 500kDa, or more than 500 kDa. Alternatively or additionally, the linker may have a size of no more than about 500kDa, 250kDa, 100kDa, 50kDa, 25kDa, 20kDa, 10kDa, 5kDa, 1kDa, 500Da, 100Da, or less than about 100 Da. The linker may comprise a chemical-physical property (e.g., hydrophobicity, hydrophilicity, polarity, steric dimensions, net charge, etc.) that mediates interactions between entities and moieties connected by the linker. For example, SNAP may comprise a rigid linker that separates the target analyte from the surface by a separation distance and/or prevents contact between the target analyte and the surface of SNAP.

The nucleic acid nanostructure (e.g., SNAP) may comprise a functional nucleic acid. Functional nucleic acids may bring additional utility to nucleic acid nanostructures. The functional nucleic acid may comprise a nucleic acid barcode, which may provide a tag or information encoding function, for example, in the form of an identification sequence of an analyte co-located with the functional nucleic acid. As shown in fig. 10A-10D, utility portion 1040 may comprise a nucleic acid barcode sequence that may be transcribed onto a molecule that interacts with analyte 1020, and vice versa. The barcode sequences contained on the utility portion 1040 or interacting molecule may be sequenced to determine the characteristics of the analyte 1020 or previous uses, such as any interactions that may have occurred with the analyte 1020. The functional nucleic acid may comprise a retention moiety, wherein the retention moiety comprises a hybridizing nucleic acid sequence configured to form short-term or weak interactions that temporarily co-localize the interacting molecules in proximity to the analyte to increase the likelihood of observing the interactions or reduce the rate at which the interacting molecules dissociate from the analyte. The hybridizing nucleic acid sequence may comprise a short region (e.g., less than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides) complementary to another oligonucleotide, a nucleic acid sequence that is incompletely complementary to another nucleic acid, a cohesive end (toehold) sequence, or any other configuration that facilitates easy reversible nucleic acid hybridization interactions. The functional nucleic acid may comprise a nucleic acid sequence configured to bind to a labeled nucleic acid (e.g., a fluorescently labeled oligonucleotide) for purposes such as detecting a spatial address of a nucleic acid nanostructure (e.g., on a site of a solid support).

In another aspect, provided herein is a method of forming a multiplexed analyte array, the method comprising: a) Contacting an array comprising a plurality of sites with a first plurality of nucleic acid nanostructures as set forth herein, wherein each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures is coupled to one analyte of interest of a first plurality of analytes of interest; b) Contacting an array comprising the plurality of sites with a second plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures is coupled to one analyte of interest of a second plurality of analytes of interest as set forth herein; c) Depositing a first plurality of nucleic acid nanostructures at a first subset of the plurality of sites; and d) depositing a second plurality of nucleic acid nanostructures at a second subset of sites of the plurality of sites, wherein the first subset of sites and the second subset of sites comprise a random spatial distribution. In some configurations, each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures may comprise a first functional nucleic acid, wherein the first functional nucleic acid comprises a first nucleotide sequence, wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures may comprise a second functional nucleic acid, wherein the second functional nucleic acid comprises a second nucleotide sequence, and wherein the first nucleotide sequence is different from the second nucleotide sequence. In some configurations, a method of forming a multiplexed array can include contacting the array with a first plurality of nucleic acid nanostructures and a second plurality of nucleic acid nanostructures simultaneously. For example, the array may be contacted with a fluid medium comprising a mixture of the first plurality of nucleic acid nanostructures and the second plurality of nucleic acid nanostructures. In other configurations, a method of forming a multiplexed array may include sequentially contacting the array with a first plurality of nucleic acid nanostructures and a second plurality of nucleic acid nanostructures. In some configurations, a method of forming a multiplexed array may include simultaneously depositing a first plurality of nucleic acid nanostructures and a second plurality of nucleic acid nanostructures on the array. For example, the array may be contacted with a fluid medium comprising a mixture of a first plurality of nucleic acid nanostructures and a second plurality of nucleic acid nanostructures, and then contacted with a second fluid medium that facilitates deposition of the nucleic acid nanostructures onto the array site. In other configurations, a method of forming a multiplexed array may include sequentially depositing a first plurality of nucleic acid nanostructures and a second plurality of nucleic acid nanostructures on the array.

The method of forming a multiplexed analyte array can further include the step of contacting the array with a first plurality of detectable nucleic acids, wherein each first detectable nucleic acid of the first plurality of detectable nucleic acids comprises a first complementary nucleotide sequence and a detectable label, wherein the first complementary nucleotide sequence is complementary to a first nucleotide sequence of a first functional nucleic acid of one nucleic acid nanostructure of the first plurality of nucleic acid nanostructures. The method of forming a multiplexed analyte array may further comprise coupling a first detectable nucleic acid to each first functional nucleic acid after contacting the array with the first plurality of detectable nucleic acids. After coupling the first detectable nucleic acid to each first functional nucleic acid, the method may further comprise the step of detecting each address of the array comprising the first detectable nucleic acid, as set forth herein. After coupling the first detectable nucleic acid to each of the first functional nucleic acids, the method may further comprise the step of removing the first detectable nucleic acid from the first functional nucleic acids. In some configurations, removing the first detectable nucleic acid from the first functional nucleic acid may include heating one nucleic acid nanostructure of the first plurality of nucleic acid nanostructures to at least a melting temperature of the first functional nucleic acid, thereby decoupling the first detectable nucleic acid from the first functional nucleic acid. In other configurations, removing the first detectable nucleic acid from the first functional nucleic acid may include contacting the solid support with a fluid medium configured to separate the first detectable nucleic acid from the first functional nucleic acid (e.g., denaturant, chaotrope, etc.) optionally in the presence of heat.

A method of forming a multiplexed analyte array may comprise contacting the array with two or more of a plurality of detectable nucleic acids. For example, the method illustrated above may further comprise the step of contacting the array with a second plurality of detectable nucleic acids, wherein each of the second plurality of detectable nucleic acids comprises a second complementary nucleotide sequence and a detectable label, wherein the second complementary nucleotide sequence is complementary to a second nucleotide sequence of a second functional nucleic acid of one of the second plurality of nucleic acid nanostructures. The method of forming a multiplexed analyte array may further comprise coupling a second detectable nucleic acid to each second functional nucleic acid after contacting the array with the second plurality of detectable nucleic acids. After coupling the second detectable nucleic acid to each second functional nucleic acid, the method may further comprise the step of detecting each address of the array comprising the second detectable nucleic acid, as set forth herein. After coupling the second detectable nucleic acid to each second functional nucleic acid, the method may further comprise the step of removing the second detectable nucleic acid from the second functional nucleic acid. In some configurations, removing the second detectable nucleic acid from the second functional nucleic acid may include heating one nucleic acid nanostructure of the second plurality of nucleic acid nanostructures to at least a melting temperature of the second functional nucleic acid, thereby decoupling the second detectable nucleic acid from the second functional nucleic acid. In other configurations, removing the second detectable nucleic acid from the second functional nucleic acid may include contacting the solid support with a fluid medium configured to separate the second detectable nucleic acid from the second functional nucleic acid (e.g., denaturant, chaotrope, etc.) optionally in the presence of heat.

FIGS. 50A-50F depict a method of forming a multiplexed array of analytes of interest using functional nucleic acids. Fig. 50A shows an array comprising a solid support 5000 comprising a plurality of sites 5001, each coupled to SNAP 5010. Solid support 5000 is contacted with a plurality of SNAP 5010. A first subset of the plurality of SNAP 5010 comprises SNAP 5010 coupled to a first target analyte 5020 (e.g., a polypeptide from a first sample), wherein each SNAP 5010 of the first subset comprises a first functional nucleic acid 5030 comprising a CGT nucleotide sequence. A second subset of the plurality of SNAP comprises SNAP 5010 coupled to a second target analyte 5025 (e.g., a polypeptide from a second sample), wherein each SNAP 5010 of the second subset comprises a second functional nucleic acid 5035 comprising a CCA nucleotide sequence. Fig. 50B shows a multiplexed array formed by depositing multiple SNAP 5010's at multiple sites 5001 on a solid support 5010. The first subset of SNAP 5010 and the second subset of SNAP 5010 comprise a random spatial distribution at the plurality of sites 5001, wherein the addresses of the first target analyte 5020 and the second target analyte 5025 on the array are initially unknown after deposition. Fig. 50C depicts contacting a solid support 5000 with a first plurality of detectable nucleic acids, wherein each of the detectable nucleic acids comprises a detectable label 5045 and a complementary nucleic acid 5040 having a GCA nucleotide sequence. FIG. 50D depicts a multiplexed array of SNAP 5010 in which a first subset of SNAP 5010 has been coupled to one of a first plurality of detectable nucleic acids by base pair bonding between a first functional nucleic acid 5030 and a complementary nucleic acid 5040. Each site 5001 containing a first target analyte 5020 can be detected with single analyte resolution by detecting a detectable label 5045 at an address on the array. Fig. 50E depicts contacting a solid support 5000 with a second plurality of detectable nucleic acids, wherein each of the detectable nucleic acids comprises a detectable label 5046 and a complementary nucleic acid 5041 having a GGT nucleotide sequence. Fig. 50F depicts a multiplexed array of SNAP 5010 in which a second subset of SNAP 5010 has been coupled to one of a second plurality of detectable nucleic acids by base pair bonding between a second functional nucleic acid 5035 and a complementary nucleic acid 5041. Each site 5001 containing a first target analyte 5025 can be detected with single analyte resolution by detecting a detectable label 5046 at an address on the array. In some configurations, the addresses of the first target analyte 5020 and the second target analyte 5025 can be detected simultaneously, for example, by using detectable labels 5045 and 5046 (e.g., fluorophores) with different detection characteristics (e.g., excitation wavelength, emission wavelength).

As set forth herein, a functional nucleic acid can comprise a nucleotide sequence (e.g., a detectable label, a nucleic acid barcode, a retention moiety, etc.) configured to hybridize to a complementary nucleotide sequence of a coupling moiety. The functional nucleic acid may comprise a nucleotide sequence configured to form a double-stranded nucleic acid with a complementary nucleic acid, wherein the double-stranded nucleic acid is disrupted by melting of the double-stranded nucleic acid. The double-stranded functional nucleic acid may have a melting temperature of at least about 50 ℃, 55 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃, 67 ℃, 68 ℃, 69 ℃, 70 ℃, 71 ℃, 72 ℃, 73 ℃, 74 ℃, 75 ℃, 76 ℃, 77 ℃, 78 ℃, 79 ℃, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, 86 ℃, 87 ℃, 88 ℃, 89 ℃, 90 ℃, 91 ℃, 92 ℃, 93 ℃, 94 ℃, 95 ℃, 96 ℃, 97 ℃, 98 ℃, 99 ℃, or more than 99 ℃. Alternatively or additionally, the double-stranded functional nucleic acid may have a melting temperature of no more than about 99 ℃, 98 ℃, 97 ℃, 96 ℃, 95 ℃, 94 ℃, 93 ℃, 92 ℃, 91 ℃, 90 ℃, 89 ℃, 88 ℃, 87 ℃, 86 ℃, 85 ℃, 84 ℃, 83 ℃, 82 ℃, 81 ℃, 80 ℃, 79 ℃, 78 ℃, 77 ℃, 76 ℃, 75 ℃, 74 ℃, 73 ℃, 72 ℃, 71 ℃, 70 ℃, 69 ℃, 68 ℃, 67 ℃, 66 ℃, 65 ℃, 64 ℃, 63 ℃, 62 ℃, 61 ℃, 60 ℃, 55 ℃, 50 ℃ or less than 50 ℃. In some configurations, the melting temperature of the double-stranded functional nucleic acid of the nucleic acid nanostructure can be designed to be lower than the melting temperature of some or all of the other double-stranded nucleic acids of the nucleic acid nanostructure. In particular configurations, the melting temperature of the double-stranded functional nucleic acid of the nucleic acid nanostructure can be designed to be at least 50%, 60%, 70%, 80%, 90%, 95% or more than 95% lower than the melting temperature of some or all of the double-stranded nucleic acid of the nucleic acid nanostructure. For example, the functional nucleic acid can be separated from the complementary nucleic acid at a melting temperature that does not result in loss of the component oligonucleotides of the nucleic acid nanostructure containing the functional nucleic acid. In some configurations, the melting temperature of the double-stranded nucleic acid containing the functional nucleic acid can be designed to be lower than the dissociation temperature of the nucleic acid nanostructure coupled to the solid support or the coupled moiety attached to the solid support (e.g., nucleic acid melting temperature, ligand-receptor dissociation temperature, covalent bond dissociation temperature, etc.). For example, the melting temperature of the double-stranded functional nucleic acid of the nucleic acid nanostructure can be designed to be at least 5 ℃, 6 ℃, 7 ℃, 8 ℃, 9 ℃, 10 ℃, 11 ℃, 12 ℃, 13 ℃, 14 ℃, 15 ℃, 16 ℃, 17 ℃, 18 ℃, 19 ℃, 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, or more than 50 ℃ lower than the dissociation temperature of the nucleic acid nanostructure coupled to the solid support or the nucleic acid nanostructure coupled portion attached to the solid support.

The nucleic acid nanostructure (e.g., SNAP) may comprise a capture surface or capture moiety that comprises one or more modifying groups that alter the interaction between the nucleic acid nanostructure and the surface. Altered interactions between nucleic acid nanostructures and surfaces may include: 1) Increasing the rate or intensity of coupling to a desired region of the surface; 2) Reducing the rate or intensity of coupling to a desired region of the surface; 3) Enhancing the specificity of coupling to a surface; 4) Reducing non-specific coupling to the surface; 5) Reducing the strength of interactions (e.g., aggregation, co-binding) between two or more nucleic acid nanostructures, and 6) combinations thereof. In some configurations, the capture moiety may comprise a modifying moiety selected from the group consisting of a charged moiety (e.g., a cationic or anionic moiety), a polar moiety, a non-polar moiety, a ligand moiety recognized by a receptor, a receptor moiety recognized by a ligand, a magnetic moiety, a steric moiety, an amphiphilic moiety, a hydrophobic moiety, and a hydrophilic moiety. In some configurations, the charged moiety may comprise a single stranded nucleic acid or a charged polymer (e.g., a cationic or anionic polymer). In some configurations, the capture portion of the nucleic acid nanostructure can comprise a plurality of single stranded nucleic acids, wherein the single stranded nucleic acids are regions (e.g., tails or loops) of longer oligonucleotides that hybridize to the nucleic acid nanostructure. In other configurations, the capture moiety of the nucleic acid nanostructure can comprise a plurality of single-stranded nucleic acids or charged polymers, wherein the single-stranded nucleic acids are coupled to oligonucleotides hybridized to the nucleic acid nanostructure, for example, through covalent linkers (e.g., click-type reaction products) or non-covalent linkers (e.g., streptavidin-biotin complexes).

Provided herein is a composition comprising: a) A nucleic acid nanostructure (e.g., a structured nucleic acid particle), wherein the nucleic acid nanostructure comprises: i) A display moiety comprising a coupling group coupled to or configured to couple to an analyte; and ii) a capture moiety coupled to the surface or configured to be coupled to the surface, wherein the capture moiety comprises a plurality of first surface-interacting oligonucleotides, and wherein each first surface-interacting oligonucleotide of the plurality of first surface-interacting oligonucleotides comprises a first nucleic acid coupled to the structured nucleic acid particle and a first surface-interacting moiety, wherein the first surface-interacting moiety is coupled to the surface-linking moiety or configured to form a coupling interaction with the surface-linking moiety, wherein the capture moiety and the display moiety have different orientations; and b) an analyte comprising a complementary coupling group coupled to or configured to be coupled to a display portion of the structured nucleic acid particle.

The nucleic acid nanostructure composition (e.g., SNAP composition) can comprise a capture moiety having a plurality of pendent groups that mediate a coupling interaction with a surface (e.g., a coupling surface of a solid support). As set forth herein, a pendent group may be characterized by one or more of the following: i) Comprising unconjugated terminal moieties or residues, ii) comprising moieties whose spatial degrees of freedom are not constrained by a coupling interaction with a second moiety of the nucleic acid nanostructure (e.g., a polymer chain), and iii) comprising moieties whose average temporal change in position relative to the nucleic acid nanostructure exceeds the average temporal change in position of the moiety incorporated within the nucleic acid nanostructure. Without wishing to be bound by theory, the pendent groups can promote a variety of properties of the nucleic acid nanostructure, including 1) increased surface coupling specificity through interaction between the capture moiety and the surface-linking moiety on the solid support, 2) increased binding affinity due to multiple binding interactions between the nucleic acid nanostructure and the coupling surface, 3) adjustable binding kinetics based on the pendent groups added to the nucleic acid nanostructure, 4) adjustable binding thermodynamics based on minimization of free energy between the capture moiety and the coupling surface, 5) reduced interactions between the attached nucleic acid nanostructure due to binding incompatibility of the capture moiety of the nucleic acid nanostructure, and 6) combinations thereof.

Fig. 40A-40C illustrate SNAP compositions that include a pendent group on a capture moiety of SNAP. FIG. 40A shows SNAP 4010 comprising an upwardly oriented display surface containing a display portion 4015 coupled to an analyte 4020 (e.g., a polypeptide). The downwardly directed capture surface of SNAP 4010 comprises a plurality of pendent groups. Each pendent group comprises an optional linker 4017 and a surface-interacting moiety, such as a surface-interacting oligonucleotide 4018 or a surface-interacting coupling group 4019 (e.g., a reactive group, streptavidin, etc.). SNAP 4010 can be contacted with solid support 4000 comprising coupling surface 4002 and one or more 4004. The coupling surface 4002 can comprise a plurality of surface-attached groups, wherein each surface-attached group comprises an optional linker 4030 (e.g., a passivating molecule such as PEG) and a surface-attached moiety (such as a complementary oligonucleotide 4038 or a complementary coupling group 4039 (e.g., a complementary reactive group, biotin, etc.)). Optionally, the surface may comprise a mixture of surface attachment groups, wherein the first plurality of surface attachment groups comprises a passivating moiety (e.g., a PEG chain) and does not comprise a coupling moiety, and the second plurality of surface attachment groups comprises a coupling moiety and a passivating moiety (e.g., an oligonucleotide coupled to a PEG chain). Fig. 40B shows a first coupling configuration of SNAP 4010 to solid support 4000. One or more surface interaction oligonucleotides 4018 have hybridized to surface-attached complementary oligonucleotides 4038, but one or more other surface interaction moieties remain unbound. This may indicate that the coupled SNAP is not in an energetically favorable binding site. Fig. 40C shows a second coupling configuration of SNAP 4010 to solid support 4000. Each surface-interacting moiety has formed a coupling interaction with a complementary surface-linking moiety. For SNAP 4010 on coupling surface 4002, such a configuration may be the most energetic and/or most stable position.

The nucleic acid nanostructure (e.g., SNAP) can comprise a capture moiety comprising a plurality of oligonucleotides coupled to the nucleic acid nanostructure and providing a plurality of pendent groups, wherein each pendent group comprises a surface-interacting moiety. The surface-interacting moiety may form a coupling interaction with a surface-linking moiety on the solid support, thereby coupling the nucleic acid nanostructure comprising the surface-linking moiety to the solid support. The nucleic acid nanostructure may comprise a plurality of oligonucleotides, wherein one oligonucleotide of the plurality of oligonucleotides comprises: a) A first nucleic acid configured to be coupled to a capture moiety of a nucleic acid nanostructure, and b) a first surface interaction moiety. In some configurations, the first surface-interacting moiety may comprise a second nucleic acid. For example, one oligonucleotide of the plurality of oligonucleotides may comprise a first nucleic acid sequence configured to couple with SNAP and a second nucleic acid sequence configured to bind to a complementary surface-ligating nucleic acid strand of a surface-ligating portion by base pair hybridization. In some cases, an oligonucleotide comprising a first nucleic acid sequence and a second nucleic acid sequence may also comprise a third nucleic acid sequence configured not to hybridize to another nucleic acid, e.g., to provide flexibility or rigidity to the pendent group, as desired. In some configurations, the first surface interaction moiety may comprise a capture group selected from the group consisting of a reactive group, a charged group, a magnetic group, and a component of a binding pair in addition to or in place of the second nucleic acid. In some configurations, the binding pair may be selected from the group consisting of streptavidin-biotin, spyCatcher-Spytag, snoopCatcher-Snooptag, and SdyCatcher-sdttag. In some configurations, the reactive group may be configured to perform a click-type reaction with the surface-attachment moiety. In some configurations, the first surface-interacting moiety may comprise a group configured to form a non-covalent interaction with the surface-linking moiety, wherein the interaction is selected from electrostatic interactions, magnetic interactions, hydrogen bonding, ionic bonding, van der Waals bonding, hydrophobic interactions, or hydrophilic interactions. In a particular configuration, the first surface-interacting moiety may comprise a nanoparticle selected from the group consisting of an inorganic nanoparticle, a carbon nanoparticle, a polymeric nanoparticle, and a biopolymer. In some configurations, the first surface-interacting moiety may further comprise a linker coupling the surface-interacting moiety to the nucleic acid nanostructure. In some configurations, the linker may comprise a hydrophobic linker, a hydrophilic linker, or a cleavable linker.

Oligonucleotides comprising surface-interacting moieties may form part of a nucleic acid nanostructure (e.g., SNAP structure). The nucleic acid nanostructure may comprise a) a scaffold nucleic acid strand; and b) a plurality of strands of staple nucleic acid coupled to the strands of scaffold nucleic acid. In some configurations, the plurality of staple nucleic acid strands may comprise a first surface-interacting oligonucleotide of the plurality of first surface-interacting oligonucleotides, wherein the first surface-interacting oligonucleotide comprises a surface-interacting moiety. The coupling of the first surface interaction oligonucleotide may form a tertiary structure of the nucleic acid nanostructure (e.g., SNAP). In some configurations, the capture moiety may comprise a tertiary structure formed by coupling of the first surface-interacting oligonucleotide to a nucleic acid nanostructure (e.g., SNAP). In other configurations, the display portion may comprise a tertiary structure formed by coupling the first surface-interacting oligonucleotide to the nucleic acid nanostructure.

The nucleic acid nanostructure (e.g., SNAP) can comprise a capture moiety comprising a plurality of pendent groups, wherein a pendent group of the plurality of pendent groups comprises a nucleic acid. In some configurations, the pendent group can comprise a nucleic acid having a nucleotide sequence that does not comprise self-complementarity. Thus, under the conditions of the compositions or methods set forth herein, the formation of self-hybridizing structures of surface-interacting oligonucleotides or other nucleic acids can be inhibited. For example, the nucleotide sequence of the overhang nucleic acid may comprise a DNA sequence having no more than 3 deoxyribonucleotide species selected from the group consisting of deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine (e.g., ACTACCTACAT). In other configurations, a nucleic acid, such as a surface-interacting oligonucleotide or a pendant group, may comprise a nucleotide sequence that has self-complementarity. For example, under some or all of the conditions of the compositions or methods set forth herein, the nucleic acid sequence may form a self-hybridizing structure, such as a duplex, stem loop, pseudoknot, hairpin, or G-quadruplex. The methods set forth herein may be configured such that the nucleic acid is in a self-hybridizing form in one step and is not in a self-hybridizing form in another step. For example, in a first step of the method, the first nucleic acid may be in a self-hybridizing state to inhibit unwanted hybridization with the second nucleic acid strand, and in a second step, the first nucleic acid may be in a single-stranded state or hybridized with the second nucleic acid strand. In some configurations, the surface interaction oligonucleotide of the plurality of surface interaction oligonucleotides may comprise a homo-nucleotide sequence selected from the group consisting of a polydeoxyadenosine sequence, a polydeoxycytidine sequence, a polydeoxyguanosine sequence, and a polydeoxythymidine sequence. The first contiguous sequence of a nucleic acid strand configured to form self-complementarity with a second portion of the nucleic acid strand may comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more than 50 contiguous nucleotides. Alternatively or additionally, the first contiguous sequence of the nucleic acid strand configured to form self-complementarity with the second portion of the nucleic acid strand may comprise no more than about 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or less than 3 contiguous nucleotides. The first contiguous sequence of the nucleic acid strand configured to form self-complementarity with the second portion of the nucleic acid strand may be separated from the second portion of the nucleic acid strand by at least about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 750, 1000, or more than 1000 nucleotides. Alternatively or additionally, a first contiguous sequence of a nucleic acid strand configured to form self-complementarity with a second portion of the nucleic acid strand may be separated from the second portion of the nucleic acid strand by no more than about 1000, 750, 500, 400, 300, 200, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or less than 3 contiguous nucleotides.

The pendant nucleic acid portion of the pendant group of the surface-interacting moiety can comprise a specific number of linked nucleotides (e.g., natural nucleotides, modified nucleotides, etc.). In some cases, the nucleic acid portion of the surface interaction moiety may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. Alternatively or additionally, the nucleic acid portion of the surface interaction moiety may comprise no more than about 100, 90, 80, 70, 60, 50, 45, 40, 35, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 nucleotides.

The nucleic acid nanostructure (e.g., SNAP) can comprise a capture moiety having a plurality of pendent groups that contain a surface-interacting moiety. The capture moiety may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 surface interaction moieties. Alternatively or additionally, the capture moiety may comprise no more than about 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 surface interaction moieties. The nucleic acid nanostructures (e.g., SNAP) may be configured as pendant groups comprising surface-interacting moieties (e.g., surface-interacting oligonucleotides, surface-interacting reactive groups, etc.) having an average surface density. The average surface density of surface-interacting moieties of the nucleic acid nanostructure can be determined by the number of surface-interacting moieties configured to couple to the coupling surface of the solid support relative to the effective surface area or footprint of the nucleic acid nanostructure capture moieties coupled to the coupling surface. The effective surface area of the capture moiety may comprise a two-dimensional projection of the capture moiety onto the effective planar surface, and may optionally comprise additional surface area resulting from the maximum extension of one or more pendant groups from the nucleic acid nanostructure capture moiety. When the nucleic acid nanostructure is coupled to a surface, the footprint of the nucleic acid nanostructure may comprise the largest cross-sectional area of the nucleic acid nanostructure or capture portion thereof. The capture moiety of a nucleic acid nanostructure (e.g., SNAP) can have at least 0.0001 surface-interacting moieties per square nanometer (/ nm) ² )、0.005/nm ² 、0.001/nm ² 、0.05/nm ² 、0.01/nm ² 、0.05/nm ² 、0.1/nm ² 、0.5/nm ² 、1/nm ² 、5/nm ² 、10/nm ² Or more than 10/nm ² Is a fraction of the average surface interaction density. Alternatively or additionally, the capture moiety of the nucleic acid nanostructure may have no more than about 10/nm ² 、5/nm ² 、1/nm ² 、0.5/nm ² 、0.1/nm ² 、0.05/nm ² 、0.01/nm ² 、0.005/nm ² 、0.001/nm ² 、0.0005/nm ² 、0.0001/nm ² Or less than 0.0001/nm ² Is a fraction of the average surface interaction density.

The plurality of surface-interacting moieties may be distributed or spaced over the capture moiety of the nucleic acid nanostructure (e.g., SNAP). In some configurations, the distribution or density of surface-interacting portions is substantially uniform over the effective surface area or footprint of the capturing portions (e.g., nearly uniform spacing and/or orientation between adjacent surface-interacting portions). In other configurations, the distribution or density of surface interaction portions is substantially uniform over the effective surface area or footprint of the capture portions. For example, a fraction or all of the plurality of surface interaction moieties may be located near the central region of the capture moiety. In another configuration, a fraction or all of the plurality of surface interaction moieties may be located near an outer region of the capture moiety. 41A-41B depict SNAP configurations having different SNAP distributions. Fig. 41A depicts SNAP 4110 coupled to analyte 4120 and containing a plurality of surface-interacting moieties 4118 on the capture moiety, wherein the plurality of surface-interacting moieties are distributed toward the outer edge of the capture moiety face. Fig. 41B depicts SNAP 4110 coupled to analyte 4120 and containing a plurality of surface interaction moieties 4118 on the capture moiety, wherein the plurality of surface interaction moieties are distributed toward a central portion of the capture moiety face.

In some configurations, a nucleic acid nanostructure (e.g., SNAP) can comprise a capture moiety comprising more than one type of surface-interacting moiety. The capture moiety may comprise more than one type of surface-interacting moiety to increase the specificity of binding sites of the nucleic acid nanostructure. For example, SNAP may comprise a plurality of surface-interacting oligonucleotides and one or more surface-interacting reactive groups. In particular examples, such SNAP may be contacted with a coupling surface comprising a high surface density of complementary oligonucleotides and a low surface density of complementary reactive groups, wherein the binding interaction between the surface-interacting oligonucleotide and the complementary oligonucleotide maintains SNAP coupling near the coupling surface until a covalent binding interaction is formed between the surface-interacting reactive group and the relatively rare surface-attached complementary reactive group. Nucleic acid nanostructures may interact with a surface through a combination of multiple interaction types, such as through two different non-covalent interactions (e.g., nucleic acid hybridization and electrostatic interactions, etc.), two different covalent interactions (e.g., two bioorthogonal click-type reactions), or a combination of covalent interactions and non-covalent interactions (e.g., covalent interactions and nucleic acid hybridization, covalent interactions and electrostatic interactions, covalent interactions and nucleic acid hybridization and electrostatic interactions, etc.).

In another aspect, provided herein is a composition comprising: a) A nucleic acid nanostructure (e.g., SNAP), wherein the nucleic acid nanostructure comprises: i) A display moiety coupled to or configured to be coupled to an analyte; and ii) a capture moiety coupled to or configured to be coupled to the coupling surface, wherein the capture moiety comprises a plurality of oligonucleotides, and wherein each oligonucleotide of the plurality of oligonucleotides comprises a surface interaction moiety; b) An analyte coupled to the display moiety; and c) a solid support comprising a coupling surface, wherein the surface comprises one or more surface-attachment moieties, and wherein a surface-interaction moiety of the plurality of surface-interaction moieties is coupled to a surface-attachment moiety of the one or more surface-attachment moieties.

As set forth herein, the nucleic acid nanostructure composition (e.g., SNAP composition) may also comprise a spacer group. The spacer group can comprise a molecule, linker, or nucleic acid nanostructure (e.g., displaying SNAP or structural SNAP) configured to bind to the analyte and nucleic acid nanostructureA separation or gap is created between surfaces or portions of the structure (e.g., display surface or portion, capture surface or portion). FIG. 29 shows a profile of SNAP complexes containing analytes, with various possible separation gaps labeled. SNAP complexes may comprise capture utility SNAP 2910, 2911, and 2912, which couple the complex to solid support 2900. SNAP 2930 is shown coupled to structural utility SNAP 2920, which is coupled to capture utility SNAP 2911. Analyte 2940 was coupled to display SNAP 2930. The separation gap from the analyte to the surface or SNAP can be measured. Some possible separation gaps may include gaps (g ₁ ) Gap (g) to top surface of capture utility SNAP 2910 ₂ ) Or to the top surface of display SNAP 2930 (g ₃ ) The method comprises the steps of carrying out a first treatment on the surface of the A gap (g) between the outer surface of analyte 2940 and the surface of solid support 2900 ₄ ) The method comprises the steps of carrying out a first treatment on the surface of the A gap (g) between the outer surface of analyte 2940 and the surface of capture utility SNAP 2910 ₅ ) The method comprises the steps of carrying out a first treatment on the surface of the Or a gap (g) between the outer surface of analyte 2940 and the surface exhibiting SNAP 2930 ₆ ). Fig. 3A-3D illustrate SNAP300 comprising multivalent linker 320 that creates an average separation gap between analyte 310 and the upper surface of SNAP 300. If SNAP300 is coupled to solid support 330, analyte 310 will also have an average separation gap from solid support 330. In some configurations, the spacer groups may comprise rigid spacer groups selected from the group consisting of polymer linkers, nucleic acid linkers, and nanoparticle linkers. In some specific configurations, the nucleic acid linker comprises a tertiary structure (e.g., a DNA duplex). In other configurations, the spacer group comprises a flexible linker. The separation gap may have a characteristic average, maximum value of minimum dimensions. The average, maximum, or minimum size of the separation gap may be at least about 1nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 11nm, 12nm, 13nm, 14nm, 15nm, 16nm, 17nm, 18nm, 19nm, 20nm, 25nm, 30nm, 35nm, 40nm, 45nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, or more than 100nm. Alternatively or additionally, the average, maximum, or minimum dimension of the separation gap may be no more than about 10 0nm, 90nm, 80nm, 70nm, 60nm, 50nm, 45nm, 40nm, 35nm, 30nm, 25nm, 20nm, 19nm, 18nm, 17nm, 16nm, 15nm, 14nm, 13nm, 12nm, 11nm, 10nm, 9nm, 8nm, 7nm, 6nm, 5nm, 4nm, 3nm, 2nm, 1nm or less than 1nm.

A nucleic acid nanostructure (e.g., SNAP) may comprise a plurality of nucleic acids (e.g., a scaffold strand, a plurality of oligonucleotides) that form a stable hybridization structure by complementary base binding. The stability of a particular hybridization structure can be characterized by conventional methods, such as by the degree of complementarity or an estimated or measured secondary structure melting temperature. Stability (e.g., melting temperature) can be predicted by a software package such as CADNANO, ATHENA or DAEDALUS. The hybridized nucleic acid structure may have a characteristic melting temperature of at least about 50 ℃, 51 ℃, 52 ℃, 53 ℃, 54 ℃, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃, 67 ℃, 68 ℃, 69 ℃, 70 ℃, 71 ℃, 72 ℃, 73 ℃, 74 ℃, 75 ℃, 76 ℃, 77 ℃, 78 ℃, 79 ℃, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, 86 ℃, 87 ℃, 88 ℃, 89 ℃, 90 ℃, or more than 90 ℃. Alternatively or additionally, the hybridized nucleic acid structure may have a characteristic melting temperature of no more than about 90 ℃, 89 ℃, 88 ℃, 87 ℃, 86 ℃, 85 ℃, 84 ℃, 83 ℃, 82 ℃, 81 ℃, 80 ℃, 79 ℃, 78 ℃, 77 ℃, 76 ℃, 75 ℃, 74 ℃, 73 ℃, 72 ℃, 71 ℃, 70 ℃, 69 ℃, 68 ℃, 67 ℃, 66 ℃, 65 ℃, 64 ℃, 63 ℃, 62 ℃, 61 ℃, 60 ℃, 59 ℃, 58 ℃, 57 ℃, 56 ℃, 55 ℃, 54 ℃, 53 ℃, 52 ℃, 51 ℃, 50 ℃, or less than 50 ℃.

The nucleic acid nanostructure (e.g., SNAP) or face of the nucleic acid nanostructure (e.g., display face, capture face) can have a characteristic dimension (e.g., length, width, radius). The characteristic dimensions may include any characteristic measure associated with the group or probe dimensions, such as length, width, height, radius, circumference, etc. The nucleic acid nanostructure or face of the nucleic acid nanostructure can have a characteristic dimension of at least about 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 120nm, 140nm, 160nm, 180nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 600nm, 700nm, 800nm, 900nm, 1000nm, or more than 1000 nm. Alternatively or additionally, the nucleic acid nanostructure or face of the nucleic acid nanostructure may have a characteristic dimension of no more than about 1000nm, 900nm, 800nm, 700nm, 600nm, 500nm, 450nm, 400nm, 350nm, 300nm, 250nm, 200nm, 180nm, 160nm, 140nm, 120nm, 100nm, 95nm, 90nm, 85nm, 80nm, 75nm, 70nm, 65nm, 60nm, 55nm, 50nm, 45nm, 40nm, 35nm, 30nm, 25nm, 20nm, 15nm, 10nm, 5nm, or less than 5 nm.

The nucleic acid nanostructure (e.g., SNAP) can be coupled to one or more analytes, or configured to be coupled to one or more analytes. The nucleic acid nanostructure may comprise one or more display surfaces or display portions coupled to or configured to be coupled to one or more analytes. The nucleic acid nanostructures may be coupled to one or more analytes. The nucleic acid nanostructure may comprise one or more display surfaces or display portions coupled to one or more analytes. The nucleic acid nanostructure display surface or moiety may comprise one or more functional groups or moieties configured to couple with an analyte. When there are multiple functional groups, the functional groups may be of the same type as each other, or alternatively, different functional groups may be present. The nucleic acid nanostructure may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 functional groups or moieties. Alternatively or additionally, the nucleic acid nanostructure may comprise no more than about 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than about 2 functional groups or moieties configured to couple to an analyte.

Multiple nucleic acid nanostructures (e.g., SNAP) and multiple analytes may be coupled at an immobilized molecular ratio. The ratio of analyte to nucleic acid nanostructure can be calculated as the average ratio. The ratio of the analyte to the nanostructure may follow some quantifiable distribution, such as poisson, binomial, beta binomial, super-geometric, or bimodal. In some configurations, on average, there may be more than one analyte coupled to the nucleic acid nanostructure. In some configurations, on average, there may be more than one nucleic acid nanostructure coupled to the analyte. The plurality of analyte-coupled nucleic acid nanostructures may have an average analyte-to-nanostructure ratio of no more than about 100:1, 50:1, 25:1, 20:1, 15:1, 10:1, 5:1, 4:1, 3:1, 2:1, 1.5:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, 1:10, 1:15, 1:20, 1:25, 1:50, 1:100, or less than 1:100. Alternatively or additionally, the plurality of analyte-coupled nucleic acid nanostructures may have an average analyte-to-nanostructure ratio of at least about 1:100, 1:50, 1:25, 1:20, 1:15, 1:10, 1:5, 1:4, 1:3, 1:2, 1:1.5, 1:1, 1.5:1, 2:1, 3:1, 4:1, 5:1, 10:1, 15:1, 20:1, 25:1, 50:1, 100:1, or more than 100:1.

A plurality of nucleic acid nanostructures (e.g., SNAP) may be characterized by an occupancy ratio. The occupancy ratio may be defined as the fraction of nucleic acid nanostructures with at least one coupled analyte. By increasing the relative ratio of analyte to nucleic acid nanostructures during analyte coupling, the occupancy ratio of the nucleic acid nanostructures can be controlled to provide a desired occupancy ratio (such as a maximum occupancy ratio). The occupancy ratio of the nucleic acid nanostructures can be controlled to minimize the number of nucleic acid nanostructures with more than one analyte by, for example, reducing the concentration of analyte relative to the nucleic acid nanostructures during analyte coupling. For example, a SNAP composition having 70% SNAP coupled to one or more analytes will have an occupancy ratio of 0.7. The occupancy ratio may be determined by suitable analytical techniques such as fluorescence microscopy or spectroscopic analysis. The plurality of nucleic acid nanostructures can have an occupancy ratio of at least about 0.01, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, 0.99, or more than 0.99. Alternatively or additionally, the plurality of nucleic acid nanostructures may have an occupancy ratio of no more than about 0.99, 0.98, 0.97, 0.96, 0.95, 0.9, 0.85, 0.8, 0.75, 0.7, 0.65, 0.6, 0.55, 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1, 0.05, 0.01, or less than about 0.01.

As set forth herein, the nucleic acid nanostructure (e.g., SNAP) may also comprise a capture surface. The capture surface may be configured to facilitate interactions between surfaces or interfaces, such as binding interactions or phase separation interactions. The surface may be any solid and/or rigid boundary, wherein the nucleic acid nanostructures are substantially inhibited or unable to orthogonally transfer through the solid and/or rigid boundary. An interface may refer to a non-solid or deformable boundary through which the nucleic acid nanostructure may orthogonally transfer. The surface may comprise a surface of a solid material such as a metal, metal oxide, ceramic, glass, polymer or semiconductor. The interface may comprise an air/liquid or liquid/liquid phase boundary. Exemplary interfaces may include air/water interfaces, or water/oil interfaces, such as oil-in-water or water-in-oil emulsions. The capture surface or capture moiety may be configured to form a reversible or irreversible interaction with the surface. For example, the capture surface of SNAP may comprise one or more single-stranded nucleic acid strands configured to hybridize to complementary single-stranded nucleic acids displayed on a surface, thereby reversibly coupling SNAP to the surface. In another example, the capture face of SNAP may comprise one or more click-type reactive groups configured to covalently bind to complementary click-type reactive groups displayed on the surface, thereby irreversibly coupling SNAP to the surface. In some configurations, a nucleic acid nanostructure (e.g., SNAP) can comprise a capture surface comprising a first moiety and a second moiety, wherein the first moiety is configured to be reversibly coupled to a surface and the second moiety is configured to be irreversibly coupled to the surface. In some cases, the nucleic acid nanostructures may be configured to provide temporary association with a solid support. For example, SNAP can be configured to reversibly couple an analyte (e.g., via an oligonucleotide that hybridizes to a SNAP structure) and then temporarily bind to the surface of a solid support, allowing the analyte to be transferred to an analyte coupling moiety (e.g., a complementary oligonucleotide, a click-type reactive group, etc.) on the surface. After the analyte has been transferred to the surface, SNAP can be dissociated and optionally reused to transfer a second analyte to the solid support.

Nucleic acid nanostructures (e.g., SNAP) may interact with a surface or interface by interactions that associate the nucleic acid nanostructures with the surface or interface. Nucleic acid nanostructures may be associated with a surface or interface through binding interactions, such as electrostatic interactions, magnetic interactions, covalent bonds, or non-covalent bonds (e.g., hydrogen bonding, nucleic acid base pair binding). The nucleic acid nanostructure may comprise one or more faces configured to achieve phase separation at a phase boundary. For example, SNAP may comprise a first face comprising a plurality of hydrophobic moieties and a second face comprising a plurality of hydrophilic moieties, wherein the SNAP is configured to associate with a phase boundary by separating the first face into more hydrophobic phases.

Fig. 4A-4G show various configurations of SNAP interacting with a surface or interface. Fig. 4A shows SNAP 410 coupled with analyte 420 interacting with surface 430 via electrostatic interactions. SNAP may comprise negatively charged capture surface 412, which may be attracted to positively charged surface 430, such as surface 430 functionalized with positively charged functional groups 432. The negative charge of SNAP may be due to one or both of a negative charge present in the phosphodiester backbone of the nucleic acid or a negatively charged moiety conjugated to SNAP. Fig. 4B shows SNAP 410 coupled to analyte 420 (e.g., a polypeptide) that interacts with surface 430 via magnetic interactions. SNAP may comprise a capture surface 412 comprising a plurality of magnetic groups (e.g., paramagnetic particles conjugated to SNAP) that may be attracted to a surface 430, such as surface 430 comprising a plurality of oppositely polarized magnetic groups 438. FIG. 4C shows SNAP 410 coupled to an analyte 420 (e.g., a polypeptide) that interacts with a surface 430 through non-covalent binding interactions between complementary oligonucleotides. SNAP 410 comprises capture surface 412 comprising a plurality of oligonucleotides 414 hybridized to a plurality of complementary oligonucleotides 434 coupled to surface 430. Fig. 4D shows SNAP 410 coupled to an analyte 420 (e.g., a polypeptide) that is covalently conjugated to surface 430. Covalent bond 435 can be formed between surface 430 and a complementary reactive group on capture face 412 of SNAP 410, such as a click reactive group (e.g., methyltetrazine-trans-cyclooctene, azide-dibenzocyclooctyne, etc.). In some configurations, SNAP 410 may comprise a plurality of reactive groups on capture face 412 configured to form covalent bonds 430.

Fig. 4E-4F depict the configuration of SNAP interacting with an interface (e.g., water/air or water/oil). SNAP can associate with an interface through phase separation interactions. Fig. 4E depicts SNAP 410 coupled to analyte 420, which comprises capture surface 412 comprising a plurality of hydrophobic groups 417 (e.g., lipids). The presence of hydrophobic group 417 associates SNAP 410 with interface 440 formed between non-aqueous phase 444 and aqueous phase 448. Hydrophobic group 417 may preferentially migrate into non-aqueous phase 444 while more hydrophilic SNAP 410 and analyte 420 may remain in aqueous phase 448. Fig. 4F depicts an alternative configuration of interface associated SNAP 410. Fig. 4F depicts SNAP 410 coupled to analyte 420, which comprises capture surface 412 comprising a plurality of hydrophobic groups 417. The SNAP is also configured such that the capture surface 412 is also a presentation surface of the SNAP. The presence of hydrophobic group 417 associates SNAP 410 with interface 440 formed between non-aqueous phase 444 and aqueous phase 448. Hydrophobic group 417 and analyte 420 may preferentially migrate into non-aqueous phase 444 while more hydrophilic SNAP 410 may remain in aqueous phase 448. The configuration of fig. 4F may be advantageous for displaying hydrophobic analytes (e.g., membrane proteins, inorganic nanoparticles).

Fig. 4G depicts the configuration of SNAP 410 coupled to analyte 420 interacting with surface 430 through ion-mediated coupling interactions. SNAP may comprise negatively charged capture surface 412, which may be attracted to surface 430, such as surface 430 functionalized with negatively charged functional groups 433. In other configurations, the surface material may have an inherent negative charge. The negative charge of SNAP 410 may be due to the presence in the phosphodiester backbone of the nucleic acidNegative charge or due to negatively charged moieties conjugated to SNAP. The inherent repulsion between capture face 412 of SNAP 410 and negatively charged functional group 433 may be overcome by complexing or layering positively charged ions 450 to form an ion-mediated layer between SNAP 410 and surface 430. The skilled artisan will readily recognize that ion-mediated interactions may be modified for other situations, such as mediating positive-positive charge interactions or altering the intensity of positive-negative charge interactions. Deposition of SNAP on a surface by ion-mediated charge interactions may occur in the presence of: specific monoatomic, polyatomic, monovalent, multivalent, metallic or nonmetallic ions, such as H ⁺ 、Li ⁺ 、Na ⁺ 、K ⁺ 、Rb ⁺ 、Cs ⁺ 、Mg ²⁺ 、Ca ²⁺ 、Sr ²⁺ 、Ba ²⁺ 、Al ³⁺ 、Ag ⁺ 、Zn ² ⁺ 、Fe ²⁺ 、Fe ³⁺ 、Cu ⁺ 、Cu ²⁺ 、H ^- 、F ^- 、Cl ^- 、Br ^- 、I ^- 、O ^2- 、S ^2- 、N ^3- 、P ^3- 、B(OH) ₄ ^- 、C ₂ H ₅ O ^- 、CH ₃ COO ^- 、C ₆ H ₅ COO ^- 、C ₆ H ₅ O ₇ ^3- 、CO ₃ ^2- 、C ₂ O ₄ ^2- 、CN ^- 、CrO ₄ ^2- 、Cr ₂ O ₇ ^2- 、HCO ₃ ^- 、HPO ₄ ^2- 、H ₂ PO ₄ ^- 、HSO ₄ ^- 、MnO ₄ ^2- 、MnO ₄ ^- 、NH ₂ ^- 、O ₂ ^2- 、OH ^- 、SH ^- 、SCN ^- 、SiO ₄ ^2- 、S ₂ O ₃ ^2- 、C(NH ₂ ) ³⁺ 、NH ₄ ⁺ 、PH ₄ ⁺ 、H ₃ O ⁺ 、H ₂ F ⁺ 、C ₅ H ₅ O ⁺ 、Hg ₂ ²⁺ Or a combination thereof. FIG. 4H depicts the configuration of SNAP 410 coupled to analyte 420 interacting with surface 430 through particle-mediated coupling interactions. SNAP may comprise positively charged capture face 412 (e.g., comprising one or more aminated capture moieties) that may be inherently repelled by surface 430, such as surface 430 functionalized with positively charged functional groups 433 (e.g., aminated silane). Intermediate negatively charged particles 460 may facilitate interaction between SNAP 410 and surface 430 by passivating the surface positive charge and providing a negative charge that electrostatically couples positively charged capture surface 412 of SNAP 410. Negatively charged particles 460 may include carboxylated inorganic nanoparticles (e.g., carboxylated gold nanoparticles, carboxylated silver nanoparticles, etc.) or carboxylated organic nanoparticles (e.g., carboxylated dextran nanoparticles, carboxylated polystyrene particles, etc.).

In some configurations, the nucleic acid nanostructure (e.g., SNAP) can be structured to inhibit or avoid formation of charge-mediated interactions. Due to charge-mediated interactions, e.g., by ionic components of the deposition buffer, the nucleic acid nanostructures may be non-specifically attracted to surface areas where deposition is not supposed to occur. The nucleic acid nanostructures may be configured to exhibit ligands or other groups on the capture surface or capture moiety that disrupt unwanted interactions. For example, SNAP may comprise one or more single stranded nucleic acids (e.g., the overhanging tail of an oligonucleotide hybridized to a SNAP moiety) that disrupt the formation of charge-mediated interactions. In another example, SNAP can comprise a capture moiety comprising one or more oligonucleotides, wherein each oligonucleotide comprises a modified nucleotide configured to disrupt formation of charge-mediated interactions. The modified nucleotides may be chemically homogeneous (e.g., the same charge, the same structure, the same polarity, etc.) or may be chemically heterogeneous.

The capture face of a nucleic acid nanostructure (e.g., SNAP) can be configured to mediate associative associations between the nucleic acid nanostructure and a surface or interface. The configuration of the nucleic acid nanostructure can determine the association strength between the nucleic acid nanostructure and the surface or interface. The nucleic acid nanostructure can have a reversible or irreversible association with a surface or interface. Irreversible associations between nucleic acid nanostructures and surfaces or interfaces can be formed by covalent bonding or very strong non-covalent interactions (e.g., streptavidin-biotin). Reversible associations between nucleic acid nanostructures and surfaces or interfaces may be formed by weaker interactions, such as electrostatic interactions, magnetic interactions, or hydrogen bonding. Reversible associations may be stable until they are destroyed, for example by the introduction of denaturants or salts or cleavage of photo-coupling agents.

The size and/or conformation of the nucleic acid nanostructure capture face may affect the association strength between the nucleic acid nanostructure and the surface or interface. A smaller interaction region between the capture surface and the surface or interface may promote weaker interactions between the nucleic acid nanostructure and the surface or interface. The capture surface or capture moiety may comprise one or more tertiary nucleic acid structures that form interactions, such as electrostatic interactions, with the surface. An increase in the size or number of tertiary structures in the capture surface or capture moiety can increase the strength of interaction with the surface. For example, an increase in the size, number, or local density of tertiary structures of nucleic acids in the capture moiety can increase the strength of electrostatic interactions between the capture moiety and the surface due to the increased number of negatively charged phosphodiester groups in the nucleic acid backbone of each tertiary structure. Fig. 5A-5D depict various configurations of SNAP with different capture face sizes and/or conformations. Fig. 5A and 5B depict tapered SNAP structures with different two-dimensional projections between the presentation surface and the capture surface. Fig. 5A depicts SNAP 510 in combination with surface 530. SNAP includes a larger presentation surface 520 that includes a presentation portion 522.SNAP also includes capture surface 540, which has an area that is smaller than the area of presentation surface 520. Capturing face 540 forms a small interaction region 545 with surface 530, potentially resulting in weaker association between SNAP 510 and surface 530. Fig. 5B depicts SNAP 510 in combination with surface 530. SNAP comprises a smaller display surface 520 that comprises analyte conjugation site 522.SNAP also includes capture surface 540, which has an area that is larger than the area of presentation surface 520. Capture surface 540 forms a large interaction region 545 with surface 530, optionally resulting in a stronger association between SNAP 510 and surface 530. Fig. 5C depicts SNAP 510 comprising a non-planar capture surface 540 associating SNAP 510 with surface 530. SNAP includes a larger presentation surface 520 that includes a presentation portion 522.SNAP forms a smaller interaction region 545 with surface 530 due to the non-planar capture surface, optionally resulting in weaker association between SNAP 510 and surface 530. Fig. 5D depicts SNAP 510 comprising a non-planar capture surface 540 associating SNAP 510 with non-planar surface 535. SNAP comprises a display surface 520 that includes a capture portion 522. Because of the shape complementarity between capture surface 540 and non-planar surface 535, SNAP forms a larger interaction region 545 with surface 535, potentially resulting in a stronger association between SNAP 510 and surface 535. Thus, the size and/or shape of the nucleic acid nanostructure (e.g., SNAP) capture surface can be used to orient the nucleic acid nanostructure on a surface. The surface may be patterned with interaction regions to provide further control over the position and/or orientation of the nucleic acid nanostructures on the surface. For example, a hexagonal array of nucleic acid nanostructures may be formed by attaching the nanostructures to a surface having a hexagonal pattern of interaction regions separated by interstitial regions that are inert to the binding nanostructures. Furthermore, engineering the size and/or shape of one or both of the surface and the plurality of nucleic acid nanostructures may provide control over the arrangement of the nucleic acid nanostructures in the array. Thus, a user may achieve a desired density of nucleic acid nanostructures in an array, an average spacing of nucleic acid nanostructures in an array, a minimum separation between adjacent nucleic acid nanostructures in an array, or a maximum separation between adjacent nucleic acid nanostructures in an array. Accordingly, analytes conjugated to nucleic acid nanostructures will also be arranged accordingly.

The nucleic acid nanostructure (e.g., SNAP) may comprise a capture surface that forms a smaller interaction region than its two-dimensional projection. Fig. 6 depicts a view of the bottom and top surfaces of a rectangular-shaped SNAP 600. The correspondence of the edges between the top view and the bottom view is indicated by dashed lines. SNAP 600 includes a capture surface 610 configured to contact only a surface or interface (not shown) around the perimeter of SNAP 600. SNAP also includes a presentation face 620 that includes a presentation portion 622. Display face 620 occupies the entire area of the top surface of SNAP 600. The configuration depicted in fig. 6 will limit the size and/or intensity of the association between SNAP 600 and the surface or interface while maximizing the available area for analyte presentation. One skilled in the art will readily recognize that the configuration depicted in fig. 6 may be reconfigured to increase or decrease the size of capture face 610 and display surface 620 by altering the components of the structured nucleic acids that make up SNAP 600.

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) can comprise a utility face or utility portion comprising one or more modifying moieties. In some configurations, the utility face may comprise all or part of another face (such as a presentation face or a capture face). A modifying moiety can be added to the capture surface or capture moiety to alter a characteristic of the surface while mediating association between the nucleic acid nanostructure and the surface, between the nucleic acid nanostructure and the interface, between the first nucleic acid nanostructure and the second nucleic acid nanostructure, or between the nucleic acid nanostructure and a conforming molecule (e.g., an affinity reagent, a fluorophore, etc.). The modifying moiety may be attached covalently or non-covalently. The modifying moiety may be coupled to the nucleic acid nanostructure before, during, or after assembly of the nanostructure. Utility surface modifying groups can include charged moieties, magnetic moieties, steric moieties, amphiphilic moieties, optical moieties (e.g., reflective materials, absorptive materials), hydrophobic moieties, and hydrophilic moieties. The charged moiety may include a functional group that may carry an inherent positive or negative charge, or may carry a charge under dissociation conditions (e.g., carboxylic acid, nitrate, sulfone, phosphate, phosphonate, etc.). The magnetic portion may include paramagnetic, diamagnetic, and ferromagnetic particles, such as nanoparticles (e.g., gadolinium, manganese, iron oxide, bismuth, gold, silver, cobalt nanoparticles, etc.). The steric moiety may include polymers and biopolymers (e.g., PEG, PEO, dextran, sheared nucleic acids). The amphiphilic moiety may include a phospholipid (e.g., phosphatidic acid, phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylinositol phosphate, phosphatidylinositol hydrogen phosphate, phosphatidylinositol triphosphate, ceramide phosphorylcholine, ceramide phosphorylethanolamine, ceramide phosphoryl lipid), a glycolipid (e.g., glyceroglycolipid, glycosphingolipid, rhamnolipid, etc.), a sterol (e.g., cholesterol, campesterol, sitosterol, stigmasterol, ergosterol, etc.). The hydrophobic moiety may include a steroid (e.g., cholesterol), a saturated fatty acid (e.g., caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachic acid, behenic acid, lignoceric acid, cerotic acid, etc.), and an unsaturated fatty acid (e.g., myristoleic acid, palmitoleic acid, hexadecenoic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, docosahexaenoic acid, etc.). Hydrophilic compounds may include charged molecules and polar molecules (e.g., diols, cyclodextrins, celluloses, polyacrylamides, and the like).

In some configurations, a nucleic acid nanostructure (e.g., SNAP) can comprise a utility face or utility portion that comprises one or more extendable nucleic acids (e.g., nucleic acid primers) or extended nucleic acids (e.g., extended nucleic acid primers). Primers or other extendable nucleic acid ends can hybridize to the template strand to direct polymerase-based extension. However, extension need not involve the addition of nucleotides, for example by a template directed polymerase, but rather by a terminal deoxynucleotidyl transferase (terminal deoxynucleotidyl transferase) or by a ligase. Optionally, some or all of the nucleic acid ends in the nucleic acid nanostructure may be non-extendable, e.g., due to the presence of 5 'or 3' extension blocking moieties, except for a given primer to be extended. Thus, extension may occur selectively at a given primer over the other ends. Exemplary extended blocking moieties include, but are not limited to, those used in nucleic acid sequencing by synthesis reactions, such as reversible terminators. Reversible terminator moieties may be particularly useful because they may be present on a first nucleic acid to prevent its extension during extension of a second nucleic acid end, and then removed from the first end to render it extendable.

The extended nucleic acid may be configured to occupy a volume surrounding the nucleic acid nanostructure and/or exclude other molecules (e.g., other SNAP, analytes, etc.) from approaching or contacting the nucleic acid nanostructure. The extended nucleic acid may comprise a single-stranded nucleic acid strand, a double-stranded nucleic acid strand, or a combination thereof. The extended nucleic acid may comprise a secondary structure (e.g., a helical structure). The extended nucleic acid may comprise regions of random or disordered structure. The extended nucleic acid strand may incorporate modified or unnatural nucleotides, or other linking moieties. The extended nucleic acid may be formed by a method such as terminal deoxynucleotidyl transferase (TdT) polymerization. Methods of forming extended nucleic acids are described in Yang et al Angewandte Chemie int.ed.,10.1002/anie.202107829, (2021), which is incorporated herein by reference in its entirety. The extended nucleic acid may have a sequence comprising at least about 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 10000, 15000, 20000 or more than 20000 nucleotides. Alternatively or additionally, the extended nucleic acid may have a sequence comprising no more than about 20000, 15000, 10000, 5000, 4000, 3000, 2500, 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or less than 100 nucleotides. The extended nucleic acid may have a length of at least about 10 nanometers (nm), 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 120nm, 140nm, 160nm, 180nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, or more than 500nm in an extended or concentrated state (e.g., coiled, self-hybridization, etc.). Alternatively or additionally, the extended nucleic acid may have a length of no more than about 500nm, 450nm, 400nm, 350nm, 300nm, 250nm, 200nm, 180nm, 160nm, 140nm, 120nm, 100nm, 90nm, 80.nm, 70nm, 60nm, 50nm, 40nm, 30nm, 20nm, 10nm, or less than 10nm in an extended or concentrated state (e.g., coiled, self-hybridized, etc.).

The utility face or utility portion of a nucleic acid nanostructure (e.g., SNAP) can comprise one or more modifying moieties. The utility face of the nucleic acid nanostructure can comprise at least about 10, 50, 100, 500, 1000, 5000, 10000, 50000, 100000, 50000, 1000000, or more than 1000000 modifying groups. Alternatively or additionally, the utility face of the nucleic acid nanostructure may comprise no more than about 1000000, 500000, 100000, 50000, 10000, 5000, 1000, 500, 100, 50, 10, or less than 10 modifying groups.

The nucleic acid nanostructure (e.g., SNAP) can comprise a utility face with a modifying moiety having a characteristic density. The modified moiety density may refer to the average or local area density of modified moieties on the utility face of the nucleic acid nanostructure. The utility surface of the nucleic acid nanostructure can have no more than about 1 group/nm ² 1 group/10 nm ² 1 group/100 nm ² 1 group/1000 nm ² 1 group/10000 nm ² 1 group/100000 nm ² 1 group/1000000 nm ² Or less than 1 group per 1000000nm ² Is a modified part of the density. Alternatively or additionally, the utility face of the nucleic acid nanostructure may have at least about 1 group per 1000000nm ² 1 group/100000 nm ² 1 group/10000 nm ² 1 group/1000 nm ² 1 group/100 nm ² 1 group/10 nm ² 1 group/nm ² Or more than 1 group/nm ² Is a modified part of the density.

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) may comprise one or more detectable labels, e.g., on the utility face of the nanostructure. The detectable label may comprise a moiety configured to provide or transmit a signal. The detectable label may provide or transmit a signal in real time (e.g., fluorophore, radiolabel) or at a later time (e.g., bar code). The detectable label may comprise a detectable label selected from the group consisting of a fluorescent group, a luminescent group, a radiolabel, an isotope, and a bar code. Any of a variety of fluorescent labels known in the art may be used to label the probes. In some cases, the fluorescent label may be a small molecule. In some cases, the fluorescent label may be a protein. In some cases, the fluorescent label may be a nanoparticle (e.g., a quantum dot, a fluorescently labeled polymer nanoparticle, etc.). Fluorescent labels may include labels that emit ultraviolet, visible, or infrared spectra. In some cases, the fluorescent molecule may be selected from FITC, alex a350、Alexa/>405、Alexa/>488、Alexa/>532、Alexa/>546、Alexa555、Alexa/>568、Alexa/>594、Alexa/>647、Alexa/>680、Alexa/>750. Pacific blue, coumarin, BODIPY FL, pacific green, oregon green, cy3, cy5, pacific orange, TRITC, texas red, R-phycoerythrin and Allophycocyanin (APC). In some cases, the label may be an Atto dye, such as Atto 390, atto 425, atto 430, atto 465, atto 488, atto 490, atto 495, atto 514, atto 520, atto 532, atto 540, atto 550, atto 565, atto 580, atto 590, atto 594, atto 610, atto 611, atto612. Atto 620, atto 633, atto 635, atto 647, atto 655, atto 680, atto 700, atto 725, atto 740, atto MB2, atto Oxa12, atto Rho101, atto Rho12, atto Rho13, atto Rho14, atto Rho3B, atto Rho6G, or Atto Thio12. A variety of useful fluorescent labeling groups are commercially available from Molecular Probes department of ThermoFisher Scientific and are generally described in Molecular Probes Handbook (11 th edition), which is incorporated herein by reference. The detectable label may also include an intercalating dye, such as ethidium bromide, propidium bromide, crystal violet, 4', 6-diamidino-2-phenylindole (DAPI), 7-amino actinomycin D (7-AAD), hoescht 33258, hoescht 33342, hoescht 34580, YOYO-1, diYO-1, TOTO-1, diTO-1, or combinations thereof.

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) may comprise a three-dimensional structure. The nucleic acid nanostructure can comprise a plurality of faces, including a display face, a binding face, and an additional utility face. In some configurations, the utility surface may be located on a nucleic acid nanostructure region that constitutes a height or depth of the nucleic acid nanostructure. The utility surface may be used for any of a variety of purposes, including coupling a nucleic acid nanostructure to other structures or providing a space between a nucleic acid nanostructure and other structures or molecules. The utility face may comprise one or more modifying groups. The utility surface modifying groups may be attached covalently or non-covalently. The utility surface modifying group can be coupled to the nucleic acid nanostructure before, during, or after assembly of the nanostructure. Utility surface modifying groups may include charged moieties, magnetic moieties, steric moieties, hydrophobic moieties, hydrophilic moieties, and coupling groups. The coupling group may comprise any group configured to couple the nucleic acid nanostructure to a solid support or another molecule (such as another nucleic acid nanostructure). The coupling groups may include covalent coupling groups and non-covalent coupling groups. Covalent coupling groups may include chemically active species such as click-reaction groups and crosslinking molecules. Crosslinking molecules may include chemical crosslinking molecules and photoinitiated crosslinking molecules. The non-covalent coupling group can include a binding pair (e.g., streptavidin-biotin) and a nucleic acid configured to base pair with complementary nucleic acids on other molecules. The nucleic acid nanostructure (e.g., SNAP), the molecule to be conjugated to the nucleic acid nanostructure, or the solid support to be conjugated to the nucleic acid nanostructure may include any of a variety of coupling groups, such as those described in U.S. patent application serial No. 17/062,405 or WO 2019/195633 A1 (each of which is incorporated herein by reference). The utility surface of the nucleic acid nanostructure may comprise one or more steric hindrance groups that block access of other molecules in the vicinity of the nucleic acid nanostructure, as determined by the size of the one or more steric hindrance groups.

The nucleic acid nanostructure (e.g., SNAP) may comprise one or more coupling surfaces or coupling moieties. The utility face or utility moiety may comprise one or more functional groups or moieties configured to couple the first nucleic acid nanostructure to the second nucleic acid nanostructure. The coupling moiety may include those set forth herein, for example in the context of a utility face. Coupling between nucleic acid nanostructures (e.g., displaying SNAP and spacing SNAP) or between nucleic acid nanostructure complexes can be formed by reversible or irreversible binding of complementary sets of coupling moieties on each pair forming nucleic acid nanostructure. Reversible binding of complementary nucleic acid nanostructures can occur via non-covalent bonds (e.g., nucleic acid hybridization, hydrogen bonding) or thermodynamically reversible covalent bonds (e.g., peroxide bonds, disulfide bonds). The nucleic acid nanostructure or complex thereof may comprise one or more coupling groups configured to couple with one or more complementary coupling moieties on the second nucleic acid nanostructure or complex thereof. The nucleic acid nanostructure or complex thereof may comprise one or more faces comprising one or more coupling moieties configured to couple with one or more complementary coupling moieties on the face of the second nucleic acid nanostructure or complex thereof. The nucleic acid nanostructure or complex thereof can comprise a plurality of coupling moieties configured to couple with a plurality of complementary coupling moieties on a second nucleic acid nanostructure or complex thereof. In some configurations, the nucleic acid nanostructure or complex thereof may comprise a plurality of coupling moieties to ensure that at least one, but preferably more than one, coupling interaction is formed with the complementary nucleic acid nanostructure or complex thereof.

The nucleic acid nanostructure may comprise a plurality of coupling surfaces or coupling moieties configured to couple the nucleic acid nanostructure to a plurality of nucleic acid nanostructures. For example, a square or rectangular shaped SNAP may comprise four coupling faces, each coupling face being disposed along one of four sides comprising the square or rectangle. The coupling face may comprise one or more functional groups or moieties configured to couple the first nucleic acid nanostructure to the second nucleic acid nanostructure. For example, the coupling face or coupling moiety may comprise a plurality of single stranded nucleic acids configured to hybridise to a plurality of complementary single stranded nucleic acids on the second coupling face or coupling moiety, thereby coupling the first coupling face to the second coupling face. In another example, the coupling face may comprise a single streptavidin molecule configured to bind to a biotin molecule on the second coupling face, thereby coupling the first coupling face to the second coupling face. In some configurations, the coupling of the first nucleic acid nanostructure to the second nucleic acid nanostructure can comprise an intermediate coupling group that mediates the coupling of the first nucleic acid nanostructure to the second nucleic acid nanostructure. For example, the plurality of SNAP may be configured to display only streptavidin molecules on one or more coupling surfaces such that a first SNAP cannot directly bind a second SNAP. The inclusion of only an intermediate coupling group for surface displaying biotin may allow the first SNAP to be coupled to the second SNAP. The intermediate coupling group may comprise a nucleic acid nanostructure or a non-nucleic acid particle or molecule (e.g., an organic or inorganic nanoparticle). The coupling of the first nucleic acid nanostructure to the second nucleic acid nanostructure may be reversible (e.g., nucleic acid hybridization) or irreversible (e.g., click reaction).

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) may comprise one or more sites that allow for controlled degradation of the nucleic acid nanostructure. The nucleic acid nanostructure may comprise one or more photocleavable linkers. The photocleavable linker may be located within any portion of the nucleic acid nanostructure, including the scaffold strand and any of a plurality of oligonucleotides that may be coupled within the nucleic acid nanostructure. In some cases, the nucleic acid nanostructures may compriseComprising a plurality of photocleavable linkers. The photocleavable linker may be located within the nucleic acid nanostructure to allow controlled degradation of the nucleic acid nanostructure, e.g., for programmed removal of SNAP or programmed release of SNAP and analyte from the surface. For nucleic acid nanostructure compositions that comprise a multifunctional moiety that hybridizes to a portion of the nucleic acid nanostructure, the multifunctional moiety may comprise a photocleavable linker. In some configurations, the multifunctional moiety may not comprise a photocleavable linker. A photocleavable linker may be included in the multifunctional moiety to allow programmable release of the analyte from the nucleic acid nanostructure or solid support coupled to the analyte. The photocleavable linker may comprise any suitable photocleavable linker, such as nitrobenzyl, carbonyl or benzyl-based photocleavable linkers. The photocleavable linker may be configured to cleave at a specific wavelength or within a specific frequency range (such as far infrared, near infrared, visible, near ultraviolet, far ultraviolet, or a combination thereof). The photocleavable linker may be selected because it has a peak cut-off wavelength that does not interfere with other biological or chemical processes, such as the absorption or emission wavelength of a fluorophore. The nucleic acid nanostructure (e.g., SNAP) may comprise one or more degradation sites that are substrates for enzymatic degradation (e.g., by restriction enzymes, proteases, kinases, or other suitable enzymes). Nucleic acid nanostructures may incorporate moieties that are enzymatically degraded substrates, such as those that are cleaved by uracil DNA glycosylase and endonuclease VIII (available from New England Biolabs, beverley MA Enzymes commercially available) degraded uracil nucleotides, 8-oxo-guanine nucleotides degraded by the DNA glycosylase OGG1 or peptides degraded by proteases. For nucleic acid nanostructure compositions that comprise a multifunctional moiety that hybridizes to a portion of the nucleic acid nanostructure, the multifunctional moiety may comprise a degradation site that is a target of enzymatic degradation. In some configurations, the multifunctional moiety may not comprise a degradation site that is a target of enzymatic degradation.

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) may comprise one or more sites or groups that are incorporated into the nucleic acid nanostructure to promote stability of the nucleic acid nanostructure. Nucleic acid nanostructures (e.g., SNAP) may comprise modified or unnatural nucleotides (e.g., PNAs, locked nucleic acids, etc.) that are resistant to degradation by endonucleases or other enzymes. The nucleic acid nanostructure can comprise one or more crosslinking groups that couple the nucleic acid nanostructure components to each other (e.g., coupling an oligonucleotide to a scaffold chain) and/or one or more crosslinking groups that couple the nucleic acid nanostructure to another entity (e.g., a solid support, a second nucleic acid nanostructure, etc.).

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) may comprise one or more linkers. The linker may comprise a molecular strand or portion linking two portions of the oligonucleotide, including, for example, any nucleic acid component of the nucleic acid nanostructure, such as a scaffold strand, an oligonucleotide hybridized to a scaffold strand, or a multifunctional oligonucleotide hybridized to a nucleic acid nanostructure. The joints may comprise rigid joints or flexible joints. The linker may comprise a polymeric moiety, such as a polyethylene glycol (PEG), polyethylene oxide (PEO) moiety, or a polynucleotide. The linker may introduce desired chemical properties such as hydrophobicity, hydrophilicity, polarity, or charge. The linker may include a moiety configured to link one or more additional moieties or molecules together, such as a plurality of multifunctional moieties. The linker may comprise one or more modified nucleotides, such as PNA, LNA, and/or nucleotides modified with functional groups configured to perform click reactions. Figures 3A-3D depict methods of coupling an analyte to a solid support using a multifunctional moiety comprising a linking group. As shown in FIG. 3A, SNAP 300, which is coupled to analyte 310 via multivalent linker 320, is coupled to a coupling moiety 335 comprising a plurality of surface linkages. The multivalent linker is coupled to four arms (321, 322, 323, 324) of the multifunctional moiety, which hybridize to SNAP and comprise a functional group 325 configured to couple to a surface-attached coupling moiety 335. FIG. 3B depicts a polymer containing five functional groups (R respectively ₁ 、R ₂ 、R ₃ 、R ₄ And R is ₅ ) A kind of electronic deviceA close-up view of multivalent coupling 320. Functional group R ₁ 、R ₂ 、R ₃ And R is ₄ Coupled to four arms 321, 322, 323, and 324, respectively, of the multifunctional moiety. Functional group R ₅ Coupled to analyte 310. FIG. 3C depicts the coupling of SNAP 300 and analyte 310 to solid support 330 through the coupling of functional group 325 to surface-attached coupling moiety 335. Fig. 3D depicts the composition after SNAP 300 structure has degraded, leaving analyte 310 coupled to solid support 330 through four arms (321, 322, 323, 324) of the multifunctional moiety. This configuration may have the advantage of increasing the chemical stability of analyte coupling, as multiple coupled multifunctional moieties provide redundancy against any single chain uncoupling. The configuration may also be advantageous because multiple coupled multifunctional moieties may stabilize the spatial position of the analyte, where only a single coupled multifunctional moiety may have more translational degrees of freedom.

As set forth herein, a nucleic acid nanostructure (e.g., SNAP) can comprise one or more crosslinking groups. Crosslinking groups may include chemical, enzymatic and photochemical crosslinking groups. The crosslinking group may stabilize or prevent dissociation of one or more nucleic acid structures in the nucleic acid nanostructure. One of the plurality of oligonucleotides may be cross-linked to a scaffold chain of the nucleic acid nanostructure. In the nucleic acid nanostructure, a first oligonucleotide of the plurality of oligonucleotides can be crosslinked with a second oligonucleotide of the plurality of oligonucleotides. Oligonucleotides comprising important structural features, such as utility moieties (e.g., display moieties, capture moieties) can be crosslinked to nucleic acid nanostructures to enhance stability or prevent dissociation of the oligonucleotide. The multifunctional moiety comprising two or more utility moieties (e.g., a display moiety and a capture moiety) may comprise one or more groups that crosslink with the nucleic acid nanostructure.

The nucleic acid nanostructure (e.g., SNAP) may comprise a fully structured portion and/or a partially structured portion. The fully structured portion of the nucleic acid nanostructure can be identified as a nucleic acid nanostructure region that retains primary, secondary, and tertiary structures during the course of use. A partially structured portion of a nucleic acid nanostructure can be identified as a region of the nucleic acid nanostructure that comprises a primary structure but does not retain a particular secondary structure and/or tertiary structure during the course of use. In some configurations, the partially structured portion of the nucleic acid nanostructure can comprise single stranded nucleic acid. The single stranded nucleic acid may be located between the double stranded nucleic acid regions, or may comprise a pendent structure or terminal strand of the nucleic acid. The single stranded nucleic acid may have a specific length, for example, at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 nucleotides. Alternatively or additionally, the single stranded nucleic acid may have a length of no more than about 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, or less than 5 nucleotides. In some configurations, a partially structured portion of a nucleic acid nanostructure can comprise a non-nucleic acid moiety, a molecular group, or a chain, such as PEG or a polymer chain. In some configurations, the partially structured portion of the nucleic acid nanostructure can comprise an amorphous structure, such as a spherical structure (e.g., nanospheres, dendrimers, etc.). Fig. 37A depicts SNAP 3710 having a partially structured region 3730 (e.g., single stranded nucleic acid, polymer, dendrimer, etc.). SNAP 3710 is coupled to analyte 3720. Partially structured region 3730 can be located on multiple SNAP faces (e.g., capture face, display face). Partially structured region 3730 can provide SNAP 3710 with one or more functions, such as increasing binding strength to a target binding surface, decreasing binding strength to a non-target surface, and preventing non-specific binding of other molecules to SNAP faces or coupled analytes.

Multifunctional moiety: in one aspect, described herein are compositions comprising a nucleic acid nanostructure (e.g., SNAP) and a multifunctional moiety, wherein the multifunctional moiety can be configured to couple with the nucleic acid nanostructure, and wherein the multifunctional moiety can be configured to form two or more additional interactions. In some configurations, the multifunctional moiety may be configured to couple to a nucleic acid nanostructure, and may continuously couple the surface to an analyte. The continuous coupling of the surface to the analyte may comprise a coupling wherein the surfaceThe face is directly coupled to the analyte via a multifunctional moiety without any other intervening groups or moieties. For example, if SNAP is coupled to the surface through a multifunctional moiety and the analyte is coupled to SNAP but not to the multifunctional moiety, the analyte will not be continuously coupled to the surface through the multifunctional moiety. The multifunctional moiety may comprise a first functional group and a second functional group. In some configurations, the first functional group may be coupled to or configured to be coupled to a surface, and the second functional group may be coupled to or configured to be coupled to an analyte. In some configurations, the multifunctional moiety may be coupled to or configured to be coupled to a nucleic acid nanostructure, and may form two or more coupling interactions with a surface. The multifunctional moiety may comprise a display moiety and a surface interaction moiety.

As set forth herein, the multifunctional moiety may comprise a plurality of functional groups. The multifunctional moiety may comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 functional groups. Alternatively or additionally, the multifunctional moiety may contain no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or less than 3 functional groups.

As set forth herein, the multifunctional moiety may comprise one or more molecular chains. The molecular chain may comprise a multimeric compound such as an oligonucleotide or a polymer chain (e.g., polyethylene, polypropylene, polyethylene glycol, polyethylene oxide, etc.). In other configurations, the multifunctional moiety may not comprise a nucleic acid. In some configurations, the multifunctional moiety may comprise multiple molecular chains. The multifunctional moiety may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 molecular chains. Alternatively or additionally, the multifunctional moiety may comprise no more than about 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 molecular chains. Two or more molecular chains of the multifunctional moiety may be bound, coupled or linked by a linking moiety. Fig. 7A-7B depict exemplary configurations of the connecting portion. Fig. 7A depicts the formation of a multifunctional moiety comprising an alkyl linking moiety. The linking moiety comprises an alkyl linking group 710 comprising four reactive functional groups including 3 methyltetrazine (mTz) groups 720 and 1 Dibenzocyclooctene (DBCO) group 730. The linking moiety may be in contact with the molecular chain 740 comprising the azide functional group, thereby linking the azide functional molecular chain 740 to the DBCO group 730 via an azide-DBCO click reaction. The linking moiety may also be in contact with a molecular chain 750 comprising a trans-cyclooctene (TCO) functionality, thereby linking the TCO functionalized molecular chain 750 to mTz functionality 720 via a mTz-TCO click reaction. FIG. 7B depicts a multifunctional moiety comprising a set of modified nucleotides in a longer oligonucleotide molecular chain. The linking moiety comprising the modified nucleotide is shown in the dashed box. The linker moiety comprises four modified thymidines, including two mTz functionalized thymidines 760 and two DBCO functionalized thymidines 770. The multifunctional moiety may be contacted with the azide-functionalized molecular chain 740 and/or the TCO-functionalized molecular chain 750 to couple one or more molecular chains by a click reaction.

The multifunctional moiety may be configured to couple to a nucleic acid nanostructure (e.g., SNAP). The coupling of nucleic acid nanostructures may depend on how the nucleic acid nanostructures are to be utilized. For example, in some configurations, the multifunctional moiety may help locate and couple SNAP on a surface. In other configurations, SNAP may help locate and couple the multifunctional moiety to the surface. Figures 8A-8D depict various configurations of multifunctional moieties coupled to SNAP. FIG. 8A shows a polymer having a functional group R ₁ And R is ₂ Comprising an oligonucleotide coupled to SNAP 800 to form a region of hybridized nucleic acid 830. Functional group R ₁ And R is ₂ Respectively by a top surface (e.g., a display surface) and a bottom surface (e.g., a capture surface). FIG. 8B shows a polymer having functional groups R ₁ And R is ₂ Comprising an oligonucleotide coupled to SNAP 800 to form a region of hybridized nucleic acid 830. Functional group R ₁ And R is ₂ Shown on the bottom surface (e.g., capture surface). FIG. 8C depicts a polymer having functional groups R ₁ And R is ₂ Comprising a molecular chain (e.g., polymer, oligonucleotide) coupled to SNAP 800 via a functional group or moiety 850 coupled to a complementary functional group or moiety 860 in SNAP 800 (e.g., via a click reaction, via nucleic acid hybridization). Functional group R ₁ And R is ₂ Respectively by a top surface (e.g., a display surface) and a bottom surface (e.g., a capture surface). FIG. 8D depicts a polymer having functional groups R ₁ And R is ₂ Comprising a molecular chain (e.g., polymer, oligonucleotide) coupled to SNAP 800 by a functional group or moiety 850 coupled (e.g., by a click reaction, by nucleic acid hybridization) to a complementary functional group or moiety 860 on the exterior face of SNAP 800. Multifunctional moiety 810 is coupled to SNAP 800 but is configured to be entirely external to SNAP 800 structure.

In some configurations, a nucleic acid nanostructure composition (e.g., SNAP composition) can include a nucleic acid nanostructure and a multifunctional moiety configured to couple with the nucleic acid nanostructure. In other configurations, the nucleic acid nanostructure composition can comprise a multifunctional moiety coupled to the nucleic acid nanostructure. For example, a SNAP composition may comprise a fluid medium that in a first configuration comprises a plurality of partially formed SNAP in contact with a plurality of multifunctional moieties and in a second configuration comprises a plurality of fully formed SNAP, wherein the multifunctional moieties are coupled to each SNAP. In some configurations, the nucleic acid nanostructure composition can further comprise an analyte configured to be coupled to the multifunctional moiety. For example, a SNAP composition may comprise a fluid medium comprising a plurality of SNAP comprising a multifunctional moiety and a plurality of analytes configured to couple to the multifunctional moiety. In some configurations, the nucleic acid nanostructure composition can further comprise an analyte coupled to the multifunctional moiety. For example, a SNAP composition may comprise a SNAP formed from a plurality of moieties in contact with a plurality of multifunctional moieties, wherein each multifunctional moiety is coupled to an analyte. In another example, a SNAP composition can comprise a plurality of SNAP containing multifunctional moieties, wherein each multifunctional moiety is coupled to an analyte. In some configurations, the nucleic acid nanostructure composition can further comprise a surface configured to couple to a multifunctional moiety. For example, a SNAP composition can comprise a solid support comprising a plurality of surface-attachment moieties, wherein the solid support is contacted with a plurality of SNAP comprising multifunctional moieties, wherein each multifunctional moiety comprises a surface-interaction moiety configured to couple to a surface-attachment moiety. In some configurations, the nucleic acid nanostructure composition can further comprise a surface coupled to the multifunctional moiety. For example, a SNAP composition may comprise a solid support comprising a plurality of surface-attachment moieties, wherein one or more of the surface-attachment moieties are coupled to a plurality of surface-interaction moieties of SNAP comprising a multifunctional moiety, and wherein the solid support is contacted with a fluid medium comprising a plurality of analytes, wherein each analyte is configured to be coupled to a display moiety of the multifunctional moiety. Those skilled in the art will readily recognize a variety of variations of nucleic acid nanostructure compositions according to the order in which the different components (e.g., SNAP, multi-functional moieties, analyte, solid support, etc.) are introduced into the system, as set forth herein.

In some configurations, provided herein are compositions comprising a nucleic acid nanostructure (e.g., SNAP) comprising a display moiety configured to couple with an analyte and a capture moiety configured to couple with a surface, and a multifunctional moiety comprising a first functional group and a second functional group, wherein the multifunctional moiety hybridizes to the nanostructure moiety, and wherein the display moiety comprises the first functional group and the capture moiety comprises the second functional group. Such nucleic acid nanostructures may be configured to couple with an analyte using a first functional group and to couple with a surface or interface using a second functional group. The nanostructure portion may be configured to occupy a given area of the surface to prevent other nucleic acid nanostructures from occupying the same area. This may occur, for example, due to space rejection, charge rejection, or other mechanisms. Such a configuration may provide surprising advantages, such as binding (linking connection) through the attachment of the multifunctional moiety between the analyte and the surface, and preventing more than one analyte from occupying a given area of the surface due to the presence of the nanostructure moiety. The nanostructure portion may be removed (e.g., degraded) intentionally or unintentionally so that the analyte may remain coupled to the surface. Thus, the nanostructure portion can advantageously inhibit interaction of the analyte with other analytes, reagents, or objects during surface deposition, and then the nanostructure portion can be removed to facilitate interaction of the analyte with other analytes, reagents, or objects useful for detection or manipulation on the surface of the analyte.

Fig. 9A-9F depict methods of coupling analytes to a surface using SNAP with multifunctional oligonucleotides. Fig. 9A depicts a schematic diagram of SNAP 910 comprising an oligonucleotide 940 having a first end functionality 920 comprising Dibenzocyclooctyne (DBCO) and a second end functionality 930 comprising methyltetrazine (mTz). Oligonucleotide 940 is configured to hybridize to a portion of SNAP such that it forms a localized region 945 of secondary or tertiary structure (e.g., a double helix), thereby stabilizing oligonucleotide 940 within SNAP structure 910. SNAP 910 is contacted with solid support 950, which comprises non-reactive region 952 and a region comprising reactive third functional group 955, which comprises an azide moiety configured to react with first terminal functional group 920. As shown in fig. 9B, first terminal functional group 920 may react with third functional group 955 to form a covalent bond that couples SNAP 910 to solid support 950 in the vicinity of the location where third functional group 955 is coupled to solid support 950. As shown in fig. 9C, the coupled SNAP may be contacted with an analyte 960 that includes a fourth functional group 970 that includes trans-cyclooctene, the fourth functional group configured to react with a second terminal functional group 930. As shown in fig. 9D, the second terminal functional group 930 may react with the fourth functional group 970 to form a covalent bond that couples the analyte 960 to the solid support 950. It is to be understood that functional groups 920, 955, 930, and 970 are exemplary and may be replaced with other coupling moieties such as those set forth herein or known in the art. As shown in fig. 9E, SNAP-analyte composition may be subjected to degradation phenomena, such as light source 980, which disrupts the structure of SNAP 910, thereby degrading SNAP 910. Degradation may be performed using other means such as endonuclease digestion of one or more nucleic acid strands in SNAP, thermal or chemical denaturation of nucleic acid strand interactions, or chemical cleavage of scissile bonds in SNAP. As shown in fig. 9F, analyte 960 may remain coupled to solid support 950 through oligonucleotide 940 after SNAP 910 degrades.

Nucleic acid nanostructures (e.g., SNAP) (such as the configurations depicted in fig. 9A-9F) comprising a multifunctional moiety may be configured to form a hybridization region with a multifunctional moiety consisting of multiple nucleic acid base pairs. In some configurations, the multifunctional moiety can form a hybridization region with a nucleic acid nanostructure comprising at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 200, or more than 200 nucleotides. Alternatively or additionally, the multifunctional moiety may form a hybridization region with a nucleic acid nanostructure comprising no more than about 200, 150, 125, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, or less than about 10 nucleotides. The hybridization region formed between the nucleic acid nanostructure and the multifunctional moiety can be characterized by a specific number of helical rotations formed (where a single rotation typically comprises between 10 and 11 base pairs). In some configurations, the multifunctional moiety can form a hybridization region comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 helical rotations. Alternatively or additionally, the multifunctional moiety may form a hybridization region comprising no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or less than 1 helical rotation.

Nucleic acid nanostructures (e.g., SNAP) may comprise multiple tertiary structures that together form a quaternary or other higher order structure in the nucleic acid nanostructure. A particular tertiary structure may comprise a portion or structure that belongs to a particular face of the nucleic acid nanostructure. The nucleic acid nanostructure may comprise a plurality of tertiary structures, wherein the display surface comprises a first tertiary structure of the plurality of tertiary structures and the capture surface comprises a second tertiary structure of the plurality of tertiary structures. In some configurations, the first tertiary structure may be the same as the second tertiary structure. In other configurations, the first tertiary structure is different from the second tertiary structure. In a nucleic acid nanostructure configuration that includes a multifunctional moiety having a first functional group and a second functional group, the multifunctional moiety can hybridize to the nucleic acid nanostructure, thereby forming a portion of a first tertiary structure or a portion of a second tertiary structure. In other configurations, the multifunctional moiety can hybridize to the nucleic acid nanostructure, thereby forming a portion of the first tertiary structure and a portion of the second tertiary structure.

The nucleic acid nanostructure (e.g., SNAP) comprising a first multifunctional moiety can also comprise a second multifunctional moiety comprising a third functional group and a fourth functional group. In some configurations, the utility moiety (e.g., display moiety) may comprise a third functional group, and the second utility moiety (e.g., capture moiety) may comprise a fourth functional group. In some configurations, the third functional group or the fourth functional group may be configured to couple to a surface. In some specific configurations, the third functional group or the fourth functional group may be coupled to the surface. In some configurations, the third functional group or the fourth functional group may be configured to couple with the second analyte. In some specific configurations, the third functional group or the fourth functional group may be coupled to the second analyte. In some configurations, the third functional group or the fourth functional group may be configured to couple to an analyte to which the first multifunctional moiety is coupled. In some specific configurations, the third functional group or the fourth functional group can be coupled to an analyte to which the first multifunctional moiety is coupled.

Fig. 10A-10D illustrate a method of coupling SNAP comprising two multifunctional moieties to a surface. Fig. 10A shows SNAP 1000 comprising a first multifunctional moiety 1010 coupled to an analyte 1020 and comprising a first functional group 1015. SNAP 1000 also includes a second multifunctional moiety 1030 coupled to utility moiety 1040 and including a second functional group 1035.SNAP 1000 may comprise a capture surface comprising a capture moiety comprising a first functional group and a second functional group. SNAP 1000 may be contacted with solid support 1050 comprising a plurality of functional groups or moieties including surface-attached non-coupling groups 1060 and surface-attached coupling groups 1065 configured to couple to a capture moiety or capture moieties. As shown in fig. 10B, the first functional group and/or the second functional group may be coupled to a surface-attached coupling group 1065, thereby coupling SNAP 1010 to solid support 1050 via at least one of the two functional groups comprising a capture moiety. As shown in fig. 10C, SNAP 1000 coupled to solid support 1050 may be exposed to degradation phenomena, such as light source 1070, which results in degradation of the SNAP 1000 structure. Degradation may be performed using other means such as endonuclease digestion of one or more nucleic acid strands in SNAP, heating, pH change, chemical cleavage of scission bonds in SNAP, or any other suitable degradation method. As shown in fig. 10D, after degradation of SNAP structures, a first multifunctional moiety 1010 coupled to analyte 1020 and a second multifunctional moiety 1030 coupled to utility moiety 1040 are co-located on solid support 1050.

The multifunctional moiety that hybridizes to the nucleic acid nanostructure (e.g., SNAP) may be configured to couple the nucleic acid nanostructure or portion thereof to a surface. In some configurations, the surface may comprise surface functional groups configured to couple with functional groups contained on the multifunctional moiety. In some configurations, the surface functional groups may comprise functional groups configured to form covalent bonds with functional groups contained on the multifunctional moiety. In some specific configurations, the surface functional groups and functional groups contained on the multifunctional moiety may form covalent bonds, such as by a click-type reaction, substitution reaction, elimination reaction, or any other suitable bonding chemistry.

Nucleic acid nanostructures (e.g., SNAP) comprising multifunctional moieties may be formed before or after the nucleic acid nanostructures are coupled to a surface. FIGS. 11A-11D depict a method of hybridizing a multifunctional moiety to SNAP after SNAP has been coupled to a surface. Fig. 11A shows SNAP 1110 in contact with surface 1100, allowing SNAP to couple to the surface, for example, by electrostatic interactions, magnetic interactions, or covalent interactions. FIG. 11B shows the contact of multifunctional moiety 1120 coupled to analyte 1130 with SNAP 1110 coupled to surface 1100. As shown in fig. 11C, multifunctional moiety 1120 hybridizes to SNAP 1110 to form a region of tertiary structure 1150. Multifunctional moiety 1120 may be further coupled to surface 1100. FIG. 11D depicts the continuous attachment of analyte 1130 to surface 1100 after optional removal of SNAP 1110.

Partially dense nucleic acids: nucleic acids useful in forming an analyte array may comprise a structure having one or more of the following features: i) Coupling the analyte at a tunable and/or controllable location on the surface of the nucleic acid, ii) inhibiting unwanted analyte or other moiety coupling at a portion of the nucleic acid not intended for coupling, iii) comprising a structure or face configured to form a specific binding interaction with the solid support or surface thereof, iv) comprising a structure or face configured to form a specific binding interaction with the solid support or surface thereof that is more likely to occur than non-specific binding interactions between the analyte coupled to the nucleic acid and the solid support or surface thereof, v) comprising a structure or face configured to inhibit contact between the analyte coupled to the nucleic acid and the solid support or surface thereof, vi) inhibiting unwanted binding interactions (e.g., aggregation, co-localization, etc.) with other nucleic acids or analytes coupled thereto.

Useful configurations of nucleic acids (such as nucleic acid nanostructures) can include nucleic acids that contain dense structures and permeable structures. The dense structure of the nucleic acid may provide spatial and orientation adjustability to the moiety coupled to or emerging from the nucleic acid structure. For example, a nucleic acid fold comprising a dense structure may be designed to orient the display portion at substantially 180 ° orientation with one or more capture portions, thereby increasing the likelihood that the nucleic acid fold will preferentially couple to a solid support through one or more capture portions rather than through an analyte coupled to the display portion. The adjustability of the compact structure may result from several aspects of the nucleic acid structure, including multiple tertiary structures that provide substantially 360 degrees of rotational freedom for the orientation of the moiety coupled to the nucleic acid, and one or more connecting strands that couple tertiary structures within the nucleic acid structure, thereby providing a degree of rigidity to the nucleic acid structure and fixing the separation distance and orientation of the tertiary structures in the nucleic acid structure relative to each other. The permeable structure of the nucleic acid may provide additional chemical and/or physical properties to the nucleic acid that facilitate or inhibit desired interactions with other entities (e.g., analytes, unbound portions, reagents, other nucleic acids, solid supports, fluidic media, etc.). For example, a nucleic acid can comprise a plurality of pendent single-stranded nucleic acid portions comprising homopolymer repeats (e.g., poly-T repeats, poly-a repeats, poly-C repeats, poly-G repeats), wherein the pendent single-stranded nucleic acid portions are configured to inhibit co-localization of two or more nucleic acids on a solid support (e.g., at the same address in an address array on the solid support). By coupling the permeable structure with the tunable dense structure of the nucleic acid, the position and orientation of the permeable structure can be controlled to create more specific and localized interactions between the nucleic acid and other entities.

As set forth herein, a nucleic acid nanostructure may comprise at least one dense region or structure. A dense region of a nucleic acid nanostructure may refer to a region or structure having an average characteristic that is closer to that of a single-stranded nucleic acid versus a multi-stranded nucleic acid (e.g., double-stranded DNA, triple-stranded DNA, etc.). As set forth herein, a nucleic acid nanostructure may comprise at least one permeable region or structure. The permeable region of a nucleic acid nanostructure may refer to a region or structure having an average characteristic that is closer to that of a single-stranded nucleic acid than a multi-stranded nucleic acid. As set forth herein, nucleic acid nanostructures need not include permeable regions or structures. The densified region or structure of the nucleic acid nanostructure may comprise one or more of the following features: i) Comprising a scaffold strand, ii) comprising a plurality of nucleic acids coupled to the scaffold strand, wherein at least 50% and optionally at least 60%, 70%, 75%, 80%, 85%, 90% or 95% of the nucleotides of the scaffold strand hybridize to nucleotide base pairing of the plurality of nucleic acids, iii) comprising a plurality of coupled nucleic acids, wherein at least 50% and optionally at least 60%, 70%, 75%, 80%, 85%, 90% or 95% of the nucleotides of the plurality of nucleic acids hybridize to other nucleotide base pairing of the plurality of nucleic acids, iv) comprising a plurality of secondary and/or tertiary nucleic acid structures, wherein the position, orientation and/or movement of a first secondary and/or tertiary nucleic acid structure relative to a second secondary and/or tertiary nucleic acid structure is constrained, v) comprising a first helical nucleic acid structure and a second helical nucleic acid structure, wherein the first helical nucleic acid structure and the second helical nucleic acid structure are linked by single-stranded nucleic acids, wherein the first helical nucleic acid structure and the second helical nucleic acid structure each comprise a helix oriented in a 3 'to 5' direction in parallel to the other nucleotide base pairing, iv) comprising a plurality of secondary and/or tertiary nucleic acid structures, wherein the first secondary and/or tertiary nucleic acid structure has an angular symmetry relative to the second helical structure of the second helical structure and/or the second helical structure has an angular symmetry of 180 ° relative to the second helical structure; vii) comprises a moiety (e.g., polypeptide, polysaccharide, nanoparticle, etc.) that constrains the position, orientation, and/or movement of the first secondary and/or tertiary nucleic acid structure relative to the second secondary and/or tertiary nucleic acid structure; viii) a volume comprising each nucleotide surrounding a dense region or structure, wherein a characteristic dimension (e.g., length, depth, diameter, etc.) of the volume does not vary by more than 10% due to intermolecular or intramolecular external motion (e.g., brownian motion, fluid shear, electromagnetic force, etc.) or due to intramolecular motion (e.g., translation, vibration, bending, rotation, etc.), and optionally does not vary by more than 5% or 1%, ix) comprises a first nucleotide having a first adjustable position and a second nucleotide having a second adjustable position, wherein the first adjustable position comprises a distance from and an orientation relative to the second adjustable position, x) comprises the first nucleotide having the first adjustable position and the second nucleotide having the second adjustable position, wherein the first adjustable position comprises a distance from or orientation relative to the second adjustable position that varies by no more than 10%, xi) comprises a volume of each nucleotide surrounding the densified region or structure, wherein a characteristic dimension (e.g., length, depth, diameter, etc.) of the volume does not vary by more than 10% and optionally by no more than 5% or 1% when the nucleic acid nanostructure comprising the densified region or structure forms a binding interaction with a molecule, portion, structure, or solid support, xii) comprises a two-dimensional projection of a region of each nucleotide surrounding the densified region or structure that varies by no more than 10% and optionally by no more than 5% or 1% when the nucleic acid nanostructure comprising the densified region or structure forms a binding interaction with a molecule, portion, structure, or solid support, xiii) comprises a plurality of single stranded nucleic acids, wherein each single stranded nucleic acid has a length of less than about 20 nucleotides and optionally no more than about 15, 10 or 5 nucleotides, xiv) comprises a first tertiary structure and a second tertiary structure, wherein the second tertiary structure is adjacent to a first tertiary structure, and wherein the first tertiary structure and the second tertiary structure have an average separation distance of no more than about 20 nanometers (nm), and optionally no more than about 10nm or 5nm, as measured by the average separation distance between the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure, xv) comprises a first tertiary structure and a second tertiary structure, wherein the second tertiary structure is adjacent to the first tertiary structure, wherein the first tertiary structure and the second tertiary structure each comprise a common nucleic acid and optionally two common nucleic acids, and wherein the common nucleic acid comprises a bend radius of at least about 90 °, wherein the radius of curvature of the bend is no more than about 10 nanometers (nm) and optionally no more than about 5nm or 5nm, as measured by the average separation distance between the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure, xv) comprises a first tertiary structure and a second tertiary structure, wherein the second tertiary structure is adjacent to the third tertiary structure, wherein the third tertiary structure and the second tertiary structure each comprises a common nucleic acid and optionally comprises a bend of at least about 90 ° and the two common nucleic acid, wherein the common nucleic acid comprises a radius of curvature of the nucleic acid and optionally is greater than about 2.5.5.5.5.5., nanoparticles, etc.) are positioned adjacent to the second tertiary structure.

As set forth herein, a nucleic acid nanostructure may comprise at least one permeable region or structure. The permeable region or structure of the nucleic acid nanostructure may comprise one or more of the following features: i) Not comprising a scaffold strand, ii) comprising one or more nucleic acids, wherein each of the one or more nucleic acids comprises a first nucleotide sequence configured to hybridize to a scaffold strand of a dense region or structure and a second nucleotide sequence not configured to hybridize to a nucleic acid of a nucleic acid nanostructure, iii) comprising one or more nucleic acids, wherein each of the one or more nucleic acids comprises a single-stranded nucleic acid of at least about 20 nucleotides in length and optionally at least about 25, 50, 100, 500, 1000, or more than 1000 nucleotides in length, iv) comprising one or more nucleic acids, wherein each of the one or more nucleic acids comprises unconjugated terminal nucleotides (e.g., 3 'terminal nucleotide, 5' terminal nucleotide), v) comprises a plurality of overhangs (e.g., single stranded nucleic acids, partially double stranded nucleic acids, polymer chains, etc.), wherein each overhang comprises a position, orientation, or movement that is not constrained by intramolecular or intra-structural binding interactions (e.g., base pair hybridization, hydrogen bonding, van der waals interactions, etc.), vi) comprises a plurality of overhangs, wherein each overhang comprises a position, orientation, or movement that is constrained by non-binding interactions (e.g., steric blocking (steric interactions), electrostatic repulsion, magnetic repulsion, hydrophobic interactions, hydrophilic interactions), vii) comprises one or more coupled nucleic acids, wherein less than 50% and optionally less than 40%, 30%, 20%, 10% of the plurality of nucleic acids, 5% or 1% of the nucleotides are base-paired with other nucleotides of the plurality of nucleic acids, ix) comprise one or more nucleic acids, wherein the one or more nucleic acids comprise a first single stranded nucleic acid and a second single stranded nucleic acid, wherein the first single stranded nucleic acid is not configured to hybridize to the second single stranded nucleic acid, x) comprise one or more nucleic acids, wherein the one or more nucleic acids comprise a single stranded nucleic acid comprising a polynucleotide repeat sequence (e.g., poly A, poly C, poly G, poly T), optionally wherein the polynucleotide repeat sequence comprises at least about 10 nucleotides or at least about 20, 30, 40, 50, 100, 200, 500, 1000, or more than 1000 nucleotides, xi) comprise a volume surrounding each nucleotide of the permeable region or structure, wherein a characteristic dimension (e.g., length, depth, diameter, etc.) of the volume varies by more than 10% and optionally more than 15% or 20% due to intermolecular or intermolecular motion (e.g., brownian motion, fluid shear, electromagnetic force, etc.) or due to intramolecular motion (e.g., translation, vibration, bending, rotation, etc.), xii) comprises a volume of each nucleotide surrounding a permeable region or structure, wherein a characteristic dimension (e.g., length, depth, diameter, etc.) of the volume varies by more than 10% and optionally more than 15% or 20% when a nucleic acid nanostructure comprising a dense region or structure forms a binding interaction with a molecule, portion, structure, or solid support, xiii) when the nucleic acid nanostructure is not coupled to a molecule, portion, structure, or position, a two-dimensional projection of a region surrounding the maximum extent of the permeable region or structure comprising the permeable region or structure, wherein the two-dimensional projection varies by more than 10%, and optionally no more than 15% or 20%, when the nucleic acid nanostructure comprising the permeable region or structure forms a binding interaction with a molecule, moiety, structure or solid support, and xiv) comprises a nucleic acid, wherein a first nucleotide sequence of the nucleic acid is coupled to a dense structure, wherein a second nucleotide sequence of the nucleic acid is not coupled to a dense structure, and wherein the nucleotides of the second nucleotide sequence comprise a larger spatial and/or temporal variation of the standard deviation of the distance to the dense structure relative to the nucleotides of the first nucleotide sequence.

In one aspect, provided herein is a nucleic acid nanostructure comprising at least 10 coupled nucleic acids, wherein the nucleic acid nanostructure comprises: a) A dense region comprising a high internal complementarity, wherein the high internal complementarity comprises at least 50% double stranded nucleic acid and at least 1% single stranded nucleic acid, and wherein the dense region comprises a display moiety, wherein the display moiety is coupled to or configured to be coupled to a target analyte; and b) a permeable region comprising low internal complementarity, wherein the low internal complementarity comprises at least about 50% single stranded nucleic acid, and wherein the permeable region comprises a coupling moiety, wherein the coupling moiety forms a coupling interaction with a solid support or is configured to form a coupling interaction with a solid support.

In another aspect, provided herein is a nucleic acid nanostructure comprising: a) A dense structure, wherein the dense structure comprises a scaffold strand and a first plurality of staple (staple) oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a plurality of adjacent tertiary structures connected by single-stranded regions of the scaffold strand, and wherein the relative positions of the plurality of adjacent tertiary structures are position-constrained; and b) a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to the scaffold strands of the dense structure, wherein the permeable structure comprises at least 50% single stranded nucleic acids, and wherein the permeable structure has an anisotropic three-dimensional distribution around at least a portion of the dense structure.

In another aspect, provided herein is a nucleic acid nanostructure comprising: a) A dense structure, wherein the dense structure comprises a scaffold strand and a first plurality of staple (staple) oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a plurality of adjacent tertiary structures connected by single-stranded regions of the scaffold, and wherein the relative positions of the adjacent tertiary structures are position-constrained, and wherein the dense structure comprises an effective surface area; and b) a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to a scaffold chain of a dense structure, wherein the permeable structure comprises at least 50% single stranded nucleic acids, and wherein (i) the effective surface area of the nucleic acid nanostructure is greater than the effective surface area of the dense structure, or (ii) the ratio of the effective surface area to the volume of the nucleic acid nanostructure is greater than the ratio of the effective surface area to the volume of the dense structure.

In another aspect, provided herein is a nucleic acid nanostructure comprising a plurality of nucleic acid strands, wherein each strand of the plurality of strands hybridizes to another strand of the plurality of strands to form a plurality of tertiary structures, and wherein one strand of the plurality of strands comprises a first nucleotide sequence that hybridizes to a second strand of the plurality of strands, wherein the strand of the plurality of strands further comprises a second nucleotide sequence of at least 100 consecutive nucleotides, and wherein at least 50 nucleotides of the second nucleotide sequence are single stranded.

52A-52H illustrate various configurations of nucleic acid nanostructures comprising dense structures and permeable structures. Fig. 52A depicts a cross-sectional view of a nucleic acid nanostructure comprising SNAP 5210 (e.g., nucleic acid folded paper) coupled to an analyte 5220 through a display portion 5215 on a display face of SNAP 5210. The nucleic acid nanostructure also includes a capture face that is opposite (e.g., about 180 ° in orientation) to the display face of SNAP 5210. The capture face comprises a permeable structure comprising a plurality of overhangs 5212 (e.g., single stranded nucleic acids, polymer strands, etc.) coupled to the capture face of SNAP 5210, wherein the overhangs 5212 comprise unbound ends. Depending on the density of the plurality of overhangs 5212 and the rigidity of the coupling points of the densified structure of SNAP 5210, the plurality of overhangs may be arranged in a flared configuration. The volume 5230 encloses an average space occupied by the permeable structure comprising a plurality of overhang portions. The overhang 5212 within the volume 5230 has an anisotropic spatial distribution relative to the dense structure of SNAP 5210 due to the adjustable positioning and orientation of the overhang on the capture face of SNAP 5210. Fig. 52B shows a top view of the nucleic acid nanostructure of fig. 52A. Line 5241 depicts the effective surface area of the dense structure of SNAP 5210 and line 5240 depicts the effective surface area of the complete nucleic acid nanostructure (i.e., including dense structures and permeable structures) that is greater than the effective surface area of the dense structure due to the outward expansion of overhang portion 5212.

Fig. 52C depicts a cross-sectional view of a nucleic acid nanostructure comprising SNAP 5210 (e.g., nucleic acid folded paper) coupled to an analyte 5220 through a display portion 5215 on the display face of SNAP 5210. The nucleic acid nanostructures also include one or more utility facets adjacent to and orthogonal to the display facet of SNAP 5210 (e.g., about 90 ° in orientation). Each utility face comprises a permeable structure comprising a plurality of overhangs 5212 (e.g., single stranded nucleic acids, polymer strands, etc.) coupled to the utility face of SNAP 5210. Depending on the density of the plurality of overhangs 5212, the flexibility of the overhangs 5212, and the rigidity of the coupling points with the densified structure of SNAP 5210, the plurality of overhangs 5212 can be arranged in a flared configuration. Lines 5230 and 5231 enclose the average cross-sectional area of the space occupied by the permeable structure comprising the plurality of overhang portions. The overhang 5212 in the space indicated by lines 5230 and 5231 comprises a substantially isotropic spatial distribution relative to the midline of the dense structure of SNAP 5210 and an anisotropic spatial distribution relative to the analyte 5220 due to the adjustable positioning and orientation of the overhang on the capture face of SNAP 5210. Fig. 52D shows a top view of a nucleic acid nanostructure. Line 5241 depicts the effective surface area of the dense structure of SNAP 5210 and line 5240 depicts the effective surface area of the intact nucleic acid nanostructures (i.e., including dense structures and permeable structures) that are greater than the effective surface area of the dense structures due to the outward direction of overhang portion 5212.

Fig. 52E depicts a cross-sectional view of a nucleic acid nanostructure comprising SNAP 5210 (e.g., nucleic acid folded paper) coupled to an analyte 5220 through a display portion 5215 on the display face of SNAP 5210. The nucleic acid nanostructure also includes a capture face that is opposite (e.g., about 180 ° in orientation) to the display face of SNAP 5210. The capture face comprises a permeable structure comprising a plurality of overhangs 5213 (e.g., single stranded nucleic acids, polymer strands, etc.) coupled to the capture face of SNAP 5210, wherein both ends of the overhangs 5213 are coupled to the dense structure of SNAP 5210. Depending on the density of the plurality of overhangs 5213, their flexibility, and the rigidity of the coupling points of the dense structure of SNAP 5210, the plurality of overhangs may occupy the average cross-sectional area of the volume line 5230 immediately below the capture face of SNAP 5210 surrounding the space occupied by the permeable structure comprising the plurality of overhangs 5213. The overhang 5213 within the space indicated by line 5230 contains an anisotropic spatial distribution relative to the dense structure of SNAP 5210 due to the adjustable positioning and orientation of the overhang on the capture face of SNAP 5210. Fig. 52F shows a top view of a nucleic acid nanostructure. Line 5241 depicts the effective surface area of the dense structure of SNAP 5210 and line 5240 depicts the effective surface area of the complete nucleic acid nanostructure (i.e., including dense structures and permeable structures) that is less than the effective surface area of the dense structure of SNAP 5210.

Fig. 52G depicts a cross-sectional view of a nucleic acid nanostructure comprising SNAP 5210 (e.g., nucleic acid folded paper) coupled to an analyte 5220 through a display portion 5215 on the display face of SNAP 5210. The nucleic acid nanostructure also comprises a plurality of overhangs 5212 (e.g., single stranded nucleic acids, polymer chains, etc.) that are coupled to nearly all orientations of SNAP 5210, excluding the volume occupied by analyte 5220. Depending on the density of the plurality of overhangs 5212, their flexibility, and the rigidity of the coupling points of the densified structure of SNAP 5210, the plurality of overhangs may be arranged in a flared configuration. The line 5230 encloses an average cross-section of the space occupied by the permeable structure comprising the plurality of overhang portions 5212. The overhang 5212 in the space indicated by line 5230 contains an anisotropic spatial distribution relative to the dense structure of SNAP 5210, although it may be an isotropic spatial distribution, excluding the volume occupied by the analyte 5220. Fig. 52H shows a top view of a nucleic acid nanostructure. Line 5241 depicts the effective surface area of the dense structure of SNAP 5210 and line 5240 depicts the effective surface area of the complete nucleic acid nanostructure (i.e., including dense structures and permeable structures) that is greater than the effective surface area of the dense structure due to the outward expansion of overhang portion 5212.

53A-53E depict cross-sectional views of various nucleic acid nanostructure configurations, wherein each nucleic acid nanostructure comprises a permeable structure, and wherein each permeable structure comprises a plurality of overhangs configured to have different interactions with other entities (e.g., analytes, other nucleic acid nanostructures, solid supports, reagents, etc.). Fig. 53A depicts a dense structure 5310 (e.g., SNAP) coupled to a permeable structure comprising a plurality of pendent oligonucleotides 5320, wherein each pendent oligonucleotide comprises a homopolymer. The homopolymer of each pendant oligonucleotide 5320 can inhibit binding interactions with other nucleic acid nanostructures having the same or similar pendant oligonucleotide sequences. Fig. 53B depicts a dense structure 5310 (e.g., SNAP) coupled to a permeable structure comprising a plurality of pendent oligonucleotides 5321, wherein each pendent oligonucleotide comprises a homopolymer sequence, and wherein some homopolymers are interrupted by random substitutions of nucleotides other than the nucleotides of the homopolymer sequence (e.g., a poly T sequence comprising randomly substituted A, C or G nucleotides). Fig. 53C depicts a dense structure 5310 (e.g., SNAP) coupled to a permeable structure comprising a plurality of pendent oligonucleotides 5320, wherein each pendent oligonucleotide comprises a homopolymer sequence region and a sequence region complementary to the homopolymer sequence region. As shown, the complementary regions may form a double stranded region 5322 to form a loop structure. Fig. 53D depicts a dense structure 5310 (e.g., SNAP) coupled to a permeable structure comprising a plurality of pendent oligonucleotides 5323, wherein each pendent oligonucleotide comprises a nucleotide sequence having a degree of self-complementarity (e.g., forming a stem, loop, hairpin, or bulge structure). Fig. 53E depicts a dense structure 5310 (e.g., SNAP) coupled to a permeable structure comprising a plurality of pendant oligonucleotides 5324, wherein each pendant oligonucleotide comprises a second oligonucleotide 5325 that hybridizes to the pendant oligonucleotide 5324. The configurations shown in fig. 53A-53E (e.g., polynucleotide repeats, random nucleotide substitutions, self-complementarity, intermittent secondary structures) can facilitate rearrangement of the orientation of the nucleic acid nanostructures on the coupling surface, thereby facilitating positioning of the nucleic acid nanostructures in a stable configuration on the coupling surface.

54A-54C illustrate schematic diagrams of methods of producing nucleic acid nanostructures (e.g., the nucleic acid nanostructures depicted in FIGS. 53A-53E) according to some embodiments set forth herein. FIG. 54A depicts a method of forming a nucleic acid nanostructure comprising a plurality of overhangs comprising polynucleotide repeats. In a first step, the scaffold strand 5410 can be optionally combined at an elevated temperature with a plurality of staple oligonucleotides 5420 that hybridize to the scaffold strand 5410 to form a dense structure and a plurality of oligonucleotides 5421 comprising a pendent nucleotide sequence 5422. After cooling the oligonucleotide mixture, a nucleic acid nanostructure is formed that comprises a dense structure 5430 and a plurality of overhang portions comprising an overhang nucleotide sequence 5422. In a second step, the nucleic acid nanostructure is then contacted with a nucleic acid elongase (e.g., a terminal deoxynucleotidyl transferase or TdT is shown) in the presence of a homogenous plurality of nucleotides (e.g., deoxythymidine) to produce a plurality of overhanging homopolymer polynucleotides 5423 (e.g., poly-T repeats). Optionally, the nucleotides provided to the enzyme may contain small amounts of other nucleotides to produce randomly incorporated nucleotides in the polynucleotide repeat sequence. FIG. 54B depicts a method of forming a nucleic acid nanostructure comprising a plurality of overhang portions comprising homopolymer polynucleotides, wherein the position of each overhang portion is controlled. In a first step, the scaffold strand 5410 can be optionally combined at an elevated temperature with a plurality of staple oligonucleotides 5420 that hybridize to the scaffold strand 5410 to form a compact structure and a plurality of oligonucleotides 5421 comprising a pendent nucleotide sequence 5422, and a plurality of oligonucleotides 5424 comprising a capping portion 5425 (e.g., dideoxynucleotide, terminator nucleotide, phosphorylated nucleotide, terminal residues for burial within the compact structure 5430, etc.), wherein the capping portion is configured to inhibit the activity of a nucleic acid elongase. After cooling the oligonucleotide mixture, a nucleic acid nanostructure is formed that comprises a dense structure 5430 and a plurality of overhang portions that comprise an overhang nucleotide sequence 5422, at least some of which includes a capping portion 5425. In a second step, the nucleic acid nanostructure is then contacted with a nucleic acid elongase (e.g., terminal deoxynucleotidyl transferase or TdT) in the presence of a homogenous plurality of nucleotides (e.g., deoxythymidine) to produce a plurality of pendent polynucleotide repeats 5423 (e.g., poly-T repeats) at any pendent oligonucleotide that does not include a capping moiety 5425. FIG. 54C depicts a method of forming a nucleic acid nanostructure comprising a plurality of overhangs comprising a homopolymer sequence, wherein the homopolymer sequence is interrupted by an intermediate nucleotide sequence. Nucleic acid nanostructures are formed according to the first step depicted in fig. 54A. Optionally, a second step depicted in fig. 54A may be performed to add a homopolymer sequence to each overhang portion. In a second step, a polymerase extension reaction is performed whereby the overhanging primer 5422 hybridizes to a template nucleic acid comprising the complement of the intermediate nucleotide sequence 5426. The polymerase extension reaction will produce a pendent oligonucleotide comprising a primer sequence 5422 and an intermediate nucleotide sequence 5426. In a third step, the enzymatic extension step of fig. 54A is performed using TdT and nucleotides to form a nucleic acid nanostructure having multiple overhangs, wherein each overhang comprises an intermediate nucleotide sequence 5426 flanked by an overhang primer sequence 5422 and a homopolymer sequence 5427.

As set forth herein, the nucleic acid nanostructure or component structure thereof may comprise an internal complementarity region. Internal complementarity may refer to the degree of double-stranded nucleic acid within a nucleic acid nanostructure or component structure thereof. Internal complementarity can be quantified as the percentage of nucleotides having base pair complementarity in the formed nucleic acid nanostructure or component structures thereof (e.g., dense structures, permeable structures). The degree of internal complementarity can be calculated with respect to the total nucleotide content. For example, a nucleic acid nanostructure may comprise a total of 10000 nucleotides in at least 200 oligonucleotides forming the nucleic acid nanostructure, wherein 8500 nucleotides have base pair complementary sequences in the double-stranded region, giving the nucleic acid nanostructure an internal complementarity of 85%. The degree of internal complementarity can be calculated for a single nucleic acid (e.g., a scaffold strand) or a subset of oligonucleotides comprising a nucleic acid nanostructure or a component structure thereof. For example, the dense structure of the nucleic acid nanostructure may comprise a scaffold strand of at least 7000 nucleotides, wherein at least 90% of the nucleotides of the scaffold strand have a base pair complementary sequence in the double-stranded region. In another example, the permeable structure of the nucleic acid nanostructure can comprise a plurality of overhangs, wherein each overhang comprises a nucleotide sequence that is devoid of internal complementarity and is devoid of complementarity to any other overhang, thereby imparting substantially 0% internal complementarity to the permeable structure.

The nucleic acid nanostructure or component structure thereof (e.g., dense structure, permeable structure) can comprise at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more than 99% internal complementarity. Alternatively or additionally, the nucleic acid nanostructure or component structures thereof may comprise no more than about 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1% or less than 1% internal complementarity. In some configurations, a nucleic acid nanostructure or component structure thereof may be considered to have high internal complementarity if the internal complementarity exceeds a percentage, such as at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99%. In some configurations, a nucleic acid nanostructure or component structure thereof may be considered to have low internal complementarity if the internal complementarity is less than a percentage, such as no more than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less than 1%.

The nucleic acid nanostructures or component structures thereof having high internal complementarity may comprise an amount of single stranded nucleic acid. A nucleic acid nanostructure or component structure thereof having high internal complementarity may comprise at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or more than 20% single stranded nucleic acid. In some configurations, nucleic acid nanostructures or component structures thereof with high internal complementarity may not comprise single stranded nucleic acids. The nucleic acid nanostructures or component structures thereof having low internal complementarity may comprise an amount of double-stranded nucleic acid. A nucleic acid nanostructure or component structure thereof having low internal complementarity may comprise no more than about 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less than 1% double-stranded nucleic acid. In some configurations, a nucleic acid nanostructure or component structure thereof having low internal complementarity may not comprise double-stranded nucleic acid.

The nucleic acid nanostructure can comprise a region (e.g., a permeable structure) comprising low internal complementarity, wherein the region comprising low internal complementarity comprises a plurality of overhang portions. As set forth herein, the overhang portion can include a capture portion. The overhang portion need not include a capture portion. The nucleic acid nanostructure may comprise a plurality of oligonucleotides, wherein each oligonucleotide comprises a first nucleotide sequence that hybridizes to a complementary nucleic acid to form a portion of a structure having high internal complementarity, and wherein each oligonucleotide comprises a overhang that does not hybridize to a region of high internal complementarity. In some cases, the overhang may comprise a single stranded oligonucleotide or a non-nucleic acid polymer chain (e.g., polyethylene glycol, polyethylene, polypropylene, etc.). The overhang portion can comprise a polymer chain (e.g., a nucleic acid chain, a non-nucleic acid polymer chain), wherein the polymer chain comprises a straight chain, a branched chain, a dendritic chain, or a combination thereof. In some configurations, the overhang portion of the plurality of overhang portions can include unbound terminal residues. In some configurations, the overhang portion of the plurality of overhang portions may not include self-complementarity. In some configurations, the overhang portion of the plurality of overhang portions can comprise a homopolymer sequence selected from the group consisting of poly T, poly a, poly G, and poly C. For example, an oligonucleotide can be extended by an enzyme (e.g., terminal deoxynucleotidyl transferase) in the presence of a homogeneous plurality of deoxythymidine nucleotides to form a poly-T sequence on the oligonucleotide. The plurality of overhangs may comprise a homogenous plurality of overhangs, wherein each overhang comprises the same chemical structure as each other overhang of the plurality of overhangs. The plurality of overhangs may comprise a heterogeneous plurality of overhangs, wherein a first overhang comprises a different chemical structure than a second overhang of the plurality of overhangs.

The overhang or a component thereof may comprise a nucleotide sequence (e.g., a homopolymer, a polynucleotide repeat, an oligonucleotide that is not self-complementary, an oligonucleotide that is self-complementary, etc.). The nucleotide sequence of the overhang or a component thereof may have a sequence length or chemical composition as exemplified herein for a staple oligonucleotide.

The nucleic acid nanostructure can comprise a region (e.g., a permeable structure) comprising low internal complementarity, wherein the region comprising low internal complementarity comprises an amount of overhang. The region comprising low internal complementarity may comprise at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more than 1000 overhang. Alternatively or additionally, the region comprising low internal complementarity may comprise no more than about 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 40, 35, 30, 25, 20, 15, 10, 5, or less than 5 overhang portions. The number of overhanging portions of a nucleic acid nanostructure can be determined based on the number of available positions on a face (e.g., capture face, utility face) of the nucleic acid nanostructure. The number of overhanging portions of the nucleic acid nanostructure can be determined based on the desired surface density of overhanging portions on the face of the nucleic acid nanostructure. For example, it may be advantageous to maximize the surface density of overhanging capture portions on the capture face of SNAP, wherein the overhanging capture portions have a substantially uniform surface density. In such examples, the maximum number of overhang portions that can be provided to the SNAP may be limited by the number of suitable locations, including orientations in the capture plane and distances from the nearest suitable location, which are in the range of, for example, about 20%, 15%, 10%, 5% or less than 5% of the average distance between the suitable locations. The number of overhang moieties provided to a nucleic acid nanostructure can be determined based on the intensity of the desired interaction with another entity (e.g., analyte, nucleic acid nanostructure, solid support, reagent, etc.). For example, additional pendant capture moieties may be added to the nucleic acid nanostructure to increase the strength of the coupling interaction with the solid support surface.

The nucleic acid nanostructure may comprise a dense structure. The dense structure may comprise multiple tertiary structures (e.g., a helical double stranded nucleic acid). Each tertiary structure may include an axis of symmetry (e.g., a helical axis) defining the angular orientation of the tertiary structure. The distance between adjacent or non-adjacent tertiary structures may be measured as the distance between the respective axes of symmetry of the tertiary structures. The average distance between adjacent or non-adjacent non-parallel tertiary structures can be measured as the average distance between the respective axes of symmetry of the tertiary structures. The dense structure may comprise a plurality of tertiary structures, wherein positional, orientation, and/or freedom of movement is constrained between the first tertiary structure and the second tertiary structure (e.g., adjacent tertiary structure, non-adjacent tertiary structure). As set forth herein, the position, orientation, and/or freedom of movement between the first tertiary structure and the second tertiary structure may be constrained by one or more connecting chains.

The dense structure may comprise a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average separation distance between the first axis of symmetry and the second axis of symmetry of less than about 50 nanometers (nm), 40nm, 30nm, 20nm, 10nm, 9nm, 8nm, 7nm, 6nm, 5nm, 4nm, 3nm, 2nm, or less than 2 nm. Alternatively or additionally, the dense structure may comprise a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average separation distance between the first axis of symmetry and the second axis of symmetry of at least about 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 20nm, 30nm, 40nm, 50nm, or more than 50 nm.

The dense structure may comprise a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average angular offset between the first axis of symmetry and the second axis of symmetry of at least about 0 °, 10 °, 20 °, 30 °, 40 °, 50 °, 60 °, 70 °, 80 °, 90 °, 100 °, 110 °, 120 °, 130 °, 140 °, 150 °, 170 °, or 180 °. Alternatively or additionally, the dense structure may comprise a plurality of tertiary structures, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average angular offset between the first axis of symmetry and the second axis of symmetry of no more than about 180 °, 170 °, 160 °, 150 °, 140 °, 130 °, 120 °, 110 °, 100 °, 90 °, 80 °, 70 °, 60 °, 50 °, 40 °, 30 °, 20 °, 10 °, or 0 °.

As set forth herein, the nucleic acid nanostructure can comprise a dense structure, wherein the dense structure comprises a nucleic acid fold. The nucleic acid folding may comprise one or more sides, wherein one of the one or more sides comprises a portion (e.g., a display portion, a capture portion, a utility portion, etc.), and wherein the nucleic acid folding provides an adjustable position and/or orientation for the portion. In some configurations, the nucleic acid folding paper may comprise a first side and a second side, wherein the first side is offset from the second side by an average angle of at least about 30 °, 45 °, 60 °, 90 °, 120 °, 135 °, 150 °, 160 °, 170 °, or 180 °. Alternatively or additionally, the nucleic acid folding paper may comprise a first side and a second side, wherein the first side is offset from the second side by an average angle of no more than about 180 °, 170 °, 160 °, 150 °, 135 °, 120 °, 90 °, 60 °, 45 °, 30 °, or less than 30 °. The nucleic acid folding paper may comprise a first side and a second side, wherein the first side comprises a display portion, as set forth herein, and the second side is adjacent to the permeable structure. The nucleic acid paper folding may comprise a first side and a second side, wherein the first side comprises a display portion, as set forth herein, and the second side is coupled to a permeable structure. For example, a nucleic acid paper sheet having a tile structure may comprise a first side comprising a click-reaction group configured to couple to an analyte and a second side comprising a capture moiety comprising a plurality of overhang portions, wherein a permeable structure comprises a plurality of overhang portions, and wherein the first side is substantially opposite in orientation (e.g., about 180 ° offset) from the second side.

The nucleic acid nanostructure may comprise a dense structure and a permeable structure, wherein the permeable structure comprises a spatial distribution relative to the dense structure. The spatial distribution may comprise an isotropic distribution or an anisotropic distribution. The spatial distribution may be with respect to two spatial dimensions and/or three spatial dimensions. For example, the permeable structure may comprise an isotropic spatial distribution in two spatial dimensions, but an anisotropic spatial distribution with respect to three spatial distributions. For example, fig. 52A depicts a cross-sectional view of a nucleic acid nanostructure having a dense structure 5210 coupled to a permeable structure comprising a plurality of overhang portions 5212. With respect to the plane of symmetry 5250 centered about the average midline of the dense structure 5210, the plurality of overhang portions 5212 are limited to a volume 5230 that is completely below the plane of symmetry 5250 (e.g., anisotropic with respect to the plane of symmetry 5250). Fig. 52B depicts a top view of the nucleic acid nanostructure depicted in fig. 52A. The plurality of overhang portions have a substantially isotropic spatial distribution with respect to a center point of the dense structure 5210 as seen in a top view. In some configurations, the spatial distribution of the permeable structure relative to the dense structure can be determined with respect to a hypothetical volume (e.g., sphere, hemisphere, cube, cylinder, etc.) that completely encloses the nucleic acid nanostructure containing the dense structure and the permeable structure. In a particular configuration, the hypothetical volume can be located with respect to an arrangement of dense structures (such as an axis of symmetry, a plane of symmetry, or a plane of symmetry of the dense structures). In some configurations, the anisotropic volume distribution may include portions of hemispherical volume surrounding the dense structure that do not contain the permeable structure. In some configurations, the anisotropic volume distribution may comprise a portion of the spherical volume surrounding the dense structure excluding the volume comprising the target analyte coupled to the dense structure.

The nucleic acid nanostructures may comprise a dense structure and a permeable structure, wherein the dense structure and the permeable structure each occupy a characteristic volume, wherein the characteristic volume comprises a minimum, average, or maximum volume occupied by the structure on a spatial and/or temporal basis. The volume of the dense structure and/or permeable structure can vary depending on the configuration of the nucleic acid nanostructure (e.g., bound to a solid support, unbound to a solid support, coupled to an analyte, coupled to a reagent, etc.) comprising the dense structure and/or permeable structure. For example, a nucleic acid nanostructure comprising a dense structure and a permeable structure may be bound to a solid support by a capture moiety comprising a permeable structure, wherein the volume of the dense structure is not altered by the binding, but the volume of the permeable structure is reduced by the binding. In some configurations, the average volume of the dense structure need not vary depending on the configuration of the nucleic acid nanostructure comprising the dense structure. In some configurations, the volume occupied by the dense structure may be greater than the volume occupied by the permeable structure. In other configurations, the volume occupied by the permeable structure may be greater than the volume occupied by the dense structure.

The nucleic acid nanostructures may comprise an average effective surface area (e.g., nucleic acid nanostructures in solution) and/or a footprint (e.g., nucleic acid nanostructures coupled to a solid support). The nucleic acid nanostructure may comprise a dense structure and/or a permeable structure, wherein the dense structure and/or permeable structure comprises an average effective surface area and/or a footprint. The average effective surface area and/or footprint of the dense structure and/or permeable structure may be modified, for example, to modulate the strength of interaction with another entity (e.g., analyte, nucleic acid nanostructure, solid support, reagent, etc.). In some configurations, the effective surface area and/or footprint of the permeable structure may be substantially the same as the effective surface area and/or footprint of the nucleic acid nanostructure. In other configurations, the effective surface area of the permeable structure may be less than the effective surface area of the nucleic acid nanostructure. In some configurations, the effective surface area of the permeable structure may be less than the effective surface area of the dense structure. In some configurations, the effective surface area of the permeable structure may be greater than the effective surface area of the dense structure. In some configurations, the footprint of the nucleic acid nanostructure can be greater than the effective surface area of the nucleic acid nanostructure. In other configurations, the footprint of the nucleic acid nanostructure can be less than or equal to the effective surface area of the nucleic acid nanostructure. In some configurations, the footprint of the dense structure may be less than or equal to the effective surface area of the dense structure. In some configurations, the nucleic acid nanostructures can comprise a footprint, wherein the footprint of the nucleic acid nanostructures is greater than, equal to, or less than the effective surface area of the nucleic acid nanostructures.

Nucleic acid on solid support

The nucleic acids as set forth herein may be configured to be coupled to a solid support or a site thereof as set forth herein. In some configurations, a plurality of nucleic acids may be coupled to a solid support, wherein each nucleic acid is configured to couple an analyte of interest to the solid support, thereby forming an array of analytes of interest on the solid support. The nucleic acid may be configured in series with the solid support or a surface thereof to increase the likelihood of one or more results of the nucleic acid/solid support interaction, including: 1) binding nucleic acid to an address of the solid support that is configured to bind nucleic acid, 2) inhibiting binding of nucleic acid to an address of the solid support that is not configured to bind nucleic acid, 3) inhibiting binding of a second nucleic acid to an address comprising a first nucleic acid, wherein the address is not configured to bind the second nucleic acid; 4) Inhibit incorrect binding orientation of nucleic acids, and 5) display target analytes in a manner that is accessible to array-based processes (e.g., characterization assays, synthetic processes, etc.).

The system of nucleic acids and solid supports may be configured to produce an array of analytes having a substantially uniform surface density of analytes of interest. A particular object is a system of nucleic acids and solid supports that produces a high density array of target analytes, for example, wherein each analyte in the array of analytes is individually distinguishable at a single analyte resolution. The array of target analytes may comprise one or more of the following properties: i) Comprises a single resolvable array address containing a maximum number, density, or pitch of one and only one target analyte, ii) comprises a single resolvable array address containing a minimum number, density, or pitch of two or more target analytes, iii) comprises a single resolvable array address containing no minimum number, density, or pitch of target analytes, and iv) comprises a single resolvable array address containing no maximum number, density, or pitch of target analytes. Useful analyte arrays for single analyte processes may comprise a spatial distribution (e.g., pitch or density) of single analytes at an array address, where the spatial distribution contains a greater number of sites occupied by one and only one single analyte, with reference to a statistical distribution, such as a poisson distribution or a normal distribution. For example, given a solid support containing N analyte binding sites and a plurality of N nucleic acids coupled to analytes in contact with the solid support or a method of making such a system, wherein neither the solid support nor the nucleic acids bias the likelihood of nucleic acids binding to any particular analyte binding site, poisson distribution would predict that about 37% of the N analyte binding sites do not contain a deposited target analyte, about 37% of the N analyte binding sites contain one and only one deposited target analyte, and about 26% of the N analyte binding sites contain two or more deposited target analytes. Thus, it would be advantageous to configure a system of nucleic acids and solid supports or a method of making such a system that provides at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99% or greater than 99% single analyte occupancy in the array site. Alternatively or additionally, it is advantageous to configure a system of nucleic acids and solid supports that provides: 1) Maximum single analyte occupied sites: ratio of no analyte occupied sites, and/or 2) maximum single analyte occupied sites: ratio of multiple analyte occupied sites.

The skilled artisan will readily recognize the myriad combinations of solid supports as set forth herein and nucleic acids as set forth herein for forming a single analyte array. In some configurations, the array forming system can comprise a nucleic acid comprising one or more capture moieties and a solid support comprising one or more surface-attachment moieties, wherein the nucleic acid is configured to bind to the solid support through a coupling interaction of the one or more capture moieties with the one or more surface-attachment moieties. The capture moiety may be selected according to one or more of the following characteristics: 1) forms a specific interaction with the surface-bound portion of the solid support, optionally in a rapid manner (high kinetic binding rate), 2) forms a long-lasting specific interaction with the surface-bound portion of the solid support (low kinetic dissociation rate), 3) does not form a low specific binding interaction with other entities in the system (e.g., other nucleic acids, analytes coupled to other nucleic acids, non-binding regions of the array, etc.), and 4) provides physical and/or chemical properties (e.g., steric blocking, electrostatic repulsion, magnetic repulsion, etc.) that inhibit binding of other nucleic acids at the array site. The surface attachment portion may be selected according to one or more of the following characteristics: 1) forming a specific interaction with the capture moiety of the nucleic acid, optionally in a rapid manner (high kinetic binding rate), 2) forming a specific interaction with the capture moiety of the nucleic acid for a long duration (low kinetic dissociation rate), 3) inhibiting binding interactions with other entities in the system (e.g. analytes), 4) providing physical and/or chemical properties (e.g. steric blocking, electrostatic repulsion, magnetic repulsion, etc.) inhibiting binding of other nucleic acids at the array sites, and 5) facilitating binding of the nucleic acid at specific positions and orientations (e.g. symmetrically concentrated on sites with target analytes not in contact with the solid support).

Surprisingly, the system of nucleic acids and solid supports or the method of making such a system can be configured to obtain spatial control of the nucleic acid binding sites on a single analyte array by forming weak binding interactions between one or more capture moieties of the nucleic acids and one or more surface-attached moieties of the solid support. Typically, the molecules are coupled to the surface by forming strong binding interactions (e.g., click-type covalent bonds, streptavidin-biotin coupling, etc.). Such strong binding interactions facilitate permanent coupling of molecules to a surface; however, if a molecule initially binds to the edge of a binding site, there may be sufficient additional space at the binding site to couple one or more additional molecules. In contrast, the system of nucleic acids and solid supports may be configured to obtain spatial control of the binding sites of nucleic acids on a single analyte array by multivalent effects in which multiple weak binding interactions between one or more capture moieties and multiple surface-attached moieties provide binding strength comparable to a single strong binding interaction, while allowing spatial rearrangement of nucleic acids from an initial binding configuration to a more stable final binding configuration on the solid support. Without wishing to be bound by theory, a stable binding configuration of a nucleic acid comprising one or more capture moieties may be obtained at binding sites comprising an excess of surface-linking moieties, due to: 1) The energy advantage of specific binding interactions between the one or more capture moieties and the excess surface-linking moiety, and 2) the entropy advantage arising from the many possible configurations of binding between the one or more capture moieties and the excess surface-linking moiety.

58A-58C illustrate the concept of achieving stable configurations of nucleic acid nanostructures on a surface by multivalent binding interactions. Fig. 58A shows a solid support 5800 comprising sites 5801 having a plurality of surface-linking moieties 5805 configured to couple with complementary capture moieties 5835 of nucleic acid nanostructures 5830. Nucleic acid nanostructures 5830 are optionally coupled to an analyte 5840. Fig. 58B shows the initial configuration of the nucleic acid nanostructures 5830 when the nucleic acid nanostructures 5830 are in contact with the solid support 5800 at random positions of the sites 5801. Due to the location of the contact, only one coupling interaction occurs between the surface attachment portion 5805 and the capture portion 5835. Fig. 58C depicts a more stable final configuration of the nucleic acid nanostructure 5830 after spatial rearrangement on the surface of the site 5801. The final configuration may be more stable than the initial configuration due to the increased number of coupling interactions between the surface-connecting portion 5805 and the capturing portion 5835. The final configuration may also be more stable than the initial configuration because it has other possible combinations of couplings between surface attachment portion 5805 and capture portion 5835, and the structure may be rearranged into these combinations if any couplings between surface attachment portion 5805 and capture portion 5835 are broken.

FIGS. 52A-52H and 53A-53D illustrate configurations of nucleic acid nanostructures that can form multivalent binding interactions with a solid support or a surface thereof. The nucleic acid nanostructures depicted in fig. 53A-53D comprise a plurality of pendent oligonucleotides configured to form a hybridization binding interaction with complementary oligonucleotides of a solid support. Other configurations of nucleic acid nanostructures that form multivalent binding interactions are depicted in fig. 55A-55D. Fig. 55A depicts a nucleic acid nanostructure 5530 coupled to an analyte 5540. The nucleic acid nanostructure comprises a first internal single-stranded nucleic acid 5532 and a second internal single-stranded nucleic acid 5534 configured to couple with a first complementary surface-bound oligonucleotide 5520 and a second surface-bound oligonucleotide 5522, each of which is coupled to a site 5501 of a solid support 5500 in molar excess relative to available binding sites of the nucleic acid nanostructure 5530. Fig. 55B depicts the nucleic acid nanostructure 5530 in a coupled configuration at the site 5501 of the solid support 5500. The first complementary surface-attached oligonucleotide 5520 and the second surface-attached oligonucleotide 5522 have been coupled to a first internal single-stranded nucleic acid 5532 and a second internal single-stranded nucleic acid 5534. Excess surface-attached oligonucleotides 5520 and 5522 remain, facilitating spatial rearrangement of nucleic acid nanostructures 5530, if advantageous, by rearrangement of binding interactions. Fig. 55C depicts a nucleic acid nanostructure 5530 coupled to an analyte 5540. The nucleic acid nanostructure comprises a plurality of capture moieties 5550 (e.g., antibodies, antibody fragments, aptamers, etc.) configured to couple with a plurality of surface-linked binding ligands 5555, each of which is coupled to a site 5501 of a solid support 5500 in molar excess relative to available capture moieties of the nucleic acid nanostructure 5530. The site 5501 can also include a plurality of uncoupled moieties 5560 (e.g., inactivating moieties that prevent non-specific binding). Fig. 55D depicts nucleic acid nanostructure 5530 in a coupled configuration at site 5501 of solid support 5500. Multiple capture moieties 5550 have been coupled to multiple surface-attached binding ligands 5555. Excess surface-bound binding ligand 5555 remains, facilitating spatial rearrangement of nucleic acid nanostructures 5530, if advantageous, by rearrangement of binding interactions. The configurations depicted in fig. 52A-52H and 53A-53D contain various chemical structures and spatial configurations of capture moieties that comprise permeable structures (e.g., multiple overhang portions). Advantageous nucleic acid nanostructures may comprise a permeable structure comprising a plurality of capture moieties, wherein each capture moiety is configured to form a binding interaction with a surface-attachment moiety of a solid support. Advantageous nucleic acid nanostructures may comprise a permeable structure comprising capture moieties, wherein the capture moieties are configured to form a plurality of binding interactions with a plurality of surface-attached moieties of a solid support.

FIGS. 56A-56C depict examples of different systems of nucleic acid nanostructures coupled to solid supports. Fig. 56A shows a solid support 5600 comprising a site 5601, wherein the site comprises a plurality of surface-linked oligonucleotides 5605 comprising a poly a sequence. Nucleic acid nanostructure 5630 is coupled to analyte 5640, and further coupled to site 5601 through a permeable structure comprising a plurality of pendent oligonucleotides 5635 comprising a poly-T sequence. Each pendant oligonucleotide 5635 is sufficiently long to couple with a plurality of surface-attached oligonucleotides 5605 to form a multivalent binding interaction between the site 5601 and the nucleic acid nanostructure 5630. Optionally, the plurality of pendent oligonucleotides 5635 may comprise oligonucleotides of different chain lengths. FIG. 56B depicts a similar composition to FIG. 56A, however, nucleic acid nanostructure 5630 instead comprises a permeable structure that contains a plurality of oligonucleotide loops 5637 that contain poly-T sequences. Each pendant oligonucleotide loop 5637 is sufficiently long to couple with a plurality of surface-attached oligonucleotides 5605 to form a multivalent binding interaction between the site 5601 and the nucleic acid nanostructure 5630. FIG. 56C shows a solid support 5600 comprising a site 5601, wherein the site comprises a first plurality of surface-attached oligonucleotides 5605 comprising a poly-A sequence and a second plurality of surface-attached oligonucleotides 5606 comprising complementarity to a hetero-polynucleotide sequence 5636. Nucleic acid nanostructure 5630 is coupled to analyte 5640 and is further coupled to site 5601 by a permeable structure comprising a plurality of pendent oligonucleotides 5635 comprising a poly-T sequence and further comprising an intermediate nucleotide sequence comprising a non-repeating nucleotide sequence 5636. The number of heteropolymeric nucleotide sequences 5636 or complementary surface-attached oligonucleotides 5606 can be limited to reduce the number of realigned configurations available for coupling to nucleic acid nanostructures of a solid support.

The coupling of the nucleic acid nanostructure to the solid support or its surface may result in a conformational change of the nucleic acid nanostructure. In some configurations, the nucleic acid nanostructures can comprise dense structures and permeable structures, wherein coupling of the nucleic acid nanostructures to the solid support or surface thereof does not cause substantial changes in conformation (e.g., shape, volume, effective surface area, footprint, etc.) to the dense structures, and wherein coupling of the nucleic acid nanostructures to the solid support or surface thereof causes substantial changes in conformation (e.g., shape, volume, effective surface area, footprint, etc.) to the permeable structures. Fig. 57 depicts conformational changes associated with the binding of nucleic acid nanostructures comprising dense structures 5710 and permeable structures 5720 when the nanostructures are bound to sites 5701 of solid support 5700. In the initial, unbonded configuration, dense structure 5710 comprises a width L _C,i Thickness H _C,i And volume V _C,i And the permeable structure 5720 includes a width L _N,i Thickness H _N,i And volume V _N,i . After coupling to the surface, the permeable structure may become dense and elongated due to the maximum number of binding interactions that the overhang forms with the surface of site 5701. Thus, in the final bonded configuration, the result is The dense structure 5710 may comprise a width L _C,f Thickness H _C,f And volume V _C,f Wherein the value is substantially unchanged from the initial value. In contrast, the permeable structure 5720 may include a width L _N,f Thickness H _N,f And volume V _N,f Wherein the final value of the width increases relative to the initial value, the final value of the height decreases relative to the initial value, and the final value of the volume may or may not change depending on the nature of the binding interaction with the site 5701. Nucleic acid nanostructures with conformational changes may be advantageous in increasing the footprint of the nucleic acid nanostructure on the surface area of the binding site, thereby reducing the available surface area for binding other nucleic acid nanostructures or other entities.

In one aspect, provided herein is a composition comprising: a) A solid support comprising a plurality of sites, and b) a plurality of nucleic acid nanostructures (e.g., SNAP), wherein each nucleic acid nanostructure is coupled to an analyte or is configured to be coupled to an analyte, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites, wherein the plurality of sites comprises a first subset comprising a first number of sites and a second subset comprising a second number of sites, wherein each site of the first subset comprises two or more coupled nucleic acid nanostructures, wherein each site of the second subset comprises one and only one coupled nucleic acid nanostructure, and wherein the ratio of the number of sites of the first subset to the number of sites of the second subset is less than the ratio predicted by poisson distribution.

In another aspect, provided herein is an analyte array comprising: a) A solid support comprising a plurality of sites; and b) a plurality of nucleic acid nanostructures (e.g., SNAP), wherein each nucleic acid nanostructure is coupled to a target analyte, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites, wherein at least 40% of the sites of the plurality of sites comprise one and only one target analyte.

In another aspect, provided herein is a composition comprising: a) A solid support comprising sites configured to couple nucleic acid nanostructures, wherein the sites comprise a surface area; and b) a nucleic acid nanostructure, wherein the nucleic acid nanostructure is coupled to the site, wherein the nucleic acid nanostructure is coupled to or configured to be coupled to an analyte of interest; wherein the nucleic acid nanostructure comprises a total effective surface area in an unbound configuration, wherein the nucleic acid nanostructure comprises a dense structure having an effective surface area in an unbound configuration, wherein the effective surface area of the dense structure is less than 50% of the surface area of the site, and wherein the unbound configuration comprises nucleic acid nanostructures that are not coupled to the site.

The array may comprise a plurality of sites, wherein the sites have a determinable occupancy. When used in reference to a site of an array, occupancy may refer to the detected or inferred presence of an entity (e.g., nucleic acid, analyte, nucleic acid and analyte, nucleic acid coupled to analyte, nucleic acid or analyte, etc.) at the array site. In particular instances, occupancy may also refer to a characteristic (e.g., chemical, physical, etc.) or feature (e.g., spatial orientation, temporal orientation, bound state, unbound state, etc.) of an entity detected or inferred to be present at the array site. For example, when forming an array for polypeptide assays, a complex comprising a polypeptide coupled to a nucleic acid nanostructure can be deposited on an array site by coupling the polypeptide to the array site instead of coupling the nucleic acid to the array site, thereby rendering the polypeptide non-interrogateable during polypeptide assays. In this case, the sites may be considered unoccupied by the analyte due to the orientation of the complex at the array sites. When used in reference to an array comprising a plurality of sites, occupancy may refer to the percentage or fraction of sites in the plurality of sites that comprise the detected or inferred presence of an entity (e.g., nucleic acid, analyte, nucleic acid and analyte, nucleic acid coupled to analyte, nucleic acid or analyte, etc.). In particular instances, occupancy may also refer to a percentage or fraction of sites in a plurality of sites that contain detected or inferred presence of an entity having a property (e.g., chemical property, physical property, etc.) or characteristic (e.g., spatial orientation, temporal orientation, binding state, unbound state, etc.). For example, if 9 of every 10 sites contain a detectable analyte, the array may have a detectable analyte occupancy fraction of 0.9. In some configurations, occupancy may refer to the number of entities at one site, such as about 0, 1, 2, 3, 4, 5, or more entities at one site. In some configurations, occupancy may refer to the number of entities having a particular characteristic or feature at one site, such as about 0, 1, 2, 3, 4, 5, or more entities at one site.

Thus, an array of analytes can be characterized by quantitative comparison of two or more occupancy metrics. For example, it may be useful to compare the occupation of sites of the array that do not contain an analyte with the occupation of sites of the array that contain at least one analyte. In another example, it may be useful to compare the occupation of a site containing one and only one analyte in the plurality of sites of the array with the occupation of a site containing two or more analytes in the plurality of sites of the array. In some configurations, comparison of two or more occupancy metrics after formation of an analyte array may provide useful quality control features. For example, if the ratio of sites occupying two or more analytes to sites occupying one and only one site exceeds a threshold, such as the ratio predicted by poisson distribution, then the analyte array may be denied further use. As set forth herein, table I lists occupancy metric pairs, the ratio of which can be used to characterize an array.

TABLE I

In another aspect, provided herein is a method of characterizing an analyte array, the method comprising: a) providing an analyte array as set forth herein, b) determining a first occupancy measure of the analyte array as set forth herein, c) determining a second occupancy measure of the analyte array as set forth herein, and d) comparing the ratio of the first occupancy measure to the second occupancy measure to an array standard. In some configurations, for a hypothetical analyte array having an occupancy distribution that conforms to a statistical or random distribution (e.g., poisson distribution, normal distribution, binomial distribution, etc.), the array criteria may include a ratio of a first occupancy metric to a second occupancy metric. For example, the array criteria may include the critical ratios listed in table I, or any other conceivable occupancy metric ratio. In some configurations, the ratio of the first occupancy metric to the second occupancy metric may meet or exceed an array criterion predicted by a statistical or random distribution (e.g., poisson distribution). In other configurations, the ratio of the first occupancy metric to the second occupancy metric may not meet or exceed an array criterion predicted by a statistical or random distribution (e.g., poisson distribution). The method of characterizing an analyte array may further comprise the step of discarding the analyte array based on comparing a ratio of the first occupancy metric to the second occupancy metric to an array standard. For example, an array of analytes having an analyte occupancy level below the array standard may be discarded. The method of characterizing an array of analytes may further comprise the step of separating analytes from the array of analytes based on comparing the ratio of the first occupancy measure to the second occupancy measure to an array standard. For example, an analyte array having an analyte occupancy below the array standard may be contacted with a stripping medium (e.g., denaturant, chaotrope) to remove coupled analytes and/or nucleic acids prior to reformation of the analyte array with a new plurality of analytes. The method of characterizing an analyte array may further comprise the step of providing additional analytes to the analyte array based on comparing the ratio of the first occupancy measure to the second occupancy measure to an array standard. For example, an array of analytes having a level of analyte occupancy below the array standard may be contacted with additional analytes coupled to the nucleic acid to increase analyte occupancy. The method of characterizing an analyte array may further include the step of utilizing the analyte array in an array-based process (e.g., assay, synthesis, etc.) based on comparing the ratio of the first occupancy metric to the second occupancy metric to an array standard.

In some configurations, an array can comprise a plurality of sites, wherein the plurality of sites comprises a first subset of sites, wherein each site of the first subset comprises a first occupancy metric (e.g., number of entities coupled to the array site, presence of entities, presence of detectable entities, etc.), a second subset of sites, wherein each site of the second subset comprises a second occupancy metric, and optionally, a third subset of sites, wherein each site of the third subset comprises a third occupancy metric. The occupancy of the array may be determined by methods such as fluorescence microscopy, electron microscopy, atomic force microscopy, and the like. The array may comprise a plurality of sites, wherein at least about 10%, 20%, 30%, 35%, 37%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, 99.99999% or more than 99.99999% of the sites in the plurality comprise occupancy of at least one analyte. Alternatively or additionally, the array may comprise a plurality of sites, wherein no more than about 99.99999%, 99.9999%, 99.999%, 99.99%, 99.9%, 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 37%, 35%, 30%, 20%, 10% or less than 10% of the plurality of sites comprise occupancy of at least one analyte. The array may comprise a plurality of sites, wherein at least about 10%, 20%, 30%, 35%, 37%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, 99.99999%, or more than 99.99999% of the sites in the plurality comprise occupancy of no more than one analyte. Alternatively or additionally, the array may comprise a plurality of sites, wherein no more than about 99.99999%, 99.9999%, 99.999%, 99.99%, 99.9%, 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 37%, 35%, 30%, 20%, 10% or less than 10% of the plurality of sites comprise occupancy of no more than one analyte.

Continuing with the example of an array containing a first subset of sites occupied by two or more analytes, a second subset of sites occupied by one analyte, and a third subset of sites occupied by zero analytes, the ratio of the number of sites of the first subset to the number of sites of the second subset or the ratio of the number of sites of the third subset to the number of sites of the second subset may substantially conform to a ratio predicted by a probability or random distribution, such as poisson distribution, normal distribution, binomial distribution, or the like. The ratio of the number of sites of the first subset to the number of sites of the second subset or the ratio of the number of sites of the third subset to the number of sites of the second subset may deviate from the ratio predicted by probability or random distribution. The ratio of the number of sites of the first subset to the number of sites of the second subset may have a value of no greater than about 0.71, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0001, 0.00001, 0.000001, or less than 0.000001. Alternatively or additionally, the ratio of the number of sites of the first subset to the number of sites of the second subset may have a value of at least about 0.000001, 0.00001, 0.0001, 0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.71, or greater than 0.71. The ratio of the number of sites of the third subset to the number of sites of the second subset may have a value of no greater than about 0.99, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0001, 0.00001, 0.000001, or less than 0.000001. Alternatively or additionally, the ratio of the number of sites of the third subset to the number of sites of the second subset may have a value of at least about 0.000001, 0.00001, 0.0001, 0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.99, or greater than 0.99.

The nucleic acid nanostructures or nucleic acid nanostructure complexes may be characterized by a spacing or separation between analyte coupling sites on adjacent nucleic acid nanostructures or nucleic acid nanostructure complexes in the nucleic acid nanostructure or nucleic acid nanostructure complex array. The nucleic acid nanostructure or nucleic acid nanostructure complex can have a nearest neighbor separation of at least about 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 120nm, 140nm, 160nm, 180nm, 200nm, 250nm, 300nm, 350nm, 400nm, 450nm, 500nm, 600nm, 700nm, 800nm, 900nm, 1 μm, 2 μm, 3 μm, 4 μm, 5 μm, 10 μm, or greater than 10 μm relative to an adjacent nucleic acid nanostructure or nucleic acid nanostructure complex. The nucleic acid nanostructure or nucleic acid nanostructure complex can have a nearest neighbor separation of no greater than about 10 μm, 5 μm, 4 μm, 3 μm, 2 μm, 1 μm, 900nm, 800nm, 700nm, 600nm, 500nm, 450nm, 400nm, 350nm, 300nm, 250nm, 200nm, 180nm, 160nm, 140nm, 120nm, 100nm, 95nm, 90nm, 85nm, 80nm, 75nm, 70nm, 65nm, 60nm, 55nm, 50nm, 45nm, 40nm, 35nm, 30nm, 25nm, 20nm, 15nm, 10nm, 5nm or less than 5nm relative to an adjacent nucleic acid nanostructure or nucleic acid nanostructure complex. The nearest-neighbor separation of the nucleic acid nanostructure or nucleic acid nanostructure complex can be determined by optical methods such as fluorescence microscopy. In some cases, the nucleic acid nanostructure or nucleic acid nanostructure complex nearest neighbor partition may be calculated as an average based on, for example, a total fluorescence count over the immobilized image region, where the total fluorescence count may be related to the number of nucleic acid nanostructures or nucleic acid nanostructure complexes observed. In other cases, the optical detection system may have sufficient optical resolution and sensor pixel density to distinguish individual nucleic acid nanostructures or nucleic acid nanostructure complexes and determine separation from all nearest neighbor nucleic acid nanostructures or nucleic acid nanostructure complexes.

As set forth herein, the nucleic acid nanostructures can be configured to couple to sites of an array, thereby blocking coupling of the second nucleic acid nanostructure to the sites. In some configurations, blocking binding may include inhibiting transport of the second nucleic acid nanostructure through the first nucleic acid nanostructure to the array site. For example, blocking binding may include inhibiting deposition of a second nucleic acid nanostructure at the array site during deposition of the first nucleic acid nanostructure at the array site. In some configurations, blocking binding may include inhibiting deposition of the second nucleic acid nanostructure at the array site after the first nucleic acid nanostructure has been coupled to the array site.

The first nucleic acid nanostructure can block binding of the second nucleic acid nanostructure at the array site by occupying a majority of the surface area of the array site. In some configurations, a nucleic acid nanostructure complex (e.g., SNAP complex) can be coupled to an array site, wherein the nucleic acid nanostructure complex comprises a plurality of nucleic acid nanostructures coupled, and wherein the optionally, the nanostructure complex is coupled to or configured to be coupled to a single target analyte. In other configurations, a nucleic acid nanostructure comprising a permeable structure can be coupled to an array site, wherein the permeable structure is configured to block binding of a second nucleic acid nanostructure to the array site, and wherein optionally the nanostructure is coupled to a single target analyte or is configured to be coupled to a single target analyte. In some configurations, the permeable structure may comprise an oligonucleotide configured to block binding of the second nucleic acid nanostructure to the array site. Exemplary compositions for permeable structures are set forth elsewhere herein (e.g., in the context of capture moieties, overhang moieties, and overhang oligonucleotides).

The nucleic acid nanostructures coupled to the solid support may be configured to inhibit or prevent contact between the target analyte and the solid support. In some configurations, the nucleic acid nanostructures may be configured to inhibit or prevent contact between the target analyte and the solid support during deposition of the nucleic acid nanostructures at the array sites on the solid support. For example, nucleic acid nanostructures may prevent the analyte from being directly coupled to the surface through non-specific binding interactions. In other configurations, the nucleic acid nanostructures may be configured to inhibit or prevent contact between the target analyte and the solid support after deposition of the nucleic acid nanostructures at the array sites on the solid support. For example, the nucleic acid nanostructure may comprise a linking moiety that couples the analyte to the nucleic acid nanostructure, wherein the linking moiety contributes to an increased spatial range of motion of the analyte, and wherein the nucleic acid nanostructure further comprises a footprint on the array site that blocks any surface area of the array site that is accessible to the analyte due to its increased range of motion. In some configurations, the nucleic acid nanostructure can comprise a permeable structure, wherein the permeable structure comprises a portion configured to prevent contact between the target analyte and the solid support. In some configurations, the permeable structure comprises a portion configured to prevent contact between the target analyte and the solid support by steric blocking of the solid support. In a particular configuration, the portion configured to prevent contact between the target analyte and the solid support comprises chemical and/or physical properties configured to prevent contact between the target analyte and the solid support. In a particular configuration, the moiety configured to prevent contact between the target analyte and the solid support comprises an electrically-repellent moiety, a magnetically-repellent moiety, a hydrophobic moiety, a hydrophilic moiety, an amphiphilic moiety, or a combination thereof.

The array sites on the solid support may be configured to prevent binding of the analyte to the array sites, or to prevent deposition of more than one nucleic acid nanostructure at the array sites. The array site may comprise a moiety configured to prevent target analytes from coupling to the site or to prevent deposition of more than one nucleic acid nanostructure at the array site. In some configurations, the moiety configured to prevent the target analyte from coupling to the site or preventing deposition of more than one nucleic acid nanostructure at the array site may comprise (i) an oligonucleotide, (ii) a polymer chain selected from a linear polymer chain, a branched polymer chain, and a dendrimer chain, (iii) a moiety comprising a chemical property configured to prevent contact between the target analyte and the solid support, or (iv) a moiety comprising an electrically repulsive moiety, a magnetically repulsive moiety, a hydrophobic moiety, a hydrophilic moiety, an amphiphilic moiety, or a combination thereof. In some configurations, the array site may comprise a first portion and a second portion, wherein the first portion and the second portion are configured to prevent target analytes from coupling to the site or to prevent deposition of more than one nucleic acid nanostructure at the array site, and wherein the first portion and the second portion comprise different chemical structures or different properties. For example, an array site may comprise a plurality of polymer chains, wherein the plurality of chains comprises a mixture of polymer chains having different structures, such as linear polymer chains (e.g., linear PEG, linear dextran) and branched polymer chains (e.g., branched PEG, branched dextran). In another example, the array site may comprise a mixture of polymer chains having different physical properties, such as a mixture of polar chains (e.g., PEG chains) and nonpolar chains (e.g., polyethylene chains).

The nucleic acid nanostructures may comprise dense structures (e.g., nucleic acid folded paper) comprising an effective surface area that is smaller than the surface area of the array sites to which the nucleic acid nanostructures are configured to couple. For example, a square, tile-shaped DNA fold may have a side length of about 83 nanometers, such that if the fold is coupled to an array site on one of its square faces, the DNA fold will occupy less than 10% of the surface area of a 300 nanometer wide circular array site. Nucleic acid nanostructures comprising dense structures may be configured to occupy a larger array site surface area than the effective surface area of the dense structures. For example, the nucleic acid nanostructure can be coupled with additional nucleic acid nanostructures to form nucleic acid nanostructure complexes with increased surface areas. In another example, the nucleic acid nanostructure can further comprise a permeable structure (e.g., a plurality of pendant oligonucleotides, such as shown in fig. 57) configured to increase the effective surface area of the nucleic acid nanostructure. The nucleic acid nanostructure may comprise a dense structure, wherein the dense structure comprises no more than about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less than 1% of the effective surface area of the array site surface area. Alternatively or additionally, the nucleic acid nanostructure may comprise a dense structure, wherein the dense structure comprises at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the effective surface area of the array site surface area.

The nucleic acid nanostructures may comprise a permeable region configured to increase the effective surface area or footprint of the nucleic acid nanostructures. In some configurations, the nucleic acid nanostructure can comprise a permeable structure, wherein the permeable structure is configured to couple to a site of a solid support (e.g., comprises a capture moiety). In some configurations, the permeable region may comprise a greater effective surface area or footprint than the effective surface area or footprint of the dense region. In other configurations, the permeable region may comprise an effective surface area or footprint that is smaller than the effective surface area or footprint of the dense region.

In some configurations, when coupled to a solid support, the nucleic acid nanostructures may comprise a total footprint that is greater than the total effective surface area of the nucleic acid nanostructures when not coupled to the solid support. When coupled to a solid support, the nucleic acid nanostructure may comprise at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 150%, 200%, or more than 200% of the total footprint of the surface area of the array site. Alternatively or additionally, when coupled to a solid support, the nucleic acid nanostructure may comprise no more than about 200%, 150%, 120%, 110%, 100%, 90%, 80%, 70%, 60%, 50%, 30%, 25%, 20%, 15%, 10%, 5%, 1% or less than 1% of the total footprint of the array site surface area. In some configurations, the nucleic acid nanostructures may comprise a footprint that exceeds the surface area of the array site. For example, fig. 56A depicts a nucleic acid nanostructure 5630 having a pendent oligonucleotide 5635 (e.g., a polynucleotide repeat obtained from TdT extension) that extends in length beyond an array site 5601 in a coupled configuration.

The nucleic acid nanostructure or component thereof (e.g., dense structure) can comprise a face or contour having a particular shape (e.g., square, rectangular, triangular, circular, polygonal, etc.). The shape or profile of the nucleic acid nanostructure or component thereof can be the same or similar to the shape or profile of the array site, e.g., as determined by the aspect ratio of the shape or profile. For example, square-shaped nucleic acid folds may be coupled to square-shaped array sites. In particular configurations, the nucleic acid nanostructures and the array sites may comprise the same or similar shape or profile, wherein the surface area of the array sites is substantially the same as the footprint of the nucleic acid nanostructures. In another particular configuration, the nucleic acid nanostructures and array sites may comprise the same or similar shape or profile, wherein the surface area of the array sites is different from the footprint (e.g., larger footprint, smaller footprint) of the nucleic acid nanostructures. In other configurations, the shape or profile of the nucleic acid nanostructure or component thereof can comprise a different shape or profile than the array site, e.g., as determined by the aspect ratio of the shape or profile. For example, square-shaped nucleic acid folds may be coupled to circular array sites. In some configurations, the shape or profile of the nucleic acid nanostructure or component thereof can comprise a different shape or profile than the array site, wherein the nucleic acid nanostructure comprises a larger footprint than the surface area of the array site. In other configurations, the shape or profile of the nucleic acid nanostructure or component thereof can comprise a different shape or profile than the array site, wherein the nucleic acid nanostructure comprises a smaller footprint than the surface area of the array site. In other configurations, the shape or profile of the nucleic acid nanostructure or component thereof can comprise a different shape or profile than the array site, wherein the nucleic acid nanostructure comprises a footprint substantially equal to the surface area of the array site.

As set forth herein, a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may be combined to form an array. For example, the plurality of SNAP may form a random array (e.g., wherein the plurality of SNAP occur in a non-repeating pattern on a surface or interface) or an ordered array (e.g., wherein the plurality of SNAP are spatially arranged in a regular repeating pattern on a surface or interface). In some configurations, homogeneous multiple nucleic acid nanostructures or nucleic acid nanostructure complexes may be combined to form random or ordered arrays on a surface or interface. In other configurations, heterogeneous pluralities of nucleic acid nanostructures or nucleic acid nanostructure complexes may be combined to form random or ordered arrays on a surface or interface. The homogeneity or heterogeneity of a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes can be determined based on the shape, conformation, or structure of the nucleic acid nanostructures or nucleic acid nanostructure complexes. For example, a homogeneous plurality of nucleic acid nanostructure complexes may comprise only nucleic acid nanostructure complexes having a cross-over configuration. In another example, the heterogeneous plurality of nucleic acid nanostructure complexes may comprise a mixture of nucleic acid nanostructure complexes having a cross or square configuration.

The nucleic acid nanostructures or nucleic acid nanostructure complexes may be arranged at a characteristic separation or interval on a surface or interface. The characteristic separation or interval may be determined by the average or local distance between adjacent analyte coupling sites on different nucleic acid nanostructures or nucleic acid nanostructure complexes. The characteristic separation or interval may be determined by: 1) The size of the nucleic acid nanostructure or nucleic acid nanostructure complex; 2) A structure or conformation of a nucleic acid nanostructure or nucleic acid nanostructure complex; 3) Spacing or separation of patterned features on a surface; or 4) combinations thereof. For structured or patterned arrays, the characteristic separation or spacing may be determined by the separation or spacing between structured or patterned features. For unstructured or unpatterned arrays, the characteristic separation or spacing may be defined by, for example, the size of the nucleic acid nanostructure complex and/or modification groups near the edges of the complex (e.g., steric hindrance groups,Coupling groups) that bind the complexes together or create an inter-complex repulsion. 17A-17C depict configurations for altering the characteristic separation or spacing of a plurality of nucleic acid nanostructure complexes via their arrangement. Fig. 17A depicts an assembled array of homogeneous SNAP complexes 1710 with a cross configuration arranged by close packing of the complexes. The assembled array may have Δg between nearest neighbor analyte coupling sites along the diagonal between coupling sites ₁ Is a characteristic interval of (a). Fig. 17B depicts an assembled array of homogeneous SNAP complexes 1710 with a cross configuration that are arranged with less densely packed structures than shown in fig. 17A. The assembled array may have a Δg between any two adjacent analyte coupling sites between the nearest adjacent analyte coupling sites ₂ Is a characteristic interval of (a). FIG. 17C depicts an assembled array of homogeneous SNAP complexes 1710 with a cross configuration combined with a separate SNAP 1720 (e.g., SNAP or SNAP complexes without polypeptide coupling sites) to form a separate array. Separating SNAP 1720 increases the characteristic spacing Δg between analyte coupling sites on adjacent SNAP complexes ₃ . Assuming uniform size of homogeneous SNAP complex 1710 with cross-over configuration, the characteristic spacer may be separated by Δg ₃ >Δg ₂ >Δg ₁ Is increased in order.

In another aspect, provided herein is a single analyte array comprising: a) A solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is distinguishable from each other address by a single analyte resolution, and wherein each address is separated from each adjacent address by one or more gap regions; and b) a plurality of analytes, wherein a single analyte of the plurality of analytes is coupled to one address of the plurality of addresses, wherein each address of the plurality of addresses comprises a single target analyte (i.e., one and only one target analyte), wherein each single analyte is coupled to the coupling surface of the address by a nucleic acid (e.g., nucleic acid nanostructure, SNAP, etc.), and wherein the nucleic acid inhibits (e.g., blocks) single analytes from contacting the coupling surface.

In another aspect, provided herein is a single analyte array comprising: a) A solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is distinguishable by a single analyte resolution, wherein each address comprises a conjugate surface, and wherein each conjugate surface comprises one or more surface-attachment moieties; and b) a plurality of nucleic acid nanostructures, wherein each structured nucleic acid particle comprises a coupling moiety, wherein the coupling moiety comprises a plurality of oligonucleotides, wherein each oligonucleotide in the plurality of oligonucleotides comprises a surface interaction moiety, wherein each structured nucleic acid particle in the plurality of structured nucleic acid particles is coupled to one address in the plurality of addresses by binding of the surface interaction moiety of the plurality of oligonucleotides to the surface attachment moiety of one or more complementary oligonucleotides, and wherein the structured nucleic acid particle in the plurality of structured nucleic acid particles comprises a display moiety comprising a coupling site coupled to an analyte.

In some configurations, the single analyte array may comprise an ordered array. In a particular configuration, the coupling surface of the ordered array may be formed by a photolithographic process. In other particular configurations, one of the plurality of addresses of the ordered array may be adjacent to one or more interstitial regions, wherein the interstitial regions of the one or more interstitial regions do not include a coupling surface. As set forth herein, a gap region of one or more gap regions may comprise a disruption moiety, wherein the disruption moiety is configured to reduce, prevent, or inhibit the possibility of coupling of a molecule (e.g., an affinity reagent, a fluorophore, etc.) to the gap region. In some configurations, the ordered array may comprise a coupling surface, wherein the coupling surface comprises a raised surface or a recessed surface relative to a interstitial region of the one or more interstitial regions.

In other configurations, the single analyte array may comprise a disordered array. The disordered array may comprise a solid support that does not comprise a coupling surface formed by a patterning process (e.g., photolithography). The disordered array may comprise, for example, a substantially planar solid support comprising a near uniform surface layer comprising a plurality of surface attachment moieties. The disordered array may contain unique distinguishable addresses for nucleic acid nanostructure localization, for example, by depositing nucleic acid nanostructures configured to prevent co-localization of multiple nucleic acid nanostructures at a single address, or by depositing nucleic acid nanostructures at concentrations that inhibit co-localization.

In a particular configuration, the array, whether ordered or unordered, may further comprise a lipid layer (e.g., monolayer, bilayer, micelle, or colloid) adjacent to the solid support. For example, if a surface-linking moiety of one or more surface-linking moieties is coupled to a lipid molecule of a lipid layer, a nucleic acid nanostructure (e.g., SNAP) can be anchored to the array via a lipid bilayer. In a particular configuration, the lipid molecules of the lipid layer may comprise phospholipids, triglycerides or cholesterol.

In some configurations, multiple nucleic acid nanostructures or nucleic acid nanostructure complexes as set forth herein may be combined to form a self-assembled or self-patterned array. The analyte may be conjugated to the nucleic acid nanostructure or nucleic acid nanostructure complex before, during, or after forming the self-assembled or self-patterned array to form the analyte array. The formation of self-assembled or self-patterned arrays may be driven by interactions between nucleic acid nanostructures and surfaces or interfaces, interactions between nucleic acid nanostructure complexes and surfaces or interfaces, interactions between two or more nucleic acid nanostructures, interactions between two or more nucleic acid nanostructure complexes, or combinations thereof. The self-assembled or self-patterned array of nucleic acid nanostructures or nucleic acid nanostructure complexes may be stable, metastable, or unstable. The stability and/or ordering of the nucleic acid nanostructures or self-assembled or self-patterned arrays of nucleic acid nanostructure complexes may be mediated by covalent, non-covalent, electrostatic or magnetic interactions. For example, self-assembled arrays of SNAP complexes may be stabilized by electrostatic interactions between constituent SNAP and the surface, and nucleic acid coupling between adjacent SNAP. Such arrays may be unstable due to excessive temperatures or the presence of denaturing agents. In another example, a self-assembled array may be formed by covalent cross-linking between adjacent SNAP complexes associated with a multiphase interface. Covalently crosslinked arrays may have substantial chemical stability, but may be damaged by excessive mechanical stress.

The self-patterned or self-assembled array of nucleic acid nanostructures or nucleic acid nanostructure complexes may form a homogeneous or heterogeneous array at a surface or interface. The self-patterned or self-assembled array of nucleic acid nanostructures or nucleic acid nanostructure complexes may be homogenous across the entire surface or interface or across a portion of the surface or interface. Fig. 18A-18C illustrate array coverage patterns for different configurations of nucleic acid nanostructures or nucleic acid nanostructure complexes in a self-assembled or self-patterned array. Fig. 18A depicts an array of rectangular SNAP or SNAP composites 1820 that fully occupy the area defined by block 1810. The ordering or patterning of the array is approximately uniform across the area 1810. Fig. 18B depicts an array of rectangular SNAP or SNAP composites 1820 that partially occupy the area defined by block 1810. The array is non-uniform in coverage relative to the region 1810, but approximately uniform in the sub-region defined by block 1840. The remaining region 1830 between region 1810 and subregion 1840 may be free of SNAP or SNAP complexes, have an unstructured or array-free SNAP or SNAP complex, or a smaller array of SNAP or SNAP complexes. Fig. 18C depicts an array of rectangular SNAP or SNAP complexes 1820 uniformly distributed within the area defined by block 1810. Dispersion of SNAP or SNAP complex 1820 includes unoccupied subregions with little or no SNAP or SNAP complex 1830. Uniform dispersion with unoccupied subregions can be formed, for example, by depositing SNAP or SNAP complexes on a patterned array or combining multiple SNAP or SNAP complexes that contain modifying groups that spatially repel other SNAP or SNAP complexes.

As set forth herein, a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may be assembled into cohesive and/or continuous structures. For example, a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may form a monolayer or film. Cohesive and/or continuous structures may form in solution and then deposit on a surface due to sedimentation or other deposition mechanisms. Cohesive and/or continuous structures comprising a plurality of assembled nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed on a surface or at an interface. 19A-19B illustrate cohesive or continuous structures formed by the assembly of multiple nucleic acid nanostructures or nucleic acid nanostructure complexes. FIG. 19A depicts a plurality of SNAPs 1930 configured to be associated with an interface 1950 formed between a first higher density fluid 1960 and a second lower density fluid 1970. Multiple SNAP 1930 are coupled into an analyte array by nucleic acid coupling 1940. The analyte array is further stabilized by a coupling 1920 (e.g., streptavidin-biotin, covalent bond formed by a click reaction, etc.) that secures the analyte array to a container 1910 containing a first higher density fluid 1960 and a second lower density fluid 1970. FIG. 19B shows a plurality of SNAPs 1930 coupled into an analyte array by nucleic acid coupling 1940. The analyte array may be formed at interface 1950 or within fluid 1960 prior to deposition onto the surface of a container 1910 containing fluid 1960. Without wishing to be bound by theory, the deposition of assembled analyte arrays on the surface may be driven by hydrodynamic instabilities caused by array size, density, weight or other characteristics.

As set forth herein, a self-patterned or self-assembled array of nucleic acid nanostructure complexes can comprise a plurality of species or configurations of nucleic acid nanostructure complexes. The types of nucleic acid nanostructure complexes can be distinguished by shape, configuration (e.g., presence or absence of a modifying group, presence or absence of a coupling group, etc.), presence or absence of a particular tag, or coupling specificity. Two or more species of nucleic acid nanostructure complexes can be configured to self-assemble into sub-regions of a larger array. Two or more species of nucleic acid nanostructure complexes can self-assemble due to complementary coupling groups (e.g., nucleic acids) on each species of nucleic acid nanostructure complex.

As set forth herein, different kinds of nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed for the purpose of distinguishing between different types of analytes. In some configurations, the analyte sample may be separated into separate portions (e.g., by size, by charge, by mass, by polarity, by location in the cell, etc.), each separate portion being placed on a different kind of nucleic acid nanostructure or nucleic acid nanostructure complex. In other configurations, the sample analyte may be coupled to one species of nucleic acid nanostructure or nucleic acid nanostructure complex, and the standard or control analyte may be coupled to a different species of nucleic acid nanostructure or nucleic acid nanostructure complex. FIG. 20 illustrates a method of forming different species of SNAP or SNAP complexes by selectively targeting polypeptides in a polypeptide sample to different SNAPs or SNAP complexes. The square species SNAP or SNAP complex comprising amine reactive group 2020 and the triangular species SNAP or SNAP complex comprising DBCO reactive group 2030 are contacted with a polypeptide sample comprising differentially labeled polypeptides including carboxylated polypeptide 2010, activated ester labeled polypeptide 2011, azide labeled polypeptide 2012, and hydroxyl labeled polypeptide 2013. Because of the relative reactivities of SNAP-based reactive groups and polypeptide-based reactive groups, square-type SNAP or SNAP complex 2020 is covalently conjugated to an activated ester-labeled polypeptide 2011 to form a polypeptide-coupled SNAP or SNAP complex. Likewise, triangular species SNAP or SNAP complex 2030 is covalently conjugated to an activated ester-labeled polypeptide 2012 to form a polypeptide-conjugated SNAP or SNAP complex.

Two different kinds of nucleic acid nanostructures or nucleic acid nanostructure complexes in an assembled array can be distinguished by different types of display analytes. Different analytes may be classified based on any analyte characteristic including, but not limited to, size, weight, length, cellular location (e.g., extracellular, membrane, cytoplasmic, organelle, nucleus, etc.), organism or system of origin (e.g., cell-free synthesis), isoelectric point, hydrodynamic radius, post-translational modification, or any other measurable or observable polypeptide characteristic. For example, a first species of SNAP or SNAP complex in a polypeptide array may comprise polypeptides from a polypeptide-containing sample, and a second species of SNAP or SNAP complex in a polypeptide array may comprise polypeptides from a standard or control sample (i.e., a quality control marker polypeptide, a positive control polypeptide, a negative control polypeptide, etc.). In another example, a polypeptide from a first organism may be placed on a first species of SNAP or SNAP complex, and a polypeptide from a second organism may be placed on a second species of SNAP or SNAP complex.

Two or more different kinds of nucleic acid nanostructures or nucleic acid nanostructure complexes can be assembled to form an array with a unique, rational, ordered, or separate arrangement. Fig. 22-24 depict examples of locally patterning SNAP complexes to produce different array conformations. Different species of SNAP or SNAP complexes may self-assemble into ordered or patterned arrays.

FIG. 22 depicts a SNAP or SNAP complex array formed by combining two different species of SNAP or SNAP complexes geometrically matched and configured to combine with each other to form a symmetric array. Square SNAP or SNAP complexes may self-align into regions of homogeneous SNAP separated by aligned complexes separating SNAP or SNAP complex 2220. The aligned complexes of isolated SNAP or SNAP complex 2220 may be readily observed or detected by some detection method (e.g., fluorescence microscopy), allowing for rapid spatial identification of the position in an array of isolated square SNAP or SNAP complexes 2210 or isolated SNAP or SNAP complexes 2220. Self-isolation may be facilitated by making SNAP or SNAP complexes having certain utility faces comprising coupling groups intended to couple with the same species of SNAP or SNAP complex and having other utility faces comprising coupling groups intended to couple with a different species of SNAP or SNAP complex. The ordered array may also contain unoccupied regions of SNAP or SNAP complexes that are not configured to couple with analyte 2230. Unoccupied regions of SNAP or SNAP complexes that are not configured to couple analyte 2230 may be used to maintain array stability and/or facilitate formation of array patterning. FIG. 24 depicts an array similar to that depicted in FIG. 22 utilizing several categories of SNAP or SNAP complexes. Large square SNAP or SNAP complex 2410, small square SNAP or SNAP complex 2411, large right triangle SNAP complex 2412, and small right triangle SNAP or SNAP complex 2413 may be configured to self-partition into homogeneous regions of similar SNAP or SNAP complexes. In some configurations, isolated SNAP or SNAP complex 2220 or 2420 can be coupled to a standard or control polypeptide (e.g., a quality control polypeptide, a positive control polypeptide, a negative control polypeptide, etc.) to produce patterned fiducials or grid lines for image registration when detecting a SNAP array, quality control of a process utilizing a SNAP array, and so forth.

FIG. 23A shows a SNAP or SNAP complex array formed by combining two different species of SNAP or SNAP complexes that are geometrically mismatched but configured to bind to each other. Binding of hexagonal SNAP or SNAP complex 2310 to square SNAP or SNAP complex 2320 creates a mismatch or discontinuity in the alignment pattern of aligned SNAP or SNAP complexes. Mismatches or discontinuities can be readily observed or detected by some detection methods (e.g., fluorescence microscopy), allowing for rapid spatial identification of locations in an array of square SNAP or SNAP complexes 2320. This type of array may be useful where one type of SNAP or SNAP complex is less in total than a second type of SNAP or SNAP complex. FIG. 23B shows a SNAP or SNAP complex array formed by combining two different species of SNAP or SNAP complexes that are geometrically mismatched but configured to bind to each other. Binding of hexagonal SNAP or SNAP complex 2310 to square SNAP or SNAP complex 2320 creates a mismatch or discontinuity in the alignment pattern of aligned SNAP or SNAP complexes. In some configurations (e.g., the concentration of each species is approximately equal), both species may selectively self-separate, resulting in a limited binding region between the two species. The mismatched or discontinuous locations can be readily observed or detected by some detection method (e.g., fluorescence microscopy), allowing for rapid spatial identification of the locations in an array of isolated square SNAP or SNAP complexes 2320 or isolated hexagonal SNAP or SNAP complexes 2310.

As set forth herein, an array comprising a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may remain stable for a particular period of time. The stability of the array may be a function of a threshold amount of nucleic acid nanostructures or nucleic acid nanostructure complexes that remain coupled to or with the array. For example, a stable array may comprise at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more than 99% of nucleic acid nanostructures or nucleic acid nanostructure complexes that remain coupled to the array after a set period of time (e.g., at least about 1 second, 1 minute, 5 minutes, 10 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 1 month, 6 months, 1 year, 5 years, or more than 5 years).

In some configurations, the capture moiety of the nucleic acid nanostructure can be coupled to the coupling surface of the solid support. In other configurations, the capture moiety of the nucleic acid nanostructure need not be coupled to a surface. For example, SNAP may be uncoupled from the coupling surface (e.g., suspended or dissolved in a fluid medium) either prior to deposition of SNAP or after SNAP has been selectively released from the coupling surface (e.g., via cleavage of a cleavable linker). The solid support may comprise any conceivable material or combination thereof, including metals, metal oxides, glasses, ceramics, semiconductors, and polymers. The solid support may comprise a gel, such as a hydrogel. The solid support may comprise a plurality of surface-displayed functional groups or moieties (e.g., amines, epoxides, carboxylates, polymer chains, oligonucleotides, etc.). The functional groups may be displayed on a solid support, for example, to passivate the surface, provide coupling sites, or hinder binding of the molecule to the surface. The surface-displayed functional groups may be configured to form covalent interactions or non-covalent interactions with nucleic acid nanostructures (e.g., SNAP) or other molecules or particles. The solid support may also comprise adjacent or coupled layers, such as lipid monolayers, lipid bilayers, multiple colloids or micelles, or the like. Adjacent or coupled layers may contain a variety of molecules that alter the surface properties of the solid support, such as surface tension, surface energy, hydrophobicity, hydrophilicity, or the tendency or likelihood of non-specific binding to a particular molecule (e.g., protein). The adjacent or coupled layers may comprise a surfactant or detergent material. Adjacent or coupled layers may comprise lipid materials such as phospholipids, triglycerides or sterols.

The solid support may comprise an address comprising one or more surface-attached moieties, wherein the address is distinguishable at a single analyte resolution. In some configurations, the address may comprise one or more surfaces, wherein the one or more surfaces may comprise a coupling surface, and wherein the coupling surface comprises one or more surface-attachment moieties. In a particular configuration, one or more surfaces of the address on the solid support may form a three-dimensional structure on the solid support. For example, the three-dimensional structure may comprise a raised structure (e.g., a post, rod, cylinder, dome, pyramid, convex region, etc.) or a pore structure (e.g., a recessed region, channel, or pore (such as a micro-, nano-, or micro-pore)).

As set forth herein, the coupling surface of the solid support may comprise a plurality of surface-attached moieties (e.g., surface-attached oligonucleotides, surface-attached reactive groups, surface-attached coupling groups, etc.). The surface-linking moiety may be covalently or non-covalently attached to the coupled surface of the solid support. In some configurations, the distribution or density of surface-attachment moieties on the coupling surface may be substantially uniform across the coupling surface. In other configurations, the surface-attachment moiety density of the coupling surface need not be substantially uniform across the coupling surface. For example, a fraction of the plurality of surface-attachment moieties may be located within a central region of the coupling surface. In another example, the plurality of surface-attachment moieties of the second fraction may be located within an outer region of the coupling surface. The plurality of surface-attachment moieties may have at least about 0.001 picomolar per square nanometer (pmol/nm) over a region of the coupling surface (e.g., the region may be a site or address of an array) ² )、0.005pmol/nm ² 、0.01pmol/nm ² 、0.05pmol/nm ² 、0.1pmol/nm ² 、0.5pmol/nm ² 、1pmol/nm ² 、5pmol/nm ² 、10pmol/nm ² 、50pmol/nm ² 、100pmol/nm ² Or more than 100pmol/nm ² Is a surface average density of (c). Alternatively or additionally, the plurality of surface-attachment moieties may have no more than about 100pmol/nm on a region of the coupling surface ² 、50pmol/nm ² 、10pmol/nm ² 、5pmol/nm ² 、1pmol/nm ² 、0.5pmol/nm ² 、0.1pmol/nm ² 、0.05pmol/nm ² 、0.01pmol/nm ² 、0.005pmol/nm ² 、0.001pmol/nm ² Or less than 0.001pmol/nm ² Is a surface average density of (c).

As set forth herein, a solid support may comprise a coupled surface comprising a plurality of surface-linking moieties, wherein a fraction of the surface-linking moieties are coupled to at least one surface-interacting moiety of a nucleic acid nanostructure (e.g., SNAP). In some configurations, a fraction of the surface-interacting moieties in the nucleic acid nanostructure are coupled to a fraction of the surface-linking moieties in the plurality of surface-linking moieties on the solid support. The fraction of surface-interacting moieties coupled to the at least one surface-attachment moiety may be at least about 0.000001, 0.00001, 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.99, 0.999, 0.9999, 0.99999, or greater than 0.99999. Alternatively or additionally, the fraction of surface-interacting moieties coupled to the at least one surface-attachment moiety may be no greater than about 0.99999, 0.9999, 0.999, 0.99, 0.95, 0.9, 0.85, 0.8, 0.75, 0.7, 0.65, 0.6, 0.55, 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00001, 0.000001, or less than 0.000001.

FIG. 40C shows the configuration of SNAP compositions with different fractions of coupled surface-interacting and surface-linking moieties. SNAP 4010 couples to coupling surface 4002 through the binding interactions of each of its 5 surface-interacting moieties. Thus, the total fraction of surface interaction moieties coupled to at least one surface attachment moiety is 1. The coupling surface comprises the 15 depicted surface attachment moieties, 5 of which are involved in forming a binding interaction with SNAP 4010. Thus, the fraction of surface-attachment moieties coupled to at least one surface-interacting moiety is 0.26. Also, the fraction of each unique type of surface-bound species can be calculated (e.g., a fraction of surface-bound oligonucleotide 4038 of 0.22 and a fraction of surface-bound complementary coupling group 4039 of 1).

As set forth herein, the solid support may comprise a passivation layer. The passivation layer may be configured to reduce, inhibit, or prevent non-specific binding of specific molecules (e.g., affinity reagents, unconjugated analytes, etc.) to the solid support. In some configurations, the passivation layer may comprise a plurality of molecules configured to prevent non-specific binding of the molecules to the solid support. In a particular configuration, the plurality of molecules may comprise a plurality of surface-attached polymers selected from polyethylene glycol, polyethylene oxide, alkanes, nucleic acids, or dextran. In some configurations, one of the plurality of molecules comprising the passivation layer may further comprise a surface attachment moiety. In some configurations, the passivation layer may comprise one of a plurality of molecules that further comprises a linker coupling the surface-linking moiety to the coupled surface. In some configurations, the linking group may comprise a group that forms a covalent bond or a coordination bond with the solid support, such as a silane, phosphate, or phosphonate.

A random or ordered array of nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed from a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes at a surface or interface. A random or ordered array of nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed from a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes at a structured or patterned surface. A random or ordered array of nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed from a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes at an unstructured or non-patterned surface, such as a surface having a continuous one-piece (down) or monolithic attachment point for the nucleic acid nanostructures or nucleic acid nanostructure complexes.

The structured or patterned surface may be formed on the solid support by any suitable method, such as photolithography, dip-pen nanolithography, nanoimprint lithography, nanosphere lithography, nanopillar arrays, nanowire lithography, scanning probe lithography, thermochemical lithography, thermal scanning probe lithography, chemical or plasma etching, localized oxide nanolithography, molecular self-assembly, template lithography, or electron beam lithography. Etching methods can facilitate the formation of two-dimensional or three-dimensional features on the surface of a solid support. In some configurations, a substantially planar solid support comprising an original surface may be formed to provide a plurality of sites, wherein each site of the plurality of sites comprises a face comprising an original surface region, and wherein each site of the plurality of sites is adjacent to one or more interstitial regions, wherein the one or more interstitial regions comprise a shaped surface, wherein the shaped surface comprises a surface produced by a shaping process (e.g., etching, deposition, etc.). For example, photolithography may be used to etch material from a planar solid support, thereby creating a plurality of raised sites surrounded by etched lines, wherein the thickness of the solid support at each raised site is substantially the same as the original thickness of the solid support, and the thickness of the solid support at the interstitial regions is less than the original thickness of the solid support. In another example, the array may be formed by: patterning a solid material (e.g., metal oxide, etc.) onto a surface of a planar solid support to create a plurality of sites surrounded by raised interstitial regions where the solid material is deposited, wherein the array thickness at each site is substantially the same as the original thickness of the solid support and the array thickness at the interstitial regions is substantially the sum of the original thickness of the solid support and the thickness of the deposited solid material. As set forth herein, the sites on the solid support may form a shape or morphology that is substantially the same as the shape of the nucleic acid nanostructure. For example, a substantially square nucleic acid nanostructure may be coupled to a substantially square array site. As set forth herein, the sites on the solid support may form a shape or morphology that is substantially different from the shape of the nucleic acid nanostructure. For example, a substantially square nucleic acid nanostructure may be coupled to a substantially circular array site. In some configurations, the solid support, its surface, and/or its sites may undergo two or more surface shaping processes to form nanoscale or microscale features (e.g., raised features, serrated features) on the surface. For example, the solid support can be formed by photolithography followed by etching (e.g., in potassium hydroxide) to produce a regular ordered array of sites, wherein each site of the regular ordered array of sites comprises three-dimensional pore features (e.g., pyramid-shaped pores, conical pores, hemispherical pores, etc.). See, e.g., hookway et al, methods,101,2016, which are incorporated by reference in their entirety.

In some configurations, a site of the plurality of sites may comprise a three-dimensional shape or morphology. The shaping process (e.g., etching) may produce sites or features thereof (e.g., raised features, recessed features) having a three-dimensional shape or morphology. 66A-66D illustrate particular aspects of site morphology of a solid support comprising raised sites, although it is readily understood that similar considerations may apply to serrated features or sites. The raised features depicted in fig. 66A-66D may be formed by a process of removing material from a solid support or by a process of depositing a second solid support material onto a first solid support material. Fig. 66A depicts a cross-sectional view of a solid support comprising raised features (e.g., sites) comprising a substantially planar top surface 6610 and a lower surface 6612 surrounding the raised features, wherein both surfaces 6610 and 6612 are substantially parallel to the bottom surface 6613 of the solid support 6613. The raised features include side surfaces 6611 that are substantially orthogonal to the substantially planar top surface 6610 and the lower surface 6612, thereby forming a sharp transition 6615 at the top of the raised features. The total thickness of the solid support 6600 can be from a maximum thickness t between the substantially planar top surface 6610 and the bottom surface 6613 _max Varying to a minimum thickness t between the lower surface 6612 and the bottom surface 6613 _min . FIG. 66B depicts a cross-section of a solid support comprising raised features (e.g., sites)The raised features comprise a substantially planar top surface 6610 and a lower surface 6612 surrounding the raised features, wherein both surfaces 6610 and 6612 are substantially parallel to the bottom surface 6613 of the solid support 6613. The raised features comprise side surfaces 6611 that are substantially orthogonal to the substantially planar top surface 6610 and the lower surface 6612, but the transition 6616 between the side surfaces 6611 and the substantially planar top surface 6610 is divergent (e.g., rounded, curved, sloped, etc.). The total thickness of the solid support 6600 can be from a maximum thickness t between the substantially planar top surface 6610 and the bottom surface 6613 _max Varying to a minimum thickness t between the lower surface 6612 and the bottom surface 6613 _min . Fig. 66C depicts a cross-sectional view of a solid support comprising raised features (e.g., sites) comprising a substantially planar top surface 6610 and a lower surface 6612 surrounding the raised features, wherein both surfaces 6610 and 6612 are substantially parallel to the bottom surface 6613 of the solid support 6613. The raised features include side surfaces 6611 that are substantially orthogonal to the substantially planar top surface 6610 and the lower surface 6612. The substantially planar top surface 6610 includes one or more non-planar surface features 6617. The non-planar surface features 6617 may occur due to the natural roughness of the solid support material or may be an artifact of the array formation process (e.g., anisotropic etching, anisotropic deposition of a surface upper layer, anisotropic removal of a processing intermediate (such as photoresist), etc.). The total thickness of the solid support 6600 can be from the maximum thickness t between the non-planar surface features 6617 and the bottom surface 6613 _max Varying to a minimum thickness t between the lower surface 6612 and the bottom surface 6613 _min . Fig. 66D depicts a raised feature, such as the feature of fig. 66B, wherein multiple portions 6620 (e.g., surface-connecting portions) have been coupled to the raised feature. Due to the morphology of the surface (e.g., divergent transitions 6616), the orientation of portions of the plurality of portions 6620 may vary over the raised features. In some configurations, different orientations of the surface coupling moiety, e.g., near the edge of the site, can facilitate coupling of the nucleic acid nanostructure to the site or feature thereof. For example, surface attachment moieties near the edges of the array site may be coupled to the array site (e.g., gap region) Adjacent nucleic acid nanostructures, thereby allowing for the rearrangement of the spatial locations of the nucleic acid nanostructures from the adjacent region to the array site. In some configurations, different orientations of the surface-coupling moiety, e.g., near the edge of the site, can inhibit non-specific coupling of the entity to the site or a feature thereof. For example, when a nucleic acid has been coupled to an array site, PEG chains near the edge of the site can inhibit binding of entities (e.g., affinity reagents, other nucleic acids) to the array site.

Optionally, the solid support may be formed into an array by a non-etching method, the array being configured to couple a plurality of analytes, as set forth herein. In some cases, the array can comprise a solid support comprising a plurality of sites and a spacer material, wherein the spacer material separates each of the plurality of sites from each other of the plurality of sites. The separator material may comprise one or more of the following features: i) Configured to be coupled (e.g., covalently coupled, non-covalently coupled) to a solid support or a surface thereof, ii) provide spatial separation between each of a plurality of sites, iii) facilitate contact of a nucleic acid nanostructure as set forth herein with a solid support or a surface thereof, and iv) inhibit binding of the nucleic acid nanostructure to a separation material. FIG. 64 depicts an analyte array formed by a non-etching method. The solid support 6400 can comprise a plurality of nanoparticles or microparticles 6410 that are arranged on the surface of the solid support 6400 to create a spatial region of the surface of the solid support 6400 that is blocked from contact with the nucleic acid 6420 and pores between the nanoparticles or microparticles 6410 that are sufficiently large (e.g., as determined by volume, as determined by area) to facilitate contact of the nucleic acid 6420 with the surface of the solid support 6400. Optionally, the surface of the solid support 6400 may contain moieties that facilitate coupling of the nanoparticles or microparticles 6410 and/or the nucleic acid 6420. Optionally, nucleic acid 6420 may be coupled to analyte 6430. In some configurations, the separator material (e.g., nanoparticle or microparticle) can comprise a surface charge (e.g., carboxylated microparticle, aminated microparticle) configured to form an electrostatic interaction with a charged surface moiety (e.g., amine, carboxylate, etc.). In particular configurations, the separator material may further comprise a passivating moiety configured to inhibit binding of entities to the separator material (e.g., PEG moiety, dextran moiety, etc.).

The unstructured or unpatterned surface may be formed by any suitable method, such as atomic layer deposition, chemical vapor deposition, or chemical liquid deposition. As set forth herein, the surface may include a plurality of functional groups to facilitate interactions with the nucleic acid nanostructure or nucleic acid nanostructure complex, such as formation of covalent, non-covalent, or electrostatic interactions. The surface-bound functional groups may include amines, thiols, carboxylic acids, activated esters, silanes, silanols, siloxanes, silicon oxides, silyl halides, silicon carbenes (silenes), silyl hydrides, phosphates, phosphonates, epoxides, azides, or mercapto groups. For example, a silicon-containing surface (e.g., glass, fused silica, silicon wafer, etc.) may comprise a monolayer coating of a silane compound such as (3-aminopropyl) trimethoxysilane (APTMS), (3-aminopropyl) triethoxysilane (APTES), (3-glycidoxypropyl) trimethoxysilane (GOPS), additional N- (3-triethoxysilylpropyl) -4-Hydroxybutyramide (HAPS), 11-acetoxyundecyltriethoxysilane, N-decyltriethoxysilane, 3-iodo-propyltrimethoxysilane, perfluorooctyltrichlorosilane, octylchlorosilane, octadecyltrichlorosilane, (tridecafluoro-1, 2-tetrahydrooctyl) trichlorosilane, or (tridecafluoro-1, 2-tetrahydrooctyl) trimethoxysilane. In another example, a metal oxide surface (e.g., zrO2, tiO ₂ ) A single layer of phosphate or phosphonate compound may be included.

In some configurations, the functional group may comprise a click-type reactive group. In some cases, the functional group may comprise an oligonucleotide. The surface may comprise a passivation layer such as a layer of PEG, PEO, dextran or nucleic acid. The functionalized or nonfunctionalized surface may contain a positive, negative, or neutral charge.

As set forth herein, the solid support or surface thereof may be patterned to form a plurality of sites patterned or ordered on the solid support or surface thereof. The solid support or a plurality of sites on its surface may be considered patterned or ordered, for example, if it comprises one or more of the following features: i) Comprising a substantially uniform average spacing or average interval between adjacent sites (e.g., as measured from the center point of a first site to the center point of a second site; as measured from the nearest edge of the first site to the nearest edge of the second site, etc.), ii) comprises a substantially uniform average site size (e.g., as measured by site diameter, site width, site perimeter, site surface area, etc.), iii) comprises a repeating pattern of sites, or iv) comprises at least a minimum fraction of sites within a range comprising an average site size between a minimum site size and a maximum site size (e.g., at least about 0.8, 0.85, 0.9, 0.95, 0.99, 0.999, 0.9999, 0.99999, or greater than 0.99999, etc.) (e.g., comprises a 0.9 fraction of sites having a diameter ranging between 300nm and 400 nm). The patterned or ordered mesh may comprise a mesh geometry, such as a rectangular mesh, a radial mesh, or a hexagonal mesh. In some configurations, the array may comprise a plurality of sites, wherein the sites do not conform to a grid or spatial pattern. In a particular configuration, the plurality of sites may not conform to a grid or spatial pattern, but the plurality of sites may comprise an average spacing and/or average site size sufficient for single analyte detection of the moiety coupled to the sites. The patterned or ordered plurality of sites on the solid support or surface thereof may contain one or more sites or addresses of failure patterns, including intentional failure (e.g., placement of fiducial elements, placement of separation spaces between subarrays, etc.) and unintentional failure (e.g., manufacturing defects, damage, etc.).

Multiple sites may be characterized as having an average failure rate or an average failure density. The average failure rate may refer to the number of site failures/number of site units measured or expected (e.g., 1/1000, etc.). The average failure density may refer to the area density of failure (e.g., 1 per square centimeter, etc.) on the solid support or its surface. As shown in fig. 63, disruption may refer to a site 6310 having one or more of the following features: 1) misaligned with respect to the grid pattern (6321), 2) members of a subset of sites misaligned with respect to the grid pattern (6324), 3) having a pitch below a minimum pitch size (6328), 4) having a pitch above a maximum pitch size (6327), 5) having a site size below a minimum site size (e.g., width, length, diameter, area, etc.) (6326), 6) having a site size above a maximum site size (6325), 7) comprising inappropriate morphology (e.g., two-dimensional shape, three-dimensional morphology, etc.) (6322), and 8) lacking structures (6320, 6323) or chemistries that promote partial deposition.

The solid support or surface thereof may comprise at least about 10 nanometers (nm), 50nm, 100nm, 200nm, 300nm, 400nm, 500nm, 600nm, 700nm, 800nm, 900nm, 1 micrometer (μm), 1.1 μm, 1.2 μm, 1.3 μm, 1.4 μm, 1.5 μm, 1.6 μm, 1.7 μm, 1.8 μm, 1.9 μm, 2 μm, 2.1 μm, 2.2 μm, 2.3 μm, 2.4 μm, 2.5 μm, 2.6 μm, 2.7 μm, 2.8 μm, 2.9 μm, 3 μm, 3.1 μm, 3.2 μm, 3.3 μm, 3.4 μm, 3.5 μm, 3.6 μm, 3.7 μm, 3.8 μm, 3.9 μm, 4.5 μm, 5 μm, 10 μm, 20 μm, or a maximum average spacing of more than 50 μm, 50 μm. Alternatively or additionally, the solid support or surface thereof may comprise sites of no more than about 50 μm, 40 μm, 30 μm, 20 μm, 10 μm, 5 μm, 4.5 μm, 4.0 μm, 3.9 μm, 3.8 μm, 3.7 μm, 3.6 μm, 3.5 μm, 3.4 μm, 3.3 μm, 3.2 μm, 3.1 μm, 3.0 μm, 2.9 μm, 2.8 μm, 2.7 μm, 2.6 μm, 2.5 μm, 2.4 μm, 2.3 μm, 2.2 μm, 2.1 μm, 2 μm, 1.9 μm, 1.8 μm, 1.7 μm, 1.6 μm, 1.5 μm, 1.4 μm, 1.3 μm, 1.2 μm, 1.1 μm, 2 nm, 700nm, 500nm, or a maximum average of 50nm, 500nm or more. The average spacing may be determined based on the spatial resolution of the method used to form the solid support (e.g., photolithography), the desired array density, and/or the necessary spatial separation between adjacent sites to obtain a single analyte resolution of the portion bound to each site.

The solid support or surface thereof may comprise at least about 10 nanometers (nm), 50nm, 100nm, 200nm, 300nm, 400nm, 500nm, 600nm, 700nm, 800nm, 900nm, 1 micrometer (μm), 1.1 μm, 1.2 μm, 1.3 μm, 1.4 μm, 1.5 μm, 1.6 μm, 1.7 μm, 1.8 μm, 1.9 μm, 2 μm, 2.1 μm, 2.2 μm, 2.3 μm, 2.4 μm, 2.5 μm, 2.6 μm, 2.7 μm, 2.8 μm, 2.9 μm, 3 μm, 3.1 μm, 3.2 μm, 3.3 μm, 3.4 μm, 3.5 μm, 3.6 μm, 3.7 μm, 3.8 μm, 3.9 μm, 4.5 μm, 5 μm, 10 μm, 20 μm, the average size of the largest dimension (e.g., 50 μm, the average size of the largest dimension, 50 μm, etc.). Alternatively or additionally, the solid support or surface thereof may comprise a site of no more than 50 μm, 40 μm, 30 μm, 20 μm, 10 μm, 5 μm, 4.5 μm, 4.0 μm, 3.9 μm, 3.8 μm, 3.7 μm, 3.6 μm, 3.5 μm, 3.4 μm, 3.3 μm, 3.2 μm, 3.1 μm, 3.0 μm, 2.9 μm, 2.8 μm, 2.7 μm, 2.6 μm, 2.5 μm, 2.4 μm, 2.3 μm, 2.2 μm, 2.1 μm, 2 μm, 1.9 μm, 1.8 μm, 1.7 μm, 1.6 μm, 1.5 μm, 1.4 μm, 1.3 μm, 1.2 μm, 1.1 μm, 2 nm, 700nm, 500nm, or a maximum size of 50nm, 500nm, 300nm, or 50 nm. Site dimensions may be determined based on the spatial resolution of the method used to form the solid support (e.g., photolithography) and/or the size of the analyte or nucleic acid to be deposited on the site.

The binding site or region may have a length of at least about 25nm ² 、100nm ² 、500nm ² 、1000nm ² 、2000nm ² 、3000nm ² 、4000nm ² 、5000nm ² 、5500nm ² 、6000nm ² 、6500nm ² 、7000nm ² 、7500nm ² 、8000nm ² 、8500nm ² 、9000nm ² 、10000nm ² 、15000nm ² 、20000nm ² 、25000nm ² 、50000nm ² 、100000nm ² 、250000nm ² 、500000nm ² Or more than 1000000nm ² Is a surface area of the substrate. Alternatively or additionally, the binding site or region may have a length of no more than about 1000000nm ² 、500000nm ² 、250000nm ² 、100000nm ² 、50000nm ² 、25000nm ² 、20000nm ² 、15000nm ² 、10000nm ² 、9000nm ² 、8500nm ² 、8000nm ² 、7500nm ² 、7000nm ² 、6500nm ² 、6000nm ² 、5500nm ² 、5000nm ² 、4000nm ² 、3000nm ² 、2000nm ² 、1000nm ² 、500nm ² 、100nm ² 、25nm ² Or less than 25nm ² Is a surface area of the substrate.

As set forth herein, the solid support or surface thereof may comprise a plurality of sites, wherein each of the plurality of sites is configured to couple an entity (e.g., an analyte, a nucleic acid, etc.). The solid support, its surface and/or its site may have one or more moieties that promote binding interactions with an entity (such as a nucleic acid). In some configurations, the solid support, its surface, and/or its site may have two or more distinct moieties that facilitate binding interactions with an entity (such as a nucleic acid). In some configurations, a first portion of the two or more portions facilitates a first binding interaction and a second portion of the two or more portions facilitates a second binding interaction. In a particular configuration, the first binding interaction is the same type of binding interaction as the second binding interaction (e.g., both are nucleic acid base pair hybridization, both are covalent bonding, both are receptor-ligand binding, etc.). In another particular configuration, the first binding interaction is a different type of binding interaction (e.g., nucleobase pair hybridization and covalent bonding, nucleobase pair hybridization and receptor-ligand binding, etc.) than the second binding interaction. In some configurations, the solid support, its surface, and/or its site may have two or more distinct moieties, wherein a first moiety of the two or more moieties promotes a first binding interaction to a first binding complement with a first binding affinity and a second moiety of the two or more moieties promotes a second binding interaction to a second binding complement with a second binding affinity. In a particular configuration, the first binding affinity of the first moiety to the first binding complement can be stronger than the second binding affinity of the second moiety to the second binding complement. For example, the surface may comprise a mixture of oligonucleotides and streptavidin, wherein the streptavidin pair biotin Is significantly stronger than the affinity of the oligonucleotide for its complementary oligonucleotide. In other configurations, the first binding affinity of the first moiety to the first binding complement can be substantially equal to the second binding affinity of the second moiety to the second binding complement. For example, the surface may comprise a mixture of a first oligonucleotide and a second oligonucleotide, wherein the two have substantially similar affinities for their respective complementary oligonucleotides. In other configurations, the first binding affinity of the first moiety to the first binding complement can be stronger than the second binding affinity of the second moiety to the second binding complement. For example, the surface may comprise a mixture of a first oligonucleotide and a second oligonucleotide, wherein the sequences of the first oligonucleotide and the second oligonucleotide differ by a single nucleotide, and wherein the affinity of the second nucleotide for the complementary oligonucleotide of the first oligonucleotide is slightly lower due to misalignment of the single nucleotide. The binding affinity between a surface moiety and complement or ligand can be characterized by a quantitative measure, such as the dissociation constant (K) _D ) Binding rate (k) _on ) Or dissociation rate (k) _off ). The binding affinity between the surface moiety and complement or ligand can have a dissociation constant of no more than about 1 millimole, 100 micromole (μΜ), 10 μΜ, 1 μΜ, 100 nanomolar (nM), 10nM, 1nM, 100 picomolar (pM), 10pM, 1pM, 0.1pM, 0.01pM, or less than 0.01 pM. Alternatively or additionally, the binding affinity between the surface moiety and complement or ligand may have a dissociation constant of at least about 0.01pM, 0.1pM, 1pM, 10pM, 100pM, 1nM, 10nM, 100nM, 1 μm, 10 μm, 100 μm, 1mM, or greater than 1 mM. In some cases, the solid support, its surface, and/or its sites may comprise a first moiety and a second moiety, wherein the first moiety and its complement-binding first dissociation constant and the second moiety and its complement-binding second dissociation constant may differ by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 orders of magnitude. In other cases, the solid support, its surface, and/or its site may comprise a first moiety and a second moiety, wherein the first moiety and its complement-binding first dissociation constant and the second moiety and its complement-binding first dissociation constant and second moietyThe second dissociation constants may differ by no more than about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or less than 1 order of magnitude.

Fig. 60A and 60B depict the surface chemistry configuration of a solid support comprising two or more distinct moieties. Fig. 60A depicts a solid support 6000 comprising sites, wherein the sites 6001 comprise a plurality of oligonucleotides 6010 and a plurality of polymer chains 6020 (e.g., PEG chains). The plurality of oligonucleotides 6010 and the plurality of polymer chains 6020 comprise a substantially uniform spatial distribution at site 6001. Optionally, the plurality of oligonucleotides 6010 and the plurality of polymer chains 6020 may comprise a non-uniform spatial distribution at site 6001. The configuration of fig. 60A can be used to couple nucleic acid nanostructures (e.g., SNAP) while preventing non-specific binding of non-nucleic acid entities (e.g., analytes). Fig. 60B shows a solid support 6000 comprising sites, wherein the sites 6001 comprise a plurality of oligonucleotides 6010, a plurality of polymer chains 6020 (e.g., PEG chains), and additional coupling moieties 6030 (e.g., click reagents, streptavidin, etc.). In some configurations, the oligonucleotides in plurality of oligonucleotides 6010 may have significantly different binding affinities than the additional coupling moiety 6030. The configuration of fig. 60B may be used to weakly couple a nucleic acid nanostructure to site 6001, and then to more strongly couple the nucleic acid nanostructure once a more stable configuration is found on site 6001.

A solid support, surface thereof, or site thereof comprising a first plurality of first surface coupling moieties (e.g., coupling moieties, higher affinity binding moieties, etc.) and a second plurality of second surface coupling moieties (e.g., non-coupling moieties, lower affinity binding moieties, etc.) may be configured to have an advantageous molar ratio of the first plurality to the second plurality. The first plurality of first surface-coupling moieties and the second plurality of second surface-coupling moieties may have a molar ratio of at least about 1:1, 1.5:1, 2:1, 3:1, 5:1, 10:1, 20:1, 50:1, 100:1:1000:1, 10000:1, 100000:1, 1000000:1, or more than 1000000:1. Alternatively or additionally, the first plurality of first surface-coupling moieties and the second plurality of second surface-coupling moieties may have a molar ratio of no more than about 1000000:1, 100000:1, 10000:1, 1000:1, 100:1, 50:1, 20:1, 10:1, 5:1, 3:1, 2:1, 1.5:1, or less than 1.5:1.

The solid support, its surface and/or its sites may have two or more different moieties. In some configurations, a first portion of the two or more portions facilitates a first binding interaction and a second portion of the two or more portions inhibits a binding interaction. For example, the surface of the site may be functionalized with a first plurality of oligonucleotides configured to bind to complementary oligonucleotides of the nucleic acid nanostructure and a second plurality of PEG moieties configured to inhibit non-specific binding of non-nucleic acid entities to the surface of the site.

The solid support, its surface and/or its sites may be provided with surface chemistry or functionalization by suitable methods such as chemical vapor deposition or chemical liquid deposition. The surface chemical deposition process may include one or more steps of forming one or more layers on the solid support, its surface and/or its sites. For example, a method of providing a plurality of surface-tethered oligonucleotides to a surface may comprise the steps of: i) Coupling a plurality of aminated silane molecules to the surface, and ii) coupling azide-terminated PEG molecules to each silane molecule, iii) coupling Dibenzocyclooctene (DBCO) -terminated oligonucleotides to each azide group. In some configurations, impurities from surface synthesis may be expected to be present on the solid support, its surface, and/or its sites. For example, in the previous examples where a surface layer of oligonucleotides is provided, some unreacted azide may be present on the surface. In some configurations, the surface impurities may be passivated by contacting the passivating molecule with the surface impurities. The passivating molecule may form covalent bonds with surface impurities to passivate the impurities. The passivating molecule need not form covalent bonds with surface impurities to passivate the impurities (e.g., electrostatic interactions). In some configurations, surface impurities can promote binding of entities (e.g., nucleic acid nanostructures) to a solid support, its surface, and/or its sites.

Fig. 61A-61E illustrate a method of coupling nucleic acid nanostructures to a surface. Fig. 61A shows contact of a silicon-containing surface 6100 with a plurality of silylated molecules comprising PEG chains 6110 and terminal azide groups 6111. Fig. 61B shows a surface 6100 coupled by covalent bond 6112 to PEG chain 6110 with terminal azide group 6111. The surface is contacted with a plurality of poly-a oligonucleotides 6120 comprising terminal DBCO moieties configured to form covalent bonds with azide groups 6111. Fig. 61C shows a surface 6100 now comprising a PEG chain 6110 ending in a poly a oligonucleotide 6120, excluding at least one unreacted azide group 6111. The surfaces are contacted by a nucleic acid nanostructure 6130 that comprises a plurality of complementary poly-T oligonucleotides 6135 and DBCO moieties 6132. FIG. 61D shows the coupling of nucleic acid nanostructure 6130 to surface 6100, due to nucleic acid hybridization of poly A oligonucleotide 6120 to poly T oligonucleotide 6135 of nucleic acid nanostructure 6130. Fig. 61E depicts a subsequent step of reacting the DBCO moiety 6132 of the nucleic acid nanostructure 6130 with an unreacted azide group 6111 to covalently bind the nucleic acid nanostructure 6130 to the surface 6100.

The solid support, its surface, and/or its sites may be configured to form a multiplexed array of analytes. The multiplexed analyte array may comprise a plurality of sites, wherein each site of a first subset of the plurality of sites comprises an analyte in a first plurality of analytes, and wherein each site of a second subset of the plurality of sites comprises an analyte in a second plurality of analytes. The multiplexed array can comprise a first plurality of analytes and a second plurality of analytes, wherein the first plurality of analytes and the second plurality of analytes differ in at least one aspect (e.g., type, source, method of preparation, etc.). The multiplexed array can comprise a first plurality of analytes and a second plurality of analytes, wherein the first plurality of analytes and the second plurality of analytes are not different in at least one aspect (e.g., replicating or repeating a sample, etc.). In some configurations, a solid support configured to form a multiplexed array may comprise a substantially uniform surface chemistry (e.g., the composition of the solid support and/or the composition of surface-coupled moieties on the solid support or sites thereof). For example, fig. 50A-50B depict the formation of a multiplexed analyte array, wherein a first plurality of analytes 5020 and a second plurality of analytes 5025 are coupled to a nucleic acid nanostructure 5010, wherein the nucleic acid nanostructure 5010 for the first plurality of analytes 5020 comprises a first functional nucleic acid 5030 and wherein the nucleic acid nanostructure 5010 for the second plurality of analytes 5020 comprises a second functional nucleic acid 5035. In such examples, the type of analyte coupled to the nucleic acid nanostructures 5010 is configured to be identified based on the constituent functional nucleic acids, thereby facilitating the use of substantially uniform surface chemistry at each site of the array and substantially uniform structure of the capture face or capture portion of each nucleic acid nanostructure 5010.

In other configurations, the multiplexed array can comprise a plurality of sites, wherein a first subset of the plurality of sites comprises a first coupling moiety and a second subset of the plurality of sites comprises a second coupling moiety, wherein the first coupling moiety is configured to couple to a first entity (e.g., nucleic acid nanostructure, analyte, etc.), and wherein the second coupling moiety is configured to couple to a second entity. In a particular configuration, a first subset of the plurality of sites comprises a spatially contiguous or spatially continuous set of sites (e.g., a cluster of sites), and/or wherein a second subset of the plurality of sites comprises a spatially contiguous or spatially continuous set of sites. In another particular configuration, a first subset of the plurality of sites does not comprise a spatially contiguous or spatially continuous set of sites (e.g., a cluster of sites), and/or wherein a second subset of the plurality of sites does not comprise a spatially contiguous or spatially continuous set of sites.

Fig. 62A-62E depict a method of forming a site array configured for multiplexing of analytes. Fig. 62A depicts a method of printing an array to form two or more regions with different binding characteristics. In a first step, a solid support 6200 comprising an array of sites 6201 may be provided. In a second step, a barrier material 6210 (e.g., a photoresist) may be provided to portions of the solid support 6200 to separate a first subset of contiguous sites of the plurality of sites 6201 from a second subset of contiguous sites of the plurality of sites 6201. In a third step, a printing device 6220 (e.g., an ink-based printer) can deposit a first fluid medium 6221 comprising a first type of coupling moiety 6222 in contact with a first subset of the plurality of sites 6201 and can deposit a second fluid medium 6225 comprising a second type of coupling moiety 6226 in contact with a second subset of the plurality of sites 6201. Optionally, after depositing the first species of coupling moiety 6222 on a first subset of the contiguous sites of the plurality of sites 6201 and depositing the second species of coupling moiety 6226 on a second subset of the contiguous sites of the plurality of sites 6201, the barrier material 6210 can be removed or stripped from the solid support 6200. FIG. 62B depicts a method of lithographically forming an array comprising two or more regions having different binding characteristics. In a first step, a solid support material 6200 comprising a coupled surface layer 6205 (e.g., a passivation layer) and an optional barrier material 6210 (e.g., a photoresist) may be provided. In a second step, the barrier material 6210 and the coupled surface layer 6205 may be patterned to expose areas of the solid support 6200. In a third step, a printing device 6220 (e.g., an ink-based printer) can deposit a first fluid medium 6221 comprising a first type of coupling moiety 6222 in contact with a first subset of the plurality of sites 6201 and can deposit a second fluid medium 6225 comprising a second type of coupling moiety 6226 in contact with a second subset of the plurality of sites 6201. Optionally, after depositing the first species of coupling moiety 6222 on a first subset of the plurality of sites 6201 and depositing the second species of coupling moiety 6226 on a second subset of the plurality of sites 6201, the barrier material 6210 can be removed or stripped from the solid support 6200. Fig. 62C depicts a method of lithographically forming an array comprising a random distribution. In a first step, a solid support material 6200 comprising a coupled surface layer 6205 (e.g., a passivation layer) and an optional barrier material 6210 (e.g., a photoresist) may be provided. In a second step, the barrier material 6210 and the coupled surface layer 6205 may be patterned to expose areas of the solid support 6200. In a third step, a printing device 6220 (e.g., an ink-based printer) can deposit a fluid medium 6223 comprising a first type of coupling moiety 6222 and a second type of coupling moiety 6226 in contact with the plurality of sites 6201. Optionally, after depositing the first species of coupling moiety 6222 and the second species of coupling moiety 6226 on the plurality of sites 6201 in a spatially random distribution, the barrier material 6210 may be removed or stripped from the solid support 6200.

Fig. 62D-62E depict methods of forming multiplexed analyte arrays using arrays such as those depicted in fig. 62A-62C. In a first step, a solid support comprising a first subset of sites and a second subset of sites may be contacted with a first plurality of nucleic acid nanostructures 6241 and a second plurality of nucleic acid nanostructures 6242, wherein the first subset of sites comprises a first coupling moiety 6222 and the second subset of sites comprises a second coupling moiety 6226, wherein each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures 6241 is configured to couple with the first coupling moiety 6222, and wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures 6242 is configured to couple with the second coupling moiety 6226. Optionally, each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures 6241 can be coupled to an analyte of the first plurality of analytes 6251, and each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures 6242 can be coupled to an analyte of the second plurality of analytes 6252. In a second step, individual nucleic acid nanostructures of the first plurality of nucleic acid nanostructures 6241 may be deposited at the site comprising the first coupling moiety 6222, and individual nucleic acid nanostructures of the second plurality of nucleic acid nanostructures 6242 may be deposited at the site comprising the second coupling moiety 6226.

The solid support, its surface, and/or its sites may be configured to couple nucleic acid nanostructures through charge-mediated interactions. The charge-mediated interaction may be a binding interaction, wherein the charged intermediate facilitates the formation of a binding interaction of the entity (e.g., analyte, nucleic acid nanostructure, etc.) with the solid support, its surface, and/or its site. In some configurations, the charge-mediated interaction may comprise ion-mediated interactionsInteractions, wherein ionic species (e.g., cations, anions) promote coupling interactions between the entity and the solid support, its surface, or its sites. For example, cationic species (e.g., na ⁺ 、Mg ²⁺ 、Ca ²⁺ Etc.) may provide electrostatic bridging interactions that promote binding of nucleic acids to charged surfaces. In particular configurations, ion-mediated interactions can facilitate coupling interactions between a charged capture surface or capture moiety of a nucleic acid nanostructure and a charged surface (e.g., a surface functionalized with an amine or carboxylate salt, etc.), wherein the charged capture surface or capture moiety of the nucleic acid nanostructure and the charged surface comprise charges of the same polarity (e.g., both positively charged, both negatively charged). For example, magnesium ions can form bridging interactions between negatively charged nucleic acids and negatively charged surfaces. In another particular configuration, the ion-mediated interaction can facilitate a coupling interaction between a charged capture surface or capture moiety of a nucleic acid nanostructure and a charged surface (e.g., a surface functionalized with an amine or carboxylate salt, etc.), wherein the charged capture surface or capture moiety of the nucleic acid nanostructure and the charged surface comprise charges of different polarity (e.g., one positively charged, one negatively charged). For example, the concentration of cationic or anionic species may be varied to modulate the strength of interaction between a positively charged surface and negatively charged nucleic acids.

In some configurations, charge-mediated interactions may be utilized to form an array of analytes. FIG. 65 depicts a method of forming an array of analytes on an unpatterned surface comprising charged species. In a first step, a solid support 6500 comprising a plurality of surface-coupled positively charged species 6510 (e.g., aminated silane) is provided. The solid support 6500 is contacted with a plurality of negatively charged nanoparticles or microparticles 6520 (e.g., carboxylated dextran, carboxylated polystyrene, etc.). Due to electrostatic interactions, a plurality of negatively charged nanoparticles or microparticles 6520 can be coupled with a surface-coupled positively charged species 6510. In a second step, a cambium comprising a plurality of negatively charged nanoparticles or microparticles 6520 may be contacted with a plurality of nucleic acid nanostructures 6530, as set forth herein. Nucleic acid nanostructures in the plurality of nucleic acid nanostructures 6530 may be coupled to an analyte 6534. The nucleic acid nanostructure may comprise a capture surface or capture moiety (e.g., an amine) comprising a positively charged moiety configured to form an electrostatic interaction with negatively charged nanoparticles or microparticles 6520. The nucleic acid nanostructures in the plurality of nucleic acid nanostructures 6530 may further comprise a utility face or utility portion comprising a portion 6532 configured to inhibit contact between adjacent nucleic acid nanostructures 6350. In a third step, a plurality of nucleic acid nanostructures 6530 may be deposited on the array, where each nucleic acid nanostructure 6530 is spatially separated from each adjacent nucleic acid nanostructure 6530, optionally by a utility portion 6532. In an optional final step, the electrostatically coupled array of nucleic acid nanostructures 6530 and negatively charged nanoparticles or microparticles 6520 can be covalently coupled by a cross-linking agent, such as sulfo-N-hydroxysuccinimide (sulfo-NHS), to permanently limit the spatial position of each nucleic acid and/or analyte in the array.

The solid support, its surface, and/or its sites may be configured to form a weak binding interaction with an entity (e.g., analyte, nucleic acid nanostructure, non-nucleic acid, reagent). In some configurations, the solid support, its surface, and/or its sites may be configured to form a plurality of weak binding interactions with the nucleic acid nanostructures in the initial configuration, and wherein the solid support, its surface, and/or its sites are configured to facilitate rearrangement of the nucleic acid nanostructures from the initial configuration to a more stable final configuration. Without wishing to be bound by theory, the weak binding interactions may comprise coupling of a first moiety (e.g., a surface coupling moiety) with a second moiety (e.g., a capture moiety), wherein the weak binding interactions are weakly biased toward association or dissociation (e.g., equilibrium constants between about 0.01 and 100, between about 0.05 and 50, between about 0.1 and 10, between about 0.5 and 5, etc.), and/or wherein the weak binding interactions are kinetically reversible on a time scale that is shorter than the time scale of the array-based process (e.g., capable of dissociating within the time scale of the nucleic acid deposition process, capable of dissociating during the array rinsing process, etc.).

The solid support, its surface, and/or its sites may be provided with a plurality of moieties, wherein a subset of the plurality of moieties are configured to form a plurality of binding interactions with one or more surface-coupled moieties of the nucleic acid nanostructure. In some configurations, a subset of the plurality of moieties can be coupled to one or more coupling moieties of the nucleic acid nanostructure, thereby coupling the nucleic acid nanostructure to the solid support, its surface, and/or its sites. In a particular configuration, the solid support, its surface, and/or its sites may be provided with a plurality of moieties, wherein the plurality of moieties comprise an excess of the coupling moiety relative to the available amount of capture moieties of the nucleic acid nanostructure. For example, the nucleic acid nanostructure may comprise 20 overhanging surface-coupling moieties, each overhanging surface-coupling moiety comprising 10 segmented poly-T repeats of 20 nucleotides in length (e.g., 200 total capture moieties), and the sites on the solid support may comprise 1000 surface-linked poly-a oligonucleotides of 20 nucleotides in length, thus providing a 5:1 excess to the surface-linking moiety. In some configurations, the solid support, its surface, and/or its sites may comprise a plurality of moieties, wherein a subset of the plurality of moieties are not configured to be coupled to an entity. For example, the array site may comprise a first plurality of moieties comprising oligonucleotides configured to couple with complementary oligonucleotides of a nucleic acid nanostructure and a second plurality of moieties comprising polymer chains configured to inhibit non-specific binding interactions between the entity and the solid support, its surface, and/or its site.

FIGS. 60A-60D present configurations of multiple portions of an array site that promote the formation of multiple weak binding interactions. Fig. 60A and 60B contain variations of different binding and non-binding moieties, as described herein. Fig. 60C shows a solid support 6000 comprising sites 6001 comprising coupled moieties comprising a first plurality of oligonucleotides 6010 complementary to surface-coupled oligonucleotides of a nucleic acid nanostructure, a second plurality of oligonucleotides 6011 comprising a plurality of nucleotide sequences that are randomly nucleotide substituted to provide a lower binding affinity for the complementary surface-coupled oligonucleotides of the nucleic acid nanostructure, and a third plurality of non-binding moieties 6020 (e.g., polymer chains). Such a configuration may be modified to include components of, for example, receptor-ligand pairs and modified versions thereof. For example, the antibody fragment and one or more mutant forms thereof may be provided to a surface, wherein the mutant forms have a lower binding affinity for the ligand of the antibody fragment coupled to the capture side of the nucleic acid nanostructure. FIG. 60D contains modifications to the array site of FIG. 60B, wherein additional coupling moieties 6030 are effectively embedded or shielded in the other moiety, thereby inhibiting their ability to form binding interactions with complementary coupling moieties of the nucleic acid nanostructure. Such a configuration can be used to slow the rate of interaction formation of high affinity binding systems (e.g., click-type reactions, streptavidin-biotin, etc.). It may be advantageous to form a high affinity interaction between the nucleic acid nanostructures and the solid support to prevent dissociation of the nucleic acid nanostructures from the solid support, but at a sufficiently slow rate to facilitate rearrangement of the nucleic acid nanostructures to a more stable configuration on the solid support, and/or to facilitate destruction of co-localized pairs of nucleic acid nanostructures from the address of the solid support prior to permanent coupling of the co-localized pairs of nucleic acid nanostructures to the surface by high affinity binding interactions. For example, the streptavidin moiety may be embedded in multiple polymer chains (e.g., PEG, alkane, dextran, etc.), requiring transfer of the complementary biotin moiety coupled to the nucleic acid nanostructure through the multiple polymer chains (e.g., via a polymer linking moiety) to the streptavidin moiety (e.g., by a diffusion mechanism or repetition, etc.).

As set forth herein, a surface or solid support may comprise a material having desired characteristics such as hydrophobicity or hydrophilicity, amphiphilicity, low adhesion of particular chemical or biological substances, and particular chemical, optical, electrical, or mechanical properties. In some cases, the surface or solid support material may be selected for its compatibility with detection techniques or methods (e.g., confocal fluorescence microscopy). For example, the material may be selected for low autofluorescence characteristics. The surface or solid support may comprise a solid surface to which the molecule may be covalently or non-covalently attached. Non-limiting examples of solid substrates include slides, surfaces of device elements, membranes, flow cells, wells, chambers, and microfluidic or microfluidic chambers. As used herein, a surface and/or solid support may be flat or curved, or may have other shapes, and may be smooth or textured. In some cases, the solid support surface may contain micropores. In some cases, the solid support surface may contain nanopores. Such wells may be configured as sites or addresses of an array. In some cases, the solid support surface may contain one or more microwells in combination with one or more nanopores, e.g., each microwell contains an array of nanopores.

The surface or solid support may comprise a polymer, glass, semiconductor (e.g., silicon, germanium), ceramic, metal, mineral (e.g., mica), or other material. In some cases, the surface or solid support may comprise a component made of glass, such as borosilicate glass, fused silica, or quartz. In other cases, the surface or solid support may comprise an optical glass or a photochromic glass. In some cases, glasses with high sodium or potassium content may be selected as materials for fluidic device components. The surface or solid support may be made of a polymer or plastic such as polycarbonate, polyethylene, polypropylene, polyethylene terephthalate, polyvinyl chloride, polymethyl methacrylate, polydimethylsiloxane, polystyrene acrylic, latex, and the like. The surface or solid support may comprise a metal, metal alloy, metal oxide, metal nitride, or a combination thereof, such as stainless steel, gold, chromium, titanium oxide, tin oxide, zirconium oxide, or aluminum. The surface or solid support may comprise a carbohydrate, such as dextran or cellulose. In some cases, the surface or solid support may comprise two or more components having different (e.g., plastic versus glass) or differing (e.g., borosilicate versus quartz glass) material types.

As set forth herein, a surface or solid support may be characterized by a thickness or depth. The thickness of the surface or solid support may be uniform or may vary across the body of the surface or solid support. The thickness of the surface or solid support may be varied by manufacturing, shaping or machining processes. In some cases, the surface or solid support may have a thickness of at least about 1 nanometer (nm), 10nm, 100nm, 1 micrometer (μm), 10 μm, 50 μm, 100 μm, 250 μm, 500 μm, 750 μm, 1 millimeter (mm), 5mm, 1 centimeter (cm), 10cm, or more than 10 cm. Alternatively or additionally, the surface or solid support may have a thickness of no more than about 10cm, 1cm, 5mm, 1mm, 750 μm, 500 μm, 250 μm, 100 μm, 50 μm, 10 μm, 1 μm, 100nm, 10nm, 1nm, or less than 1 nm.

As set forth herein, a surface or solid support may comprise one or more surface coatings. The surface coating may be organic or inorganic. In some cases, the surface coating may be deposited by a suitable deposition process, such as atomic layer deposition, chemical vapor deposition, chemical liquid deposition, spin coating, self-assembled monolayer. In some cases, the surface coating may be patterned by a suitable patterning process, such as dry etching, wet etching, lift-off, deep ultraviolet lithography, or a combination thereof. The surface coating deposited may have a uniform thickness or a variable thickness on the surface of the solid support. In some cases, the surface coating may comprise an atomic or molecular monolayer. In some cases, the surface coating may comprise a self-assembled monolayer or submonolayer. In some cases, the surface coating may comprise a metal or metal oxide layer. In some cases, the surface coating may comprise a silane layer (e.g., ethoxy-, methoxy-or chloro-silane, silanol, siloxane, etc.), a phosphonate layer, a carboxylate layer (e.g., carboxylate transition metal oxide), a thiol layer (e.g., gold thiolate), or a phosphate layer. In some cases, the surface coating may comprise a polymer, mineral, ceramic, or ink. The surface or solid support may comprise a layer or coating comprising functional groups or moieties configured to couple with complementary functional groups or moieties on SNAP or SNAP complexes. The surface or solid support may have a gel coat.

As set forth herein, the surface or surface coating on a solid support may be characterized by a particular thickness. The surface coating may be at least about 1 angstrom1 nanometer (nm), 5nm, 10nm, 20nm, 30nm, 40nm, 50nm, 100nm, 250nm, 500nm, 1 micrometer (μm), 5 μm, 10 μm, 50 μm, 100 μm or more. Alternatively or additionally, the surface coating may be no more than about 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 500nm, 250nm, 100nm, 50nm, 40nm, 30nm, 20nm, 10nm, 5nm, 1nm>Or thinner.

As set forth herein, the surface or surface coating of a solid support may be characterized by surface roughness. The surface roughness may be due to inherent properties of the material or the processing method used to form the material or surface. The surface roughness may be calculated as the average size of roughness features (e.g., depressions, protrusions, etc.) or may be provided as a distribution of feature sizes relative to an average or usual surface height or level. The surface may have a coating or layer to alter the average surface roughness or the distribution of roughness features over the surface. For example, the surface may be coated to reduce the average surface roughness of the material. In other cases, the surface may be etched, coated, or otherwise treated to increase the surface roughness.

In some configurations, SNAP or SNAP complexes may comprise a capture surface or capture moiety configured to facilitate coupling with a surface having surface roughness. For example, SNAP may comprise a capture surface comprising a plurality of single stranded nucleic acids or other interacting groups (e.g., charged moieties, magnetic moieties, etc.) that may form an increased interaction area with the surface. Fig. 25A-25C illustrate examples of interactions with surfaces that include surface roughness. Fig. 25A depicts the contact of SNAP complex 2510 with component SNAP, which has an unmodified capture face with surface 2500 comprising surface roughness. SNAP complex 2510 can only form limited interactions with the surface where the capture surface contacts the high points of surface 2500. FIG. 25B depicts the contact of SNAP complex 2510 with a component SNAP having a capture surface modified with single stranded nucleic acids 2520 (or other interacting groups) with a surface 2500 comprising surface roughness. SNAP complex 2510 may form increased interactions with the surface where single stranded nucleic acid 2520 contacts the high points of surface 2500. Fig. 25C illustrates contacting a plurality of SNAP complexes 2510 with a nanostructured surface 2500 comprising a plurality of columnar structures 2530. SNAP complex 2510 may be configured to facilitate the presentation of analytes on top of each nanostructured feature of surface 2500. For example, the utility SNAP of SNAP complex 2510 may comprise utility portions (e.g., hydrophobic portions) on the utility face that may interact with utility portions of other SNAP complexes 2510, thereby increasing the likelihood that utility SNAP of adjacent SNAP complexes 2510 co-localize in the raised features of each SNAP complex bound to the top of columnar structures 2530 and exhibit void regions between SNAP.

A surface such as a solid support may comprise a characterized roughness. The surface roughness may be characterized by methods such as surface profilometry, contact profilometry, atomic force microscopy, optical microscopy, or any other suitable technique. The surface may comprise a characterized average roughness of at least about 0.1nm, 0.2nm, 0.3nm, 0.4nm, 0.5nm, 0.6nm, 0.7nm, 0.8nm, 0.9nm, 1nm, 2nm, 3nm, 4nm, 5nm, 6nm, 7nm, 8nm, 9nm, 10nm, 11nm, 12m, 13nm, 14nm, 15nm, 16nm, 17nm, 18nm, 19nm, 20nm, or more than 20 nm. The surface may comprise an average roughness of no more than about 20nm, 19nm, 18nm, 17nm, 16nm, 15nm, 14nm, 13nm, 12nm, 11nm, 10nm, 9nm, 8nm, 7nm, 6nm, 5nm, 4nm, 3nm, 2nm, 1nm, 0.9nm, 0.8nm, 0.7nm, 0.6nm, 0.5nm, 0.4nm, 0.3nm, 0.2nm, 0.1nm, or less than 0.1 nm.

The surface or solid support may comprise one or more surfaces coated with a metal or metal oxide layer. Depending on the preferred chemistry, the metal or metal oxide layer may comprise a specific substance. Candidate metals or metal oxidesTo contain zirconia (ZrO ₂ ) Hafnium (Hf), gold (Au), titanium dioxide (TiO) ₂ ) Aluminum (Al), aluminum oxide (Al ₂ O ₃ ) Or a combination thereof.

In some cases, the surface or solid support may be optically opaque. In some cases, all or part of the solid surface or solid support may be optically opaque at one or more wavelengths (such as infrared, visible, red, orange, yellow, green, blue, violet, or ultraviolet). In some cases, all or part of the solid surface or solid support may be optically transparent, or may be optically transparent at one or more wavelengths (such as infrared, visible, red, orange, yellow, green, blue, violet, or ultraviolet). For example, the solid surface or solid support may be optically opaque in the unfunctionalized regions and optically transparent in the functionalized regions.

Method for coupling nucleic acids to solid supports

In another aspect, provided herein is a method of coupling a nucleic acid nanostructure to an array site, the method comprising: a) contacting an array comprising sites with a nucleic acid nanostructure, wherein the sites comprise a plurality of surface-connecting moieties, and wherein the nucleic acid nanostructure comprises a plurality of capture moieties, b) coupling the nucleic acid nanostructure to the sites in an initial configuration, wherein the initial configuration does not comprise a stable configuration, and wherein the nucleic acid nanostructure is coupled by coupling capture moieties of the plurality of capture moieties to surface-connecting moieties of the plurality of surface-connecting moieties, c) uncoupling capture moieties of the plurality of capture moieties from coupling with surface-connecting moieties of the plurality of surface-connecting moieties, and d) changing the nucleic acid nanostructure from the initial configuration to the stable configuration, wherein each capture moiety of the plurality of capture moieties is coupled to a surface-connecting moiety of the plurality of surface-connecting moieties. Optionally, the nucleic acid nanostructure can be conjugated to or configured to be conjugated to a target analyte. Other optional compositions of nucleic acid nanostructures are set forth elsewhere herein.

In some configurations, decoupling the capture moiety of the nucleic acid nanostructure from the surface-attachment moiety of the array site comprises heating the solid support and/or the nucleic acid nanostructure, and/or contacting the solid support with a fluid medium configured to decouple the surface-attachment moiety from the capture moiety.

In some configurations, a method of coupling a nucleic acid nanostructure to an array site can comprise contacting an array with a fluidic medium, as set forth herein, wherein the fluidic medium comprises a nucleic acid nanostructure. Optionally, the fluidic medium may include a plurality of nucleic acid nanostructures, at least a subset of which are individually coupled to respective sites of the array. In a particular configuration, changing the nucleic acid nanostructure from the initial configuration to the stable configuration may further comprise changing a fluid medium in contact with the solid support. In some configurations, altering the fluid medium in contact with the solid support may include introducing a chemical (e.g., surfactant, denaturant, chaotrope, ionic species, acid, base, etc.). In other configurations, altering the fluid medium in contact with the solid support may include altering the concentration of a chemical species (e.g., surfactant, denaturant, chaotrope, ionic species, acid, base, etc.) in the fluid medium.

Methods of coupling nucleic acid nanostructures to array sites may utilize nucleic acid nanostructures comprising one or more capture moieties configured to form multivalent binding interactions (e.g., coupled to more than one surface-linking moiety). The capture portion of the nucleic acid nanostructure can comprise structures that promote multivalent binding interactions (e.g., polynucleotide repeats, first and second polynucleotide repeats separated by an intervening nucleotide sequence, etc.). The capture moiety may optionally comprise a structure that weakens the binding strength or binding specificity of any single binding interaction of the multivalent binding interactions. In some configurations, the nucleic acid nanostructure can comprise a capture moiety comprising a homopolymer sequence or other composition set forth elsewhere herein (e.g., in the context of a pendant oligonucleotide and a staple oligonucleotide). The nucleic acid nanostructure can be coupled to a solid support comprising a first surface-linking moiety that is complementary or reactive with the surface-coupling moiety. In some configurations, the nucleic acid nanostructure can comprise a capture moiety comprising a nucleotide sequence that comprises self-complementarity. The method of coupling a nucleic acid nanostructure to a surface may comprise one or more of the following steps: i) Disruption of the self-complementary nucleotide sequence of the capture moiety, and ii) coupling of the surface-linking moiety to the self-complementary nucleotide sequence of the capture moiety (e.g., via a cohesive end-mediated strand displacement reaction, etc.).

A method of coupling a nucleic acid nanostructure to a surface may comprise: i) Coupling the nucleic acid nanostructure to the surface in an initial configuration, and ii) changing the nucleic acid nanostructure to a final configuration, wherein the final configuration is more stable (temporal, spatial, thermodynamic, kinetic, etc.) than the initial configuration. In some cases, the initial configuration may comprise spatial positioning of the nucleic acid nanostructure at a site on the solid support, wherein the initial configuration comprises non-maximized or partial amount of coupling of the capture moiety to the surface-linking moiety. For example, if fewer than 20 capture moieties in a nucleic acid nanostructure containing 20 capture moieties are coupled to surface-linking moieties of an array site, the nucleic acid nanostructure may have a non-maximized or partial amount of coupling. In another example, a nucleic acid nanostructure containing 20 capture moieties can be expected to form a coupling interaction with at least 10 surface-linking moieties (e.g., with at least 50% of available binding groups) to achieve a maximized amount of coupling. In other cases, the initial configuration may comprise a non-maximized footprint of the nucleic acid nanostructure on the array site. For example, if only a fraction of the nucleic acid nanostructures are coupled to the surface of the array site (see fig. 58B), then the nucleic acid nanostructures do not maximize their footprint on the array site and a non-maximized amount of coupling interactions may be formed. In other cases, the initial configuration may comprise an asymmetric arrangement of nucleic acid nanostructures at the site. For example, a substantially square nucleic acid nanostructure may be initially coupled to a substantially square array site, wherein a center point of the nucleic acid nanostructure is not aligned with a center point of the array site. In some configurations, a more stable final configuration may comprise sites on the array site, wherein the nucleic acid nanostructure forms a maximized amount of coupling of the capture moiety to the surface-linking moiety. In other configurations, a more stable final configuration may comprise a maximized footprint of the nucleic acid nanostructure at the site. In other configurations, the more stable final configuration may comprise a symmetrical arrangement of nucleic acid nanostructures at the site.

The nucleic acid nanostructures may be coupled to the array site by coupling one or more capture moieties of the nucleic acid nanostructures to a plurality of surface-attachment moieties of the array site. The array sites may have an excess of surface-attached moieties, wherein the excess is determined with respect to the amount of available binding groups on the one or more capture moieties and/or with respect to the spatial density of available binding groups on the one or more capture moieties. For example, the nucleic acid nanostructure may comprise 20 capture moieties comprising a poly-T sequence, wherein each capture moiety is configured to form about 10 binding interactions with a surface-linked poly-a oligonucleotide. In this case, array sites containing more than 200 surface-attached poly-A oligonucleotides can be considered to contain an excess of surface-attached moieties. In another example, the nucleic acid nanostructure can comprise a plurality of capture moieties having an average surface density of about 1 capture moiety per 10 square nanometers. In this case, an array site containing surface connecting portions with a surface density exceeding 1 surface connecting portion per 10 square nanometers may contain an excessive amount of surface connecting portions. Based on absolute or spatial density, the array site may contain at least about 1.1-fold, 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1000-fold, 5000-fold, 10000-fold, 100000-fold, 1000000-fold, or more than 1000000-fold molar excess of surface-linking moieties relative to the amount of available capture moieties of the nucleic acid nanostructure. Alternatively or additionally, the array site may contain no more than about 1000000-fold, 100000-fold, 10000-fold, 5000-fold, 1000-fold, 500-fold, 250-fold, 100-fold, 50-fold, 25-fold, 10-fold, 5-fold, 4-fold, 3-fold, 2-fold, 1.5-fold, 1.2-fold, 1.1-fold, or less than 1.1-fold molar excess of surface-linking moieties relative to the amount of available capture moieties of the nucleic acid nanostructure based on absolute or spatial density. In other configurations, the array site may comprise an insufficient molar surface-attachment moiety relative to the number of available capture moieties of the nucleic acid nanostructure.

Provided herein is a method of forming an array, the method comprising providing a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes as set forth herein, coupling each nucleic acid nanostructure or nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure or nucleic acid nanostructure complexes with one or more additional nucleic acid nanostructures or nucleic acid nanostructure complexes from the plurality of nucleic acid nanostructure or nucleic acid nanostructure complexes, and coupling each nucleic acid nanostructure or nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure or nucleic acid nanostructure complexes with a surface, wherein each nucleic acid nanostructure or nucleic acid nanostructure complex comprises a display nucleic acid nanostructure and one or more capture nucleic acid nanostructures or utility nucleic acid nanostructures, and wherein each nucleic acid nanostructure complex comprises a coupling moiety coupled with the surface, thereby forming an array.

In some configurations, each nucleic acid nanostructure complex is assembled prior to contact with another nucleic acid nanostructure complex to which it is to be coupled. In other configurations, the individual nucleic acid nanostructures are contacted with one another to cause conjugation of the nucleic acid nanostructure complex to other nucleic acid nanostructure complexes. Thus, a method of forming an array may comprise providing a plurality of nucleic acid nanostructures to produce a plurality of nucleic acid nanostructure complexes, each nucleic acid nanostructure complex comprising at least two nucleic acid nanostructure complexes coupled together, and coupling the plurality of nucleic acid nanostructure complexes to a surface, wherein each nucleic acid nanostructure complex comprises a display nucleic acid nanostructure and one or more utility nucleic acid nanostructures, and wherein each nucleic acid nanostructure complex comprises a coupling moiety coupled to the surface, thereby forming an array.

The displayed nucleic acid nanostructures may be coupled to the analyte either before or after incorporation into the array. In some configurations, the method may further comprise the step of coupling the analyte to the display moiety. In some configurations, the analyte may be coupled to the display moiety after coupling each nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure complexes to the surface. In some configurations, the analyte may be coupled to the display moiety prior to coupling each nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure complexes to the surface. In some configurations, the analyte may be coupled to the display portion after coupling each nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure complexes to one or more additional nucleic acid nanostructure complexes from the plurality of nucleic acid nanostructure complexes. In some configurations, the analyte may be coupled to the display moiety prior to coupling each nucleic acid nanostructure complex of the plurality of nucleic acid nanostructure complexes to one or more additional nucleic acid nanostructure complexes from the plurality of nucleic acid nanostructure complexes. In some configurations, the analyte may be coupled to the display moiety after providing the plurality of nucleic acid nanostructure complexes. In some configurations, the analyte may be coupled to the display moiety prior to providing the plurality of nucleic acid nanostructure complexes.

An array comprising nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed under specific formation conditions, as set forth herein. The conditions may include specific solvents or buffer conditions. In some configurations, a plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may be provided in a pH buffer comprising a magnesium salt. In some configurations, the coupling of the plurality of nucleic acid nanostructures or nucleic acid nanostructure complexes may occur in the presence of a surfactant. An array can be formed having displayed nucleic acid nanostructures that can be coupled to an analyte either before or after the array is formed. In some configurations, the analyte may be covalently coupled to the display moiety.

An array comprising nucleic acid nanostructures or nucleic acid nanostructure complexes may be formed at a particular temperature configuration. For example, a first SNAP or SNAP complex may be combined with a second SNAP or SNAP complex at a first temperature, and then the temperature may be changed (e.g., lowered, raised) to couple the first SNAP or SNAP complex with the second SNAP or SNAP complex to form an array. The steps in the array formation process may occur at the following temperatures: at least about 0 ℃, 10 ℃, 25 ℃, 50 ℃, 75 ℃, 90 ℃, 95 ℃, or more than 95 ℃. Alternatively or additionally, steps in the array formation process may occur at the following temperatures: no more than about 95 ℃, 90 ℃, 75 ℃, 50 ℃, 25 ℃, 10 ℃, 0 ℃ or less than 0 ℃. In some configurations, temperature may be used to increase the specificity of deposition of nucleic acid nanostructures on a surface. For example, it may be advantageous to contact a nucleic acid nanostructure comprising a plurality of surface-interacting oligonucleotides with a coupling surface comprising a plurality of surface-attached complementary oligonucleotides at a higher temperature, and then to reduce the temperature when the nucleic acid nanostructure has sufficient time to attain the most stable configuration on the coupling surface. Surprisingly, an increase in the temperature at which the nucleic acid nanostructures or nucleic acid nanostructure complexes are deposited may increase the likelihood that only one nucleic acid nanostructure is deposited on the coupling surface, since the energy available for the nucleic acid nanostructure to find the maximum number of surface-interacting moieties on the coupling surface may form the site of the binding interaction and the likelihood that the optimal deposition site of the nucleic acid nanostructure on the coupling surface will prevent the stable co-deposition of other nucleic acid nanostructures on the same coupling surface increases.

As set forth herein, a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) or an analyte-coupled form thereof may be deposited on a surface or solid support. The methods and compositions set forth below will generally be exemplified with reference to SNAP or SNAP complexes; however, it should be understood that the examples can be extended to any nucleic acid, as set forth herein, including populations with the same species of SNAP or SNAP complex, populations with different species of SNAP or SNAP complex, populations with the same species of analyte coupled SNAP or SNAP complex, or populations with different species of analyte coupled SNAP or SNAP complex.

In one aspect, provided herein is a method comprising: a) Contacting a nucleic acid as set forth herein with a solid support as set forth herein; and b) coupling the nucleic acid to the solid support. In some cases, the method may comprise the steps of: a) providing a solid support as set forth herein, wherein the solid support comprises sites and interstitial regions, wherein the sites are configured to couple to nucleic acids as set forth herein, and wherein the interstitial regions are configured to inhibit binding of nucleic acids, b) contacting the solid support with the nucleic acids, and c) coupling the nucleic acids to the sites of the solid support. In some cases, the method may comprise the steps of: a) providing a solid support as set forth herein, wherein the solid support comprises a plurality of sites and one or more interstitial regions, wherein a site of the plurality of sites is configured to couple to a nucleic acid as set forth herein, and wherein the interstitial regions are configured to inhibit binding of a nucleic acid, b) contacting the solid support with a plurality of nucleic acids, wherein the plurality of nucleic acids comprises the nucleic acid, and c) coupling a nucleic acid of the plurality of nucleic acids to a site of the plurality of sites.

The analyte may be coupled to the SNAP or SNAP complex before, during or after deposition of the SNAP or SNAP complex on the surface or solid support. Deposition of SNAP or SNAP complexes on a surface or solid support may be driven by physical phenomena such as gravity, centrifugal force, electrostatic interactions, magnetic interactions, covalent or non-covalent binding. In some cases, deposition of SNAP or SNAP complexes may be due to electrostatic interactions between negatively charged SNAP or SNAP complexes and positively charged substrates (or other materials), and vice versa. In other cases, deposition of SNAP or SNAP complexes may be due to coupling interactions between multiple surface-interacting moieties on SNAP and multiple surface-linking moieties on the coupling surface.

SNAP, SNAP complex, or analyte coupled form thereof may be purified prior to coupling the SNAP, SNAP complex, or analyte coupled form thereof to the solid support. In some cases, purification can include removal of excess or unwanted reagents (e.g., salts, unbound oligonucleotides, unbound analytes, etc.). In some cases, the purification process may include removing SNAP or SNAP complexes that do not include the coupled analyte. In some cases, the purification process may include removing SNAP or SNAP complexes comprising more than one coupled analyte. In some cases, the purification process may include removing analytes coupled to more than one SNAP or SNAP complex. SNAP, SNAP complex, or analyte coupled form thereof may be purified by suitable purification methods such as size exclusion chromatography, high pressure liquid chromatography, ultrafiltration, tangential flow filtration, reverse osmosis, affinity chromatography, or combinations thereof. The various analytes or SNAP analyte complexes may be characterized based on statistical or random measures of purity. In some cases, if the purity measurement deviates from the expected purity measurement of a statistical or random distribution (e.g., poisson distribution, normal distribution, binomial distribution, etc.), multiple analytes may be provided for the preparation of an array of analytes, where the statistical or random distribution is calculated for the case of a single analyte coupled to a single nucleic acid. For example, if the purified fraction contains less than 36.8% nucleic acid nanostructures that are not coupled to the analyte (e.g., a lower rate than predicted by poisson distribution), then multiple analytes coupled to multiple nucleic acid nanostructures may be used in the methods as set forth herein. The purified plurality of analytes can be characterized with respect to a fraction of unoccupied nucleic acids, a fraction of nucleic acids having more than one analyte, a fraction of analytes coupled to more than one nucleic acid, or a combination thereof.

SNAP, SNAP complex, or analyte coupled forms thereof may be deposited on a surface or solid support to form a patterned, ordered, or disordered array of SNAP, SNAP complex, or analyte coupled forms thereof. In some cases, the surface or solid support may be structured, engineered, or fabricated to control where deposition of SNAP or SNAP complexes may occur. The surface or solid support may contain localized or uniform regions of positive or negative surface charge density that promote electrostatic interactions with SNAP or SNAP complexes. The surface or solid support may be deposited with a coating, layer or functional group that alters the surface charge density of the surface or material to promote electrostatic interactions with the anchoring groups of the protein conjugate. The surface or solid support may be functionalized with a chemical that allows direct covalent attachment of SNAP or SNAP complexes to the surface or material. Exemplary surfaces and solid supports that may be particularly useful are set forth elsewhere herein.

Deposition of SNAP, SNAP complexes, or analyte coupled versions thereof, as set forth herein, on a surface or solid support material may be controlled to ensure adequate separation between adjacent SNAP or SNAP complexes. For analyte determination, the SNAP, SNAP complex, or analyte coupled form thereof may be deposited with sufficient separation to ensure that each SNAP, SNAP complex, or analyte coupled form thereof is located at a unique, optically observable address or location on a surface or solid support. The separation between adjacent SNAP, SNAP complexes or analyte coupled forms thereof may be made of a surface or solid support material; SNAP, SNAP complex or analyte coupled form thereof or by a combination thereof. For example, features may be present on a surface, and each feature may have a size or chemical functionalization that accommodates only a single SNAP or SNAP complex. Alternatively or additionally, the functional group may be present on the SNAP or SNAP complex in an orientation that limits the arrangement of the SNAP or SNAP complex on the surface that is reactive with the functional group. The surface or solid support material may be modified to mediate deposition of SNAP, SNAP complex or analyte coupled forms thereof at the binding site. The surface between binding sites or regions of the solid support may be modified to prevent or inhibit deposition of SNAP, SNAP complexes or analyte coupled forms thereof. Deposition of SNAP, SNAP complexes, or analyte-coupled forms thereof may be prevented by surface groups or materials that sterically hinder deposition of protein conjugates on the surface, such as tethered dextran, tethered polyethylene glycol (PEG) macromolecules, or sheared salmon sperm DNA. Deposition of SNAP, SNAP complex or analyte coupled form thereof onto specific areas on the surface (such as interstitial areas intended to separate the addresses where SNAP will reside) may be prevented by electrostatic or magnetic repulsion of the surface groups of SNAP, SNAP complex or analyte coupled form thereof. For example, negatively charged SNAP or SNAP complexes may repel areas of the substrate surface that have been functionalized with negatively charged groups such as carboxylic acids, organophosphates, organosulfates, or combinations thereof. In some cases, solvent configuration may be utilized to promote and/or inhibit SNAP deposition at a surface or region of a solid support. For example, salts, surfactants or emulsions may be used in areas of more or less favorable binding conditions.

Covalent bonds may be formed between SNAP, SNAP complexes, or analyte-coupled forms thereof, as set forth herein, and a surface or solid support. Covalent bonds may be formed directly between SNAP, SNAP complexes or analyte coupled forms thereof and a surface or solid support. Covalent bonds may be formed between the functionality on SNAP, SNAP complex or analyte coupled form thereof and the surface or solid support. For example, SNAP complexes or analyte coupled forms thereof functionalized with organosilane groups may be bound to a silicon surface or a solid support via a coordination bond. Covalent bonds may be formed between the functional groups on SNAP, SNAP complexes or analyte coupled versions thereof and the functional groups on the surface or solid support. For example, SNAP complexes or analyte coupled forms thereof containing activated ester functionality can be bound to a surface or solid support containing aminated functionality (e.g., 3-amino-propyltriethoxysilane, silanol, etc.). In some cases, SNAP complexes, or analyte-coupled forms thereof may be coupled to a solid support or surface through covalent bonds formed by click reactions.

SNAP or SNAP complexes as set forth herein may be deposited on a material, surface, or solid support comprising an ordered or unordered surface. The ordered surface may comprise a surface patterned with a plurality of binding sites or regions separated by gap regions, wherein each binding site may be configured to bind SNAP complexes, and wherein the gap regions may be configured to not bind SNAP complexes. In some configurations, the surface or solid support may comprise a patterned array. Ordered surfaces may promote deposition of SNAP or SNAP complexes by limiting the areas in which SNAP or SNAP complexes may be deposited or by providing ordered features that promote deposition of SNAP or SNAP complexes. In other configurations, a disordered surface may comprise a surface without patterned or structured features. For example, the surface may comprise a uniform coating or layer configured to couple functional groups or moieties of SNAP or SNAP complexes. In some configurations, the disordered surface may comprise a phase boundary between two fluids, such as a gas/liquid interface or a liquid/liquid interface. In other configurations, the disordered surface may comprise a movable layer (e.g., lipid monolayer or bilayer, tethered or adhered micelle or colloid layer, etc.). SNAP or SNAP complexes may be configured to self-assemble or self-pattern on disordered surfaces. For example, a SNAP or SNAP complex may contain utility moieties on one or more faces that spatially block access to other SNAP or SNAP complexes, thereby limiting the ability of two SNAP to co-localize within a spatially blocked or obstructed area.

The material may comprise a surface or solid support that is patterned or structured with binding sites or regions and interstitial regions to form a patterned SNAP or SNAP complex array. In some configurations, a single binding site may also comprise a structure that facilitates deposition of SNAP or SNAP complexes at the binding site or region and/or that limits or prevents co-deposition of multiple SNAP or SNAP complexes at the binding site or region. Surface features that may be altered to promote deposition of SNAP or SNAP complexes may include binding site or region size, binding site or region morphology, and binding site or region chemistry. In some configurations, the solid support, its surface, and/or its sites may comprise two-dimensional and/or three-dimensional features that facilitate the binding of SNAP or SNAP complexes to the surface. In particular configurations, the two-dimensional and/or three-dimensional features may comprise a shape or morphology that substantially matches the shape or morphology of SNAP and/or SNAP composites. If the shape or morphology of the solid support, its surface and/or its sites has a surface area substantially similar to the effective surface area or footprint of the SNAP, SNAP complex or its face, the shape or morphology of the solid support, its surface and/or its sites may match the shape or morphology of the SNAP. If the shape or morphology of the solid support, its surface and/or its sites has a surface profile that is substantially aligned with the profile of the SNAP, SNAP complex or its face, the shape or morphology of the solid support, its surface and/or its sites may match the shape or morphology of the SNAP. For example, triangle SNAP may be deposited on triangle sites. In another example, the sites may comprise pyramid-shaped three-dimensional raised structures coupled to pyramid-shaped void spaces of SNAP structures. In other particular configurations, the two-dimensional and/or three-dimensional features may comprise shapes or morphologies that do not substantially match the shape or morphology of the SNAP and/or SNAP composite.

In some configurations, the SNAP or SNAP complex may have a shape or conformation that limits deposition of the SNAP or SNAP complex at the binding site or region. Fig. 26A depicts a binding site 2600 comprising 2 electrostatically bound cross-shaped SNAP complexes 2610. Although the two SNAP complexes 2610 each occupy less than 25% of the surface area of the binding site 2600, the cross-shaped conformation limits the ability of more than two SNAP complexes to deposit with sufficient surface contact to form a stable electrostatic binding interaction. Fig. 26B depicts a binding site 2600 comprising 2 electrostatically bound star SNAP complexes 2620. Although the combined footprint of the 2 SNAP complexes 2620 is less than the total footprint of the binding site 2600, the conformation of the first complex prevents the second complex from fully occupying the binding site, thereby increasing the likelihood that the second complex may dissociate from the binding site 2600. Thus, a first SNAP complex 2610 occupying binding site 2600 will sterically hinder a second SNAP complex 2610 from jointly occupying binding site 2600. In some configurations, the conformation of a first SNAP or SNAP complex coupled to a binding site or region may prevent coupling of a second SNAP or SNAP complex to the binding site. FIG. 26C depicts a binding site 2600 comprising SNAP complex 2630 comprising 21 tile-shaped SNAPs that fully occupy the binding site such that no other SNAP complexes can be deposited on binding site 2600.

The binding sites or regions may also be configured to promote SNAP or SNAP complex deposition due to the morphology of the binding sites or regions. The binding sites or regions may comprise raised pedestals, wells or depressions. Surface discontinuities (e.g., edges or boundaries) forming pedestals or holes may limit deposition of SNAP due to energy effects. Without wishing to be bound by theory, if a portion of the SNAP or SNAP complex may not be in complete contact with the binding surface, the SNAP or SNAP complex may be less likely to deposit near the edge or discontinuity. Decreasing the size of the binding site or region may also increase the likelihood that only a single SNAP or SNAP complex may advantageously bind to the binding site or region. The binding sites or regions may also comprise small scale features that facilitate deposition of SNAP or SNAP complexes within the binding sites or regions. Fig. 28A-28B depict raised surface features 2800 that match the conformation of capture face 2820 on SNAP complex 2810. Such features may be created by etching or deposition techniques to form more specific features to bind SNAP or SNAP complexes at the binding sites. Multiple types of patterned surface features may be utilized to separate different SNAP or SNAP complex types on a surface. Fig. 27A depicts a surface 2700 comprising 6 binding sites 2710. Two binding sites were patterned with triangular surface features 2715 and 4 binding sites were patterned with square surface features 2718. As shown in fig. 27B, triangular SNAP complex 2725 preferentially binds to triangular surface features 2715 and square SNAP complex 2728 preferentially binds to square surface features 2718 after the surface has been contacted with a mixture of triangular and square SNAP complexes.

The surface chemistry of the binding site or binding region may also be configured to promote SNAP or SNAP complex deposition. The binding site or binding region may include a localized region configured to couple a functional group or moiety of a SNAP or SNAP complex (e.g., click-reactive group, oligonucleotide, etc.). The binding site or region may also comprise a region of blocking or inactivating groups that block specific or non-specific binding of SNAP or SNAP complexes to specific portions (e.g., edges, boundaries) of the binding site or region. Local surface chemistry can be generated by any suitable technique, including deposition and lift-off techniques. Further surface chemistry methods are discussed in PCT/US2020/058416, which is incorporated herein by reference in its entirety. In some cases, the distribution or density of two or more species of functional groups or moieties (e.g., surface-linking moieties) may be controlled by depositing a mixture of two or more species at a relative concentration that produces a desired surface distribution or surface density for each respective species. For example, a coupled surface comprising two surface-attached oligonucleotides in a molar ratio of 1:100 may be formed by co-depositing the oligonucleotides from a fluid medium comprising the two oligonucleotides in a molar ratio of about 1:100. In some cases, the relative ratios of species may be adjusted due to kinetic differences in deposition.

Multiple SNAP, SNAP complexes, or analyte coupled forms thereof may be deposited on a surface or solid support at known or characterized efficiencies. In some cases where the available number of binding sites on a surface or substrate exceeds the population size of a plurality of SNAP, SNAP complexes or analyte coupled forms thereof, the deposition efficiency may be measured based on the fraction of the plurality of SNAP, SNAP complexes or analyte coupled forms thereof deposited on the surface or solid support. In some cases where the number of SNAP, SNAP complexes, or analyte coupled forms thereof exceeds the number of available binding sites on a surface or solid support, the efficiency of deposition may be measured based on the fraction of available binding sites occupied on the surface or solid support after deposition.

Based on the percentage or fraction of the plurality of SNAP, SNAP complex or analyte coupled form thereof deposited on the surface or solid support, the binding efficiency of the plurality of SNAP, SNAP complex or analyte coupled form thereof to the surface or solid support can be quantified. The binding efficiency of a plurality of SNAP, SNAP complexes, or analyte-coupled forms thereof may be at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, 99.999%, 99.9999%, 99.99999%, 99.999999%, or more than 99.999999% based on the available amount of SNAP, SNAP complexes, or analyte-coupled forms thereof in the plurality. Alternatively or additionally, the binding efficiency of a plurality of SNAP, SNAP complexes, or analyte-coupled forms thereof may be no more than about 99.999999%, 99.99999%, 99.9999%, 99.999%, 99.99%, 99.9%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or less than about 1% based on the available amount of SNAP, SNAP complexes, or analyte-coupled forms thereof in the plurality.

The binding efficiency of a plurality of SNAP, SNAP complexes or analyte coupled forms thereof to a surface or solid support can be quantified based on the percentage or fraction of available binding sites on the surface or solid support occupied by SNAP, SNAP complexes or analyte coupled forms thereof. The occupancy rate of surface or solid support binding sites may be at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, 99.999%, 99.9999%, 99.99999%, 99.999999% or more than 99.999999% based on the total number of available binding sites. Alternatively or additionally, the occupancy rate of surface or solid support binding sites may be no more than about 99.999999%, 99.99999%, 99.9999%, 99.999%, 99.99%, 99.9%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1% or less than 1% based on the total number of available binding sites.

In a particular configuration, more than one SNAP, SNAP complex, or analyte-coupled form thereof as set forth herein may be deposited onto a surface or solid support at a unique location, address, or binding site on the surface or solid support. In some cases, the number of binding sites having more than one SNAP, SNAP complex, or analyte coupled form thereof may be minimized to accommodate single molecule detection during analyte determination. In other cases, such as during a bulk analyte assay, more than one SNAP, SNAP complex, or analyte-coupled form thereof may be deposited at multiple, most, or all available binding sites. A surface or solid support comprising a plurality of deposited SNAP, SNAP complexes, or analyte coupled forms thereof may be characterized or quantified to determine the number of binding sites having more than one SNAP, SNAP complex, or analyte coupled form thereof. The surface or solid support binding site may contain more than one SNAP, SNAP complex or analyte-coupled form thereof, e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more SNAP, SNAP complex or analyte-coupled form thereof. Binding sites with more than one deposited SNAP, SNAP complex or analyte coupled form thereof may be present according to some quantifiable distribution, such as poisson distribution, binomial distribution, beta binomial distribution, super-geometric distribution or bimodal distribution.

The percentage of binding sites on a surface or solid support that have more than one SNAP, SNAP complex, or analyte-coupled form thereof can be quantified based on the observed number of molecules detected at each unique location on the surface or solid support. The number of excess molecules at unique locations on a surface or solid support can be quantified by detecting excess fluorescence, luminescence, flashing, or size (e.g., as characterized by atomic force microscopy). The percentage of binding sites on a surface or solid support having more than one SNAP, SNAP complex, or analyte-coupled form thereof may be no more than about 50%, 40%, 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, 0.0001%, 0.00001%, 0.000001%, 0.0000001%, or less than about 0.0000001% of all available binding sites. Alternatively or additionally, the percentage of binding sites on a surface or solid support having more than one SNAP, SNAP complex, or analyte-coupled form thereof may be at least about 0.0000001%, 0.000001%, 0.00001%, 0.0001%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, or more than about 50% of all available binding sites. In some cases, there may not be observed more than one deposited SNAP, SNAP complex, or analyte-coupled form of binding site on a surface or solid support.

The SNAP, SNAP complex or analyte coupled form thereof may be deposited on a surface or solid support under conditions that promote deposition of the SNAP, SNAP complex or analyte coupled form thereof at a binding site on the surface or solid support. Deposition may occur under externally applied physical phenomena such as electric fields, magnetic fields, heating, cooling, or combinations thereof. In some cases, the SNAP, SNAP complex, or analyte coupled form thereof may be deposited on a surface or solid support under conditions that promote deposition of the SNAP, SNAP complex, or analyte coupled form thereof. The solvent used for deposition may vary depending on chemical composition, ionic strength, pH, electrical conductivity, magnetic permeability, thermal capacity, thermal conductivity, reactivity, density, viscosity, polarity, and combinations thereof. The chemical composition of the solvent used to deposit SNAP, SNAP complex, or analyte coupled forms thereof may vary depending on the type and amount of solvent, the type and amount of salt, the type and amount of metal, the type and amount of surfactant, the pH of the ingredients, pKa of the ingredients, and ingredient reactivity. In some cases, a solvent for depositing SNAP, SNAP complex, or analyte-coupled form thereof may be composed to enhance interaction between SNAP, SNAP complex, or analyte-coupled form thereof, and a surface or solid support, such as electrostatic binding of SNAP, SNAP complex, or analyte-coupled form thereof. Without wishing to be bound by theory, the deposition solvent of SNAP, SNAP complex, or analyte coupled form thereof may minimize the free energy of deposition of SNAP, SNAP complex, or analyte coupled form thereof. The deposition solvent may comprise a dispersant, such as a surfactant or detergent, that reduces or prevents aggregation of SNAP, SNAP complexes or analyte-coupled forms thereof prior to deposition. In some cases, SNAP or SNAP complex storage or preparation solvent compositions may be used as the deposition solvent. The deposition solvent may be configured to increase the likelihood of deposition of SNAP and/or SNAP complexes at preferred locations on a surface or solid support. The deposition solvent may be configured to reduce the likelihood of deposition of SNAP and/or SNAP complexes at non-preferred locations on the surface or solid support.

Methods of depositing nucleic acids on a solid support as set forth herein may be facilitated by adjusting the strength of the binding interaction between the nucleic acid and the solid support. For example, the nucleic acid may be deposited on the solid support in an initial configuration and then rearranged into a more stable final configuration by disrupting one or more existing binding interactions between the nucleic acid and the solid support at a first address of the solid support and by forming one or more new binding interactions between the nucleic acid and the solid support at a second address of the solid support. In another example, a nucleic acid configured to form covalent interactions and non-covalent interactions with a solid support may first be deposited on the solid support in a fluid medium that inhibits covalent interactions and promotes non-covalent interactions. The solid support and/or nucleic acid may then be contacted with a second fluid medium that facilitates covalent interactions.

The method of depositing nucleic acid may comprise modulating the strength of the binding interaction between the nucleic acid and the solid support by altering the fluid medium in contact with the nucleic acid and/or the solid support. The fluidic medium as set forth herein may be altered by changing fluidic parameters, which may include any conceivable parameters such as chemical composition (e.g., solvent type, presence and concentration of substances such as chaotropes or surfactants, etc.), polarity, density, viscosity, boiling point, freezing point, pH, ionic strength, osmotic pressure, and flow rate. Modulating the strength of the binding interaction may include one or more of the following steps: a) depositing nucleic acids as set forth herein on a solid support as set forth herein in a first fluid medium comprising a first fluid parameter as set forth herein, b) optionally incubating the nucleic acids and/or solid supports in the first fluid medium, c) contacting the nucleic acids and/or solid supports with a second fluid medium comprising a second fluid parameter, wherein the first fluid parameter and the second fluid parameter are different, d) optionally incubating the nucleic acids and/or solid supports in the second fluid medium, and e) optionally displacing the second fluid medium from the solid support and/or nucleic acids. In some configurations, the solid support may be contacted with the second fluid medium prior to depositing the nucleic acid in the first fluid medium. For example, the solid support may be incubated in a second fluid medium that activates the surface of the solid support to form a binding interaction, and then subsequently contacted with a first fluid medium comprising nucleic acid, thereby forming a binding interaction between the nucleic acid and the surface. In some configurations, displacing the second fluid medium from the solid support may include displacing the second fluid medium including the second fluid parameter with the first fluid medium including the first fluid parameter. For example, the solid support may be incubated in a second fluid medium that activates the surface of the solid support to form a binding interaction, and then subsequently contacted with a first fluid medium comprising nucleic acid, thereby forming a binding interaction between the nucleic acid and the surface. In another example, a solid support comprising deposited nucleic acid may be contacted with a second fluid medium to decrease the strength of the binding interaction between the nucleic acid and the solid support, and then the second fluid medium may be displaced by the first fluid medium to increase the strength of the binding interaction between the nucleic acid and the solid support. In some configurations, displacing the second fluid medium from the solid support may include displacing the second fluid medium including the second fluid parameter with a third fluid medium including the third fluid parameter. For example, the second fluidic medium may be replaced with a rinse buffer configured to remove any unbound entities (e.g., nucleic acids, analytes, affinity reagents, etc.) from the solid support or surface thereof. In another example, the second fluid medium may be replaced with a medium comprising a cross-linking agent configured to couple the nucleic acid to the solid support or a surface thereof.

In some configurations, the method of adjusting the strength of the binding interaction may include displacing the first fluid medium by stepwise changing to the second fluid medium. For example, a first fluid medium may be withdrawn from contact with the solid support and then a second fluid medium may be contacted with the solid support. In other configurations, the method of modulating the strength of the binding interaction may include displacing the first fluid medium by a gradient change to the second fluid medium. For example, the ionic strength of a solution in contact with a solid support may be changed from a first ionic strength to a second ionic strength by flowing a fluid medium through the solid support, wherein the fluid medium undergoes a linear or non-linear concentration gradient from the first ionic strength to the second ionic strength. In some configurations, the method of modulating the strength of the binding interaction may include altering an environmental characteristic of the fluid medium, the solid support, and/or the nucleic acid, such as temperature, shear force, an electric field, or a magnetic field. For example, the solid support or a fluid medium in contact therewith can be heated to attenuate non-covalent binding interactions (e.g., nucleic acid base pair hybridization) between the nucleic acid and the solid support.

The method as set forth herein may include forming a multiplexing array. The multiplexed array may include a first plurality of analytes and a second plurality of analytes, wherein the first plurality of analytes differs from the second plurality of analytes in one or more respects (e.g., sample type, sample source, analyte type, etc.). In some cases, the multiplexed analyte array may comprise a random ordered array comprising: a) A plurality of sites, wherein each site comprises a fixed address, and b) a first plurality of analytes and a second plurality of analytes, wherein each site of the plurality of sites comprises one and only one analyte of the first plurality of analytes or the second plurality of analytes, and wherein the spatial distribution of sites comprising one analyte of the first plurality of analytes has a random spatial order. In some cases, a random ordered array may be formed by: a) Depositing a first plurality of analytes on a solid support as set forth herein, and b) depositing a second plurality of analytes on the solid support after depositing the first plurality of analytes on the solid support. In other cases, a random ordered array may be formed by: a) Combining the first plurality of analytes with the second plurality of analytes, and b) depositing the combined first plurality of analytes and second plurality of analytes on a solid support as set forth herein. The first plurality of analytes may be distinguished from the second plurality of analytes by one or more features, such as different nucleic acid nanostructures, different detectable labels, different functional nucleic acids, or combinations thereof. In other cases, the multiplexing array may comprise an ordered array comprising: a) A plurality of sites, wherein each site comprises a fixed address, and b) a first plurality of analytes and a second plurality of analytes, wherein each site of the plurality of sites comprises one and only one analyte of the first plurality of analytes or the second plurality of analytes, and wherein the spatial distribution of sites comprising one analyte of the first plurality of analytes has a non-random spatial order. For example, an array can be prepared having a first continuous plurality of sites and a second continuous plurality of sites, wherein each of the first continuous plurality of sites is coupled to one of the first plurality of analytes, and wherein each of the second continuous plurality of sites is coupled to one of the second plurality of analytes. In some cases, the ordered array may be formed by: a) Depositing a first plurality of analytes on a solid support as set forth herein, and b) depositing a second plurality of analytes on the solid support after depositing the first plurality of analytes on the solid support. For example, by a printing method, a first plurality of analytes may be deposited on a first continuous area of the array and a second plurality of analytes may be deposited on a second continuous area of the array. In other cases, the ordered array may be formed by: a) Combining the first plurality of analytes with the second plurality of analytes, and b) depositing the combined first plurality of analytes and second plurality of analytes on a solid support as set forth herein. For example, a first plurality of analytes comprising a first plurality of nucleic acid nanostructures and a second plurality of analytes comprising a second plurality of nucleic acid nanostructures may be deposited simultaneously on an array comprising a first plurality of sites and a second plurality of sites, wherein each site of the first plurality of sites is coupled to a nucleic acid nanostructure of the first plurality of nucleic acid nanostructures, wherein each site of the second plurality of sites is coupled to a nucleic acid nanostructure of the second plurality of nucleic acid nanostructures, and wherein the first plurality of sites is spatially separated from the second plurality of sites.

Nucleic acid complexes

As set forth herein, described herein are nucleic acid nanostructure (e.g., SNAP) complexes comprising two or more nucleic acid nanostructures. The nucleic acid nanostructure complex may comprise any structure comprising a first nucleic acid nanostructure coupled to a second nucleic acid nanostructure. The nucleic acid nanostructure complex may comprise a first nucleic acid nanostructure and a second nucleic acid nanostructure, wherein the first nucleic acid nanostructure is a display nucleic acid nanostructure or a utility nucleic acid nanostructure, and wherein the second nucleic acid nanostructure is independently selected from the display nucleic acid nanostructure and the utility nucleic acid nanostructure. Thus, a nucleic acid nanostructure complex may comprise two or more nucleic acid nanostructures each having a particular function. In some configurations, the nucleic acid nanostructure complex can comprise a utility nucleic acid nanostructure comprising a capture nucleic acid nanostructure, a coupled nucleic acid nanostructure, a structural nucleic acid nanostructure, or a combination thereof. In some configurations, the nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and one or more additional nucleic acid nanostructures that perform a function of the nucleic acid nanostructure complex, such as: 1) Positioning the display nucleic acid nanostructure with respect to the second display nucleic acid nanostructure; 2) Positioning the displayed nucleic acid nanostructure with respect to the non-displayed nucleic acid nanostructure; 3) Altering display of an analyte coupled to a display nucleic acid nanostructure; 4) Increasing the coupling strength of the nucleic acid nanostructure complex to the surface; 5) Increasing the size of the surface occupied by the nucleic acid nanostructure complex; 6) Adding additional functionality (e.g., steric blocking, optical reflection or absorption, magnetic coupling, bar codes, etc.) to the nucleic acid nanostructure complex; 7) Increasing the amount of analyte displayed on the surface; or 8) combinations thereof. The nucleic acid nanostructure complex may comprise one or more nucleic acid nanostructures comprising a capture surface or capture moiety, wherein the capture surface or capture moiety comprises one or more surface interaction moieties configured to form a coupling interaction with a coupling surface of a solid support.

The first nucleic acid nanostructure (e.g., SNAP) and the second nucleic acid nanostructure of the nucleic acid nanostructure complex can be coupled by one or more coupling moieties. The first nucleic acid nanostructure comprising a first coupling surface may be configured to couple with a second nucleic acid nanostructure comprising a second coupling surface, thereby forming a nucleic acid nanostructure complex. The first nucleic acid nanostructure may comprise a first coupling moiety comprising one or more functional groups or moieties configured to couple to a second nucleic acid nanostructure by reaction with a second coupling moiety comprising one or more complementary functional groups or moieties. Two or more nucleic acid nanostructures may be coupled in a nucleic acid nanostructure complex by any suitable coupling interaction, including covalent and non-covalent interactions.

Provided herein is a nucleic acid nanostructure complex (e.g., SNAP complex) comprising two or more nucleic acid nanostructures, wherein each of the two or more nucleic acid nanostructures may be independently selected from a display nucleic acid nanostructure, a utility nucleic acid nanostructure, or a combination thereof, wherein the display nucleic acid nanostructure may comprise a display moiety that may be configured to couple with an analyte, wherein the utility nucleic acid nanostructure may comprise a capture moiety that may be configured to couple with a surface, and wherein the two or more nucleic acid nanostructures may be coupled to form a nucleic acid nanostructure complex.

Also provided herein is a nucleic acid nanostructure composition (e.g., SNAP composition) comprising a surface-containing material and two or more nucleic acid nanostructures, wherein each of the two or more nucleic acid nanostructures may be independently selected from a display nucleic acid nanostructure, a utility nucleic acid nanostructure, or a combination thereof, wherein the display nucleic acid nanostructure may comprise a display moiety that may be configured to couple with an analyte, wherein the two or more nucleic acid nanostructures may be coupled with a surface, and wherein a first nucleic acid nanostructure of the two or more nucleic acid nanostructures may be coupled with a second nucleic acid nanostructure of the two or more nucleic acid nanostructures, thereby forming a nucleic acid nanostructure complex. In a particular configuration, the nucleic acid nanostructure composition is an array of nucleic acid nanostructures or nucleic acid nanostructure complexes. The nucleic acid nanostructure or nucleic acid nanostructure complex can be attached to an analyte or other target molecule of interest, thereby providing an array of target analytes or molecules. Further examples of nucleic acid nanostructure compositions (e.g., SNAP compositions) and nucleic acid nanostructure complexes that can form sites or addresses of an array are set forth in the following paragraphs and in the context of various array compositions elsewhere herein.

Also provided herein is a nucleic acid nanostructure composition (e.g., SNAP composition) comprising an analyte, a display nucleic acid nanostructure, and one or more utility nucleic acid nanostructures, wherein the display nucleic acid nanostructure may comprise a display portion that may be configured to couple with the analyte, wherein the utility nucleic acid nanostructure may comprise a capture portion that may be coupled with a surface or configured to couple with a surface, wherein the display nucleic acid nanostructure may be coupled with the analyte, and wherein the display nucleic acid nanostructure may be coupled with the one or more nucleic acid nanostructures, thereby forming a nucleic acid nanostructure complex.

Also provided herein is a nucleic acid nanostructure composition (e.g., SNAP composition) comprising a material comprising a surface, an analyte, a display nucleic acid nanostructure, and one or more utility nucleic acid nanostructures, wherein the display nucleic acid nanostructure comprises a display moiety that can be configured to couple with the analyte, wherein the capture nucleic acid nanostructure comprises a capture moiety that can be configured to couple with the surface, wherein the display nucleic acid nanostructure can couple with the analyte, wherein the display nucleic acid nanostructure can couple with the one or more nucleic acid nanostructures, thereby forming a nucleic acid nanostructure complex, and wherein the nucleic acid nanostructure complex can couple with the surface.

A nucleic acid nanostructure complex (e.g., SNAP complex) as set forth herein may comprise a display nucleic acid nanostructure and a utility nucleic acid nanostructure. The utility nucleic acid nanostructure may comprise a nucleic acid nanostructure selected from the group consisting of a capture nucleic acid nanostructure, a coupled nucleic acid nanostructure, a structural nucleic acid nanostructure, or a combination thereof. The nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and one or more capture nucleic acid nanostructures configured to couple the nucleic acid nanostructure complex to a surface. The nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and one or more coupled nucleic acid nanostructures configured to bind the nucleic acid nanostructure complex to a second nucleic acid nanostructure or a second nucleic acid nanostructure complex. The nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and one or more utility nucleic acid nanostructures.

A nucleic acid nanostructure (e.g., SNAP complex) as set forth herein may comprise a displayed nucleic acid nanostructure coupled to or configured to be coupled to an analyte. The nucleic acid nanostructure complex may comprise a utility nucleic acid nanostructure configured to be coupled to a surface. In some configurations, the nucleic acid nanostructure can comprise a nucleic acid nanostructure as described by any of the configurations described herein, e.g., SNAP comprising a multifunctional moiety.

A nucleic acid nanostructure complex (e.g., SNAP complex) as set forth herein may comprise a display nucleic acid nanostructure or a utility nucleic acid nanostructure comprising a detectable label. In some configurations, the display nucleic acid nanostructure or utility nucleic acid nanostructure can comprise a utility face, wherein the utility face comprises a capture moiety, a detectable label, or a steric blocking moiety. Any of a variety of detectable labels may comprise fluorescent labels, luminescent labels, nucleic acid barcodes, nanoparticle labels, isotopes or radioactive labels.

The first nucleic acid nanostructure and the second nucleic acid nanostructure can be coupled by one or more coupling moieties. In some configurations, the display nucleic acid nanostructure can comprise a first nucleic acid nanostructure coupling moiety and the utility nucleic acid nanostructure can comprise a second nucleic acid nanostructure coupling moiety, wherein the display nucleic acid nanostructure can be coupled to the capture nucleic acid nanostructure by coupling the first nucleic acid nanostructure coupling moiety to the second nucleic acid nanostructure coupling moiety. In some configurations, the first nucleic acid nanostructure coupling moiety and the second nucleic acid nanostructure coupling moiety may form a covalent bond, for example, between complementary pairs of click-type reaction moieties. In other configurations, the first nucleic acid nanostructure coupling moiety and the second nucleic acid nanostructure coupling moiety may form a non-covalent bond, such as a hydrogen bond, a nucleobase pair bond, or a streptavidin-biotin bond.

A nucleic acid nanostructure complex (e.g., SNAP complex) as set forth herein may comprise a specific amount of two or more types of nucleic acid nanostructures. In some configurations, the nucleic acid nanostructure complex comprises a plurality of utility nucleic acid nanostructures and a single display nucleic acid nanostructure. In some cases, the nucleic acid nanostructure complex can comprise a specific number of one type of nucleic acid nanostructure (e.g., exhibiting SNAP, utility SNAP). The nucleic acid nanostructure complex may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 specific numbers of one type of nucleic acid nanostructure. Alternatively or additionally, the nucleic acid nanostructure complex may comprise no more than about 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 specific numbers of one type of nucleic acid nanostructure.

In some cases, a nucleic acid nanostructure complex (e.g., SNAP complex) can comprise a fixed ratio of a first type of nucleic acid nanostructure (e.g., exhibiting SNAP) and a second type of SNAP (e.g., utility SNAP). The nucleic acid nanostructure complex may comprise a ratio of at least about 1:1, 1.1:1, 1.25:1, 1.5:1, 1.75:1, 2:1, 2.5:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1: 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1, 100:1, or greater than 100:1. Alternatively or in addition to this, nucleic acid nanostructure complex may include nucleic acid types in a ratio of up to about 100:1, 95:1, 90:1, 85:1, 80:1, 75:1, 70:1, 65:1, 60:1, 55:1, 50:1, 49:1, 48:1, 47:1, 46:1, 45:1, 44:1, 43:1, 42:1, 41:1, 40:1, 39:1, 38:1, 37:1, 36:1, 35:1, 34:1, 33:1, 32:1, 31:1, 30:1, 29:1, 28:1, 27:1, 26:1, 25:1, 24:1, 23:1, 22:1, 21:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 25:1, 25.1, 25:1, 2:1, 5:1, and the second nanostructure of the type of the nucleic acid nanostructure of the type of the first type of the nucleic acid nanostructure of the complex).

The nucleic acid nanostructure complex (e.g., SNAP complex) can comprise a first type of nucleic acid nanostructure (e.g., exhibiting SNAP) and a second type of nucleic acid nanostructure (e.g., utility SNAP), wherein the second type of nucleic acid nanostructure is coupled to a specific face (e.g., a coupling face) of the first type of nucleic acid nanostructure. In some configurations, the nucleic acid nanostructure composite may comprise a first type of nucleic acid nanostructure and two or more second types of nucleic acid nanostructures coupled to one or more faces of the first type of nucleic acid nanostructure. In some configurations, the nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and two or more utility nucleic acid nanostructures coupled to one or more faces of the display nucleic acid nanostructure. In some configurations, a first utility nucleic acid nanostructure of the two or more utility nucleic acid nanostructures can be coupled to a first face of a display nucleic acid nanostructure, and a second utility nucleic acid nanostructure of the two or more utility nucleic acid nanostructures can be coupled to a second face of the display nucleic acid nanostructure. In some configurations, a face of a first utility nucleic acid nanostructure is coupled to a face of a second utility nucleic acid nanostructure. In some configurations, the first utility nucleic acid nanostructure is not coupled to the second utility nucleic acid nanostructure. In some configurations, the nucleic acid nanostructure complex further comprises a third utility nucleic acid nanostructure. In some configurations, the third utility nucleic acid nanostructure is coupled to a third face that displays the nucleic acid nanostructure. In some configurations, the third utility nucleic acid nanostructure is coupled to a face of the first utility nucleic acid nanostructure, a face of the second utility nucleic acid nanostructure, or a combination thereof.

A nucleic acid nanostructure complex (e.g., SNAP complex) as set forth herein may comprise two or more nucleic acid nanostructures of different sizes or shapes, as determined based on a minimum, average, or maximum measure, wherein the measure is, for example, a length, a width, a depth, a perimeter, a diameter, an effective surface area, a footprint, an effective occupied volume, any measure of structural morphology, or a combination thereof. The nucleic acid nanostructure complex may comprise a first nucleic acid nanostructure (e.g., exhibiting SNAP or utility SNAP) comprising a first coupling face coupled to a second nucleic acid nanostructure (e.g., exhibiting SNAP or utility SNAP) comprising a second coupling face, wherein the first coupling face and the second coupling face have different sizes, dimensions, or morphologies. In various configurations, the size of the coupling face of the first nucleic acid nanostructure is less than, greater than, or equal to the size of the coupling face of the second nucleic acid nanostructure. The nucleic acid nanostructure complex may also comprise a third nucleic acid nanostructure (e.g., exhibiting SNAP, utility SNAP) comprising a third coupling surface coupled to the first nucleic acid nanostructure. In some configurations, the size of the coupling face of the third nucleic acid nanostructure is less than, greater than, or equal to the size of the coupling face of the first nucleic acid nanostructure.

The nucleic acid nanostructure complex (e.g., SNAP complex) can comprise a first nucleic acid nanostructure (e.g., exhibiting SNAP or utility SNAP) comprising a first coupling face and a second nucleic acid nanostructure (e.g., exhibiting SNAP or utility SNAP) comprising a second coupling face, wherein the first nucleic acid nanostructure and/or the second nucleic acid nanostructure comprises a exhibiting moiety and/or a capturing moiety. In some configurations, the first coupling face and the second coupling face do not comprise a capture moiety. In some configurations, the first coupling face and the second coupling face do not comprise a display portion. In some configurations, the capture moiety may comprise a plurality of surface interaction moieties.

The nucleic acid nanostructures in the nucleic acid nanostructure complex (e.g., SNAP complex) may comprise one or more coupling surfaces configured to couple the nucleic acid nanostructures to a second nucleic acid nanostructure. The nucleic acid nanostructures in the nucleic acid nanostructure complex may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 coupling surfaces. Alternatively or additionally, SNAP in a SNAP complex may comprise no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 coupling faces. In some configurations, each coupling face of a nucleic acid nanostructure in the nucleic acid nanostructure complex can be coupled to a second nucleic acid nanostructure. In some configurations, at least one coupling face of a nucleic acid nanostructure in the nucleic acid nanostructure complex is coupled to a second nucleic acid nanostructure. In some configurations, at least one coupling face of a nucleic acid nanostructure in the nucleic acid nanostructure complex is not coupled to a second nucleic acid nanostructure.

As set forth herein, a nucleic acid nanostructure complex (e.g., SNAP complex) that contains two or more nucleic acid nanostructures may be configured to contain a particular symmetry, such as mirror symmetry or rotational symmetry. Symmetry of the nucleic acid nanostructure composite may be determined with respect to the average size, shape, or configuration of the nucleic acid nanostructures within the nucleic acid nanostructure composite. For example, variations in feature localization due to the helical and tertiary structure of SNAP may result in small differences between two opposing features of SNAP complexes designed to have symmetrical structures. The symmetrical nucleic acid nanostructure may have two symmetry features that lie within about 10% of the intended location relative to the symmetry axis or symmetry plane.

Symmetry may facilitate one or more functions of the nucleic acid nanostructure or nucleic acid nanostructure complex (e.g., SNAP complex). Symmetry may be characterized with respect to a reference plane, which is a hypothetical configuration for demonstration purposes. In some aspects, the nucleic acid nanostructures (e.g., SNAP) may be configured to have symmetry with respect to certain reference planes or axes of rotation, and such symmetry may optionally facilitate increased flexibility or molecular movement. The nucleic acid nanostructure complex may be further configured with one or more alignment planes. The alignment plane may comprise a reference plane to which one or more coupling surfaces are aligned. The alignment plane may encompass a continuous surface, wherein the first nucleic acid nanostructure has a degree of bending, flexing, or deforming relative to the second nucleic acid nanostructure. The nucleic acid nanostructures may be designed to be symmetrical to allow assembly into nucleic acid nanostructure complexes of a particular shape or conformation. The nucleic acid nanostructure complex may have a specific symmetry that facilitates coupling to sites on the surface that are configured to couple to the complex.

Nucleic acid nanostructures or nucleic acid nanostructure complexes as set forth herein may be generally asymmetric or with respect to some reference plane or axis of rotation. For example, SNAP or SNAP complexes may be asymmetric in a particular orientation, or may have no plane or axis of symmetry. An asymmetric nucleic acid nanostructure or nucleic acid nanostructure complex may provide the advantage of being more rigid than a symmetric nucleic acid nanostructure or nucleic acid nanostructure complex, for example, due to a reduced range of motion of individual nucleic acid nanostructures in the asymmetric complex. The asymmetry in the nucleic acid nanostructure or nucleic acid nanostructure complex may also facilitate the function of the nucleic acid nanostructure or nucleic acid nanostructure complex. For example, the asymmetric structure of the top and bottom SNAP faces may help to differentially couple the bottom face to the surface and the top face to the display SNAP.

12A-12C illustrate various aspects of SNAP and SNAP complex configurations associated with symmetry. FIG. 12A shows SNAP complexes formed by four utility SNAPs 1210 coupled to a central display SNAP 1220. Each utility SNAP 1210 is coupled to presentation SNAP 1220 by coupling a coupling face on utility SNAP 1210 to a coupling face on presentation SNAP 1220. The effective surface area of the coupling face of both utility SNAP 1210 and display SNAP 1220 is approximately the product of the average side length and the average SNAP thickness. The SNAP complex formed by coupling four utility SNAP 1210 to display SNAP 1220 has two planes of symmetry indicated by reference plane 1230. FIG. 12B shows a cross-sectional view of a first configuration of SNAP complex. Utility SNAP 1210 is coupled to display SNAP 1220 with sufficient rigidity to create a nearly coplanar alignment between the bottom surfaces of SNAP in SNAP complex. SNAP complexes remain side-to-side symmetric about reference plane 1230, but lack up-to-down symmetry due to configuration differences. SNAP complex also includes an alignment plane indicated by reference plane 1235 at the coupling plane between utility SNAP 1210 and display SNAP 1220. The arrows at the sides of the cross-section depict the possible directions of bending or flexing of utility SNAP 1210 relative to display SNAP 1220. Utility SNAP 1210 and display SNAP 1220 may comprise a bottom capture surface comprising a plurality of single stranded nucleic acids 1240 configured to facilitate coupling of SNAP complexes to a surface. Utility SNAP 1210 may also comprise a top utility face comprising a plurality of steric blocking groups 1250 configured to prevent adhesion of molecules other than analyte 1260 coupled to display SNAP 1220 to SNAP complexes. FIG. 12C depicts an alternative configuration of a SNAP complex with utility SNAP 1210 coupled to presentation SNAP 1220 at an angle such that capture planes of the utility SNAP 1210 and presentation SNAP 1220 are not coplanar. In some configurations, the coupling of SNAP in SNAP complexes may be sufficiently rigid to minimize bending or deformation at the interface between SNAP. In other cases, the coupling of SNAP in SNAP complexes may be flexible enough to allow SNAP to adopt a variety of structures, such as a transition between the structures of fig. 12B and 12C.

FIGS. 13A-13D show additional aspects of symmetry and asymmetry associated with the formation of nucleic acid nanostructure complexes. In particular, the configurations shown in FIGS. 13A-13D include configurations having utility SNAP coupled with other utility SNAPs in the SNAP complex, thereby reducing the ability of SNAP to bend or deform along specific reference planes in the SNAP complex, including, for example, reference planes positioned between the coupled SNAPs. Fig. 13A depicts a substantially rectangular SNAP complex having an asymmetric configuration. SNAP complex comprises a central display SNAP 1310 that contains display portion 1320. SNAP complexes also contain four utility SNAP (1331, 1332, 1333, 1334). Utility SNAP 1331, 1332 and 1333 are each coupled via a coupling face to a complementary coupling face displaying SNAP 1310. Fourth utility SNAP 1334 is not coupled directly to display SNAP, but is coupled to first utility SNAP 1331 and third utility SNAP 1333. Because the average size of each SNAP in a complex is different, utility SNAP 1331, 1332 and 1333 comprise coupling faces having different sizes. Utility SNAP 1334 comprises two separate coupling faces comprising larger faces that are laterally coupled to utility SNAP 1331 and 1333, thereby forming an alignment plane orthogonal to depicted line 1340. Fig. 13B depicts a substantially square SNAP complex having an asymmetric configuration. SNAP complex comprises a central display SNAP 1310 that contains display portion 1320. SNAP complexes also contain eight utility SNAP s, including 3 small utility SNAP 1351, 2 medium utility SNAP 1352, and 3 large utility SNAP 1353. The helical arrangement of utility SNAP increases in size as the helical distance increases from display SNAP 1310. Each utility SNAP in this configuration is coupled to at least 3 other utility SNAP through at least 2 coupling faces on different sides of SNAP. The configuration of fig. 13B lacks any coupling surface between SNAP across the full length of the SNAP complex. This configuration advantageously maintains co-planarity of the SNAP (relative to the plane of the page oriented as shown in fig. 13B) because the SNAP composite does not contain an uninterrupted alignment plane along which two adjacent SNAP would bend or flex relative to each other, thereby deviating from co-planarity. Any bending or flexing of SNAP within the composite will be resisted due to the complex coupling pattern in the SNAP composite.

Fig. 13C-13D depict SNAP configurations having rotational symmetry about an axis oriented orthogonally to a display portion 1320 of central display SNAP 1310. FIG. 13C shows a substantially square SNAP complex comprising a display SNAP 1310 and 8 utility SNAPs (including 4 utility SNAPs 1360 coupled to a coupling face of display SNAP 1310 and 4 utility SNAPs 1365 coupled only to display coupled utility SNAPs 1360). Fig. 13D shows a substantially square SNAP composite comprising a central display SNAP 1310 and 4 triangular utility SNAP 1370. SNAP is shown coupled to each of the 4 utility SNAP 1370, and each utility SNAP 1370 is coupled to two other utility SNAP 1370 in addition to SNAP 1310. The configuration depicted in fig. 13C-13D has rotational symmetry such that a 90 ° rotation about the display portion produces the same configuration. However, the configuration lacks any uninterrupted plane of alignment between SNAP, thereby increasing the SNAP composite structure's resistance to bending or deformation (relative to the oriented page planes shown in fig. 13C-13D). Such rigidity may be used to increase the stability of a larger array comprising a plurality of coupled nucleic acid nanostructure complexes. Maintaining the planarity of the nucleic acid nanostructure capture face may be particularly advantageous for facilitating attachment of the nucleic acid nanostructure complex to a planar surface via the capture face, and for maintaining the nucleic acid nanostructure complex in a focal plane for subsequent optical detection. The substantially rigid structure may also have increased binding specificity and strength when contacted with a surface comprising a complementary morphology of the nucleic acid nanostructure complex capture face. Fig. 14A-14B depict three-dimensional SNAP composite structures to demonstrate another example of symmetry. FIG. 14A depicts a SNAP complex comprising a central display SNAP 1420 coupled to four generic utility SNAPs 1410 comprising a top coupling face and a bottom coupling face. The SNAP comprises an axis of rotational symmetry through the center of display SNAP 1420, but the overlapping of rectangular SNAP may resist bending or deformation of the SNAP complex. FIG. 14B depicts a similar SNAP complex comprising four display SNAPs 1430 with axes of rotational symmetry and top and bottom coupling faces overlapping on each display SNAP 1430.

A nucleic acid nanostructure complex (e.g., SNAP complex) as set forth herein may comprise at least one axis of symmetry or one plane of symmetry. The nucleic acid nanostructure complex may further comprise at least one uninterrupted alignment plane. For example, uninterrupted planes may be located between adjacent SNAP s, and the uninterrupted planes may span the length of the SNAP composite. In some configurations, the symmetry axis may comprise a rotational symmetry axis or a reflection axis or a plane of symmetry. In some configurations, the nucleic acid nanostructure complex can comprise an axis of rotational symmetry and a reflection axis or plane of symmetry. In other configurations, the nucleic acid nanostructure complex may not comprise an axis of symmetry or a plane of symmetry. In some configurations, the nucleic acid nanostructure complex may not comprise an uninterrupted alignment plane. Likewise, the uninterrupted planes may be located between adjacent nucleic acid nanostructures, and the uninterrupted planes may span the length of the nucleic acid nanostructure complex.

The orientation of a first nucleic acid nanostructure relative to a second nucleic acid nanostructure in a nucleic acid nanostructure complex (e.g., SNAP complex) can be controlled. In some configurations, the first nucleic acid nanostructure can be oriented relative to the second nucleic acid nanostructure in the nucleic acid nanostructure complex such that a face of the first nucleic acid nanostructure (e.g., capture face, display face, utility face) is substantially parallel or coplanar with a face of the second nucleic acid nanostructure (e.g., capture face, display face, utility face). In other configurations, the first nucleic acid nanostructure can be oriented relative to the second nucleic acid nanostructure in the nucleic acid nanostructure complex such that a face of the first nucleic acid nanostructure is not parallel or coplanar with a face of the second nucleic acid nanostructure. The orientation between two nucleic acid nanostructures can be controlled in part by the ability to position the coupling moiety on a particular nucleotide comprising one or more tertiary structures of the nucleic acid nanostructures. FIGS. 15A-15B depict orientation control of a helical structure utilizing DNA-based SNAP. Fig. 15A shows a cross-sectional view of a first SNAP 1510 configured to couple with 2 second SNAP 1520. First SNAP 1510 comprises a plurality of helical tertiary structures comprising a first coupling group 1530 and a second coupling group 1535. The relative placement of the first coupling group 1530 on the helix orients the first coupling group 1530 nearly orthogonal to the first coupling face 1540. The relative placement of the second coupling groups 1535 on the helix orients the second coupling groups 1535 at a non-orthogonal angle with respect to the second coupling face 1540. Second SNAP 1520 comprises a plurality of helical tertiary structures that comprise complementary coupling groups 1550. Fig. 15B shows the conformation of SNAP complexes formed by coupling 2 second SNAP 1520 with first SNAP 1510. Due to the relative orientation of first coupling group 1530 and second coupling group 1535, bottom face 1560 of one second SNAP 1520 is coplanar with bottom face 1562 of first SNAP, while bottom face 1565 of the other second SNAP 1520 is not coplanar with bottom face 1560 or 1562.

Nucleic acid nanostructure complexes (e.g., SNAP complexes) can comprise a particular shape based on a two-dimensional projection on a surface, such as a square, rectangle, triangle, circle, cross, polygon, or irregular shape. Nucleic acid nanostructure complexes can be described in terms of three-dimensional structures. The nucleic acid nanostructure complex may comprise a first nucleic acid nanostructure comprising a first conformation (e.g., a substantially square face) and a second nucleic acid nanostructure comprising a second conformation (e.g., a substantially triangular face, a substantially rectangular face, etc.). The nucleic acid nanostructure complex may comprise a first nucleic acid nanostructure and a second nucleic acid nanostructure, wherein the two nucleic acid nanostructures comprise substantially similar conformations (e.g., substantially square faces, substantially triangular faces, substantially rectangular faces, etc.). The nucleic acid nanostructure complex may comprise one or more nucleic acid nanostructure conformations. The nucleic acid nanostructure complex may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 nucleic acid nanostructure conformations. Alternatively or additionally, the nucleic acid nanostructure complex may comprise no more than about 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 2 nucleic acid nanostructure conformations.

The nucleic acid nanostructure complex (e.g., SNAP complex) can be coupled to one or more analytes, or configured to be coupled to one or more analytes. The nucleic acid nanostructure complex may comprise one or more display moieties coupled to or configured to be coupled to one or more analytes. The nucleic acid nanostructure complex may comprise one or more display nucleic acid nanostructures coupled to or configured to be coupled to one or more analytes. The nucleic acid nanostructure complex can be coupled to a fewer number of analyte molecules than the number of display moieties in the nucleic acid nanostructure complex. For example, the nucleic acid nanostructure complex may be coupled to only a single analyte, or may not be coupled to an analyte. In some configurations, the display moiety may be coupled to two or more analytes. In some configurations, two or more display moieties may be coupled to an analyte.

The nucleic acid nanostructure complex (e.g., SNAP complex) may be configured to occupy a specific amount of surface area on a surface. The surface area occupied by the nucleic acid nanostructure complex can be measured as the effective surface area or footprint created by a two-dimensional projection of the nucleic acid nanostructure complex onto a surface. In some configurations, the effective surface area or footprint may also include the surface area of a surface or interface that is excluded from association with other molecules (nucleic acid nanostructures or non-nucleic acid molecules) due to effects caused by the nucleic acid nanostructure complex, such as steric exclusion or repulsion. The nucleic acid nanostructure complex can have a length of at least about 25nm ² 、100nm ² 、500nm ² 、1000nm ² 、2000nm ² 、3000nm ² 、4000nm ² 、5000nm ² 、5500nm ² 、6000nm ² 、6500nm ² 、7000nm ² 、7500nm ² 、8000nm ² 、8500nm ² 、9000nm ² 、10000nm ² 、15000nm ² 、20000nm ² 、25000nm ² 、50000nm ² 、100000nm ² 、250000nm ² 、500000nm ² Or more than 1000000nm ² Is effective in terms of surface area or footprint. Alternatively or additionally, the nucleic acid nanostructure complex may have a wavelength of no more than about 1000000nm ² 、500000nm ² 、250000nm ² 、100000nm ² 、50000nm ² 、25000nm ² 、20000nm ² 、15000nm ² 、10000nm ² 、9000nm ² 、8500nm ² 、8000nm ² 、7500nm ² 、7000nm ² 、6500nm ² 、6000nm ² 、5500nm ² 、5000nm ² 、4000nm ² 、3000nm ² 、2000nm ² 、1000nm ² 、500nm ² 、100nm ² 、25nm ² Or less than 25nm ² Is effective in terms of surface area or footprint.

The nucleic acid nanostructure complex (e.g., SNAP complex) may comprise a three-dimensional structure that improves analyte display. Analyte presentation may be improved by increasing the likelihood of detection and observation of the analyte, increasing contact of the analyte with probes or reagents, and/or reducing negative interactions between the analyte and other molecules. FIGS. 16A-16B depict cross-sectional views of various three-dimensional nucleic acid nanostructure complexes. FIG. 16A depicts a three-dimensional SNAP complex with pore-like structures formed around a central analyte. The pore structure may be advantageous for affinity-based assays, where a decrease in the available volume around the analyte may reduce the ability of the affinity reagent to migrate away from the analyte. In addition, the surrounding utility SNAP may contain optical materials that increase light collection or reduce background signals, thereby improving the efficiency of the optical detection method. FIG. 16B depicts a three-dimensional SNAP complex that forms a rod that lifts an analyte above the surface with which the SNAP complex associates. The elevated analyte may be less likely to have unwanted interactions, such as interactions with molecules that may bind non-specifically to the nucleic acid nanostructure complex. The raised analyte may also be more accessible to receptors that would otherwise undergo steric hindrance, charge repulsion, or other inhibitory interactions with the surface to which the nucleic acid nanostructure is attached.

Provided herein is a method of forming a nucleic acid nanostructure complex (e.g., SNAP complex), the method comprising providing a display nucleic acid nanostructure and one or more capture nucleic acid nanostructures or utility nucleic acid nanostructures, wherein the display nucleic acid nanostructure comprises one or more coupling moieties, and wherein the capture nucleic acid nanostructure or utility nucleic acid nanostructure comprises one or more complementary coupling moieties, wherein the one or more complementary coupling moieties are configured to couple with the one or more coupling moieties, and coupling a display nucleic acid nanostructure to the one or more capture nucleic acid nanostructures or utility nucleic acid nanostructures by coupling the one or more coupling moieties with the one or more complementary coupling moieties, thereby forming a nucleic acid nanostructure complex, wherein the nucleic acid nanostructure complex comprises a display moiety configured to couple with an analyte, and wherein the nucleic acid nanostructure complex comprises a capture moiety configured to associate with a surface. The nucleic acid nanostructure complex may comprise a display nucleic acid nanostructure and/or a utility nucleic acid nanostructure comprising a capture moiety comprising a plurality of surface-interacting moieties.

The nucleic acid nanostructure complex (e.g., SNAP complex) formation method may include coupling one or more coupling moieties to one or more complementary coupling moieties by forming a covalent bond. In some configurations, the covalent bond is formed by performing a click-type reaction. However, other coupling reactions and moieties may be used, such as those set forth elsewhere herein. For example, a nucleic acid nanostructure complex formation method may comprise coupling one or more coupling moieties to one or more complementary coupling moieties by forming a non-covalent bond. In some configurations, forming the non-covalent bond includes forming a nucleic acid base pair hybridization. In some configurations, the one or more complementary coupling moieties comprise one or more oligonucleotides having a sequence complementary to the set of one or more oligonucleotides. In some configurations, forming the non-covalent bond includes forming a receptor-ligand complex, such as a streptavidin-biotin complex.

Nucleic acid nanostructure complexes (e.g., SNAP complexes) can be formed under specific formation conditions. Nucleic acid nanostructure complexes can be formed in a fluid medium. The conditions may include specific solvents, polarities, ionic strength, or pH buffer conditions. In some configurations, the display nucleic acid nanostructure or utility nucleic acid nanostructure may be provided in a solution comprising a magnesium salt. In some configurations, coupling of the display nucleic acid nanostructure to one or more utility nucleic acid nanostructures can occur in the presence of a surfactant. The nucleic acid nanostructure complex can be formed with a display nucleic acid nanostructure. The displayed nucleic acid nanostructure can be coupled to the analyte either before or after formation of the nucleic acid nanostructure complex. In some configurations, the analyte may be covalently coupled to the display moiety.

Nucleic acid nanostructure complexes (e.g., SNAP complexes) can be formed at a particular temperature profile. For example, a first nucleic acid nanostructure can be combined with a second nucleic acid nanostructure at a first temperature, and then the temperature can be changed (e.g., lowered, raised) so that the first nucleic acid nanostructure is coupled with the second nucleic acid nanostructure to form a nucleic acid nanostructure complex. The steps in the nucleic acid nanostructure complex formation process may occur at the following temperatures: at least about 0 ℃, 5 ℃, 10 ℃, 15 ℃, 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃, 35 ℃, 36 ℃, 37 ℃, 38 ℃, 39 ℃, 40 ℃, 41 ℃, 42 ℃, 43 ℃, 44 ℃, 45 ℃, 46 ℃, 47 ℃, 48 ℃, 49 ℃, 50 ℃, 51 ℃, 52 ℃, 53 ℃, 54 ℃, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃, 66 ℃, 67 ℃, 68 ℃, 69 ℃, 70 ℃, 71 ℃, 72 ℃, 73 ℃, 74, 75 ℃, 76 ℃, 77 ℃, 78 ℃, 79 ℃, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, 86 ℃, 87 ℃, 88 ℃, 89 ℃, 90 ℃, 91 ℃, 92 ℃, 93 ℃, 94 ℃, 95 ℃, or more than 95 ℃. Alternatively or additionally, steps in the nucleic acid nanostructure complex formation process may occur at the following temperatures: no more than about 95 ℃, 94 ℃, 93 ℃, 92 ℃, 91 ℃, 90 ℃, 89 ℃, 88 ℃, 87 ℃, 86 ℃, 85 ℃, 84 ℃, 83 ℃, 82 ℃, 81 ℃, 80 ℃, 79 ℃, 78 ℃, 77 ℃, 76 ℃, 75 ℃, 74 ℃, 73 ℃, 72 ℃, 71 ℃, 70 ℃, 69 ℃, 68 ℃, 67 ℃, 66 ℃, 65 ℃, 63 ℃, 62 ℃, 61 ℃, 60 ℃, 59 ℃, 58 ℃, 57 ℃, 56 ℃, 55 ℃, 54 ℃, 53 ℃, 52 ℃, 51 ℃, 50 ℃, 49 ℃, 48 ℃, 47 ℃, 46 ℃, 45 ℃, 44 ℃, 43 ℃, 42 ℃, 41 ℃, 40 ℃, 39 ℃, 38 ℃, 37 ℃, 36 ℃, 35 ℃, 34 ℃, 32 ℃, 31 ℃, 30 ℃, 29 ℃, 28 ℃, 27 ℃, 26 ℃, 25 ℃, 24 ℃, 23 ℃, 22 ℃, 21, 20 ℃, 15 ℃, 10 ℃, 5 ℃, 0 ℃, or less than 0 ℃.

The nucleic acid nanostructure complex (e.g., SNAP complex) may comprise a fully structured moiety and/or a partially structured moiety. The fully structured portion of the nucleic acid nanostructured complex can be defined as a region of the nucleic acid nanostructured complex that retains each of the primary structure, secondary structure, and tertiary structure during the course of use. A partially structured portion of a nucleic acid nanostructured complex can be defined as a region of the nucleic acid nanostructured complex that comprises a primary structure but does not retain a particular secondary and/or tertiary structure during the course of use. Examples of useful partially structured moieties are permeable structures or regions of nucleic acid nanostructures. In some configurations, the partially structured portion of the nucleic acid nanostructure complex can comprise single stranded nucleic acid. The single stranded nucleic acid may be located between the double stranded nucleic acid regions, or may comprise a pendent structure or terminal strand of the nucleic acid. The single stranded nucleic acid may comprise a sequence, composition or length as exemplified herein for a overhanging nucleic acid or overhanging portion. In some configurations, the partially structured portion of the nucleic acid nanostructure complex can comprise an amorphous structure, such as a spherical structure (e.g., nanospheres, dendrimers, etc.). Fig. 37B depicts a SNAP complex comprising DNA origami SNAP 3710 coupled to two DNA nanospheres SNAP 3735 and analyte 3720. DNA nanospheres 3735 may be considered partially structured due to their single-stranded, globular, and/or amorphous structure. The partially structured region of the SNAP complex may provide one or more functions to SNAP 3710, such as increasing the binding strength to a target binding surface, decreasing the binding strength to a non-target surface, and preventing non-specific binding of other molecules to the SNAP face or coupled analyte.

Nucleic acid composition

As set forth herein, nucleic acids, such as nucleic acid nanostructures, SNAP, nucleic acid nanostructure complexes, and/or components thereof (e.g., scaffolds, staples, multifunctional moieties, etc.), may be stored, prepared, or used in a suitable solvent or buffer. The solvent or buffer may provide favorable conditions for promoting stability of the nucleic acid. The solvent or buffer may facilitate a process, such as contacting a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) with a surface or contacting a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) with an analyte. In some configurations, a suitable DNA buffer may comprise magnesium salts and/or EDTA. The nucleic acid may be placed in a solvent or buffer configured to promote the desired interaction (e.g., binding of the nucleic acid to the array site, etc.). The nucleic acid may be placed in a solvent or buffer configured to inhibit unwanted interactions (e.g., aggregation of the first nucleic acid with the second nucleic acid, etc.). The interaction of nucleic acids (e.g., binding to a solid support, remaining in solution, etc.) may be facilitated by the presence of chemicals as set forth herein. For example, binding of nucleic acids to the surface of a solid support may be mediated by cationic species. In another example, a surfactant material may be included in the nucleic acid composition to prevent unwanted nucleic acid aggregation, for example, due to the first nucleic acid adhering to an analyte coupled to the second nucleic acid. The methods as set forth herein may utilize a fluid medium comprising one or more chemicals as set forth herein. The methods as set forth herein may include the step of altering a fluid medium as set forth herein, for example, by introducing or removing one or more chemicals from the fluid medium. The method as set forth herein may comprise the step of exchanging the first fluid medium as set forth herein for the second fluid medium.

The solvent or buffer in contact with the nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) can comprise any of a variety of components, such as a solvent species, pH buffering species, cationic species, anionic species, surfactant species, denaturing species, or a combination thereof. The solvent material may include water, acetic acid, methanol, ethanol, n-propanol, isopropanol, n-butanol, formic acid, ammonia, propylene carbonate, nitromethane, dimethylsulfoxide, acetonitrile, dimethylformamide, acetone, ethyl acetate, tetrahydrofuran, dichloromethane, chloroform, carbon tetrachloride, dimethyl ether, diethyl ether, 1-4-dioxane, toluene, benzene, cyclohexane, hexane, cyclopentane, pentane, or combinations thereof. The solvent or solution may contain buffer substances including, but not limited to MES, tris, bis-tris, bis-tris propane, ADA, ACES, PIPES, MOPSO, MOPS, BES, TES, HEPES, HEPBS, HEPPSO, DIPSO, MOBS, TAPSO, TAPS, TABS, POPSO, TEA, EPPS, tris (hydroxymethyl) methylglycine (Tricine), gly-Gly, N-Bis (hydroxyethyl) glycine (Bicine), AMPD, AMPSO, AMP, CHES, CAPSO, CAPS, and CABS. The solvent or solution may contain cationic species such as Na ⁺ 、K ⁺ 、Ag ⁺ 、Cu ⁺ 、NH ₄ ⁺ 、Mg ²⁺ 、Ca ²⁺ 、Cu ²⁺ 、Cd ²⁺ 、Zn ²⁺ 、Fe ²⁺ 、Co ²⁺ 、Ni ²⁺ 、Cr ²⁺ 、Mn ² ⁺ 、Ge ²⁺ 、Sn ²⁺ 、Al ³⁺ 、Cr ³⁺ 、Fe ³⁺ 、Co ³⁺ 、Ni ³⁺ 、Ti ³⁺ 、Mn ³⁺ 、Si ⁴⁺ 、V ⁴⁺ 、Ti ⁴⁺ 、Mn ⁴⁺ 、Ge ⁴⁺ 、Se ⁴⁺ 、V ⁵⁺ 、Mn ⁵⁺ 、Mn ⁶ ⁺ 、Se ⁶⁺ And combinations thereof. The solvent or solution may contain anionic species such as F ^- 、Cl ^- 、Br ^- 、ClO ₃ ^- 、H ₂ PO ₄ ^- 、HCO ₃ ^- 、HSO ₄ ^- 、OH ^- 、I ^- 、NO ₃ ^- 、NO ₂ ^- 、MnO ₄ ^- 、SCN ^- 、CO ₃ ^2- 、CrO ₄ ^2- 、Cr ₂ O ₇ ^2- 、HPO ₄ ^2- 、SO ₄ ^2- 、SO ₃ ^2- 、PO ₄ ^3- And combinations thereof. The solvent or solution may contain a surfactant material, including, but not limited to, stearic acid, lauric acid, oleic acid, sodium dodecyl sulfate, sodium dodecyl benzene sulfonate, dodecylamine hydrochloride, cetyltrimethylammonium bromide, polyethylene oxide, nonylphenyl ethoxylate, triton X, pentapropylene glycol monolodecyl ether, octapropylene glycol monolodecyl ether, pentaethylene glycol monolodecyl ether, octaethylene glycol monolodecyl ether, lauramide monoethyl amine, lauramide diethylamine, octylglucoside, decyl glucoside, lauryl glucoside, tween 20, tween 80, N-dodecyl-beta-D-maltoside, nonylphenol ether 9, glycerol monolaurate, ethoxylated (tallow) amine, poloxamer, digitonin, zolyl FSO, 2, 5-dimethyl-3-hexyne-2, 5-diol, igepal CA630, aerosol-OT, triethylamine hydrochloride, cetrimonium bromide, benzethonium chloride, octenidine dihydrochloride, cetylpyridinium chloride, methyltrialkylammonium chloride (aden), dimethyl dioctadecyl ammonium chloride, CHAIS, CHAIN-16, CHAIN-propyl chloride, CHAIN-16, N- (dimethylammonium) butyrate, lauryl-N, N- (dimethyl) -glycine betaine, hexadecylphosphocholine, lauryldimethylamine N-oxide, lauryl-N, N- (dimethyl) -propane sulfonate, 3- (1-pyridyl) -1-propane sulfonate inner salt, 3- (4-tert-butyl-1-pyridinyl) -1-propanesulfonic acid inner salt and combinations thereof. The solvent or solution may comprise denatured substances including, but not limited to, acetic acid, trichloroacetic acid, sulfosalicylic acid, sodium bicarbonate, ethanol, ethylenediamine tetraacetic acid (EDTA), urea, guanidinium chloride, lithium perchlorate, sodium dodecyl sulfate, 2-mercaptoethanol, dithiothreitol, and tris (2-carboxyethyl) phosphine (TCEP).

The pH buffering substance, cationic substance, anionic substance, surfactant substance, or denaturing substance may be present in an amount of at least about 0.0001M, 0.001M, 0.01M, 0.02M, 0.03M, 0.04M, 0.05M, 0.06M, 0.07M, 0.08M, 0.09M, 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2M, 2.1M, 2.2M the concentration of 2.3M, 2.4M, 2.5M, 2.6M, 2.7M, 2.8M, 2.9M, 3M, 3.1M, 3.2M, 3.3M, 3.4M, 3.5M, 3.6M, 3.7M, 3.8M, 3.9M, 4M, 4.1M, 4.2M, 4.3M, 4.4M, 4.5M, 4.6M, 4.7M, 4.8M, 4.9M, 5M, 5.1M, 5.2M, 5.3M, 5.4M, 5.5M, 5.6M, 5.7M, 5.8M, 5.9M, 6M, 7M, 8M, 9M or more than 10M is present in the solvent composition. Alternatively or in addition to this, the pH buffering substance, cationic substance, anionic substance, surfactant substance, or denaturing substance may be in a range of no more than about 10M, 9M, 8M, 7M, 6M, 5.9M, 5.8M, 5.7M, 5.6M, 5.5M, 5.4M, 5.3M, 5.2M, 5.1M, 5.0M, 4.9M, 4.8M, 4.7M, 4.6M, 4.5M, 4.4M, 4.3M, 4.2M, 4.1M, 4.0M, 3.9M, 3.8M, 3.7M, 3.6M, 3.5M, 3.4M, 3.3M, 3.2M, 3.1M, 3.0M, 2.9M, 3.1M a concentration of 2.8M, 2.7M, 2.6M, 2.5M, 2.4M, 2.3M, 2.2M, 2.1M, 2.0M, 1.9M, 1.8M, 1.7M, 1.6M, 1.5M, 1.4M, 1.3M, 1.2M, 1.1M, 1.0M, 0.9M, 0.8M, 0.7M, 0.6M, 0.5M, 0.4M, 0.3M, 0.2M, 0.1M, 0.09M, 0.08M, 0.07M, 0.06M, 0.05M, 0.04M, 0.03M, 0.02M, 0.01M, 0.001M or less than about 0.001M is present in the solvent or solution.

The pH buffering material, cationic material, anionic material, surfactant material, or denaturing material may be present in an amount of at least about 0.0001 wt% (wt%), 0.001 wt%, 0.002 wt%, 0.003 wt%, 0.004 wt%, 0.005 wt%, 0.006 wt%, 0.007 wt%, 0.008 wt%, 0.009 wt%, 0.01 wt%, 0.02 wt%, 0.03 wt%, 0.04 wt%, 0.05 wt%, 0.06 wt%, 0.07 wt%, 0.08 wt%, 0.09 wt%, 0.1 wt%, 0.2 wt%, 0.3 wt%, 0.4 wt%, 0.5 wt%, 0.6 wt%, 0.7 wt%, 0.8 wt%, 0.9 wt%, 1.0 wt%, 1.1 wt%, 1.2 wt%, 1.3 wt%, 1.4 wt%, 1.5 wt%, 0.07 wt%, 0.4 wt%; the solvent composition may be present in a weight percentage of 1.6 wt%, 1.7 wt%, 1.8 wt%, 1.9 wt%, 2 wt%, 2.1 wt%, 2.2 wt%, 2.3 wt%, 2.4 wt%, 2.5 wt%, 2.6 wt%, 2.7 wt%, 2.8 wt%, 2.9 wt%, 3 wt%, 3.1 wt%, 3.2 wt%, 3.3 wt%, 3.4 wt%, 3.5 wt%, 3.6 wt%, 3.7 wt%, 3.8 wt%, 3.9 wt%, 4 wt%, 4.1 wt%, 4.2 wt%, 4.3 wt%, 4.4 wt%, 4.5 wt%, 4.6 wt%, 4.7 wt%, 4.8 wt%, 4.9 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt%, 10 wt% or more than 10 wt%. Alternatively or in addition to this, the pH buffering material, cationic material, anionic material, surfactant material, or denaturing material may be present in an amount of no more than about 10 wt%, 9 wt%, 8 wt%, 7 wt%, 6 wt%, 5 wt%, 4.9 wt%, 4.8 wt%, 4.7 wt%, 4.6 wt%, 4.5 wt%, 4.4 wt%, 4.3 wt%, 4.2 wt%, 4.1 wt%, 4.0 wt%, 3.9 wt%, 3.8 wt%, 3.7 wt%, 3.6 wt%, 3.5 wt%, 3.4 wt%, 3.3 wt%, 3.2 wt%, 3.1 wt%, 3.0 wt%, 2.9 wt%, 2.8 wt%, 2.7 wt%, 2.6 wt%, 2.5 wt%, 2.4 wt%, 2.3 wt%, 2.2 wt%, 2.1 wt%, 2.0 wt%, 1.9 wt%, 1 wt%, 1.9 wt%, and 1.9 wt%, or a mixture thereof a weight percent of 1.8 wt%, 1.7 wt%, 1.6 wt%, 1.5 wt%, 1.4 wt%, 1.3 wt%, 1.2 wt%, 1.1 wt%, 1.0 wt%, 0.9 wt%, 0.8 wt%, 0.7 wt%, 0.6 wt%, 0.5 wt%, 0.4 wt%, 0.3 wt%, 0.2 wt%, 0.1 wt%, 0.09 wt%, 0.08 wt%, 0.07 wt%, 0.06 wt%, 0.05 wt%, 0.04 wt%, 0.03 wt%, 0.02 wt%, 0.01 wt%, 0.009 wt%, 0.008 wt%, 0.007 wt%, 0.006 wt%, 0.005 wt%, 0.004 wt%, 0.002 wt%, 0.001 wt%, 0.0001 wt% or less than 0.0001 wt% is present in the solvent or solution.

Solvents or solutions having nucleic acids (e.g., nucleic acid nanostructures, SNAP, complexes thereof, or components thereof) or other compositions set forth herein may be formulated to have a pH of a certain value or within a certain range of values. The solvent or solution may have at least about 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 1.3, 1.6 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12.0, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 13.3, 13.0, 13.13.5, 13.0, 13.13.0, 13.3, 13.5, 13.13.0, 13.7, 13.5, 13.0, 13.3, 13.0. Alternatively or in addition to this, the solvent or solution may have no more than about 14.0, 13.9, 13.8, 13.7, 13.6, 13.5, 13.4, 13.3, 13.2, 13.1, 13.0, 12.9, 12.8, 12.7, 12.6, 12.5, 12.4, 12.3, 12.2, 12.1, 12.0, 11.9, 11.8, 11.7, 11.6, 11.5, 11.4, 11.3, 11.2, 11.1, 11.0, 10.9, 10.8, 10.7, 10.6, 10.5, 10.4, 10.3, 10.2, 10.1, 10.0, 9.9, 9.8, 9.7, 9.6, 9.5, 9.4, 9.3, 9.2, 9.1, 9.0, 8.9, 8.8.8, 8.7, 8.6, 8.5, 8.4.3, 8.7, 7.1, 8.7, 7.7, 8.5, 7.7, 8.1, 7.2, 7.1 and 7. 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, 5.5, 5.4, 5.3, 5.2, 5.1, 5.0, 4.9, 4.8, 4.7, 4.6, 4.5, 4.4, 4.3, 4.2, 4.1, 4.0, 3.9, 3.8, 3.7, 3.6, 3.5 a pH of 3.4, 3.3, 3.2, 3.1, 3.0, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0 or less than about 0.

A nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) as set forth herein may be formed or modified at a particular temperature or temperature range. The temperature at which the nucleic acid is formed or modified may depend on the components used. For example, the addition of oligonucleotides to SNAP structures may be limited by the melting temperature of certain oligonucleotides. In another example, SNAP components conjugated by click reaction may be added at benign temperatures (such as room temperature). In some configurations, the nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) can be formed in a single step reaction (i.e., combining all necessary components) requiring multiple temperature changes (e.g., melting temperature, followed by nucleic acid annealing temperature, followed by conjugation reaction temperature). In other configurations, the nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) can be formed in multiple steps, each step having a unique temperature profile. The nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) formation process may occur at the following temperatures: at least about-100 ℃, -90 ℃, -80 ℃, -70 ℃, -60 ℃, -50 ℃, -40 ℃, -30 ℃, -20 ℃, -10 ℃, -5 ℃, 0 ℃, 4 ℃, 10 ℃, 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 90 ℃ or more than 90 ℃. Alternatively or additionally, the nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) formation process may occur at the following temperatures: no more than about 90 ℃, 80 ℃, 75 ℃, 70 ℃, 65 ℃, 60 ℃, 55 ℃, 50 ℃, 45 ℃, 40 ℃, 35 ℃, 30 ℃, 25 ℃, 20 ℃, 15 ℃, 10 ℃, 4 ℃, 0 ℃, -10 ℃, -20 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, 100 ℃ or less than-100 ℃.

The nucleic acids (e.g., nucleic acid nanostructures, SNAP, complexes thereof, or components thereof) as set forth herein may be stored in a suitable storage medium (e.g., a storage buffer). The nucleic acid may be stored at a temperature that maintains the storage medium in a liquid state. The nucleic acid may be stored at a temperature that causes the storage medium to freeze to a solid state. The nucleic acid may be stored before or after the analyte (e.g., polypeptide) has been coupled to the nucleic acid. The nucleic acids may be stored at temperatures within one or more of the ranges set forth above for forming nucleic acid nanostructures.

A nucleic acid as set forth herein (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) can remain stable during storage. Stability may be expressed by post-storage nucleic acid activity relative to a pre-storage baseline, such as the ability to couple an analyte (e.g., a polypeptide), the ability to couple with another nucleic acid, or the ability to associate with a surface or interface. Nucleic acids can be stabilized against aggregation or precipitation by the presence of surfactants or detergent substances. The nucleic acid may be stabilized against degradation (such as oxidation) by the presence of antioxidants or free radical scavengers. SNAP may be stable when stored for a period of at least about 1 hour, 6 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, or more than 10 years. Alternatively or additionally, the nucleic acid may be stable when stored for no more than about 10 years, 5 years, 4 years, 3 years, 2 years, 1 year, 9 months, 6 months, 5 months, 4 months, 3 months, 2 months, 1 month, 4 weeks, 3 weeks, 2 weeks, 1 week, 3 days, 2 days, 1 day, 12 hours, 6 hours, 1 hour, or less than 1 hour.

The nucleic acids as set forth herein may be provided as components of a kit. The kit may include a nucleic acid as set forth herein configured to couple with the analyte of interest. The kit may provide a nucleic acid as set forth herein or a plurality thereof. The collection kit may be specific to a particular assay performed on the sample. For example, a collection kit for use in a polypeptide assay may include polypeptide-specific reagents to protect and/or preserve the polypeptides within the sample. The collection kit may include one or more sample containers, one or more reagents, instructions for use of the sample collection kit and optionally intermediate sample containers, a sealant for the container, a label for the container such as a bar code or Radio Frequency Identification Device (RFID), or packaging for transporting and/or storing the sample containers. The kit may include one or more reagents for any of a variety of purposes including sample preservation, sample stability, sample quality control, processing and/or purification, and sample storage. The kit may include reagents such as buffers, acids, bases, solvents, denaturants, surfactants, detergents, reactants, labels (e.g., fluorophores, radiolabels), indicator dyes, enzymes, enzyme inhibitors, oxygen scavengers, water scavengers, wetting agents, affinity reagents (e.g., antibodies) or other capture agents (e.g., biotinylated particles). The kit may include one or more reagents in liquid or solid form. The kit may include one or more separate reagents and/or internal standards added to the sample container either before or after sample preparation. The kit may include one or more reagents and/or internal standards provided within the sample collection container. For example, the reagents and/or internal standards may be provided in crystalline or coated form on the surface of the collection vessel, or may be in a liquid solution within the collection vessel. In some configurations, the kit may further comprise an array or solid support as set forth herein. The array or solid support may be provided in a kit, wherein the one or more nucleic acids are present in or deposited on the array or solid support.

Kits for use in assays or other methods may be used in accordance with a set of instructions provided. The instructions may direct the use of nucleic acids according to the teachings set forth herein. The kit may provide instructions for coupling the target analyte to the nucleic acid, for example, by the methods set forth herein. The kit may provide instructions for depositing a nucleic acid as set forth herein or a nucleic acid coupled to an analyte of interest onto an array or solid support as set forth herein. The kit may be used by a technician or by self-collection subject. The skilled person using the kit may receive special training in the correct use of the kit. The kit protocol may employ one or more intermediate steps prior to completion of sample preparation. The intermediate steps during sample preparation may be performed in a container or in a separate medium (provided with the kit or by the collector). For example, a blood sample may be fractionated by a phlebotomist, preserving only red blood cells or plasma fractions for preparation. The kit may include an indicator dye, litmus paper, or other method of confirming successful sample collection and/or preparation. The kit may include a sealant (e.g., an adhesive or cohesive) to ensure that the sample is not tampered with or damaged during storage or transport. The kit may include a label for sample tracking by the collector or the analysis device. The label of the container may include a serial number, RFID, bar code or QR code. The label of the container may be pre-printed or pre-applied to the container or may be placed by the collector.

Nucleic acid production method

Nucleic acids (e.g., nucleic acid nanostructures, SNAP, complexes thereof, or components thereof) as described in the present disclosure can be made by suitable methods. The manufacture of the nucleic acid may comprise one or more of the following steps: 1) Providing a scaffold nucleic acid strand configured to couple a plurality of oligonucleotides; 2) Providing a plurality of oligonucleotides configured to be coupled to a scaffold strand; 3) Providing one or more additional oligonucleotides configured to be coupled to the scaffold nucleic acid strand or other oligonucleotide; 4) Providing one or more oligonucleotides configured to couple to a scaffold nucleic acid strand and further configured to couple to an analyte; 5) Providing one or more oligonucleotides configured to couple to a scaffold nucleic acid strand and to couple to an analyte; 6) Providing one or more oligonucleotides configured to couple to a scaffold nucleic acid strand and further configured to couple to a surface; 7) Annealing the scaffold nucleic acid strand to a plurality of oligonucleotides to form SNAP; 8) Annealing the scaffold strand to an oligonucleotide configured to couple with an analyte; 9) Annealing the scaffold strand to an oligonucleotide, the oligonucleotide coupled to an analyte; 10 Annealing the scaffold strand to an oligonucleotide configured to be coupled to a surface; and 11) forming one or more couplings or crosslinks between two or more oligonucleotides of the nucleic acid.

The manufacture of the detectable probes comprising the nucleic acid retaining component (e.g., DNA fold, DNA nanosphere) can be formed by conventional techniques. The DNA nanospheres can be fabricated by methods such as rolling circle amplification to produce scaffold chains that can be further modified to couple or conjugate multiple binding components and/or detectable labels. An exemplary method for making nucleic acid nanospheres is described, for example, in U.S. patent No. 8,445,194, which is incorporated herein by reference. Nucleic acid-retaining components comprising double-stranded DNA (e.g., DNA fold) segments can be made, for example, using techniques described in the following documents: rothemund, nature440:297-302 (2006) and U.S. Pat. Nos. 8,501,923 and 9,340,416, each of which is incorporated herein by reference. The retention component may be formed from a scaffold strand hybridized to an additional oligonucleotide.

FIG. 36A shows a first approach to forming SNAP comprising a DNA fold coupled to a plurality of analytes and a plurality of detectable labels. Prior to assembly of the retention components, an oligonucleotide with coupled or conjugated analyte 3620 and an oligonucleotide with conjugated detectable label 3630 are prepared. The oligonucleotide with conjugated binding component 3620 and the oligonucleotide with conjugated or conjugated detectable label 3630 are contacted with single-stranded scaffold 3610 (e.g., M13 phage DNA, single-stranded plasmid DNA) and additional structural nucleic acid 3640. The nucleic acids are contacted in a suitable DNA buffer at an elevated temperature (e.g., at least about 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃, 90 ℃, or about 95 ℃) and then cooled. The oligonucleotides will hybridize to the scaffold strand 3610 at the appropriate sequence-dependent positions to form SNAP-analyte conjugates 3650. The amount of analyte coupled to SNAP may be controlled by using fewer or greater numbers of oligonucleotides coupled to or configured to be coupled to the analyte or by altering the sequence of the scaffold strand.

FIG. 36B shows an alternative pathway for forming SNAP with multiple coupled analytes and multiple detectable labels. Prior to assembly of the retention component, an oligonucleotide having a handle configured to couple or conjugate with the analyte 3625 and an oligonucleotide having a moiety configured to couple or conjugate with the detectable label 3635 are prepared. An oligonucleotide having a moiety configured to conjugate an analyte 3625 and an oligonucleotide having a moiety configured to couple or conjugate a detectable label 3635 are contacted with a single-stranded scaffold 3610 (e.g., M13 phage DNA, plasmid DNA) and additional structural nucleic acid 3640. The nucleic acids are contacted in a suitable DNA buffer at an elevated temperature (e.g., at least about 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃, 90 ℃, or about 95 ℃) and then cooled. Upon cooling, SNAP 3655 is formed, which is configured to bind a plurality of analyte and/or label components. The retention component 3655 is contacted with a plurality of analytes 3628 and/or a labeling component 3638 having a moiety complementary to the moiety on SNAP 3655 in a suitable conjugation buffer. SNAP-analyte conjugate 3650 is formed after coupling or conjugation of the plurality of analytes 3628 and/or the plurality of label components 3638.

In some configurations, a detectable nucleic acid (e.g., nucleic acid nanostructure, SNAP) as set forth herein can be formed by coupling or conjugating an analyte and/or a labeling component in the following manner: a reaction of a reactive group configured to form a bond with another molecule or group, such as a bio-orthogonal reaction or click chemistry (see, e.g., U.S. patent nos. 6,737,236 and 7,427,678, each of which is incorporated herein by reference in its entirety); azide-alkyne Huisgen cycloaddition reactions using copper catalysts (see, e.g., U.S. patent nos. 7,375,234 and 7,763,736, each of which is incorporated herein by reference in its entirety); a copper-free Huisgen reaction ("no metal click") using strained alkyne or triazine-hydrazine moieties that can be linked to aldehyde moieties (see, e.g., U.S. patent No. 7,259,258, incorporated by reference), triazine chloride moieties that can be linked to amine moieties, carboxylic acid moieties that can be linked to amine moieties using coupling reagents such as EDC, thiol moieties that can be linked to thiol moieties, alkene moieties that can be linked to diene moieties coupled by diels-alder reaction, and acetyl bromide moieties that can be linked to phosphorothioate moieties (see, e.g., WO 2005/065814, incorporated by reference). The reactive handle may comprise a functional group configured to react by a click reaction (e.g., a metal catalyzed azide-alkyne cycloaddition reaction, a strain promoted azide-nitrone cycloaddition reaction, a strained alkene reaction, a thiol-ene reaction, a diels-alder reaction, a reverse electron demand diels-alder reaction, [3+2] cycloaddition reaction, [4+1] cycloaddition reaction, a nucleophilic substitution reaction, a dihydroxylation reaction, a thiol-alkyne reaction, a light-click reaction, a nitrone dipolar cycloaddition reaction, a norbornene cycloaddition reaction, an oxanorbornadiene cycloaddition reaction, a tetrazine ligation reaction, a tetrazole light-click reaction). Exemplary silane-derived click reactants may include alkenes, alkynes, azides, epoxides, amines, thiols, nitrones, isonitriles, isocyanides, aziridines, active esters, and tetrazines (e.g., dibenzocyclooctyne-azide, methyltetrazine-trans-cyclooctene, epoxide-thiols, etc.). Click-type reactions can provide an advantageous method of rapidly forming bonds under benign conditions (e.g., room temperature, aqueous solvents). In some configurations, SNAP may comprise a cross-linking molecule that forms a bond that irreversibly couples a first SNAP component to a second SNAP component. Crosslinking molecules may include chemical crosslinking molecules and photoinitiated crosslinking molecules.

In some configurations, the nucleic acid or other component of the nucleic acid may include different types of reactive groups. The use of different reactive groups may provide a degree of control over the number and location of the different components to be coupled or conjugated to the nucleic acid. In a particular configuration, the different reactive groups exhibit orthogonal reactivity whereby the first component has a moiety that reacts with a first reactive handle on the probe (i.e., a reactive moiety) but does not substantially react with a second reactive handle on the probe, and whereby the second component has a moiety that reacts with the second reactive handle but does not react with the first reactive handle. Thus, the number of different analytes and their positions can be adjusted by appropriate use of orthogonal reactive shanks on the detectable probes, or the number of different labeling components and their positions can be adjusted by appropriate use of orthogonal reactive shanks on the detectable probes. Furthermore, by appropriate use of orthogonal reactive handles on nucleic acids, respectively, analytes can be localized differently than the labeling components on nucleic acids.

After synthesis of a nucleic acid as set forth herein (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof), the formed structure may be purified by one or more additional methods. The nucleic acid may undergo one or more separation processes to remove unwanted components, such as one or more of the following: 1) Uncoupled oligonucleotides; 2) Unconjugated analyte; 3) Unconjugated modifying groups; 4) A buffer component; 5) A partially formed nucleic acid; 6) A falsely formed nucleic acid; and 7) excess nucleic acid. The nucleic acid may undergo a dilution or concentration process to adjust the concentration of the nucleic acid-containing solution. The nucleic acid may be separated from the unwanted components by any suitable method including, but not limited to, for example, high Pressure Liquid Chromatography (HPLC), size Exclusion Chromatography (SEC), affinity chromatography, ultracentrifugation, permeation, reverse osmosis, and ultrafiltration. In some configurations, the separation can be performed on a separation medium (e.g., a chromatographic column) that is not designated for nucleic acid separation. In some configurations, the separation can be performed on a separation medium (e.g., a chromatographic column) that is not specified for the desired hydrodynamic size range of the isolated nucleic acid.

Polypeptide assay

The present disclosure provides systems, compositions, and methods useful for forming particles useful for coupling single analytes. The present disclosure also provides systems, compositions, and methods for forming single analyte arrays useful when performing various single analyte assays, including assays of biological analytes (e.g., genomics, transcriptomics, proteomics, metabolomics, etc.) and non-biological analytes (e.g., carbon nanoparticles, inorganic nanoparticles, etc.). In some configurations, the provided single analyte arrays may be particularly useful for single polypeptide proteome assays, such as affinity reagent-based characterization assays (e.g., fluorescence-based or barcode-based affinity binding characterization) or peptide sequencing assays (e.g., edman-type degradation fluorescence sequencing or affinity reagent-based assays).

The present disclosure also provides methods for detecting one or more polypeptides (e.g., sample polypeptides, standard polypeptides, etc.) or polypeptide products (e.g., sample polypeptide complexes, standard polypeptide complexes, etc.). One or more probes having known binding affinity for the polypeptide may be used to detect the polypeptide. Probes and/or polypeptides may bind to form a complex, and then the formation of the complex may be detected. The complex may be detected directly, for example, due to the presence of a label on the probe or polypeptide. In some configurations, it is not necessary to directly detect the complex, e.g., to form a complex, and then detect the form of the probe, polypeptide, or tag or label component present in the complex.

In some detection assays, proteins may be circularly modified and modified products from separate cycles may be detected. In some configurations, the protein may be sequenced by a sequential process, wherein each cycle includes the steps of labeling and removing the amino terminal amino acids of the protein and detecting the label. Thus, a method of detecting a protein may comprise the steps of: (i) exposing terminal amino acids on the protein; (ii) detecting a change in signal from the protein; and (iii) identifying the type of amino acid removed based on the change detected in step (ii). The terminal amino acids may be exposed, for example, by removing one or more amino acids from the amino-or carboxy-terminus of the protein. Steps (i) to (iii) may be repeated to produce a series of signal changes indicative of the protein sequence.

In a first configuration of the above method, one or more types of amino acids in the protein may be attached to a tag that uniquely identifies the type of amino acid. In this configuration, the signal change identifying the amino acid may be a loss of signal from the corresponding tag. Exemplary compositions and techniques that can be used to remove amino acids from proteins and detect signal changes are those set forth in the following documents: swaminathan et al, nature Biotech.36:1076-1082 (2018); or U.S. patent No. 9,625,469 or 10,545,153, each of which is incorporated herein by reference. Methods and apparatus developed by ericyon corporation (Austin, TX) can also be used to detect proteins.

In a second configuration of the above method, the terminal amino acid of the protein may be recognized by an affinity reagent that is specific for the terminal amino acid or for a labeling moiety present on the terminal amino acid. The affinity reagent may be detected on the array, for example, due to a label on the affinity reagent. Optionally, the label is a nucleic acid barcode sequence that is added to the primer nucleic acid at the time of complex formation. The formation of the complex and the identity of the terminal amino acid can be determined by decoding the barcode sequence. Exemplary affinity reagents and detection methods are set forth in U.S. patent application publication nos. 2019/0145982A1, 2020/0348108 A1 or 2020/0348307A1, each of which is incorporated herein by reference. Methods and apparatus developed by Encodia corporation (San Diego, calif.) can also be used to detect proteins.

Cyclic removal of terminal amino acids from proteins can be performed using Edman-type sequencing reactions in which phenyl isothiocyanate is reacted with an N-terminal amino group under slightly alkaline conditions (e.g., about pH 8) to form a cyclic phenylthiocarbamoyl Edman complex derivative. The phenyl isothiocyanate may be substituted or unsubstituted with one or more functional groups, linking groups, or linking groups containing functional groups. The Edman-type sequencing reaction may include variations in reagents and conditions that result in detectable amino acid removal from the ends of the protein, thereby facilitating the determination of the amino acid sequence of the protein or portion thereof. For example, the phenyl group may be replaced by at least one aromatic, heteroaromatic or aliphatic group that may participate in an Edman-type sequencing reaction, non-limiting examples of which include: pyridine, pyrimidine, pyrazine, pyridine oxazoline (pyridazoline), fused aromatic groups such as naphthalene and quinoline, methyl or other alkyl groups or alkyl group derivatives (e.g., alkenyl, alkynyl, cycloalkyl). Under certain conditions (e.g., acidic conditions at about pH 2), the derivatized terminal amino acid may be cleaved, for example, to a thiazolinone derivative. Thiazolinone amino acid derivatives can form more stable hydantoin thioureas (PTH) or similar amino acid derivatives that can be detected under acidic conditions. This procedure can be repeated iteratively for the remaining protein to identify subsequent N-terminal amino acids. Many variants of Edman-type degradation have been described and can be used, including for example the one-step removal of the N-terminal amino acid using alkaline conditions (Chang, j.y., FEBS litts., 1978,91 (1), 63-68). In some cases, edman-type reactions may be hindered by N-terminal modifications that may be selectively removed (e.g., N-terminal acetylation or formylation) (see, e.g., gheorghe M.T., bergman T. (1995) in Methods in Protein Structure Analysis, chapter 8: deacetylation and internal cleavage of Proteins for N-terminal Sequence analysis. Springer, boston, MA. Https:// doi. Org/10.1007/978-1-4899-1031-8_8).

Non-limiting examples of functional groups for substituted phenyl isothiocyanates can include ligands of known receptors (e.g., biotin and biotin analogs), labels such as luminophores, or reactive groups such as click functional groups (e.g., compositions having azide or acetylene moieties). The functional group may be a DNA, RNA, peptide or small molecule barcode or other tag that may be further processed and/or detected.

Removal of the amino terminal amino acid using the Edman-type method utilizes at least two main steps, the first step comprising reacting an isothiocyanate or equivalent with the N-terminal residue of the protein to form a relatively stable Edman complex, such as a phenylthiocarbamoyl complex. The second step includes removing the derivatized N-terminal amino acid, for example, via heating. Proteins that have now been shortened by one amino acid can be detected, for example, by contacting the protein with a labeled affinity reagent complementary to the amino terminus and checking for binding of the protein to the reagent, or by detecting the loss of the label attached to the removed amino acid.

The Edman-type method can be performed in multiplexed format to detect, characterize or identify a variety of proteins. The method for detecting a protein may comprise the steps of: (i) Exposing terminal amino acids on the protein at the address of the array; (ii) Binding an affinity reagent to the terminal amino acid, wherein the affinity reagent comprises a nucleic acid tag, and wherein a primer nucleic acid is present at the address; (iii) Extending the primer nucleic acid, thereby producing an extended primer having one copy of the tag; and (iv) detecting the tag of the extended primer. The terminal amino acids may be exposed, for example, by removing one or more amino acids from the amino-or carboxy-terminus of the protein. Steps (i) to (iv) may be repeated to generate a series of tags indicative of the protein sequence. The method can be applied in parallel to a variety of proteins on an array. Regardless of how complex, primer extension can be performed by, for example, polymerase-based extension of the primer using the nucleic acid tag as a template. Alternatively, the extension of the primer may be performed by, for example, ligase-based or chemical-based ligation of the primer to the nucleic acid hybridized to the nucleic acid tag. Nucleic acid tags can be detected by: hybridization to nucleic acid probes (e.g., in an array), amplification-based detection (e.g., PCR-based detection or rolling circle amplification-based detection), or nucleic acid sequencing (e.g., a cyclic reversible terminator method, a nanopore method, or a single molecule real-time detection method). Exemplary methods that may be used to detect proteins using nucleic acid tags are set forth in U.S. patent application publication nos. 2019/0145982 A1, 2020/0348108 A1, or 2020/0348307 A1, each of which is incorporated herein by reference.

Polypeptides may also be detected based on their enzymatic or other biological activity. For example, the polypeptide may be contacted with a reactant that is converted to a detectable product by the enzymatic activity of the polypeptide. In other assay formats, a first polypeptide having a known enzymatic function may be contacted with a second polypeptide to determine whether the second polypeptide alters the enzymatic function of the first polypeptide. Thus, the first polypeptide serves as a reporter system for detecting the second polypeptide. Exemplary changes that may be observed include, but are not limited to, activation of an enzyme function, inhibition of an enzyme function, degradation of the first polypeptide, or competition for reactants or cofactors used by the first polypeptide.

The presence or absence of post-translational modification (PTM) may be detected using the compositions, devices, or methods set forth herein. PTM may be detected using an affinity reagent that recognizes PTM or based on the chemical properties of PTM. Exemplary PTM that may be detected, identified or characterized include, but are not limited to, myristoylation, palmitoylation, prenylation (isoperification), prenylation (presyl), farnesylation, geranylgeranylation (geranylgeranylation), lipidylation, flavin moiety attachment, heme C attachment, phosphopantetheination (phosphopantetheinyl), retinylidene schiff base formation, diphtheria amide (dipeptidomide) formation, ethanolamine phosphoglyceride attachment, 8-hydroxy 2,7,10-triaminocarpric acid (hypusine), beta lysine addition, acylation, acetylation, deacetylation, formylation, alkylation, methylation, C-terminal amidation, arginine, polyglutamic acylation (butyrylation), butyrylation, gamma carboxylation, glycosylation, saccharification, polysialization, malonyl, hydroxylation, iodination, nucleotide addition, phosphate formation, phosphoramidation, phosphorylation, adenylation, uridylylation, propionyl, pyroglutamate formation, S-glutathionylation, S-nitrosylation, S-sulfinylation, S-sulfonylation, succinylation, sulfation, saccharification, carbamylation, carbonylation, isopeptide bond formation, biotinylation, carbamylation, oxidation, reduction, pegylation, ISG-ation, sumoylation, ubiquitination (nepdatation), pup-ylation, citrullination, deamination, elminylation, disulfide bridge formation, proteolytic cleavage, isoaspartate formation, racemization and protein splicing.

PTM may occur at specific amino acid residues of a protein. For example, the phosphate moiety of a particular protein form (proteocord) may be present on serine, threonine, tyrosine, histidine, cysteine, lysine, aspartic acid or glutamic acid residues of the protein. In other examples, the acetyl moiety may be present at the N-terminus or on lysine; serine or threonine residues can have an O-linked glycosyl moiety; asparagine residues may have an N-linked glycosyl moiety; proline, lysine, asparagine, aspartic acid or histidine amino acids may be hydroxylated; arginine or lysine residues may be methylated; or the N-terminal methionine or lysine amino acid may be ubiquitinated.

Polypeptides may also be detected based on their binding interactions with other molecules, such as polypeptides (e.g., with or without post-translational modifications), nucleic acids, nucleotides, metabolites, small molecules involved in biological signal transduction pathways, biological receptors, and the like. For example, a polypeptide involved in a signal transduction pathway may be identified by detecting binding of the polypeptide to a second polypeptide known to be its binding partner in the pathway. In general, a target polypeptide may be conjugated to SNAP or SNAP complex and then contacted with a probe polypeptide or other probe molecule known to have affinity for the polypeptide. The target polypeptide may be identified based on the observed binding of the probe molecule or lack of binding of the probe molecule. The probe molecules may optionally be labeled using labels as set forth herein or as known in the art.

In some configurations of the polypeptide detection methods set forth herein, the polypeptide can be detected on a solid support. For example, a polypeptide may be attached to a support, which may be contacted with a probe in solution, which may interact with the polypeptide to produce a detectable signal, which may then be detected to determine the presence of the polypeptide. In a multiplexed version of the method, different polypeptides may be attached to different addresses in the array, and the detection and detection steps may occur in parallel. In another example, a probe may be attached to a solid support, which may be contacted with a polypeptide in solution, which may interact with the probe to produce a detectable signal, which may then be detected to determine the presence of the polypeptide. The method may also be multiplexed by attaching different probes to different addresses of the array. The polypeptide may be attached to the support by conjugation to SNAP or SNAP complexes. For example, a plurality of polypeptides may be conjugated to a plurality of SNAP or SNAP complexes such that each SNAP or SNAP complex conjugated to a polypeptide forms an address in an array. In yet another method, mass spectrometry can be used to detect polypeptides. Several exemplary detection methods are set forth below and elsewhere herein. It should be appreciated that other detection methods may be used.

Typical polypeptide detection methods, such as enzyme-linked immunosorbent assays (ELISA), achieve high confidence characterization of one or more polypeptides in a sample by utilizing high specificity binding of antibodies, aptamers, or other binding agents to the polypeptides and detecting binding events while ignoring all other polypeptides in the sample. ELISA is typically performed at low complexity scales (e.g. parallel or serial detection of one to several hundred different polypeptides), but can be used at higher complexity. One or more polypeptides may be conjugated to one or more SNAP or SNAP complexes, and the conjugated polypeptides may be detected using ELISA.

The ELISA method can be performed by: detecting immobilized binding reagents and/or polypeptides in a multiwell plate, detecting immobilized binding reagents and/or polypeptides on an array, or detecting immobilized binding reagents and/or polypeptides on particles in a microfluidic device. Exemplary board-based methods include, for example, MULTI-ARRAY technology commercialized by MesoScale Diagnostics (Rockville, maryland) or Simple Plex technology commercialized by Protein Simple (San Jose, calif.). Exemplary array-based methods include, but are not limited to, the use of commercial exploitation by Quantix (Billerica, mass.) Planar array technology or->Those of bead technology. Further exemplary array-based methods are set forth in U.S. patent nos. 9,678,068, 9,395,359, 8,415,171, 8,236,574, or 8,222,047, each of which is incorporated herein by reference. An exemplary microfluidic detection method includes the trade nameMethods of technology commercialized by Luminex (Austin, texas), or identified as100/200 or FEXMAP->Is used on a platform. The plate-based method of the microfluidic detection method may be modified to use SNAP or SNAP complexes as set forth herein.

Other detection methods that may also be used and are particularly useful at low complexity scales include the use of SOMAmer reagents and procedures for SOMAscan assays that are commercially available from Soma Logic (Boulder, CO). In one configuration, the sample is contacted with an aptamer that is capable of binding the polypeptide with high specificity for the amino acid sequence of the polypeptide. The resulting aptamer-polypeptide complex can be separated from other sample components, for example, by attaching the complex to a bead, SNAP or SNAP complex removed from the sample. The aptamer may then be isolated and, because the aptamer is a nucleic acid, detected using any of a variety of methods known in the art for detecting nucleic acids, including, for example, hybridization to a nucleic acid array, PCR-based detection, or nucleic acid sequencing. Exemplary methods and compositions for aptamer-based or other detection methods set forth herein are set forth in U.S. patent nos. 8,404,830, 8,975,388, 9,163,056, 9,938,314, 10,239,908, 10,316,321, or 10,221,207. Further examples are set forth in U.S. patent nos. 7,855,054, 7,964,356, 8,975,026, 8,945,830, 9,404,919, 9,926,566, 10,221,421, 10,316,321, or 10,392,621. The above-mentioned patents are incorporated herein by reference. The aptamer or polypeptide set forth above or in the above references may be attached to SNAP or SNAP complex as set forth herein.

Polypeptides may also be detected based on the proximity of two or more probes. For example, two probes may each include a receptor component and a nucleic acid component. When probes bind adjacent to each other, for example, due to the presence of a ligand for the respective receptor on a single polypeptide or due to the presence of ligands on two polypeptides that are associated with each other, the nucleic acids may interact to cause a modification indicative of the proximity. For example, one nucleic acid may extend using another nucleic acid as a template, one nucleic acid may form a template that positions another nucleic acid for ligation with another nucleic acid, and so on. Exemplary methods are commercialized by Olink Proteomics AB (Uppsala Sweden) or set forth in U.S. patent nos. 7,306,904, 7,351,528, 8,013,134, 8,268,554, or 9,777,315, each of which is incorporated herein by reference. The polypeptides, probes, ligands, or receptors set forth above or in the above references may be attached to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) as set forth herein.

The method of detecting a polypeptide may comprise the step of detecting a sample polypeptide (e.g., a sample polypeptide conjugate) and/or detecting a standard polypeptide (e.g., a standard polypeptide conjugate). In one configuration, the detecting may include the steps of: (i) Contacting the first set of binding reagents with the sample polypeptide and/or the standard polypeptide, and (ii) detecting binding of the sample polypeptide and/or the standard polypeptide to the binding reagents in the second set of binding reagents. The method may optionally include one or more of the further steps of: (iii) Removing the first set of binding reagents, (iv) binding a second set of binding reagents to the sample polypeptide and/or the standard polypeptide, wherein the binding reagents in the second set are different from the binding reagents in the first set, and (v) detecting binding of the sample polypeptide and/or the standard polypeptide to the binding reagents in the second set. The method may optionally be performed on one or more sample polypeptides or standard polypeptides in an array. Methods and apparatus employing standard polypeptides are described in the following documents: U.S. patent application Ser. No. 63/139,818, which is incorporated herein by reference. The sample polypeptides or standard polypeptides set forth above or in the above references may be attached to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof) as set forth herein.

Highly specific binding reagents can be used in a number of polypeptide detection methods. Alternatively, the detection may be based on multiple cycles of low specificity detection performed on the sample, such that individual cycles may detect multiple polypeptides without having to distinguish one detected polypeptide from another in any one cycle. However, using the compositions and methods set forth herein, results from multiple cycles can be combined to achieve high confidence quantification, identification, or characterization of multiple individual polypeptides in a sample. In many embodiments, one or more individual cycles produce ambiguous results with respect to distinguishing the identity of the subset of polypeptides that produce the detectable signal; however, characterizing the signal in multiple cycles allows individual and unequivocal identification of individual polypeptides. The resulting set of identified polypeptides may be greater than the number of polypeptides that generate a signal from any single cycle.

Some configurations of detection methods based on multiple low specificity detection cycles can be understood to some extent by analogy to the children's game "20 questions". The goal of this game is to identify the target answer among as few questions as possible. An effective tactic is to raise questions about features ranging from broad features (e.g., "it is a person, a place, or a thing. In general, by raising a much smaller number (N) of questions than the possible number (M) of answers, i.e., N < < M, it is possible to identify a character in a game. By way of analogy, affinity reagents used in some configurations of the detection methods set forth herein may have a broad interaction with a population of polypeptides. For example, an affinity reagent may be considered a 'promiscuous' affinity reagent because it has affinity for a single epitope present in a plurality of different polypeptides in a sample, or because it has affinity for a plurality of different epitopes present in one or more polypeptides in a sample. Information can be obtained by testing the interaction of the affinity reagent with the polypeptide, whether or not the interaction is observed. For example, an inability of the affinity reagent to bind to the polypeptide indicates that the polypeptide lacks an epitope for the affinity reagent.

In analogy to the 20 questions above, the results are based on clear expressions of queries and answers, and are also based on accurate and reliable answers (e.g., type, size, attributes, etc.). By analogy, it may be more difficult to characterize a polypeptide by measuring affinity reagent interactions when the measurement is prone to some degree of systematic or random error or uncertainty. For example, the accuracy of measurement of the interaction of an affinity reagent (e.g., an antibody) with a binding target (e.g., an epitope) may be affected by a number of factors, such as the detection limit or sensitivity of the system, non-specific interactions between the epitope and the affinity reagent (false positives), or random, time-dependent reversal of interactions (false negatives).

It is not uncommon for polypeptide characterization measurements to contain a degree of uncertainty. By combining probability decoding methods with multiple low specificity detection cycles, high confidence characterization can be achieved. Superposition or combination of binary polypeptide interaction data (e.g., no interaction of the affinity reagent A1 with epitope X with the unknown polypeptide P is observed, and thus the polypeptide P does not contain epitope X) may lead to incorrect characterization of the polypeptide due to inclusion or exclusion of possible candidate states resulting from measurement errors. In contrast, superimposing or combining probabilistic polypeptide interaction data may allow the algorithm to converge to a high confidence prediction of polypeptide identity without the need to exclude any candidate states. For example, if affinity reagents A1 through A6 are known to interact with known polypeptide P1 with a probability of interaction, and measurable interactions of affinity reagents A2, A5, and A6 with unknown polypeptide P are observed, it can be inferred that polypeptide P may not be polypeptide P1 (2 out of 3 possible interactions are not observed; 2 out of 3 impossible interactions are observed). Furthermore, a confidence may be assigned to the probability-based characterization such that each observed polypeptide may be predicted when the confidence rises above a threshold confidence. For example, in the above observations of polypeptide P, six of the described observations need not provide a high enough confidence to exclude polypeptide P1 as a possible identity, but similar trends over 20 or more affinity reagents may provide a high enough confidence to exclude P1 as a possible identity. Thus, polypeptide P1 may undergo a binding reaction with a range of confounding affinity reagents, and while observations obtained from each binding reaction alone may be ambiguous for identifying a polypeptide, decoding observations from a range of binding reactions may identify polypeptide P1 with an acceptable level of confidence.

Polypeptide detection assays based on multiple low specificity detection cycles may be configured to allow polypeptide characterization at the individual molecule or single molecule level. The polypeptides to be characterized may be provided on a solid support containing unique, detectably distinguishable characterization sites. For example, a polypeptide may be attached to a site by conjugation to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof). Such characterization sites may be spaced apart, arranged or otherwise ordered to allow for the presence of a single siteThe individual sites are distinguished from each other when their interaction with the affinity reagent is detected. The solid support may comprise a sufficient number of unique, optically-distinguishable characterization sites to accommodate multiple, most or all polypeptides from the sample, such as at least about 1x10 ⁴ 1x10 ⁵ 1x10 ⁶ 1x10 ⁷ 1x10 ⁸ 1x10 ⁹ 1x10 ¹⁰ 1x10 ¹¹ 1x10 ¹² One or more than 1x10 ¹² A single site. Each site may contain a known number of polypeptides to be characterized. In some cases, the characterization site may contain a single polypeptide molecule to be detected, identified, or characterized. In other cases, the site may contain a plurality of polypeptide molecules, at least one of which is to be detected. For example, the polypeptide molecule to be detected may be one subunit of a larger protein having a plurality of different subunits.

In some cases, polypeptide detection assays based on multiple low specificity detection cycles may utilize affinity reagents, such as antibodies (or functional fragments thereof), aptamers, small protein binders, or any other suitable binding reagents. The affinity reagent may be a hybrid affinity reagent that has the potential to interact (e.g., bind) with more than one polypeptide in the sample. In some cases, the affinity reagent may have the potential to interact with two or more unique, structurally distinct proteins in the sample. For example, based on regions of structural similarity, affinity reagents may bind to a particular membrane protein and a particular cytoplasmic protein with nearly equal probability. In some cases, binding affinity reagents may have the potential to bind to a particular amino acid epitope or family of epitopes, regardless of the sequence context (e.g., amino acid sequences upstream and/or downstream of the epitope). The affinity reagent may bind to a polypeptide conjugated to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof).

Affinity reagents for multiple low specificity detection cycles can be characterized such that they have an identified, determined, or assessed probability-based binding profile. The affinity reagent can have a property that binds to a first polypeptide with an identified, determined, or assessed binding probability of greater than about 50% (e.g., at least about 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, 99.99%, 99.999%, or greater than about 99.999%) and binds to a second structurally non-identical polypeptide with an identified, determined, or assessed binding probability of less than about 50% (e.g., no more than about 50%, 40%, 30%, 20%, 10%, 5%, 1%, 0.1%, 0.01%, 0.001%, or less than about 0.001%). In particular cases, the difference in the observed binding probabilities of the affinity reagent to the first polypeptide and the second polypeptide may be due to the presence, absence or accessibility of a particular epitope or family of epitopes in the first polypeptide or the second polypeptide. Probabilistic affinity binding profiles can be determined or identified by in vitro measurements or computer simulation predictions.

The polypeptide detection method based on a plurality of low specificity detection cycles may further incorporate computational decoding methods optimized for the above-described affinity reagents. The decoding method may superimpose or combine data from multiple rounds of detection of interactions of affinity reagents with individual polypeptides, and may assign confidence to signal detection from each polypeptide. For example, affinity reagent interactions may be detected at each site in an array of sites, and the detection of each signal at each site may be given a degree of confidence. Similarly, a series of detection events for each site may be given a degree of confidence. A polypeptide may be considered identified or characterized if the confidence of the prediction based on the superimposed or combined affinity reagent interaction data exceeds a threshold confidence. The threshold confidence in the prediction of polypeptide characterization may depend on the nature of the characterization. The threshold confidence level may fall within a range from about 50% to about 99.999%, such as about 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.99%, or about 99.999%. In some cases, the threshold confidence level may be outside of this range. In some cases, computational decoding methods may incorporate machine learning or training algorithms to update or refine the determined or identified probability interaction spectrum of an affinity agent or polypeptide with increased information or in an ever-expanding context.

Particularly useful methods and algorithms that can be used for detection methods employing multiple low specificity detection cycles are described in, for example, U.S. patent No. 10,473,654; or PCT publication No. WO 2019/236749A2; or U.S. patent application publication nos. 2020/0082914A1 or 2020/0090785A1, each of which is incorporated herein by reference. The methods set forth above and in the foregoing references may be modified to use the SNAP or SNAP complexes of the present disclosure, e.g., to attach a polypeptide to a solid support.

A method of detecting a polypeptide may comprise a process of detecting a sample polypeptide, the process comprising the steps of: (i) Binding a first binding reagent to a sample polypeptide at an array address, wherein the binding reagent comprises a nucleic acid tag, and wherein a primer nucleic acid is present at the address; (ii) Extending the primer nucleic acid, thereby producing an extended primer having one copy of the tag; and (iii) detecting the tag of the extended primer. The polypeptide may be attached at the address of the array by conjugation to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof). The extension of the primer may be performed by polymerase-based extension of the primer, for example, using a nucleic acid tag as a template. Alternatively, the extension of the primer may be performed by, for example, ligase-based or chemical-based ligation of the primer to the nucleic acid hybridized to the nucleic acid tag. The nucleic acid tag can be detected by: hybridization with nucleic acid probes (e.g., in a microarray), amplification-based detection (e.g., PCR-based detection or rolling circle amplification-based detection), or nucleic acid sequencing (e.g., a cyclic reversible terminator method, a nanopore method, or a single molecule real-time detection method). Exemplary methods that can be used to detect polypeptides using nucleic acid tags are set forth in the following documents: U.S. patent application publication nos. 2019/0145982A1, 2020/03481308 A1 or 2020/0348307A1, each of which is incorporated herein by reference.

A method of detecting a polypeptide may comprise a process of detecting a sample polypeptide, the process comprising the steps of: (i) exposing a terminal amino acid on the polypeptide; (ii) detecting a change in signal from the polypeptide; and (iii) identifying the type of amino acid removed based on the change detected in step (ii). The terminal amino acids may be exposed, for example, by removing one or more amino acids from the amino-terminus or carboxy-terminus of the polypeptide. Steps (i) to (iii) may be repeated to produce a series of signal changes indicative of the polypeptide sequence. Optionally, one or more different polypeptides may be attached at respective addresses of the polypeptide array, for example, by conjugation with a nucleic acid (e.g., nucleic acid nanostructure, SNAP, complex thereof, or component thereof) at the address. Signal changes may optionally be detected at one or more addresses on the array.

In a first configuration of the above method, one or more types of amino acids in the polypeptide may be attached to a tag that uniquely identifies the type of amino acid. In this configuration, the signal change identifying the amino acid may be a loss of signal from the corresponding tag. Exemplary compositions and techniques that can be used to remove amino acids from proteins and detect signal changes are set forth in the following documents: swaminathan et al, nature Biotech.36:1076-1082 (2018); or U.S. patent No. 9,625,469 or 10,545,153, each of which is incorporated herein by reference. The polypeptide may be attached to the solid support by conjugation to SNAP or SNAP complexes.

In a second configuration of the above method, the terminal amino acid of the polypeptide may be recognized by a binding reagent that is specific for the terminal amino acid or for a tag moiety present on the terminal amino acid. Binding reagents may be detected on the array, for example, due to labels on the binding reagents. Exemplary binding reagents and detection methods are set forth in the following documents: U.S. patent application publication nos. 2019/0145982A1, 2020/03481308 A1 or 2020/0348307A1, each of which is incorporated herein by reference. The polypeptide may be attached to the solid support by conjugation to a nucleic acid (e.g., a nucleic acid nanostructure, SNAP, complex thereof, or component thereof).

A method of detecting a polypeptide may comprise a process of detecting a sample polypeptide of a polypeptide array, the process comprising the steps of: (i) Exposing terminal amino acids on the polypeptides at the address of the array; (ii) Binding a binding reagent to the terminal amino acid, wherein the binding reagent comprises a nucleic acid tag, and wherein a primer nucleic acid is present at the address; (iii) Extending the primer nucleic acid, thereby producing an extended primer having one copy of the tag; and (iv) detecting the tag of the extended primer. The terminal amino acids may be exposed, for example, by removing one or more amino acids from the amino-terminus or carboxy-terminus of the polypeptide. Steps (i) to (iv) may be repeated to generate a series of tags indicative of the polypeptide sequence. The extension of the primer may be performed by polymerase-based extension of the primer, for example, using a nucleic acid tag as a template. Alternatively, the extension of the primer may be performed by, for example, ligase-based or chemical-based ligation of the primer to the nucleic acid hybridized to the nucleic acid tag. The nucleic acid tag can be detected by: hybridization with nucleic acid probes (e.g., in a microarray), amplification-based detection (e.g., PCR-based detection or rolling circle amplification-based detection), or nucleic acid sequencing (e.g., a cyclic reversible terminator method, a nanopore method, or a single molecule real-time detection method). Exemplary methods that can be used to detect polypeptides using nucleic acid tags are set forth in the following documents: U.S. patent application publication nos. 2019/0145982A1, 2020/03481308 A1 or 2020/0348307A1, each of which is incorporated herein by reference. The polypeptide, primer nucleic acid, or template nucleic acid that replicates by primer extension may be attached to SNAP or SNAP complex.

The detection method may comprise determining a property of the detection, such as a polypeptide sequence, the presence of a known epitope, a polypeptide size, a polypeptide isoelectric point, a polypeptide hydrophobicity, a polypeptide hydrodynamic radius, a polypeptide pKa, the presence of a post-translational modification, the absence of a post-translational modification, a polypeptide charge, the presence of an unnatural amino acid or other unnatural amino acid chemical unit, the presence of a secondary, tertiary or quaternary structure, the absence of a secondary, tertiary or quaternary structure, the presence of a binding molecule, or the absence of a binding molecule. The bound non-polypeptide molecule may comprise a chelating ion, a bound metal cluster, a bound cofactor (e.g., porphyrin), a bound ligand, a bound substrate, or a bound biomolecule (e.g., polysaccharide, nucleic acid, protein, etc.).

The methods or devices of the present disclosure may optionally be configured for optical detection (e.g., luminescence detection). Based on measurable characteristics, such as the wavelength of radiation exciting the luminophore, the wavelength of radiation emitted by the luminophore, the intensity of radiation emitted by the luminophore (e.g. at a specific detection wavelength), the luminescence lifetime (e.g. the time the luminophore remains in an excited state), or the luminescence polarity, analytes or other entities may be detected and optionally distinguished from each other. Other optical features that may be detected and optionally used to distinguish analytes include, for example, absorption of radiation, resonance raman, radiation scattering, and the like. The luminophore may be an intrinsic moiety of the protein or other analyte to be detected, or the luminophore may be an exogenous moiety synthetically added to the protein or other analyte.

The methods or devices of the present disclosure may use light sensing devices adapted to detect features set forth herein or known in the art. Particularly useful components of the light sensing device may include, but are not limited to, components used in an optical subsystem or a nucleic acid sequencing system. Examples of useful subsystems and components thereof are set forth in the following documents: U.S. patent application publication No. 2010/011768 A1 or U.S. patent nos. 7,329,860, 8,951,781 or 9,193,996, each of which is incorporated herein by reference. Other useful light sensing devices and components thereof are described in the following documents: U.S. patent nos. 5,888,737, 6,175,002, 5,695,934, 6,140,489 or 5,863,722; or U.S. patent publication No. 2007/007991A1, 2009/0249114 A1, or 2010/011768, or WO2007/123744, each of which is incorporated herein by reference. Light sensing devices and components that may be used to detect a light emitter based on light emission lifetime are described in, for example, the following documents: U.S. patent nos. 9,678,012, 9,921,157, 10,605,730, 10,712,274, 10,775,305, or 10,895,534, each of which is incorporated herein by reference.

The luminescence lifetime may be detected using an integrated circuit having a photodetection region configured to receive an incident photon and to generate a plurality of charge carriers in response to the incident photon. The integrated circuit may include at least one charge carrier storage region and a charge carrier separation structure configured to selectively direct charge carriers of the plurality of charge carriers directly into the charge carrier storage region based on a time at which the charge carriers are generated. See, for example, U.S. patent nos. 9,606,058, 10,775,305, and 10,845,308, each of which is incorporated herein by reference. A light source generating short light pulses may be used for luminescence lifetime measurement. For example, a light source (such as a semiconductor laser or LED) may be driven with a bipolar waveform to produce light pulses with FWHM durations as short as about 85 picoseconds, with suppressed tail emission. See, for example, US 10,605,730, which is incorporated herein by reference.

For configurations using optical detection (e.g., luminescence detection), one or more analytes (e.g., proteins) may be immobilized on a surface, and the surface may be scanned with a microscope to detect any signals from the immobilized analytes. The microscope itself may contain a digital camera or other luminescence detector configured to record, store and analyze data collected during the scan. The luminescence detector of the present disclosure may be configured for epi-luminescence (TIR) detection, total Internal Reflection (TIR) detection, waveguide-assisted excitation, and the like.

The light sensing means may be based on any suitable technology and may be, for example, a Charge Coupled Device (CCD) sensor that generates pixelated image data based on the location in the photon impacting means. It should be appreciated that any of a variety of other light sensing devices may also be used, including, but not limited to, detector arrays configured for Time Delay Integration (TDI) operation, complementary Metal Oxide Semiconductor (CMOS) detectors, avalanche Photodiode (APD) detectors, geiger-mode photon counters, photomultiplier tubes (PMTs), charge Injection Device (CID) sensors, JOT image sensors (Quanta), or any other suitable detector. The light sensing device may optionally be coupled to one or more excitation sources, such as lasers, light Emitting Diodes (LEDs), arc lamps, or other energy sources known in the art.

The optical detection system may be configured for single molecule detection. For example, a waveguide or optical confinement may be used to deliver excitation radiation to the location of the solid support where the analyte is located. Zero mode waveguides may be particularly useful, examples of which are set forth in U.S. patent nos. 7,181,122, 7,302,146, or 7,313,308, each of which is incorporated herein by reference. Analytes may be limited to surface features, for example, to facilitate single molecule resolution. For example, the analytes may be distributed into pores having nano-dimensions, such as those set forth in U.S. patent No. 7,122,482 or 8,765,359 or U.S. patent application publication No. 2013/016153 A1, each of which is incorporated herein by reference. The holes may be configured for selective excitation, for example, as set forth in U.S. patent nos. 8,798,414 or 9,347,829, each of which is incorporated herein by reference. Analytes may be distributed onto nanoscale rods, such as high aspect ratio rods, which may optionally be dielectric posts extending through the metal layer to improve detection of analytes attached to the posts. See, for example, U.S. patent nos. 8,148,264, 9,410,887, or 9,987,609, each of which is incorporated herein by reference. Further examples of nanostructures that may be used to detect an analyte are those that change state in response to the analyte concentration so that the analyte may be quantified, as set forth in WO 2020/176793 A1 (which is incorporated herein by reference).

The apparatus or methods set forth herein need not be configured for optical detection. For example, an electron detector may be used to detect protons or charged labels (see, e.g., U.S. patent application publication nos. 2009/0026082A1; 2009/0126889 A1;2010/0137143A1; or 2010/0282617A1, each of which is incorporated herein by reference in its entirety). A Field Effect Transistor (FET) may be used to detect an analyte or other entity, for example, based on the proximity of a field-interfering portion to the FET. The field disturbing moiety may be due to a foreign label attached to the analyte or affinity reagent or the moiety may be inherent to the analyte or affinity reagent used. Surface plasmon resonance can be used to detect binding of analytes or affinity reagents at or near a surface. Exemplary sensors and methods for attaching molecules to sensors are described in U.S. patent application publication nos. 2017/02409762 Al, 2018/0051316Al, 2018/0110265 Al, 2018/0155773A1, or 2018/0305727Al; or in U.S. patent nos. 9,164,053, 9,829,456, 10,036,064, each of which is incorporated herein by reference.

The compositions, devices, or methods of the present disclosure may be used to characterize or identify at least about 0.0000001%, 0.000001%, 0.00001%, 0.0001%, 0.001%, 0.01%, 0.1%, 1%, 10%, 25%, 50%, 90%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, 99.99999%, 99.999999% or more of all protein species in a proteome. Alternatively or additionally, the proteome characterization method may characterize or proteome not more than about 99.999999%, 99.99999%, 99.9999%, 99.999%, 99.99%, 99.9%, 99%, 90%, 50%, 25%, 10%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, 0.00001%, 0.000001%, 0.0000001% or less of all protein species in the proteome.

In some configurations of the compositions, devices, and methods set forth herein, one or more proteins may be present on a solid support, where the proteins may optionally be detected. For example, a protein may be attached to a solid support that may be contacted with a detection reagent (e.g., an affinity reagent) in solution, which may interact with the protein to produce a detectable signal, which may then be detected to determine the presence, absence, amount, characteristic or identity of the protein. In a multiplexed version of the method, different proteins may be attached to different addresses in the array, and the detection steps may be performed in parallel, such that the proteins at each address are detected, quantified, characterized, or identified. In another example, a detection reagent may be attached to a solid support, which may be contacted with a protein in solution, which may interact with the detection reagent to produce a detectable signal, which may then be detected to determine the presence of the protein. The method may also be multiplexed by attaching different probes to different addresses of the array.

In a multiplexed configuration, different proteins can be attached to different unique identifiers (e.g., addresses in an array), and the proteins can be manipulated and detected in parallel. For example, a fluid containing one or more different affinity reagents may be delivered to the array such that the proteins of the array are simultaneously contacted with the affinity reagents. Furthermore, multiple addresses may be observed in parallel, allowing for rapid detection of binding events. The plurality of different proteins may have at least 5, 10, 100, 1x 10 ³ 1x 10 ⁴ 1x 10 ⁵ Complexity of one or more protein primary sequences of different natural lengths. Alternatively or additionally, the proteome, proteome subfractions or other protein samples analyzed in the methods set forth herein may have up to 1x 10 ⁵ Seed, 1x 10 ⁴ Seed, 1x 10 ³ Complexity of the primary sequence of proteins of different natural lengths of species, 100 species, 10 species, 5 species or less. The total number of proteins in a sample that are detected, characterized, or identified may differ from the number of different levels of sequences in the sample, for example, due to the presence of multiple copies of at least some protein species. Furthermore, the total number of proteins in a sample that are detected, characterized, or identified may differ from the number of candidate proteins suspected of being present in the sample, for example, due to the presence of multiple copies of at least some protein species, the absence of some proteins in the sample source, or the loss of some proteins prior to analysis.

Particularly useful multiplexed formats use arrays in which proteins and/or affinity reagents are attached to unique identifiers (such as addresses on a surface). The protein may be attached to the unique identifier in any of a variety of ways. The attachment may be covalent or non-covalent. Exemplary covalent attachments include chemical linkers, such as those obtained using click chemistry or other linkages known in the art or described in the following documents: U.S. patent application Ser. No. 17/062,405, incorporated herein by reference. Non-covalent attachment may be mediated by receptor-ligand interactions (e.g., (streptavidin) -biotin, antibody-antigen, or complementary nucleic acid strands), e.g., where the receptor is attached to a unique identifier and the ligand is attached to a protein, or vice versa. In a particular configuration, the protein is attached to a solid support (e.g., an address in an array) by a Structured Nucleic Acid Particle (SNAP). The protein may be attached to SNAP, and the SNAP may interact with the solid support, e.g., by non-covalent interactions of DNA with the support and/or by covalent attachment of SNAP to the support. Nucleic acid folded papers or nucleic acid nanospheres are particularly useful. The use of SNAP and other moieties to attach proteins to unique identifiers (such as tags or addresses in an array) is described in the following documents: U.S. patent application Ser. No. 17/062,405, incorporated herein by reference.

The methods, compositions and apparatus of the present disclosure are particularly suitable for use with proteins. Although proteins are illustrated throughout this disclosure, it should be understood that other analytes may be similarly used. Exemplary analytes include, but are not limited to, biomolecules, polysaccharides, nucleic acids, lipids, metabolites, hormones, vitamins, enzyme cofactors, therapeutic agents, candidate therapeutic agents, or combinations thereof. The analyte may be a non-biological atom or molecule such as a synthetic polymer, metal oxide, ceramic, semiconductor, mineral, or a combination thereof.

The one or more proteins used in the methods, compositions or devices herein may be derived from natural or synthetic sources. Exemplary sources include, but are not limited to, biological tissue, fluids, cells, or subcellular compartments (e.g., organelles). For example, the sample may be derived from a tissue biopsy, biological fluid (e.g., blood, sweat, tears, plasma, extracellular fluid, urine, mucus, saliva, semen, vaginal fluid, synovial fluid, lymph, cerebrospinal fluid, peritoneal fluid, pleural fluid, amniotic fluid, intracellular fluid, extracellular fluid, etc.), fecal sample, hair sample, cultured cells, culture medium, fixed tissue sample (e.g., freshly frozen or formalin-fixed paraffin embedded), or a product of a protein synthesis reaction. The protein source may include any sample in which the protein is a natural or expected ingredient. For example, the major source of cancer biomarker proteins may be tumor biopsy samples or body fluids. Other sources include environmental samples or forensic samples.

Exemplary organisms from which the protein or other analyte may be derived include, for example, mammals, such as rodents, mice, rats, rabbits, guinea pigs, ungulates, horses, sheep, pigs, goats, cattle, cats, dogs, primates, non-human primates, or humans; plants such as arabidopsis (Arabidopsis thaliana), tobacco, maize, sorghum, oat, wheat, rice, canola, or soybean; algae, such as chlamydomonas reinhardtii (Chlamydomonas reinhardtii); nematodes, such as caenorhabditis elegans (Caenorhabditis elegans); insects such as drosophila melanogaster (Drosophila melanogaster), mosquitoes, fruit flies, bees or spiders; fish, such as zebra fish; a reptile; amphibians such as frog or Xenopus laevis (Xenopus laevis); the reticulum dish (dictyostelium discoideum); fungi such as pneumocystis californicus (Pneumocystis carinii), fugu rubripes (Takifugu rubripes), yeast, saccharomyces cerevisiae (Saccharamoyces cerevisiae) or schizosaccharomyces pombe (Schizosaccharomyces pombe); or plasmodium falciparum (Plasmodium falciparum). The protein may also be derived from a prokaryote such as bacteria, escherichia coli (Escherichia coli), staphylococci (staphylococci) or Mycoplasma pneumoniae (Mycoplasma pneumoniae); archaebacteria (archaea); viruses such as hepatitis c virus, influenza virus, coronavirus or human immunodeficiency virus; or a viroid. The protein may originate from a homogeneous culture or population of the above-mentioned organisms, or alternatively from a collection of several different organisms, for example in a community or an ecosystem.

In some cases, the protein or other biological molecule may be derived from an organism collected from a host organism. For example, the protein may be derived from parasitic, pathogenic, commensal or latent organisms collected from the host organism. The protein may be derived from an organism, tissue, cell or biological fluid known or suspected to be associated with a disease state or disorder (e.g., cancer). Alternatively, the protein may be derived from an organism, tissue, cell or biological fluid known or suspected to be associated with a particular disease state or disorder. For example, proteins isolated from such sources may be used as controls for comparison with results obtained from sources known or suspected to be associated with a particular disease state or disorder. The sample may comprise a microbiome or a major portion of a microbiome. In some cases, one or more proteins used in the methods, compositions, or apparatus set forth herein may be obtained from a single source, and no more than a single source. The single source may be, for example, a single organism (e.g., an individual human), a single tissue, a single cell, a single organelle (e.g., endoplasmic reticulum, golgi apparatus, or nucleus), or a single protein-containing particle (e.g., a viral particle or vesicle).

The methods, compositions, or devices of the present disclosure may use or include a plurality of proteins having any of a variety of compositions, such as a plurality of proteins consisting of a proteome or fraction thereof. For example, the plurality of proteins may comprise liquid phase proteins, such as proteins in a biological sample or fraction thereof, or the plurality of proteins may comprise immobilized proteins, such as proteins attached to a particle or solid support. As further examples, the plurality of proteins may include proteins that are detected, analyzed, or identified in connection with the methods, compositions, or devices of the present disclosure. The content of the various proteins may be understood from any of a variety of features, such as those set forth below or elsewhere herein.

A variety of proteins can be characterized in terms of total protein mass. The total mass of protein in one liter of plasma is estimated to be 70 grams, and the total mass of protein in human cells is estimated to be between 100 picograms (pg) and 500pg depending on the cell type. See Wisniewski et al Molecular & Cellular Proteomics 13:10.1074/mcp. M113.037309,3497-3506 (2014), which is incorporated herein by reference. The plurality of proteins used or included in the methods, compositions, or devices set forth herein may include at least 1pg, 10pg, 100pg, 1ng, 10ng, 100ng, 1mg, 10mg, 100mg, or more of the mass of the protein. Alternatively or additionally, the plurality of proteins may contain up to 100mg, 10mg, 1mg, 100ng, 10ng, 1ng, 100pg, 10pg, 1pg or less of protein by mass.

A variety of proteins can be characterized in terms of mass percentages relative to a given source, such as a biological source (e.g., cells, tissue, or biological fluid such as blood). For example, the plurality of proteins may contain at least 60%, 75%, 90%, 95%, 99%, 99.9% or more of the total protein mass present in the source from which the plurality of proteins are derived. Alternatively or additionally, the plurality of proteins may contain up to 99.9%, 99%, 95%, 90%, 75%, 60% or less of the total protein mass present in the source from which the plurality of proteins are derived.

A plurality of proteins can be characterized according to the total number of protein molecules. The total number of protein molecules in s.cerevisiae cells was estimated to be about 4200 ten thousand protein molecules. See Ho et al, cell Systems (2018), DOI: 10.1016/j.cells.2017.12.004, which is incorporated herein by reference. The plurality of proteins used or included in the methods, compositions, or apparatus set forth herein may include at least 1 protein molecule, 10 protein molecules, 100 protein molecules, 1x 10 ⁴ Protein molecule 1x 10 ⁶ Protein molecule 1x 10 ⁸ Protein molecule 1x 10 ¹⁰ Protein molecules, 1 mole (6.02214076X 10) ²³ A number of molecules), 10 moles of protein molecules, 100 moles of protein molecules, or more. Alternatively or additionally, the plurality of proteins may contain up to 100 moles of protein molecules, 10 moles of protein molecules, 1 mole of protein molecules, 1x 10 ¹⁰ Protein molecule 1x 10 ⁸ Protein molecule 1x 10 ⁶ Protein molecule 1x 10 ⁴ Protein molecules, 100 protein molecules, 10 protein molecules, 1 protein molecule or less.

A plurality of proteins can be characterized according to the diversity of full-length primary protein structures in the plurality of proteins. For example, the diversity of full length primary protein structures in a variety of proteins can be equivalent to the number of different protein-encoding genes in a variety of protein sources. Whether the protein isWhether derived from a known genome or any genome, the diversity of full-length primary protein structures can be counted independently of the presence or absence of post-translational modifications in the protein. It is estimated that the human proteome has about 20,000 different protein-encoding genes, such that a variety of proteins derived from humans may contain up to about 20,000 different primary protein structures. See Aebersol et al, nat. Chem. Biol.14:206-214 (2018), which is incorporated herein by reference. Other genomes and proteomes in nature are known to be larger or smaller. The plurality of proteins used or included in the methods, compositions or devices set forth herein may have at least 2, 5, 10, 100, 1x 10 ³ Seed, 1x 10 ⁴ Seed, 2x 10 ⁴ Seed, 3x 10 ⁴ Complexity of one or more different full-length primary protein structures. Alternatively or additionally, the plurality of proteins may have up to 3x 10 ⁴ Seed, 2x 10 ⁴ Seed, 1x 10 ⁴ Seed, 1x 10 ³ Complexity of the structure of the full-length primary protein in species, 100, 10, 5, 2 or less.

In contrast, the plurality of proteins used or included in the methods, compositions, or devices set forth herein may contain at least 60%, 75%, 90%, 95%, 99%, 99.9% or more of at least one protein that represents the protein encoded by the genome of the source from which the sample is derived. Alternatively or additionally, the plurality of proteins may contain up to 99.9%, 99%, 95%, 90%, 75%, 60% or less of the proteins encoded by the genome of the source from which the sample is derived.

A variety of proteins can be characterized by a diversity of primary protein structures among a variety of proteins including transcriptional splice variants. When splice variants are included, the human proteome is estimated to include about 70,000 different primary protein structures. See Aebersol et al, nat. Chem. Biol.14:206-214 (2018), which is incorporated herein by reference. Furthermore, the number of partial length primary protein structures may increase due to fragmentation occurring in the sample. In a method, composition or apparatus set forth herein The plurality of proteins used or included may have at least 2, 5, 10, 100, 1x 10 ³ Seed, 1x 10 ⁴ Seed, 7x 10 ⁴ Seed, 1x 10 ⁵ Seed, 1x 10 ⁶ Complexity of one or more different primary protein structures. Alternatively or additionally, the plurality of proteins may have up to 1x 10 ⁶ Seed, 1x 10 ⁵ Seed, 7x 10 ⁴ Seed, 1x 10 ⁴ Seed, 1x 10 ³ Complexity of the primary protein structure of species, 100, 10, 5, 2 or less.

A plurality of proteins can be characterized according to protein structure in the plurality of proteins including different levels of structure and different protein morphologies in the first level structure. Different molecular forms of proteins expressed from a given gene are considered to be different protein morphologies. Protein morphology may be different, for example, due to differences in primary structure (e.g., shorter or longer amino acid sequences), different domain arrangements (e.g., transcriptional splice variants), or different post-translational modifications (e.g., the presence or absence of phosphoryl, glycosyl, acetyl, or ubiquitin moieties). When counting the different primary structures and protein morphologies, it is estimated that the human proteome includes thousands of proteins. See Aebersol et al, nat. Chem. Biol.14:206-214 (2018), which is incorporated herein by reference. The plurality of proteins used or included in the methods, compositions or devices set forth herein may have at least 2, 5, 10, 100, 1x 10 ³ Seed, 1x10 ⁴ Seed, 1x10 ⁵ Seed, 1x10 ⁶ Seed, 5x 10 ⁶ Seed, 1x10 ⁷ Complexity of the structure of one or more different proteins. Alternatively or additionally, the plurality of proteins may have up to 1x10 ⁷ Seed, 5x 10 ⁶ Seed, 1x10 ⁶ Seed, 1x10 ⁵ Seed, 1x10 ⁴ Seed, 1x10 ³ Complexity of the structure of the different proteins of species, 100, 10, 5, 2 or less.

A plurality of proteins can be characterized according to the dynamic range of different protein structures in a sample. The dynamic range may be a measure of: all of the different protein structures in a plurality of proteinsThe range of abundance, the range of abundance of all different grade protein structures in the plurality of proteins, the range of abundance of all different full-length primary protein structures in the plurality of proteins, the range of abundance of all different full-length gene products in the plurality of proteins, the range of abundance of all different protein morphologies expressed from a given gene, or the range of abundance of any other set forth herein. The dynamic range of all proteins in human plasma is estimated to span more than 10 orders of magnitude from albumin (the most abundant protein) to the least abundant protein measured clinically. See Anderson and Anderson Mol Cell Proteomics 1:845-67 (2002), which are incorporated herein by reference. The dynamic range of the various proteins set forth herein can be at least 10, 100, 1x10 ³ 、1x 10 ⁴ 、1x 10 ⁶ 、1x 10 ⁸ 、1x 10 ¹⁰ Or a greater factor. Alternatively or additionally, the dynamic range of the various proteins set forth herein may be up to 1x 10 ¹⁰ 、1x10 ⁸ 、1x 10 ⁶ 、1x 10 ⁴ 、1x 10 ³ A factor of 100, 10 or less.

Examples

Example 1: conjugation of proteins to SNAP

MTz-functionalized proteins are conjugated to TCO-functionalized DNA origami SNAP complexes comprising one or more TCO functional groups. Each TCO functionalized DNA origami SNAP complex comprises a tile-shaped display SNAP comprising TCO functionalized polypeptide binding groups coupled to four tile-shaped utility SNAP. Each display SNAP contains 1 or 4 TCO binding groups. The TCO functionalized DNA folding paper is provided in a buffer at pH 8.0 comprising 200mM NaCl, 5mM Tris-HCl, 11mM MgCl ₂ And 1mM EDTA. The amount of mTz modified protein was calculated based on the amount of tile used in the conjugation reaction. The volume of protein added to the conjugation reaction was calculated according to equation (1):

y ＝ (xC _x wz)/C _y (1)

total volume (μl) of functionalized protein where y= mTz

Total volume of x=dna fold (μl)

C _x Concentration of =dna paper folding (μm)

C _y Concentration of = mTz functionalized protein (μm)

Molar equivalent of w=protein to TCO

z = number of TCO moieties per DNA origami molecule

According to the amounts calculated in equation (1), the volumes of the functionalized protein and TCO-DNA fold were combined mTz. If the volume of mTz functionalized protein in the reaction mixture exceeds 10% of the total volume (x+y), additional MgCl must be added ₂ To maintain the magnesium concentration of the reaction mixture. If desired, 1. Mu.l MgCl should be added to the protein before the DNA fold is added at a concentration according to equation (2) ₂ ：

C _M ＝ 12.4y + 12.4 (2)

Wherein C is _M ＝MgCl ₂ Concentration (mM)

The reaction mixture was gently mixed and then placed on a thermal mixer or thermal cycler at 25 ℃. The reaction tube was jacketed to prevent exposure to light. The reactant having 10-fold or higher excess protein is incubated for 5 hours or more. The reactant was incubated for 16 hours or more with less than 10-fold protein excess to ensure complete reaction of mTz with TCO.

The protein conjugates were purified on an Agilent 1100HPLC using an Agilent Bio-SEC 5.6X300 mm column. The HPLC solvent was filtered 200mM NaCl, 5mM Tris-HCl, 11mM MgCl ₂ And 1mM EDTA, pH 8.0.HPLC was run at an isocratic flow rate of 0.3ml/min for 25 min. Fractions were collected at 30s intervals between 5min and 13min of operation. The detection of the DNA-containing fractions was carried out at a wavelength of 260nm and the DNA-containing fractions were pooled. The combined DNA-containing fractions were concentrated to a total volume of about 100. Mu.l.

EXAMPLE 2 analysis of protein conjugates

Protein a, maltose Binding Protein (MBP) and ubiquitin protein conjugates were formed by mTz-TCO conjugation chemistry. The protein conjugates were formed by folding a paper of DNA containing a single TCO moiety. A single TCO DNA fold was conjugated with the fluorescent-labeled versions of the three proteins described above. Protein A was labeled with Alexa-Fluor 647 fluorescent dye. MBP was labeled with Alexa-Fluor 488 fluorochrome. Ubiquitin was labeled with tetramethylrhodamine (wavelength of about 555 nm). Control reactions were performed using mTz functionalized proteins and DNA origami without TCO moieties.

The fluorescently labeled protein conjugates were run on an Agilent 1100HPLC with an Agilent Bio-SEC 5.6 x 300mm column. The HPLC solvent was filtered 200mM NaCl, 5mM Tris-HCl, 11mM MgCl ₂ And 1mM EDTA, pH 8.0.HPLC was run at an isocratic flow rate of 0.3ml/min for 25 min. HPLC monitors light absorption over a wavelength range between 190nm and 800 nm. The wavelength of 260nm was used to determine the presence of DNA. The 488nm, 553nm and 652nm wavelengths were used to determine the presence of the fluorescently labeled protein, as the case may be.

Figure 30A shows HPLC data for protein a conjugates. The upper chromatogram depicts 260nm data showing DNA fold eluting at around 11 min. The lower chromatogram depicts 652nm data, showing that protein eluted at around 11min, and after around 15min there was an excess of unconjugated protein. The negative control data shown in fig. 30B shows that no protein eluted with the DNA fold at 11min (bottom chromatogram) due to the available TCO to complete conjugation.

Figure 30C shows HPLC data for MBP protein conjugates. The lower chromatogram depicts 260nm data showing DNA fold eluted at around 11 min. The chromatogram above depicts 488nm data showing that protein eluted at around 11min and that there was an excess of unconjugated protein after around 15 min. Fig. 30D shows HPLC data for ubiquitin protein conjugates. The upper chromatogram depicts 260nm data showing DNA fold eluting at around 11 min. The lower chromatogram depicts 553nm data, showing that protein eluted at around 11min, and after around 15min there was an excess of unconjugated protein.

Example 3: deposition of SNAP

An anchor group comprising 5 tile DNA folds was deposited on the glass substrate. A schematic of the basic structure of 5 tile fold paper is shown in fig. 31. The origami composite comprises four edge tiles 3110 connected to a center tile 3120 at hybridization region 3140. The center tile 3120 includes a reactive handle 3130 configured to conjugate a functionalized protein. The DNA folds were labeled with Alexa-Fluor 488 dye to make them optically detectable. The glass substrate was a Nexterion D263 170 μm thick glass slide that had been coated with a uniform (3-aminopropyl) trimethoxysilane (APTMS) monolayer.

The glass substrate was incubated with 5mM Tris-HCl-pH8.0, 205mM NaCl, 1mM EDTA and 12.5mM MgCl prior to deposition of the anchoring groups ₂ Is incubated in the deposition buffer solution for 1 hour. In a solution containing 5mM Tris-HCl-pH8.0, 205mM NaCl, 1mM EDTA and 12.5mM MgCl ₂ 10. Mu.l of 2 ng/. Mu.l (91 pM) 5 tile DNA folds were applied to the glass substrate. The DNA fold was slowly applied to the glass substrate to prevent shearing. The DNA fold was incubated on the substrate for 10 minutes. After incubation, the incubation was performed by using a buffer containing 1 XNeovients buffer (10 mM HEPES, 120mM NaCl, 5mM MgCl) ₂ And 5mM KCl, pH 7.4), 0.1% Tween-20 and 0.001% Lipidure CM5206, and excess DNA paper folding was removed from the substrate. Additional MgCl ₂ Adding to washing buffer to make total MgCl ₂ The concentration reached 10mM. The deposited DNA fold can be imaged by exciting the labeled DNA fold with 488nm light.

EXAMPLE 4 SNAP deposition conditions

Anchor group deposition under different deposition solvents was investigated. 5 tile DNA folds were deposited on a glass substrate. The deposition buffers used were: 1) DNA paper folding buffer (5 mM Tris-HCl-pH8.0, 205mM NaCl, 1mM EDTA and 12.5mM MgCl) ₂ ) The method comprises the steps of carrying out a first treatment on the surface of the 2) DNA paper folding buffer added with another 2.5M NaCl; and 3) a DNA paper folding buffer containing 0.01% Tween-20. The DNA fold was deposited on a glass substrate according to the method described in example 3. Each buffer was used for the pre-deposition incubation and deposition steps. By using O ₂ Plasma clean a Nexterion D263 170 μm thick slide (without APTMS coating) and then prepare a control substrate according to the deposition method of example 3. Each Nexterion D263 slide was attached to a second slide with an inward facing PEG 3-6 surface coating to form a glass substrate with a deposition area on each channelA 3-channel flow cell. Each channel of each flow cell corresponds to one of the three tested deposition buffers. Deposition on APTMS coated substrates was tested on 3 different flow cells. Deposition on uncoated substrates was tested on 3 different flow cells.

All glass substrates were imaged by confocal scanning laser microscopy at 488nm at 30 positions. Each image is counted for pixel intensity by image analysis software. The pixel intensity counts in the 30 image series for each slide were averaged to provide an average fluorescence intensity.

Fig. 32A and 32B show confocal scan image results of DNA origami deposition in DNA origami buffer for both APTMS coated (fig. 32A) and uncoated (fig. 32B) substrates. A single DNA fold can be seen at discrete locations on the coated substrate surface. There is significantly minimal deposition on the uncoated substrate. Fig. 32C and 32D show confocal scan image results of DNA fold deposition with DNA fold buffer with 2.5MNaCl for an APTMS coated substrate (fig. 32C) and an uncoated substrate (fig. 32D). Although less deposition appears to occur than a DNA fold buffer without 2.5M NaCl, a single DNA fold can be seen at discrete locations on the coated substrate surface. There is significantly minimal deposition on the uncoated substrate. FIGS. 32E and 32F show confocal scan image results of DNA origami deposition in DNA origami buffer with 0.01% Tween-20 for APTMS coated (FIG. 32E) and uncoated (FIG. 32F) substrates. A single DNA fold can be seen at discrete locations on the coated substrate surface. There was no significant deposition on the uncoated substrate. Figure 33 shows the average total anchor group counts of the images collected under each buffer of each test flow cell. The left data series shows the results of the substrate coated with APTMS. The data set on the right shows the results for the uncoated substrate. The DNA fold is shown deposited on the coated substrate with standard DNA fold buffer or in the presence of high salt concentration or surfactant. Minimal DNA fold deposition was observed on the uncoated substrate. The difference in total deposition on the substrate between the different buffer compositions suggests that the solvent composition can affect the number and density of anchoring groups on the substrate surface.

EXAMPLE 5 deposition of protein conjugates

The protein conjugates were deposited on glass substrates coated with an APTMS layer according to the method described in example 4. The protein conjugate comprises 5 tile DNA origami conjugated to Maltose Binding Protein (MBP) via a covalent methyltetrazine-trans cyclooctene bond. MBP protein conjugates are labeled with Alexa-Fluor 647 fluorophores to allow detection of protein conjugate deposition. Deposition of each MBP protein conjugate was observed under the same buffer conditions as described in example 4 (DNA paper folding buffer with or without 2.5M NaCl or 0.01% Tween-20). The deposition of MBP protein conjugates under DNA origami buffer was tested in two separate flow cells. The deposition of MBP protein conjugates in the presence of 2.5M NaCl or 0.01% Tween-20 was tested in three separate flow cells. As a negative control, a flow cell incubated with buffer without protein conjugate was also observed.

Figures 34A-34C show confocal scan image results of DNA origami deposition under different DNA origami buffer compositions for APTMS coated substrates. Figure 34A shows single MBP protein conjugates deposited in DNA origami buffer. FIG. 34B shows single MBP protein conjugates deposited in DNA origami buffer containing 2.5M NaCl. FIG. 34C shows single MBP protein conjugates deposited in DNA paper folding buffer containing 0.01% Tween-20. A single DNA fold can be seen at discrete locations on each APTMS coated substrate surface. Figure 35 shows the average total protein conjugate counts collected under each buffer for each flow cell tested. Data alternate between flow cells tested with protein conjugates and flow cells not tested with protein conjugates. The leftmost four counts were only for DNA origami buffer. The middle six counts were for DNA origami buffer containing 2.5M NaCl. The right six counts were for DNA paper folding buffer containing 0.01% Tween-20. For all substrates, deposition of protein conjugates on the APTMS coated glass substrate was observed, with slightly lower counts being observed in the presence of 2.5M NaCl and slightly higher counts being observed in the presence of 0.01% Tween-20. After formation of the protein conjugate, efficient deposition of the anchor groups on the APTMS coated substrate was observed.

EXAMPLE 6 deposition of protein conjugates

Protein conjugates were deposited on patterned Nexterion D263 glass chips containing a square pattern of binding sites. The patterned region of each glass chip contained a polypeptide binding region with more than 1.9 hundred million binding sites. The polypeptide binding region was patterned by 12544 sub-grids, each containing 123 binding sites in a square configuration (total 15129 binding sites per sub-grid). The surface of the glass chip is coated with a layer of APTMS. The protein conjugate contained 5 tile DNA origami conjugated to His-tagged ubiquitin (Ubi-His) via a covalent methyltetrazine-trans-cyclooctene bond. DNA paper folding of Ubi-His protein conjugates was labeled with Alexa-Fluor 488 fluorophore to allow detection of protein conjugate deposition. Mu.l of 0.3nM protein conjugate was incubated on chip in DNA paper folding buffer for 10 min, then with 40. Mu.l of a kit containing 200mM HEPES, 2.4M NaCl, 100mM MgCl ₂ Rinsing buffer rinse of 100mM KCl, 0.1% Tween-20 and 0.001% Lipidure CM5206 (pH 7.4). After rinsing, the glass chip was imaged at 488nm by confocal laser scanning microscopy to detect protein conjugates deposited on the patterned glass surface. After initial imaging, the chip was incubated with blocking buffer containing the same components as the rinse buffer with 100mg/ml dextran sulfate. The chip was incubated with 40 μl blocking buffer for 60 minutes and then rinsed again with 40 μl rinsing buffer. The chip was then incubated with 25. Mu.l of B1 aptamer (his tag affinity target) labeled with Alexa-Fluor 647nm fluorescent dye. The chip was imaged at 647nm using a Thorlabs confocal laser scanning microscope.

FIG. 21A shows fluorescence microscopy results at 488nm for DNA origami-Ubi-His conjugates deposited on patterned glass arrays. It was observed that DNA folds had been deposited on the array almost completely occupying the binding sites. FIG. 21B shows imaging of the same deposited Ubi-His conjugate imaged with B1 aptamer at 647nm (positive control). When imaged with his-tag specific labeled affinity reagent, the grid deposition pattern was again observed confirming co-localization of DNA fold and conjugated protein.

EXAMPLE 7 SNAP Synthesis and purification

Multiple tile-shaped SNAP is formed by combining an M13 phage genome scaffold strand with multiple 218 different oligonucleotides, including multiple TCO-terminated oligonucleotides configured to couple with an analyte. The oligonucleotides were mixed in a solution containing 100mM MgCl ₂ Is combined in the DNA origami buffer and heated to 95 ℃. After heating, the oligonucleotides were allowed to cool slowly to 20 ℃ allowing the oligonucleotides to anneal into SNAP structures. After SNAP formation, SNAP was purified from excess oligonucleotides on an HPLC system containing a size exclusion chromatography column. Surprisingly, it was found that the glycan-specific column effectively purified the SNAP formed with minimal residual oligonucleotides or other unwanted components.

EXAMPLE 8 SNAP Synthesis and purification

SNAP was synthesized via the method described in example 7. The synthesized SNAP was essentially a square DNA origami structure with sides of approximately 83 nanometers (nm). Each square SNAP contains 65 oligonucleotides with pendant handles for binding additional components to SNAP by conjugation to complementary oligonucleotides of the pendant group: 1 overhanging single-stranded DNA handle for coupling analyte to upper display surface, 20 overhanging single-stranded DNA handles for coupling SNAP to surface, and 44 overhanging single-stranded DNA handles (11 per side) for coupling detectable fluorescent label to 4 edges of SNAP. All oligonucleotide sequences were designed using the cadno 2 software.

Table I contains a sequence listing of SNAP oligonucleotide coupling regions. SEQ ID 1 is a sequence listing of the coupling region of an oligonucleotide configured to couple with a complementary oligonucleotide conjugated to an analyte. SEQ ID 2 is a sequence listing of the coupling region of an oligonucleotide configured to couple with a complementary oligonucleotide conjugated to the surface of a solid support. SEQ ID 3 is a fluorescent Alexa-Fluor which is configured and conjugated to ^TM A sequence listing of the coupling region of complementary oligonucleotide-coupled oligonucleotides of 488 dye molecules.

Table II contains a sequence listing of 217 staple oligonucleotides used to form SNAP with 20 overhanging surface-connecting portions. The overhang regions of 65 coupled oligonucleotides are highlighted in bold text. All of the staple oligonucleotides listed in table III were combined with M13mp18 single-stranded phage genomic DNA to fold the DNA origami structure.

Table II

Table III

/>

EXAMPLE 9 SNAP Synthesis and purification

SNAP was synthesized by the method described in example 7. The synthetic SNAP is designed as a substantially square DNA origami structure with sides of approximately 83 nanometers (nm). Each square SNAP contains 109 oligonucleotides with pendant handles for binding additional components to SNAP by conjugation to complementary oligonucleotides of the pendant group: 1 overhanging single-stranded DNA handle for coupling analyte to upper display surface, 64 overhanging single-stranded DNA handles for coupling SNAP to surface, and 44 discrete overhanging single-stranded DNA handles (11 per side) for coupling detectable fluorescent label to 4 edges of SNAP. All oligonucleotide sequences were designed using the cadno 2 software.

Table I contains a sequence listing of SNAP oligonucleotide coupling regions. SEQ ID 1 is a sequence listing of the coupling region of an oligonucleotide configured to couple with a complementary oligonucleotide conjugated to an analyte. SEQ ID 2 is a sequence listing of the coupling region of an oligonucleotide configured to couple with a complementary oligonucleotide conjugated to the surface of a solid support. SEQ ID 3 is a fluorescent Alexa-Fluor which is configured and conjugated to ^TM A sequence listing of the coupling region of complementary oligonucleotide-coupled oligonucleotides of 488 dye molecules. The sequences listed in table II are each designed to exclude the nucleotide guanosine, thereby avoiding the possibility of self-complementarity (i.e., formation of secondary structures). It is expected that the overhanging single stranded DNA surface interaction moiety (e.g., SEQ ID 2) will be more likely to be complementary at ambient temperature (e.g., about 20 °) if no secondary structure is presentSurface-attached oligonucleotides bind.

Table III contains a sequence listing of 217 staple oligonucleotides used to form SNAP with 64 overhanging surface-connecting portions. The overhang regions of 65 coupled oligonucleotides are highlighted in bold text. All of the staple oligonucleotides listed in table IV were combined with M13mp18 single-stranded phage genomic DNA to fold the DNA origami structure.

Table IV

/>

Example 10 deposition of SNAP on prepared surface

A surface is prepared for the formation of an unpatterned array. A layer of (3-aminopropyl) trimethoxysilane (APTMS) was deposited on the surface of the slide. The APTMS coated surface was then reacted with azide-PEG-NHS ester to covalently form a PEG passivation layer on the slide surface. After formation of the PEG passivation layer, the surface-attached azide groups are conjugated to an oligonucleotide containing Dibenzylcyclooctene (DBCO) functionality. Each oligonucleotide has the sequence 5'-DBCO-TGTGGAGAGGAAGATGGTA-3' (SEQ. ID 438). The reaction scheme for preparing a glass surface is shown in fig. 42. By varying the concentration of oligonucleotides in contact with the azide-containing surface, an array of oligonucleotides with different surface oligonucleotide densities is formed. Oligonucleotide concentrations of 0.01 micromolar (μM), 0.1 μM and 1 μM were used for surface preparation.

The prepared glass surface was contacted with a DNA fold containing 20 surface interaction moieties as described in example 8. 44 Alexa-Fluor 488 fluorochromes were bound to each DNA fold via a complementary oligonucleotide to the overhang region of the label binding oligonucleotide (see SEQ. ID 3). Both polypeptides bind to each DNA fold via a complementary oligonucleotide to the overhang region of the analyte binding oligonucleotide (see, e.g., seq id 1). Each polypeptide is a 12 amino acid histidine peptide (SEQ. ID 439-HHHHHHHHHHHH), hereinafter His-12.

DNA paper folds containing overhanging oligonucleotides were deposited on the prepared glass surface by: hybridization to surface-attached oligonucleotides (see seq. Id 438) occurs through overhang surface interaction oligonucleotides (see seq. Id 2). The deposition buffer is described in example 3. Four separate arrays were deposited with His-12 DNA paper folds. Two additional arrays (control SNAP) were prepared with DNA origami containing the pendent oligonucleotides but no polypeptide. Oligonucleotides are used to form arrays.

After array formation, SNAP locations on each array were identified by fluorescence microscopy imaging at 488 nm. After locating the SNAP deposited on each array, the array is contacted with a histidine-bound detectable probe. Each detectable probe contained one DNA origami tile with 20 conjugated B1 aptamers and 44 conjugated Alexa-Fluor 647 fluorochromes. Probes were contacted with each array at a concentration of 30nM and incubated for 30 min. Unbound probes were rinsed from each array by a rinse buffer (see example 3). After rinsing, each array was imaged to identify the array address to which the B1 probe binds.

FIG. 43 shows binding data for B1 probes relative to each SNAP array. Binding of the B1 probe was observed for at least 20-25% of the array addresses. In contrast, B1 probe binding to polypeptide-free SNAP was observed to be near zero. FIG. 46 shows fluorescence microscopy image data of SNAP deposited on oligonucleotide-containing surfaces containing different oligonucleotide surface densities. SNAP was contacted with oligonucleotide-containing surfaces at concentrations of 10 picomolar (pM) or 100 pM. The SNAP density of the deposition was observed to increase with increasing surface density of the oligonucleotides and increasing SNAP concentration.

Example 11 detection of Polypeptides on SNAP

Two SNAP arrays were prepared by the method described in example 10. Each array was prepared with SNAP containing 20 pendant capture oligonucleotides and a single polypeptide-conjugated oligonucleotide. Each SNAP was conjugated to a single His-12 peptide. After array preparation, each array was incubated with B1 probes as described in example 10. Probes were contacted with each array at a concentration of 10nM for 20 min. Probe binding was detected by fluorescence microscopy at 647 nm. FIG. 44 depicts the fraction of observed array addresses with detected B1 probe binding. About 10% of the array addresses were observed to bind to the B1 probe.

Example 12 detection of Polypeptides on SNAP

Glass surfaces containing oligonucleotides were prepared according to the protocol of FIG. 42. Additional glass surfaces containing only APTMS surface-attached moieties were prepared. SNAP was prepared with 20 overhanging capture moieties as described in example 9. Each SNAP is configured to have two polypeptide binding sites. SNAP was conjugated to streptavidin polypeptides, each with 2 His-12 tags.

SNAP was incubated with the prepared glass surface to form an array of polypeptides. A total of 6 replicates of each type of surface (with APTMS and with oligonucleotides) were tested, with 4 surfaces incubated with streptavidin conjugated SNAP and 2 surfaces incubated with SNAP without polypeptide.

After SNAP deposition, each glass surface was imaged by confocal fluorescence microscopy to identify the array address of the deposited SNAP. The imaging of SNAP addresses was performed by detecting Alexa-Fluor 488 dye on each SNAP. After identifying the occupied array address, SNAP is contacted with B1 aptamer probes as described in examples 10 and 11. Probe binding was detected by confocal fluorescence microscopy by detecting Alexa-Fluor 647 dye on each probe. The 647nm data was compared to 488nm data to determine the fraction of array addresses where occupancy of bound B1 probes was observed. FIG. 45 shows the binding assay data for SNAP deposited on APTMS surfaces and oligonucleotide-containing surfaces. The APTMS surface was observed to have a lower detection rate of His-12 containing polypeptide binding, and a higher false positive rate (detection of SNAP without polypeptide). Higher binding detection and lower false positive rates of His-12 containing polypeptides were observed on the oligonucleotide-containing surface. The presence of a PEG passivation layer and the increased specificity of the surface interaction between SNAP and the oligonucleotide-containing surface may increase the likelihood of a true positive detection and decrease the likelihood of a false positive detection.

Example 13 formation of unpatterned SNAP array

SNAP is deposited on an unpatterned glass surface containing PEG-azide surface attachment moieties. The glass surface was prepared according to the protocol shown in fig. 42, excluding the final oligonucleotide conjugation step. The surface concentration of azide groups was varied by mixing NHS-PEG 2K-azide molecules and NHS-PEG5K molecules in different ratios. The ratio of NHS-PEG 2K-azide to NHS-PEG5K molecule varies between 5:95 and 100:0. After forming the azide-containing glass surface, SNAP containing surface-coupled diphenylene-cyclooctene (DBCO) moieties was contacted with the surface at a concentration of 1 nanomole (nM). SNAP is incubated for at least 12 hours to promote the formation of a click-type interaction between the surface-attached azide and SNAP-coupled DBCO moiety. Incubation was performed at 20 ℃ and 4 ℃ to test the effect of temperature on deposition. Negative control arrays were also formed by contacting azide-containing surfaces with SNAP without DBCO moieties. FIG. 47 shows fluorescence microscopy images of SNAP arrays as a function of PEG 2K-azide to PEG5K ratio and deposition temperature. The concentration of SNAP deposited on the unpatterned array is seen to increase with increasing surface density of azide moieties and increasing temperature. Minimal SNAP deposition was observed on the glass surface in the absence of a DBCO moiety coupled to SNAP.

Example 14 Synthesis and characterization of SNAP with permeable Structure

Square, tile-shaped DNA fold containing single stranded DNA (ssDNA) was prepared by the method described in example 7. The DNA paper folding structure is formed by folding a mixture of ssDNA oligonucleotides and m13mp18 stent ssDNA. All oligonucleotides (including oligonucleotides with TCO display portion) were mixed in excess with the scaffold DNA. The purified DNA paper folding tile was deposited on mica for AFM imaging (fig. 59A). The measured tile dimensions match the expected tile edge length (80-90 nm) and tile height (2 nm).

After synthesis of the tile fold, a permeable structure was formed on each DNA fold by TdT extension in the presence of excess deoxythymidine nucleotides (which extended ssDNA overhangs around the DNA fold tile seed structure). The permeable polytssdna extensions are expected to lie substantially flat on the positively charged surface of the solid support. A DNA paper folding tile with poly-T extensions was imaged on a mica or Amine (APTMS) coated glass surface with a polylysine coating (fig. 59B). It was found that DNA origami tiles with poly-T extensions have typical diameters in the range of 600-700 nm; is large enough to preclude deposition of a second brush tile on 400nm sized array sites on the solid support.

According to AFM data, 95% of DNA origami tile particles with poly-T extensions were intact (fig. 59C). According to the method of example 1, a DNA origami tile with a poly-T extension was coupled to a mTz modified protein. Analytical HPLC results showed that the fraction of poly-T extended DNA origami tiles with functional TCO groups was 95% and the fraction with conjugated protein was 90% (fig. 59C). Fig. 59D plots dimensional data for DNA folds of various configurations, including fold only, poly-T extensions in solution, and poly-T extensions on surface. The average edge length of the compact DNA paper folding tile is 90nm. Dynamic light scattering measurements showed that the average diameter of the poly-T extended DNA fold in solution was 500nm. Based on AFM measurements, the average diameter of the poly-T extended DNA paper fold on the surface was 650nm. In summary, the poly-T extended DNA folds are conjugated to proteins with high efficiency and their large size is configured to prevent deposition of more than one poly-T extended DNA fold at each site on the solid support.

EXAMPLE 15 Single molecule array preparation

The patterned solid support is formed by photolithographic patterning of a glass substrate. After photolithographic patterning, the solid support was functionalized with APTMS to provide a positively charged surface coating. After APTMS deposition, the photolithographic photoresist is stripped from the chip to provide a patterned array of binding sites (as shown in fig. 67A). Patterning of the glass surface matched the expected feature periodicity and spacing and confirmed that only patterned features had positively charged amine coating (fig. 67B). The uniform intensity of the patterned areas indicated that the APTMS coating was consistent within and between features. High resolution AFM characterization showed glass/silicon surface roughness to be within the expected and operable range <2nm ² ) (FIG. 67C). The measured feature diameter (fig. 67D) and pitch (fig. 67E) match the expected values of about 400 nanometers and 1.4 microns, respectively.

Example 16 non-poisson array Loading of SNAP containing permeable Structure

To evaluate the occupancy of a single molecule on a chip, two versions of DNA origami tiles with poly-T extensions were generated for mixing experiments. A DNA origami tile with poly T extension was produced by the method of example 14, wherein the first version was labeled with Alexa-Fluor 488 dye and the second version was labeled with Alexa-Fluor 647 dye. An equimolar mixture of the two types of SNAP was deposited on the patterned glass array as described in example 15. By counting features illuminated by a single wavelength (representing only one deposited tile) and features illuminated by two wavelengths (representing more than one deposited tile), single molecule occupancy can be estimated. For a 96% occupied array (i.e., 4% of the sites do not contain the observed SNAP), a double occupancy was observed at 5% of the array sites. Without exclusion (poisson deposition), it would be expected that nearly 25% of the spots were observed to have two colors. Atomic Force Microscopy (AFM) is also used to demonstrate single molecule occupancy of array sites at high resolution. AFM results showed that 90% of the spots had a single brush DNA paper folded tile.

To estimate the dynamic range provided by the above array using partially structured SNAP, dilution experiments and 488/647 mixing experiments were used. At different dilutions and brush DNA fold tile ratios of 488 to 647, a ratio of 10 was determined ⁵ The number of 488 brush tiles observed in each spot. By extrapolating the data points, it was demonstrated at 10 ⁷ Single DNA origami tiles can be observed in each spot.

Example 17 functional nucleic acid on SNAP

SNAP arrays are prepared to determine whether a detectable label can be applied and removed from each SNAP on the array in a plurality of binding and removal cycles. Chips were prepared comprising a glass surface with a (3-aminopropyl) trimethoxysilane (APTMS) coating. In a solution containing 1 XNeovienttures buffer, 0.1% Tween20, 0.001% lipidure and 10mM MgCl ₂ SNAP was contacted with the APTMS coated surface of the chip at a concentration of 4.5 picomoles. Each SNAP comprises a functional nucleic acid comprising a overhanging single stranded DNA coupled to a tile-shaped DNA break. The functional nucleic acid has the nucleotide sequence ATTATACTACATACACC (SEQ. ID 440). SNAP-containing buffer was incubated on APTMS-coated surfaces for 10 min, followed by incubation with a solution containing 1XNeove ntures buffer, 0.1% Tween20, 0.001% lipidure and 10mM MgCl ₂ The surface is rinsed with a buffer of (a).

After preparing a randomly deposited SNAP array on an APTMS coated surface, the array was subjected to 14 detection cycles. Each detection cycle comprises 1) contacting the array with a fluid medium comprising fluorescent-labeled oligonucleotides having nucleotide sequence TAATATGATGTATGTGG (seq.id 441) and 5 Alexa-Fluor dyes, 2) incubating the fluorescent-labeled oligonucleotides with the array for 1 minute, 3) incubating the array with a solution comprising 1X neuventures buffer, 0.1% Tween20, 0.001% lipidure, and 10mM MgCl ₂ 4) performing fluorescent imaging of the array to detect the spatial position of the coupled fluorescent-labeled oligonucleotides, 5) applying a solution containing 6M guanidine hydrochloride and 10mM MgCl ₂ And 6) with a buffer containing 1 XNeovienttures buffer, 0.1% Tween20, 0.001% lipidure and 10mM MgCl ₂ Is used to rinse the array. Odd-numbered cycles (e.g., 1, 3, 5, … …, etc.) utilize fluorescently labeled oligonucleotides comprising Alexa-Fluor 488 fluorophores, and even-numbered cycles (e.g., 2, 4, 6, … …, etc.) utilize fluorescently labeled oligonucleotides comprising Alexa-Fluor 647 fluorophores.

Fig. 68 shows fluorescence imaging data for each cycle. Odd numbered cycles were shown to detect fluorescence at the array address in the 488-nm channel of the fluorescence microscope, but not actually in the 647-nm channel of the fluorescence microscope. Even numbered cycles were shown to detect little fluorescence at the array address in the 488-nm channel of the fluorescence microscope, but fluorescence in the 647-nm channel of the fluorescence microscope. The results indicate that it is possible to 1) strip the oligonucleotide detectable label from the functional nucleic acid of SNAP using a chaotropic agent (e.g., guanidine hydrochloride), and 2) not disrupt the electrostatic interaction between SNAP and the charged surface when SNAP is contacted with the chaotropic agent.

Additional experiments were performed to assess the effect of longer nucleotide sequences on oligonucleotide removal under stripping conditions. Two arrays were prepared by the method described above. The first array comprises a deposited SNAP with a functional nucleic acid configured to couple to a fluorescent-labeled oligonucleotide having nucleotide sequence ACAACTCAACCTCATCCCACTCC CACTCTCACCCTCATCAA (seq. Id 442). The second array contained SNAP with functional nucleic acids as described above having nucleotide sequence TA ATATGATGTATGTGG (seq. Id 441). The arrays were contacted with their corresponding fluorescently labeled complementary oligonucleotides (each containing 5 Alexa-Fluor 488 dyes), imaged fluorescently, incubated with 6M guanidine chloride, and then contacted with their corresponding complementary oligonucleotides. FIG. 70 shows fluorescence imaging data for two arrays depicting fluorescent labeling of functional nucleic acids and stripping results for each respective array. After guanidine chloride incubation, longer base pair oligonucleotides can still be detected in many sites, indicating that the length of the functional nucleic acid sequence can be adjusted to help retain or remove complementary oligonucleotides in the functional nucleic acid as desired.

Example 18 multiplexing arrays Using functional nucleic acids

SNAP arrays were prepared by the method of example 17. The mixture of deposited SNAP includes an equimolar mixture of a plurality of first tile shapes SNAP with a first functional nucleic acid and a plurality of second tile shapes SNAP with a second functional nucleic acid. The nucleotide sequence of the first functional nucleic acid is ATTATACTACATACACC (seq. Id 440) and the nucleotide sequence of the second functional nucleic acid is GTTTGTTGTTTGGGTTG (seq. Id 443).

The multiplexed array containing the first tile shape SNAP and the second tile shape SNAP is detected for 2 detection cycles, wherein the first cycle utilizes Alexa-Fluor 488-labeled oligonucleotides having a sequence complementary to the first functional nucleic acid, and wherein the second cycle utilizes Alexa-Fluor 488-labeled oligonucleotides having a sequence complementary to the second functional nucleic acid. Each complementary oligonucleotide contained 5 Alexa-Fluor 488 dyes. FIGS. 69A and 69C show fluorescence microscopy images of the binding of a first complementary oligonucleotide and a second complementary oligonucleotide, respectively. FIGS. 69B and 69D show fluorescence microscopy images of the stripping of the first and second complementary oligonucleotides, respectively, after application in guanidine hydrochloride. As shown, the addresses occupied by SNAPs of a first plurality of SNAPs can be distinguished from the addresses occupied by SNAPs of a second plurality of SNAPs based on the detection of the binding of complementary oligonucleotides to the functional nucleic acids of the SNAPs.

While preferred embodiments of the present invention have been shown and described herein, such embodiments are provided by way of example only, as will be apparent to those skilled in the art. It is not intended that the invention be limited to the specific embodiments provided in the specification. While the invention has been described with reference to the foregoing specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it is to be understood that all aspects of the invention are not limited to the specific descriptions, configurations, or relative proportions set forth herein, depending on various conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the present invention will also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

The disclosure set forth herein is also defined by the following terms, as set forth in the appended claims:

1. A composition comprising:

a structured nucleic acid particle comprising (i) a display moiety configured to be coupled to an analyte, (ii) a capture moiety configured to be coupled to a surface; and

(iii) A multifunctional moiety comprising a first functional group and a second functional group;

wherein the multifunctional moiety is coupled to the structured nucleic acid particle; and is also provided with

Wherein the first functional group is coupled to the display moiety, and wherein the second functional group is coupled to the capture moiety.

2. The composition of clause 1, wherein the multifunctional moiety comprises a nucleic acid strand.

3. The composition of clause 1 or 2, wherein the structured nucleic acid particles comprise a display surface comprising the display portion and a capture surface comprising the capture portion.

4. The composition of clause 3, wherein the structured nucleic acid particle comprises a plurality of tertiary structures, wherein the display surface comprises a first tertiary structure of the plurality of tertiary structures and the capture surface comprises a second tertiary structure of the plurality of tertiary structures.

5. The composition of clause 4, wherein the first tertiary structure is the same as the second tertiary structure.

6. The composition of clause 4, wherein the first tertiary structure is different from the second tertiary structure.

7. The composition of any of clauses 4-6, wherein the nucleic acid strand hybridizes to the structured nucleic acid particle forming a portion of the first tertiary structure or a portion of the second tertiary structure.

8. The composition of clause 7, wherein the multifunctional moiety hybridizes to the structured nucleic acid particle to form a portion of the first tertiary structure and a portion of the second tertiary structure.

9. The composition of any of clauses 4-8, wherein the orientation of the display surface or the orientation of the capture surface is defined relative to the axis of symmetry of the first tertiary structure or the axis of symmetry of the second tertiary structure.

10. The composition of clause 9, wherein the orientation of the presentation surface is the same as the orientation of the capture surface.

11. The composition of clause 9, wherein the orientation of the display surface is offset from the orientation of the capture surface by at least about 90 °.

12. The composition of clause 11, wherein the orientation of the presentation surface is offset from the orientation of the capture surface by about 180 °.

13. The composition of any one of clauses 4-12, wherein the display portion comprises two or more of the plurality of tertiary structures.

14. The composition of any one of clauses 4-13, wherein the capture moiety comprises two or more capture tertiary structures of the plurality of tertiary structures.

15. The composition of clause 14, wherein a display tertiary structure of the two or more display tertiary structures comprises a capture tertiary structure of the two or more capture tertiary structures.

16. The composition of clause 14, wherein the two or more display tertiary structures do not comprise any capture tertiary structures of the two or more capture tertiary structures.

17. The composition of clause 14, wherein the two or more capture tertiary structures do not comprise any of the two or more display tertiary structures.

18. The composition of any one of clauses 2-17, wherein the nucleic acid strand and the structured nucleic acid particle form a hybridization region comprising at least about 10 nucleotides.

19. The composition of clause 18, wherein the hybridization region comprises at least about 20 nucleotides.

20. The composition of any one of clauses 2-19, wherein the nucleic acid strand forms a hybridization region comprising at least one helical rotation.

21. The composition of clause 20, wherein the hybridization region comprises at least two helical rotations.

22. The composition of any one of the preceding clauses wherein the structured nucleic acid particles comprise a scaffold strand and a plurality of oligonucleotides hybridized to the scaffold strand.

23. The composition of clause 22, wherein a scaffold strand hybridized to the plurality of oligonucleotides forms a plurality of tertiary structures, wherein the plurality of tertiary structures comprises the first tertiary structure and the second tertiary structure.

24. The composition of clause 23, wherein the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure are coplanar.

25. The composition of clause 23, wherein the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure are not coplanar.

26. The composition of clause 23, wherein the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure intersect.

27. The composition of clause 23, wherein the axis of symmetry of the first tertiary structure and the axis of symmetry of the second tertiary structure do not intersect.

28. The composition of any one of clauses 23-27, wherein the plurality of tertiary structures surrounds an interior volume region of the structured nucleic acid particles.

29. The composition of clause 28, wherein the interior volume region comprises the display surface or the capture surface.

30. The composition of any one of the preceding clauses further comprising the analyte.

31. The composition of clause 30, wherein the display portion is coupled to the analyte.

32. The composition of any one of the preceding clauses further comprising the surface.

33. The composition of clause 32, wherein the capture moiety is coupled to the surface.

34. The composition of any one of clauses 30-33, wherein the analyte comprises a biomolecule selected from the group consisting of a polypeptide, a polysaccharide, a nucleic acid, a lipid, and combinations thereof.

35. The composition of any of clauses 1-33, wherein the analyte comprises a non-biological particle selected from the group consisting of a polymer, a metal oxide, a ceramic, a semiconductor, a mineral, and combinations thereof.

36. The composition of any one of the preceding clauses further comprising a second multifunctional moiety comprising a third functional group and a fourth functional group.

37. The composition of clause 36, wherein the display portion comprises the third functional group and the capture portion comprises the fourth functional group.

38. The composition of clause 36, wherein the display portion does not contain the third functional group or the fourth functional group.

39. The composition of clauses 36 or 37, wherein the fourth functional group is configured to couple to the surface.

40. The composition of clause 39, wherein the fourth functional group is coupled to the surface.

41. The composition of any one of clauses 36-40, wherein the third functional group is configured to couple to a second analyte.

42. The composition of clause 41, wherein the third functional group is coupled to the second analyte.

43. The composition of any one of clauses 36-40, wherein the third functional group is configured to couple to the analyte.

44. The composition of clause 43, wherein the third functional group is coupled to the analyte.

45. The composition of any one of clauses 36-40, wherein the third functional group is configured to couple to a functional nucleic acid strand.

46. The composition of clause 45, wherein the functional nucleic acid strand comprises a hybridization sequence, a priming sequence, or a nucleic acid barcode.

47. The composition of clauses 45 or 46, wherein the third functional group is coupled to the functional nucleic acid strand.

48. The composition of any of clauses 32-47, wherein the surface comprises a surface functional group configured to couple with the second functional group.

49. The composition of clause 48, wherein the surface functional group and the second functional group form a covalent bond.

50. The composition of clause 49, wherein the covalent bond is formed by a click reaction.

51. The composition of any one of the preceding clauses wherein the structured nucleic acid particles comprise one or more photocleavable linkers.

52. The composition of clause 51, wherein the multifunctional moiety does not comprise a photocleavable linker.

53. The composition of any one of the preceding clauses wherein the structured nucleic acid particles comprise one or more restriction sites.

54. The composition of clause 53, wherein the multifunctional moiety does not comprise a restriction site of the one or more restriction sites.

55. The composition of any one of the preceding clauses wherein the multifunctional moiety comprises a linker.

56. The composition of clause 55, wherein the linker comprises a modified nucleotide.

57. The composition of clauses 55 or 56, wherein the linker comprises a linking moiety configured to couple one or more additional molecules to the multifunctional moiety.

58. The composition of clause 57, wherein the one or more additional molecules comprise a third multifunctional moiety, wherein the third multifunctional moiety comprises a fifth functional group and a sixth functional group.

59. The composition of clause 58, wherein the sixth functional group is coupled to the linking moiety.

60. The composition of clauses 58 or 59, wherein the third multifunctional moiety hybridizes to the structured nucleic acid particle, wherein the capture moiety comprises the fifth functional group.

61. The composition of any one of clauses 58-60, wherein the fifth functional group is configured to be coupled to the surface.

62. The composition of clause 61, wherein the fifth functional group is coupled to the surface.

63. The composition of any one of the preceding clauses wherein the capture moiety comprises a modifying moiety selected from the group consisting of a charged moiety, a magnetic moiety, a steric moiety, an amphiphilic moiety, a hydrophobic moiety, and a hydrophilic moiety.

64. The composition of clause 63, wherein the charged moiety comprises a single stranded nucleic acid.

65. The composition of clause 64, wherein the capture moiety comprises a plurality of single stranded nucleic acids.

66. The composition of any one of the preceding clauses, further comprising a spacer group, wherein the spacer group is configured to couple the analyte to the display moiety, thereby creating a separation gap between the analyte and the structured nucleic acid particle.

67. The composition of clause 66, wherein the spacer group comprises a rigid spacer group selected from the group consisting of a polymer linker, a nucleic acid linker, and a nanoparticle linker.

68. The composition of clause 67, wherein the nucleic acid linker comprises a tertiary structure.

69. The composition of clauses 67 or 68, wherein the spacer group comprises a flexible linker.

70. The composition of any one of clauses 66 to 69, wherein the separation gap comprises a gap between the analyte and the capture moiety.

71. The composition of any one of clauses 66-70, wherein the separation gap comprises a gap between the analyte and the nearest point of the structured nucleic acid particle.

72. The composition of any one of clauses 66-71, wherein the separation gap is at least about 5 nanometers.

73. The composition of clause 72, wherein the separation gap is not more than about 100 nanometers.

74. The composition of any one of clauses 22-74, wherein the structured nucleic acid particles comprise two or more scaffold chains.

75. The composition of clause 74, wherein an oligonucleotide of the plurality of oligonucleotides hybridizes to at least two of the two or more scaffold chains.

76. The composition of clause 75, wherein at least 10% of the plurality of oligonucleotides hybridize to at least two of the two or more strands.

77. The composition of any one of the preceding clauses wherein the multifunctional moiety is covalently crosslinked to the structured nucleic acid particle.

78. The composition of any one of clauses 2-77, wherein the nucleic acid strand hybridizes to the structured nucleic acid particle at a characteristic melting temperature of at least 70 degrees celsius (c).

79. A composition comprising:

structured Nucleic Acid Particles (SNAP); and

a multifunctional moiety;

wherein the multifunctional moiety is coupled to the SNAP, and wherein the multifunctional moiety is configured to form a continuous linker from the surface to the analyte.

80. The composition of clause 79, wherein the multifunctional moiety comprises a first functional group and a second functional group.

81. The composition of clauses 79 or 80, wherein the multifunctional moiety comprises a nucleic acid strand configured to couple to the SNAP.

82. The composition of clauses 79 or 80, wherein the multifunctional moiety does not comprise a nucleic acid.

83. The composition of clause 82, wherein the multifunctional moiety further comprises a third functional group configured to couple to the SNAP.

84. The composition of clause 83, wherein the third functional group is configured to form a covalent bond with a complementary functional group of the SNAP.

85. The composition of clause 83, wherein the third functional group is configured to be non-covalently coupled to the SNAP.

86. The composition of any one of clauses 80-85, wherein the first functional group is configured to couple to the surface and the second functional group is configured to couple to the analyte.

87. The composition of any one of clauses 79-86, wherein the multifunctional moiety is coupled to the SNAP.

88. A Structured Nucleic Acid Particle (SNAP) complex comprising two or more SNAP, wherein each SNAP of the two or more SNAP is independently selected from display SNAP, utility SNAP, or a combination thereof;

wherein the display SNAP comprises a display moiety configured to couple with an analyte;

wherein the utility SNAP comprises a capture moiety configured to couple to a surface; and is also provided with

Wherein the two or more SNAP are coupled to form the SNAP complex.

89. The SNAP complex of clause 88, wherein the utility SNAP comprises a capture SNAP, a join SNAP, a structure SNAP, or a combination thereof.

90. The SNAP complex of clause 89, wherein the SNAP complex comprises a display SNAP and a capture SNAP.

91. The SNAP complex of clause 90, wherein the display SNAP or the capture SNAP comprises a DNA nanosphere or a DNA fold.

92. The SNAP complex of clause 91, wherein said DNA fold comprises a scaffold nucleic acid strand and a plurality of oligonucleotides coupled to said scaffold nucleic acid strand.

93. The SNAP complex of clause 92, wherein the scaffold strand comprises a circular strand or a non-circular strand having a length of at least 1000 nucleotides.

94. The SNAP complex of clause 92 or 93, wherein an oligonucleotide of the plurality of oligonucleotides comprises a capture moiety.

95. The SNAP complex of any of clauses 88-94, wherein the capture moiety is selected from the group consisting of a reactive moiety, a charged moiety, a magnetic moiety, streptavidin, and biotin.

96. The SNAP complex of clause 95, wherein the reactive moiety comprises a click reaction reagent.

97. The SNAP complex of any of clauses 92-96, wherein an oligonucleotide of the plurality of oligonucleotides further comprises a display portion.

98. The SNAP complex of clauses 92-97, wherein an oligonucleotide of the plurality of oligonucleotides comprises a capture moiety.

99. The SNAP complex of any of clauses 88-98, wherein the capture moiety is selected from the group consisting of a reactive moiety, a charged moiety, a magnetic moiety, streptavidin, and biotin.

100. The SNAP complex of clause 99, wherein said reactive moiety comprises a click reaction reagent.

101. The SNAP complex of any of clauses 88-100, wherein the display portion is attached to a face of the display SNAP that is offset from the face of the display SNAP to which the capture portion is attached by an angle of about 180 °.

102. The SNAP complex of any of clauses 88-101, wherein the display portion is attached to a face of the display SNAP that is offset from the face of the SNAP to which the capture portion is attached by an angle of less than about 180 °.

103. The SNAP complex of any of clauses 90-102, wherein the display SNAP comprises a utility face, wherein the utility face comprises a capture moiety, a detectable label, or a spatial blocking moiety.

104. The SNAP complex of clause 103, wherein the detectable label comprises a fluorescent label, a luminescent label, a nucleic acid barcode, an isotope, or a radiolabel.

105. The SNAP complex of any of clauses 90-104, wherein the displayed SNAP comprises a first SNAP coupling moiety and the captured SNAP comprises a second SNAP coupling moiety, wherein the displayed SNAP is coupled to the captured SNAP by coupling the first SNAP coupling moiety to the second SNAP coupling moiety.

106. The SNAP complex of clause 105, wherein the first SNAP coupling moiety and the second SNAP coupling moiety form a covalent bond.

107. The SNAP complex of clauses 105 or 106, wherein the first SNAP coupling moiety and the second SNAP coupling moiety comprise complementary pairs of click reaction reagents.

108. The SNAP complex of clause 105, wherein the first SNAP coupling moiety and the second SNAP coupling moiety form a non-covalent bond.

109. The SNAP complex of clause 108, wherein said non-covalent bond comprises a hydrogen bond, a nucleobase pair bond, or a streptavidin-biotin bond.

110. The SNAP complex of any of clauses 88-109, wherein the SNAP complex comprises multiple capture SNAP and a single display SNAP.

111. The SNAP complex of clause 110, wherein the plurality of SNAP comprises at least about 4 captured SNAP.

112. The SNAP complex of any of clauses 88-111, wherein the SNAP complex comprises a ratio of more than one capture SNAP per display SNAP.

113. The SNAP complex of clause 112, wherein the SNAP complex comprises at least two capture SNAP per display SNAP.

114. The SNAP complex of clause 113, wherein the SNAP complex comprises at least four capture SNAP per display SNAP.

115. The SNAP complex of any of clauses 88-114, wherein the SNAP complex comprises a display SNAP and two or more capture SNAP coupled to one or more faces of the display SNAP.

116. The SNAP complex of clause 115, wherein a first capture SNAP of the two or more capture SNAP is coupled to a first side of the display SNAP, and wherein a second capture SNAP of the two or more capture SNAP is coupled to a second side of the display SNAP.

117. The SNAP complex of clause 116, wherein a face of the first captured SNAP is coupled to a face of the second captured SNAP.

118. The SNAP complex of clause 116, wherein the first captured SNAP is not coupled to the second captured SNAP.

119. The SNAP complex of any of clauses 116-118, wherein the SNAP complex further comprises a third captured SNAP.

120. The SNAP complex of clause 119, wherein the third capture SNAP is coupled to a third face of the display SNAP.

121. The SNAP complex of clause 119 or 120, wherein the third captured SNAP is coupled to a face of the first captured SNAP, a face of the second captured SNAP, or a combination thereof.

122. The SNAP complex of any of clauses 119-121, wherein the first capture SNAP is larger in face than the first face of the display SNAP.

123. The SNAP complex of any of clauses 119-121, wherein the face of the first captured SNAP is substantially the same size as the first face of the displayed SNAP.

124. The SNAP complex of any of clauses 119-121, wherein the first capture SNAP is smaller in face than the first face of the display SNAP.

125. The SNAP complex of any of clauses 119-124, wherein the second capture SNAP is larger in face than the first face of the display SNAP.

126. The SNAP complex of any of clauses 119-124, wherein the face of the second captured SNAP is substantially the same size as the first face of the displayed SNAP.

127. The SNAP complex of any of clauses 119-124, wherein the second capture SNAP is smaller in face than the first face of the display SNAP.

128. The SNAP complex of any of clauses 115-127, wherein the one or more faces of the display SNAP do not comprise the capture moiety.

129. The SNAP complex of any of clauses 115-127, wherein the one or more faces of the display SNAP comprises at least about two faces.

130. The SNAP composite of clause 129, wherein the one or more faces of the display SNAP comprise at least about four faces.

131. The SNAP complex of any of clauses 128-130, wherein each of the one or more faces is coupled to a capture SNAP.

132. The SNAP complex of any of clauses 128-130, wherein at least one of the one or more faces is not coupled to a capture SNAP.

133. The SNAP complex of any of clauses 88-132, wherein the SNAP complex comprises at least one axis of symmetry.

134. The method of clause 133, wherein the axis of symmetry comprises a rotational axis of symmetry or a reflective axis of symmetry.

135. The method of clause 134, wherein the SNAP complex comprises an axis of rotational symmetry and an axis of reflective symmetry.

136. The SNAP complex of any of clauses 88-132, wherein the SNAP complex has no axis of symmetry.

137. The SNAP complex of any of clauses 88-136, wherein the SNAP complex has a square, rectangular, triangular, cross, or polygonal conformation.

138. The SNAP complex of any of clauses 89-137, wherein the capture SNAP comprises a utility face comprising a steric blocking moiety or a SNAP complex coupling moiety.

139. The SNAP complex of clause 138, wherein the spatial enclosure portion is selected from the group consisting of: polyethylene glycol (PEG), polyethylene oxide (PEO) or dextran.

140. The SNAP complex of clause 138, wherein the SNAP complex coupling moiety is configured to couple the SNAP complex with a second SNAP complex.

141. The SNAP complex of clauses 138 or 140, wherein the complex coupling moiety is configured to form a covalent bond or a non-covalent bond.

142. The SNAP complex of any of clauses 89-141, wherein the displayed SNAP comprises a capture moiety.

143. The SNAP complex of clause 142, wherein the capture moiety displaying SNAP or the capture moiety capturing SNAP comprises a modification moiety selected from the group consisting of: a charged moiety, a magnetic moiety, a steric moiety, an amphiphilic moiety, a hydrophobic moiety and a hydrophilic moiety.

144. The SNAP complex of any of clauses 142 or 143, wherein the capture moiety displaying SNAP is different from the capture moiety capturing SNAP.

145. The SNAP complex of clauses 142 or 143, wherein the capture portion displaying SNAP is the same as the capture portion capturing SNAP.

146. The SNAP complex of any of clauses 88-145, wherein the analyte is coupled to the display SNAP.

147. The SNAP complex of clause 146, wherein a single analyte is coupled to the display SNAP.

148. The SNAP complex of clause 146, wherein a plurality of polypeptides are coupled to the display SNAP.

149. The SNAP complex of any of clauses 88-148, wherein the SNAP complex comprises a plurality of displayed SNAP.

150. The SNAP complex of clause 149, wherein a display SNAP of the plurality of display SNAP is coupled to the analyte.

151. The SNAP complex of any of clauses 88-150, wherein a first SNAP comprising a first capture surface of the two or more SNAP and a second SNAP comprising a second capture surface of the two or more SNAP are rigidly coupled.

152. The SNAP complex of clause 151, wherein the capture plane of the first SNAP and the capture plane of the second SNAP are substantially coplanar.

153. The SNAP complex of clause 151, wherein the capture plane of the first SNAP and the capture plane of the second SNAP are not coplanar.

154. The SNAP complex of clause 153, wherein the capture face of the first SNAP is oriented at an angle of at least about 10 ° relative to the capture face of the second SNAP.

155. The SNAP complex of any of clauses 88-154, wherein the SNAP complex comprises one or more structural SNAP.

156. The SNAP complex of clause 155, wherein the one or more structural SNAP comprises a separate SNAP, a support SNAP, or a modified SNAP.

157. The SNAP complex of clause 156, wherein the separation SNAP is configured to form a separation gap between the analyte and the surface.

158. The SNAP complex of clause 157, wherein the separation gap is at least about 5nm.

159. The SNAP complex of clauses 157 or 158, wherein the separation gap is not greater than about 100nm.

160. The SNAP complex of clause 156, wherein the supporting SNAP or the modified SNAP couples at least one SNAP of the two or more SNAP.

161. A Structured Nucleic Acid Particle (SNAP) composition comprising:

a material comprising a surface; and

two or more SNAP, wherein each SNAP of the two or more SNAP is independently selected from a presentation SNAP, a utility SNAP, or a combination thereof;

wherein the display SNAP comprises a display moiety configured to couple with an analyte,

wherein the two or more SNAP are coupled to the surface; and is also provided with

Wherein a first SNAP of the two or more SNAP is coupled with a second SNAP of the two or more SNAP, thereby forming a SNAP complex.

162. The composition of clause 161, wherein the utility SNAP comprises capture SNAP, coupling SNAP, structural SNAP, or a combination thereof.

163. The composition of clause 161 or 162, wherein the material comprises a solid support.

164. The composition of any one of clauses 161-163, wherein the material comprises silicon, fused quartz, mica, or glass.

165. The composition of clause 163 or 164, wherein the surface comprises a layer selected from a metal, a metal oxide, or a polymer.

166. The composition of any of clauses 161-165, wherein the surface further comprises a functional group coupled to a first SNAP of the two or more SNAP.

167. The composition of clause 166, wherein a first SNAP of the two or more SNAP comprises a capture moiety coupled to a functional group of the material.

168. The composition of clause 166 or 167, wherein the functional group is coupled to a display SNAP or capture SNAP.

169. The composition of any of clauses 166-168, wherein the functional group is configured to form an electrostatic, magnetic, covalent, or non-covalent interaction with the SNAP complex.

170. The composition of clause 161, wherein a first SNAP of the two or more SNAP comprises a capture moiety directly coupled to the material.

171. The composition of clause 170, wherein the material comprises a metal oxide.

172. The composition of any of clauses 161-171, wherein the surface is patterned with a plurality of binding sites separated by gap regions, wherein each binding site is configured to bind to the SNAP complex, wherein the gap regions are configured not to bind to the SNAP complex.

173. The composition of clause 161 or 162, wherein the surface comprises a phase boundary between two fluids.

174. The composition of clause 173, wherein the phase boundary comprises a gas/liquid interface or a liquid/liquid interface.

175. The composition of any one of clauses 161-174, wherein the analyte is coupled to the SNAP complex.

176. The composition of any one of clauses 161-175, wherein the SNAP complex comprises at least 5000 square nanometers (nm) ² ) Is effective in terms of surface area.

177. The composition of clause 176, wherein the SNAP complex comprises at least 10000nm ² Is effective in terms of surface area.

178. The composition of clause 177, wherein the SNAP complex comprises at least 100000nm ² Is effective in terms of surface area.

179. The composition of any of clauses 161-178, wherein the effective surface area of the SNAP complex comprises at least 25% of the effective surface area of the binding site of the material configured to couple with the SNAP complex.

180. The composition of clause 179, wherein the effective surface area of the SNAP complex comprises at least 50% of the effective surface area of the binding site of the material configured to couple with the SNAP complex.

181. The composition of any of clauses 179 or 180, wherein the conformation of the SNAP complex coupled to the binding site prevents a second SNAP complex from coupling to the binding site.

182. The SNAP complex of any of clauses 161-181, wherein the SNAP complex has a square, rectangular, triangular, cross, or polygonal conformation.

183. The SNAP complex of any of clauses 161-182, wherein the surface comprises a binding structure that conforms to the conformation of the SNAP complex.

184. The SNAP complex of clause 183, wherein the binding structure comprises a two-dimensional or three-dimensional geometry.

185. The SNAP complex of clause 183 or 184, wherein the surface is patterned with a plurality of binding sites separated by gap regions, wherein each binding site comprises the binding structure, wherein each binding structure is configured to bind to the SNAP complex, wherein the gap regions are configured not to bind to the SNAP complex.

186. A Structured Nucleic Acid Particle (SNAP) composition comprising:

an analyte;

displaying SNAP; and

one or more SNAP selected from the group consisting of display SNAP, utility SNAP, and combinations thereof;

wherein the display SNAP comprises a display moiety configured to couple with the analyte;

wherein the display SNAP is coupled to the analyte; and is also provided with

Wherein the display SNAP is coupled to the one or more SNAP, thereby forming a SNAP complex.

187. A Structured Nucleic Acid Particle (SNAP) composition comprising:

a material comprising a surface;

an analyte;

displaying SNAP; and

wherein the display SNAP is coupled to the analyte;

wherein the display SNAP is coupled to the one or more SNAP, thereby forming a SNAP complex; and is also provided with

Wherein the SNAP complex is coupled to the surface.

188. An array, comprising:

a plurality of SNAP complexes; and

a material comprising a surface;

wherein each of said SNAP complexes is coupled to said surface; and is also provided with

Wherein each SNAP complex of the plurality of SNAP complexes is coupled to one or more other SNAP complexes of the plurality of SNAP complexes;

wherein each SNAP complex of the plurality of SNAP complexes comprises two or more SNAP independently selected from the group consisting of display SNAP, utility SNAP, and combinations thereof.

189. The array of clause 188, wherein the utility SNAP comprises capture SNAP, coupling SNAP, structural SNAP, or a combination thereof.

190. The array of clauses 188 or 189, wherein each SNAP complex of the plurality of SNAP complexes is reversibly coupled to one or more other SNAP complexes.

191. The array of clause 190, wherein a first SNAP complex of the plurality of SNAP complexes remains reversibly coupled to a second SNAP complex of the plurality of SNAP complexes for at least about 1 day.

192. The array of clauses 188 or 189, wherein each SNAP complex of the plurality of SNAP complexes is irreversibly coupled to one or more other SNAP complexes.

193. The array of any one of clauses 188-192, wherein each display SNAP of the array comprises a display portion.

194. The array of clause 193, wherein each display portion is separated from an adjacent display portion by a distance of at least about 50 nanometers (nm).

195. The array of clause 194, wherein each display portion is separated from an adjacent display portion by a distance of at least about 100 nm.

196. The array of clause 195, wherein each display portion is separated from an adjacent display portion by a distance of at least about 300 nm.

197. The array of any of clauses 188-196, wherein the surface is patterned with a plurality of binding sites separated by gap regions, wherein each binding site is configured to bind a plurality of SNAP complexes, wherein the gap regions are configured to not bind the SNAP complexes.

198. The array of clause 197, wherein each binding site is configured to bind two or more coupled SNAP complexes.

199. The array of any of clauses 188-198, wherein a plurality of SNAP complexes are coupled to a plurality of analytes.

200. The array of any of clauses 188-199, wherein the array comprises two or more species of SNAP complexes, wherein each species of the two or more species of SNAP complexes is chemically or conformationally different.

201. The array of clause 200, wherein the plurality of SNAP complexes of the first species are separated from the plurality of SNAP complexes of the second species.

202. The array of clauses 200 or 201, wherein the array comprises a homogeneous or heterogeneous mixture of the two or more species of SNAP complexes.

203. The method of any of clauses 200-202, wherein each of the two or more species of SNAP complexes is configured to couple with a single species of analyte of a plurality of species of analyte.

204. The array of clause 203, wherein the single species of analyte is selected from the group consisting of a sample analyte, a control analyte, a standard analyte, and an inert analyte.

205. A method of forming an array, comprising:

providing a plurality of SNAP complexes;

coupling each SNAP complex of the plurality of SNAP complexes with one or more additional SNAP complexes from the plurality of SNAP complexes; and

coupling each SNAP complex of the plurality of SNAP complexes to a surface;

wherein each SNAP complex comprises a display SNAP and one or more utility SNAP, and wherein each SNAP complex comprises a coupling moiety coupled to the surface, thereby forming an array.

206. The method of clause 205, wherein the utility SNAP comprises capture SNAP, coupling SNAP, structural SNAP, or a combination thereof.

207. The method of clauses 205 or 206, wherein associating each SNAP complex of the plurality of SNAP complexes occurs prior to coupling each SNAP complex of the plurality of SNAP complexes to one or more additional SNAP complexes.

208. The method of clauses 205 or 206, wherein associating each SNAP complex of the plurality of SNAP complexes occurs after coupling each SNAP complex of the plurality of SNAP complexes to one or more additional SNAP complexes.

209. The method of any of clauses 205-207, wherein the displaying SNAP comprises displaying a portion.

210. The method of clause 209, further comprising the step of coupling an analyte to the display portion.

211. The method of clause 210, wherein the analyte is coupled to the display portion after coupling each SNAP complex of the plurality of SNAP complexes to the surface.

212. The method of clause 210, wherein the analyte is coupled to the display portion prior to coupling each SNAP complex of the plurality of SNAP complexes to the surface.

213. The method of clause 210, wherein the analyte is coupled to the display portion after coupling each SNAP complex of the plurality of SNAP complexes to one or more additional SNAP complexes from the plurality of SNAP complexes.

214. The method of clause 210, wherein the analyte is coupled to the display portion prior to coupling each SNAP complex of the plurality of SNAP complexes to one or more additional SNAP complexes from the plurality of SNAP complexes.

215. The method of clause 210, wherein after providing the plurality of SNAP complexes, the polypeptide is coupled to the display portion.

216. The method of clause 210, wherein the analyte is coupled to the display portion prior to providing the plurality of SNAP complexes.

217. The method of any one of clauses 210-216, wherein the analyte is covalently coupled to the display portion.

218. The method of clause 217, wherein the analyte is covalently coupled to the display portion by a click reaction.

219. The method of clause 217 or 218, wherein the coupling occurs in the presence of a surfactant.

220. A composition comprising:

a. a structured nucleic acid particle, wherein the structured nucleic acid particle comprises:

i. maintaining the components;

a display moiety comprising a coupling group configured to couple an analyte, wherein the display moiety is coupled to the retention component; and

a capture moiety configured to couple to a surface, wherein the capture moiety comprises a plurality of first surface-interacting oligonucleotides, and wherein each first surface-interacting oligonucleotide of the plurality of first surface-interacting oligonucleotides comprises a first nucleic acid strand coupled to the retention component and a first surface-interacting moiety, wherein the first surface-interacting moiety is configured to form a coupling interaction with a surface-linking moiety;

wherein the capture moiety is prevented from contacting the display moiety by the retention component, an

b. An analyte comprising a complementary coupling group configured to couple with the display portion of the structured nucleic acid particle.

221. The composition of clause 220, wherein the first surface interaction moiety comprises a second nucleic acid strand.

222. The composition of clause 221, wherein said second nucleic acid strand is configured to hybridize to a complementary nucleic acid strand of said surface-binding moiety.

223. The composition of any one of clauses 220-222, wherein the first surface interaction moiety comprises a capture group selected from the group consisting of a reactive group, a charged group, a magnetic group, and a binding pair component.

224. The composition of clause 223, wherein the binding pair is selected from the group consisting of streptavidin-biotin, spyCatcher-Spytag, snoopCatcher-snoptag, and sdycatcche r-sdutag.

225. The composition of any one of clauses 220-224, wherein the first surface interaction moiety comprises a linker.

226. The composition of clause 225, wherein the linker comprises a hydrophobic linker, a hydrophilic linker, or a cleavable linker.

227. The composition of clause 223, wherein the reactive group is configured to conjugate to the surface-linking moiety via a click-type reaction.

228. The composition of clause 223, wherein the first surface interaction moiety comprises a group configured to form a non-covalent interaction selected from electrostatic interactions, magnetic interactions, hydrogen bonding, ionic bonding, van der waals bonding, hydrophobic interactions, or hydrophilic interactions.

229. The composition of clauses 223 or 228, wherein the first surface interaction moiety comprises a nanoparticle selected from the group consisting of an inorganic nanoparticle, a carbon nanoparticle, a polymer nanoparticle, and a biopolymer.

230. The composition of any one of clauses 220-229, wherein the structured nucleic acid particles comprise:

a. a scaffold nucleic acid strand; and

b. a plurality of staple nucleic acid strands, wherein each staple nucleic acid strand hybridizes to a discrete region of the scaffold nucleic acid strand.

231. The composition of clause 230, wherein the plurality of staple nucleic acid strands comprises a first surface-interacting oligonucleotide of the plurality of first surface-interacting oligonucleotides.

232. The composition of clause 231, wherein the coupling of the first surface interaction oligonucleotide forms a tertiary structure of the structured nucleic acid particle.

233. The composition of clause 232, wherein the capture moiety comprises the tertiary structure.

234. The composition of clauses 232 or 233, wherein the display portion comprises a tertiary structure.

235. The composition of any one of clauses 220-234, wherein a first surface interaction oligonucleotide of the plurality of first surface interaction oligonucleotides comprises a first nucleotide sequence configured to couple with the structured nucleic acid particle and a second nucleotide sequence configured to couple with a complementary oligonucleotide of a surface attachment moiety.

236. The composition of clause 235, wherein the second nucleotide sequence comprises a nucleotide sequence that does not have self-complementarity of more than three consecutive nucleotides.

237. The composition of clause 235, wherein the second nucleotide sequence comprises no more than 3 deoxyribonucleotide species selected from the group consisting of deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine.

238. The composition of clause 235, wherein the second nucleotide sequence comprises a nucleotide sequence having self-complementarity of at least four consecutive nucleotides.

239. The composition of clause 238, wherein the self-complementarity comprises a nucleic acid secondary structure selected from the group consisting of a duplex, a stem-loop, a pseudoknot, and a G-quadruplex.

240. The composition of any one of clauses 235-239, wherein a first surface interaction oligonucleotide of the plurality of first surface interaction oligonucleotides comprises a homo-nucleotide sequence of at least four nucleotides selected from a polydeoxyadenosine sequence, a polydeoxycytidine sequence, a polydeoxyguanosine sequence, or a polydeoxythymidine sequence.

241. The composition of any one of clauses 235-240, wherein the second nucleotide sequence comprises at least 5 nucleotides.

242. The composition of clause 241, wherein the second nucleotide sequence comprises at least 10 nucleotides.

243. The composition of clause 242, wherein the second nucleotide sequence comprises at least 15 nucleotides.

244. The composition of any one of clauses 241-243, wherein the second nucleotide sequence comprises no more than 100 nucleotides.

245. The composition of any one of clauses 220-244, wherein a first surface interaction oligonucleotide of the plurality of first surface interaction oligonucleotides further comprises a coupling group.

246. The composition of clause 245, wherein the first surface interaction oligonucleotide is coupled to the analyte.

247. The composition of any one of clauses 220-246, wherein the plurality of first surface interaction oligonucleotides comprises at least 5 first surface interaction oligonucleotides.

248. The composition of clause 247, wherein the plurality of first surface interaction oligonucleotides comprises at least 10 first surface interaction oligonucleotides.

249. The composition of clause 248, wherein the plurality of first surface interaction oligonucleotides comprises at least 20 first surface interaction oligonucleotides.

250. The composition of any one of clauses 247 to 249, wherein the capture moiety comprises an average first surface interaction oligonucleotide density of at least 0.0001 single stranded oligonucleotides per square nanometer of effective surface area.

251. The composition of clause 250, wherein the capture moiety comprises an average first surface interaction oligonucleotide density of at least 0.001 single stranded oligonucleotides per square nanometer of effective surface area.

252. The composition of clause 251, wherein the capture moiety comprises an average first surface interaction oligonucleotide density of at least 0.01 single stranded oligonucleotides per square nanometer of effective surface area.

253. The composition of any one of clauses 247 to 252, wherein the first surface interaction oligonucleotide density is substantially uniform over the effective surface area of the capture moiety.

254. The composition of any one of clauses 247 to 252, wherein the first surface interaction oligonucleotide density is not substantially uniform over the effective surface area of the capture moiety.

255. The composition of clause 254, wherein a fraction of the plurality of first surface interaction oligonucleotides is located near the central region of the capture moiety.

256. The composition of clause 254 or 255, wherein a fraction of the plurality of first surface interaction oligonucleotides are concentrated near the outer region of the capture moiety.

257. The composition of any one of clauses 220-256, wherein the capture moiety further comprises a second surface interaction oligonucleotide, wherein the second surface interaction oligonucleotide comprises a first nucleotide sequence and a second surface interaction moiety, the first nucleotide sequence configured to couple with the structured nucleic acid particle, wherein the second surface interaction moiety of the second surface interaction oligonucleotide is different from the first surface interaction moiety of a first surface interaction oligonucleotide of the plurality of first surface interaction oligonucleotides.

258. The composition of clause 257, wherein the first surface-interacting moiety comprises a nucleic acid having a first nucleic acid sequence and the second surface-interacting moiety comprises a nucleic acid having a second nucleic acid sequence, wherein the first nucleic acid sequence is different from the second nucleic acid sequence.

259. The composition of clause 257, wherein the first surface-interacting moiety comprises a nucleic acid having a first nucleic acid sequence and the second surface-interacting moiety comprises a reactive group configured to form a covalent bond with a coupling surface or a non-nucleic acid group configured to form a non-covalent interaction with a coupling surface.

260. A composition comprising:

i. maintaining the components;

a display moiety coupled to the retention component; and

a capture moiety coupled to the retention component, wherein the capture moiety comprises a plurality of oligonucleotides, and wherein each oligonucleotide of the plurality of oligonucleotides comprises a surface interaction moiety; and

b. a solid support comprising a coupling surface, wherein the surface comprises a surface-connecting moiety, and wherein a surface-interacting moiety of the plurality of surface-interacting moieties is coupled to the surface-connecting moiety, wherein the display moiety is prevented from contacting the surface by the retention component.

261. The composition of clause 260, further comprising an analyte coupled to the display portion.

262. The composition of clause 261, wherein the analyte is prevented from contacting the surface by the retention component.

263. The composition of clause 260, wherein the solid support comprises an address comprising the one or more surface-attachment moieties, wherein the address is resolvable at a single analyte resolution.

264. The composition of clause 261, wherein the address comprises one or more surfaces, wherein the one or more surfaces comprise the coupling surface, and wherein the coupling surface comprises the one or more surface attachment moieties.

265. The composition of clause 262, wherein the one or more surfaces form a three-dimensional structure of the solid support.

266. The composition of clause 263, wherein the three-dimensional structure comprises a raised structure or a pore structure.

267. The composition of any one of clauses 260-264, wherein the coupling of the structured nucleic acid particles to the solid support blocks the display portion from contacting the coupling surface.

268. The composition of any one of clauses 260-265, wherein the coupling surface comprises a surface area greater than the effective surface area of the capture moiety of the structured nucleic acid particles.

269. The composition of any one of clauses 260-265, wherein the coupling surface comprises a surface area that is less than the effective surface area of the capture moiety of the structured nucleic acid particles.

270. The composition of any one of clauses 260-267, wherein the one or more surface-attachment moieties comprise one or more complementary oligonucleotides, wherein a complementary oligonucleotide of the plurality of complementary oligonucleotides is configured to couple with the surface-interacting moiety, and wherein the surface-interacting moiety comprises a nucleic acid strand having a nucleotide sequence configured to hybridize to the complementary oligonucleotide.

271. The composition of any one of clauses 260-268, wherein the one or more surface-attachment moieties comprise one or more complementary reactive groups, wherein a complementary reactive group of the one or more complementary reactive groups is configured to couple with the surface-interacting moiety, and wherein the surface-interacting moiety comprises a reactive group configured to couple with the complementary reactive group.

272. The composition of any one of clauses 260-269, wherein the one or more surface attachment moieties comprise one or more surface groups, wherein the surface groups of the one or more complementary reactive groups are configured to form a coupling interaction with the surface interaction moiety, and wherein the coupling interaction comprises an electrostatic interaction, a magnetic interaction, a hydrogen bond, an ionic bond, a van der waals bond, a hydrophobic interaction, or a hydrophilic interaction.

273. The composition of any one of clauses 260-270, wherein the coupling surface comprises a plurality of surface-attachment moieties.

274. The composition of clause 271, wherein the surface-attachment moiety density of the coupling surface is substantially uniform across the coupling surface.

275. The composition of clause 271, wherein the surface-attachment moiety density of the coupling surface is not substantially uniform across the coupling surface.

276. The composition of clause 273, wherein a fraction of the plurality of surface-attachment moieties are located in a central region of the coupling surface.

277. The composition of clauses 273 or 274, wherein the plurality of surface-connecting portions of the second fraction are located in an outer region of the coupling surface.

278. The composition of any one of clauses 271-275, wherein a fraction of the surface-interacting moieties of the plurality of oligonucleotides are coupled to a fraction of the surface-linking moieties of the plurality of surface-linking moieties.

279. The composition of clause 276, wherein the fraction of the surface-interacting moiety comprises at least 0.1.

280. The composition of clause 277, wherein the fraction of the surface-interacting moiety comprises at least 0.5.

281. The composition of clauses 277 or 278, wherein the fraction of the surface-interacting moiety is less than 1.0.

282. The composition of any one of clauses 277-279, wherein the fraction of surface-attachment moieties comprises at least 0.01.

283. The composition of clause 280, wherein the fraction of surface-attachment moieties comprises at least 0.1.

284. The composition of clause 281, wherein the fraction of surface-attachment moieties comprises less than 1.0.

285. The composition of any one of clauses 260-284, wherein the solid support further comprises a passivation layer.

286. The composition of clause 285, wherein the passivation layer comprises a plurality of molecules configured to prevent non-specific binding of molecules to the solid support.

287. The composition of clause 286, wherein the plurality of molecules comprises a plurality of surface-linked molecular chains selected from polyethylene glycol, polyethylene oxide, alkanes, nucleic acids, or dextran.

288. The composition of clauses 286 or 287, wherein each molecule of the plurality of molecules comprises a surface-connecting portion of the one or more surface-connecting portions.

289. The composition of any one of clauses 286-288, wherein each molecule of the plurality of molecules further comprises a linking group coupling a surface-linking moiety of the one or more surface-linking moieties to a coupling surface.

290. The composition of clause 289, wherein the linking group comprises a silane, a phosphate or a phosphonate.

291. A method of identifying a polypeptide, the method comprising:

a. providing a composition of any one of clauses 260-290, wherein the polypeptide is coupled to the display portion;

b. contacting the solid support with a plurality of detectable affinity reagents;

c. detecting the presence or absence of binding of a detectable affinity reagent of the plurality of detectable affinity reagents to the polypeptide;

d. optionally repeating steps b) -c) with a second plurality of detectable affinity reagents; and

e. identifying the polypeptide based on the presence or absence of binding of one or more of the affinity reagents.

292. The method of clause 291, wherein the detecting of the presence or absence of the binding comprises detecting a signal from a detectable affinity reagent of the plurality of detectable affinity reagents.

293. The method of clause 292, wherein the detectable signal comprises fluorescence, luminescence lifetime, or signal encoding.

294. The method of clause 293, wherein the signal encoding comprises transferring a nucleic acid barcode or a peptide barcode from the detectable affinity reagent to a record nucleic acid or peptide.

295. A method of sequencing a polypeptide, the method comprising:

b. removing terminal amino acid residues of said polypeptide by Edman-type degradation reaction;

c. identifying the terminal amino acid residue; and

d. repeating steps b-c) until the amino acid residue sequence of the polypeptide is identified.

296. The method of clause 295, wherein the identifying of the terminal amino acid residue comprises:

a. contacting said polypeptide with an affinity reagent having binding specificity for said terminal amino acid residue; and

b. detecting the presence or absence of the affinity reagent, wherein the affinity reagent is configured to generate a distinguishable signal corresponding to the terminal amino acid residue, wherein the distinguishable signal is detectable by fluorescence, luminescence, or luminescence lifetime.

297. The method of clause 296, wherein the distinguishable signal is detectable by fluorescence, luminescence, or luminescence lifetime.

298. The method of clause 296, wherein the identifying of the terminal amino acid residue comprises performing a fluorescent sequencing reaction on the polypeptide.

299. A single analyte array comprising:

a. a solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is distinguishable by a single analyte resolution, wherein each address comprises a conjugate surface, and wherein each conjugate surface comprises one or more surface-attachment moieties;

b. A plurality of structured nucleic acid particles, wherein each structured nucleic acid particle comprises a coupling moiety, wherein the coupling moiety comprises a plurality of oligonucleotides, wherein each oligonucleotide in the plurality of oligonucleotides comprises a surface interaction moiety, wherein each structured nucleic acid particle in the plurality of structured nucleic acid particles is coupled to an address in the plurality of addresses by binding of the surface interaction moiety of the plurality of oligonucleotides to a surface attachment moiety of one or more complementary oligonucleotides, and wherein a structured nucleic acid particle in the plurality of structured nucleic acid particles comprises a display moiety comprising a coupling site coupled to an analyte.

300. The single analyte array of clause 299, wherein the array comprises an ordered array.

301. The single analyte array of clause 300, wherein each coupling surface is formed by a photolithographic process.

302. The single analyte array of clause 300 or 301, wherein each address of the plurality of addresses is adjacent to one or more interstitial regions, wherein each interstitial region of the one or more interstitial regions does not comprise a coupling surface.

303. The single analyte array of clause 302, wherein a gap region of the one or more gap regions comprises a disruption moiety, wherein the disruption moiety is configured to reduce the likelihood of a molecule coupling with the gap region.

304. The single analyte array of clause 302 or 303, wherein the coupling surface comprises a raised surface or a recessed surface relative to a interstitial region of the one or more interstitial regions.

305. The single analyte array of clause 299, wherein the array comprises a disordered array.

306. The single analyte array of clause 305, wherein the disordered array further comprises a lipid bilayer adjacent to the solid support.

307. The method of clause 306, wherein a surface-connecting moiety of the one or more surface-connecting moieties is coupled to a lipid molecule of the lipid bilayer.

308. The method of clause 307, wherein the lipid molecule comprises a phospholipid or cholesterol.

309. The single analyte array of any of clauses 299-308, wherein the SNAP occupancy score for the plurality of addresses comprises at least 0.5.

310. The single analyte array of clause 309, wherein the SNAP occupancy score for the plurality of addresses comprises at least 0.9.

311. The single analyte array of clauses 309 or 310, wherein the plurality of addresses comprises an address score of two or more SNAP's of no more than about 0.1.

312. The single analyte array of clause 311, wherein the plurality of addresses comprises an address score of two or more SNAP's of no more than about 0.01.

313. The single analyte array of any of clauses 309-312, wherein the score of the address having the detectable analyte is at least 0.5.

314. The single analyte array of clause 313, wherein the score of the address having the detectable analyte is at least 0.9.

315. A single analyte array comprising:

a. a solid support comprising a plurality of addresses, wherein each address of the plurality of addresses is distinguishable from each other address by a single analyte resolution, and wherein each address is separated from each adjacent address by one or more gap regions; and

b. a plurality of analytes, wherein a single analyte of the plurality of analytes is coupled to an address of the plurality of addresses, wherein each address of the plurality of addresses comprises no more than one single analyte, wherein each single analyte is coupled to a coupling surface of the address by a nucleic acid structure, and wherein the nucleic acid structure blocks the single analyte from contacting the coupling surface.

Claims

1. A nanostructure, comprising:

(a) A compact nucleic acid structure comprising a scaffold strand hybridized to a first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridizes to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single stranded regions of the scaffold strand, and wherein the relative positions of the adjacent tertiary structures are position constrained;

(b) A permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides hybridized to the scaffold strand; and

(c) A solid support comprising surface-attached oligonucleotides, wherein the surface-attached oligonucleotides are attached to the surface of the solid support, and wherein the surface-attached oligonucleotides hybridize to the structurally-permeable staple oligonucleotides.

2. The nanostructure of claim 1, wherein the dense nucleic acid structure further comprises a display moiety, wherein the display moiety is configured to couple the nanostructure with a target analyte.

3. The nanostructure of claim 1 or 2, wherein a staple oligonucleotide of the second plurality of staple oligonucleotides comprises a pendant single stranded nucleic acid.

4. The nanostructure of claim 3, wherein the overhanging single stranded nucleic acid is spatially oriented at an angular offset of at least 90 ° relative to the orientation of the display portion.

5. The nanostructure of claim 3 or 4, wherein each staple oligonucleotide of the second plurality of staple oligonucleotides comprises a pendant single stranded nucleic acid.

6. The nanostructure of any one of claims 3-5, further comprising: (d) An analyte of interest coupled to the dense nucleic acid structure.

7. The nanostructure of claim 6, wherein the target analyte comprises a target polypeptide.

8. The nanostructure of claim 6 or 7, wherein the polypeptide of interest is covalently attached to the dense nucleic acid structure.

9. The nanostructure of claim 8, wherein the permeable structure is spatially oriented at an angular offset of at least 90 ° relative to the orientation of the target analyte.

10. The nanostructure of claim 8 or 9, wherein the permeable structure is positionally constrained from contact with the target analyte.

11. The nanostructure of any one of claims 8-10, further comprising: (e) an affinity reagent coupled to the target analyte.

12. The nanostructure of claim 11, wherein the affinity reagent is coupled to an epitope of the analyte of interest.

13. The nanostructure of claim 11 or 12, wherein the nanostructure positionally constrains the affinity reagent to prevent contact with the solid support.

14. The nanostructure of any one of claims 1-13, wherein the surface of the solid support comprises raised features or recessed features.

15. The nanostructure of claim 14, wherein the raised features or recessed features comprise an amount of the surface-bound oligonucleotides that exceeds an amount of the second plurality of staple oligonucleotides hybridized to the surface-bound oligonucleotides.

16. The nanostructure of claim 15, wherein two or more of the surface-linked oligonucleotides hybridize to staple oligonucleotides of the second plurality of staple oligonucleotides.

17. The nanostructure of any one of claims 14-16, wherein the surface area of the raised features or the recessed features exceeds the effective surface area of the nanostructure.

18. The nanostructure of any one of claims 14-17, wherein the shape of the surface region of the raised features or the recessed features is different from the shape of the effective surface region of the dense nucleic acid structure.

19. The nanostructure of any one of claims 1-148, wherein the solid support further comprises a interstitial region, wherein the interstitial region is configured to inhibit coupling of the nanostructure to the interstitial region.

20. The nanostructure of any one of claims 1-19, wherein a first tertiary structure of the plurality of tertiary structures comprises a first axis of symmetry having a first length, wherein a second tertiary structure of the plurality of tertiary structures comprises a second axis of symmetry having a second length, and wherein an average distance between the first axis of symmetry and the second axis of symmetry is no more than 20 nanometers, wherein the average distance is calculated over the smaller of the first length and the second length.

21. The nanostructure of claim 20, wherein the first axis of symmetry is substantially coplanar with the second axis of symmetry.

22. The nanostructure of claim 20 or 21, wherein the first axis of symmetry is substantially parallel to the second axis of symmetry.

23. The nanostructure of claim 20 or 21, wherein the first axis of symmetry is not parallel to the second axis of symmetry.

24. The nanostructure of claim 20, wherein the average distance between the first axis of symmetry and the second axis of symmetry varies by no more than 10% over time.

25. The nanostructure of claim 20, wherein the first axis of symmetry is not coplanar with the second axis of symmetry.

26. The nanostructure of claim 25, wherein the first axis of symmetry is skewed from the second axis of symmetry.

27. The nanostructure of claim 26, wherein the angular offset between the first axis of symmetry and the second axis of symmetry is at least 5 °.

28. The nanostructure of claim 26 or 27, wherein the angular offset does not vary by more than 10% in time.

29. An array comprising a plurality of sites, wherein a site of the plurality of sites comprises the nanostructure of any one of claims 1-28.

30. The array of claim 29, wherein at least 40% of the plurality of sites comprise the nanostructure of any one of claims 1-28.

31. A method of coupling a nucleic acid nanostructure to an array, comprising:

a. contacting a solid support with a nucleic acid nanostructure, wherein the solid support comprises a surface-linked oligonucleotide attached to the solid support, and wherein the nucleic acid nanostructure comprises:

i. a compact nucleic acid structure comprising a scaffold strand hybridized to a first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridizes to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single stranded regions of the scaffold strand, and wherein the relative positions of the adjacent tertiary structures are position constrained;

a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides hybridized to the scaffold strand; and

b. hybridizing a surface-attached oligonucleotide to a staple oligonucleotide of the second plurality of staple oligonucleotides.

32. A method of preparing an analyte array, comprising:

a. Providing an array comprising a plurality of sites, wherein each site comprises a surface-linked oligonucleotide;

b. contacting the array with a plurality of analytes, wherein each analyte is coupled to a nucleic acid nanostructure, wherein each nucleic acid nanostructure comprises a plurality of surface-coupled oligonucleotides; and

c. coupling one and only one nucleic acid nanostructure to a site of the plurality of sites, wherein coupling the nucleic acid nanostructure comprises hybridizing a surface-attached oligonucleotide of the site to a surface-coupled oligonucleotide of the nucleic acid nanostructure.

33. The method of claim 32, wherein at least 70% of the plurality of sites comprise at least one nucleic acid nanostructure coupled to the sites.

34. The method of claim 32 or 33, wherein at least 40% of the plurality of sites comprise no more than one nucleic acid nanostructure coupled to the sites.

35. The method of any one of claims 32-34, wherein each of the surface-linked oligonucleotides comprises a polynucleotide repeat sequence.

36. The method of claim 35, wherein each of the surface-coupled oligonucleotides comprises a polynucleotide repeat sequence that is complementary to the polynucleotide repeat sequence of the surface-attached oligonucleotide.

37. The method of any one of claims 32-36, wherein the nucleic acid nanostructure comprises a nucleic acid fold.

38. The method of any one of claims 32-37, wherein each of the sites comprises an amount of surface-bound oligonucleotides that exceeds an amount of the surface-coupled oligonucleotides hybridized to the surface-bound oligonucleotides.

39. The method of any one of claims 32-38, wherein coupling one and only one nucleic acid nanostructure to a site of the plurality of sites comprises hybridizing two or more surface-linked oligonucleotides to a surface-coupled oligonucleotide of the plurality of surface-coupled oligonucleotides.

40. The method of any one of claims 32-39, wherein contacting the array with a plurality of analytes comprises contacting the array with a first fluid medium comprising the plurality of analytes.

41. The method of claim 40, further comprising: (d) changing a condition of the first fluid medium.

42. The method of claim 41, wherein changing the condition of the fluid medium comprises changing a temperature of the first fluid medium.

43. The method of claim 41, wherein changing the condition of the fluid medium comprises changing an ionic strength of the first fluid medium.

44. The method of claim 41, wherein changing the condition of the fluid medium comprises changing the pH of the first fluid medium.

45. The method of claim 41, wherein altering the condition of the first fluid medium comprises altering the concentration of a surfactant, chaotrope, or denaturant.

46. The method of any one of claims 32-45, further comprising: (d) Rinsing unbound analyte from the solid support in a second fluid medium.

47. The method of claim 46, wherein the second fluid medium comprises a surfactant, chaotrope, or denaturant.

48. The method of any one of claims 32-47, further comprising coupling each of the analytes to a nucleic acid nanostructure of the plurality of nucleic acid nanostructures prior to step (b).

49. The method of claim 48, wherein said coupling each of said analytes to a nucleic acid nanostructure of said plurality of nucleic acid nanostructures comprises coupling one and only one analyte to one and only one nucleic acid nanostructure.

50. The method of any one of claims 32-49, wherein the plurality of analytes comprises polypeptides.

51. The method of claim 50, wherein the polypeptide is derived from a biological sample.

52. The method of any one of claims 32-51, wherein the plurality of analytes comprises a plurality of peptide fragments derived from a single polypeptide.

53. The method of any one of claims 32-52, further comprising, after coupling one and only one nucleic acid nanostructure to the site of the plurality of sites: (g) Contacting the array with a plurality of affinity reagents, and (h) binding an affinity reagent of the plurality of affinity reagents to an analyte coupled to the nucleic acid nanostructure.

54. The method of claim 53, further comprising: (i) Identifying an address on the array, the address comprising an affinity reagent that binds to the analyte.

55. The method of any one of claims 32-54, wherein the coupling one and only one nucleic acid nanostructure to a site in the plurality of sites further comprises coupling one and only one nucleic acid nanostructure to a fraction of sites in the plurality of sites.

56. The method of claim 55, further comprising: (j) The address of each of the points of the score is identified with a single analyte resolution.

57. The method of any one of claims 32-56, wherein the solid support comprises a plurality of sites, wherein each site of the plurality of sites is individually resolvable at a single analyte resolution.

58. The method of claim 57, wherein each of the plurality of sites comprises a surface-linked oligonucleotide.

59. The method of claim 57 or 58, wherein the average spacing of the plurality of sites is no more than 2 microns.

60. The method of any one of claims 57-59, wherein the average size of the plurality of sites is no more than 500nm.

61. An array of target analytes, comprising:

a. a solid support comprising a plurality of sites, wherein each site comprises a surface-linked oligonucleotide;

b. a plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure is configured to couple to an analyte, wherein each nucleic acid nanostructure comprises a plurality of surface-coupled oligonucleotides, wherein each surface-coupled oligonucleotide does not comprise self-complementarity, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites by hybridization of a surface-coupled oligonucleotide to a surface-attached oligonucleotide; and

c. A plurality of target analytes, wherein each target analyte is coupled to a nucleic acid nanostructure of the plurality of nucleic acid nanostructures.

62. A nucleic acid nanostructure comprising at least 10 coupled nucleic acids, wherein the nucleic acid nanostructure comprises:

a. a dense region comprising high internal complementarity, wherein the high internal complementarity comprises at least 50% double stranded nucleic acid and at least 1% single stranded nucleic acid, and wherein the dense region comprises a display moiety, wherein the display moiety is coupled to or configured to be coupled to a target analyte; and

b. a permeable region comprising low internal complementarity, wherein the low internal complementarity comprises at least about 50% single stranded nucleic acid, and wherein the permeable region comprises a coupling moiety, wherein the coupling moiety forms or is configured to form a coupling interaction with a solid support.

63. The nucleic acid nanostructure of claim 62, wherein the nucleic acid nanostructure comprises at least 50 coupled oligonucleotides.

64. The nucleic acid nanostructure of claim 63, wherein the nucleic acid nanostructure comprises at least 100 coupled oligonucleotides.

65. The nucleic acid nanostructure of any one of claims 62-64, wherein the high internal complementarity comprises at least 80% double stranded nucleic acid.

66. The nucleic acid nanostructure of claim 65, wherein the high internal complementarity comprises at least 5% single stranded nucleic acid.

67. The nucleic acid nanostructure of any one of claims 62-66, wherein the high internal complementarity comprises no more than 20% single stranded nucleic acid.

68. The nucleic acid nanostructure of any one of claims 62-67, wherein the low internal complementarity comprises at least 90% single stranded nucleic acid.

69. The nucleic acid nanostructure of claim 68, wherein the low internal complementarity comprises at least 99% single stranded nucleic acid.

70. The nucleic acid nanostructure of claim 68 or 69, wherein the low internal complementarity does not comprise double stranded nucleic acids.

71. The nucleic acid nanostructure of any one of claims 62-70, wherein the permeable region comprises a plurality of overhang portions.

72. The nucleic acid nanostructure of claim 71, wherein the overhang portion of the plurality of overhang portions comprises unbound terminal residues.

73. The nucleic acid nanostructure of claim 71 or 72, wherein an overhang portion of the plurality of overhang portions does not comprise self-complementarity.

74. The nucleic acid nanostructure of any one of claims 71-73, wherein an overhang portion of the plurality of overhang portions comprises a polynucleotide repeat selected from the group consisting of a poly-T repeat, a poly-a repeat, a poly-G repeat, and a poly-C repeat.

75. The nucleic acid nanostructure of any one of claims 71-74, wherein an overhang portion of the plurality of overhang portions comprises at least 1000 nucleotides.

76. The nucleic acid nanostructure of claim 71, wherein the permeable region comprises at least 10 overhang portions.

77. A nucleic acid nanostructure, comprising:

a. a dense structure, wherein the dense structure comprises a scaffold strand and a first plurality of staple oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single stranded nucleic acid regions of the scaffold, and wherein the relative positions of adjacent tertiary structures in the adjacent tertiary structures are position constrained; and

b. A permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to a scaffold chain of the dense structure, wherein the permeable structure comprises at least 50% single stranded nucleic acids, and wherein the permeable structure has an anisotropic three-dimensional distribution around at least a portion of the dense structure.

78. The nucleic acid nanostructure of claim 77, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average separation distance between the first axis of symmetry and the second axis of symmetry of less than 10 nanometers.

79. The nucleic acid nanostructure of claim 77, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises a 0 ° average angular offset between the first axis of symmetry and the second axis of symmetry.

80. The nucleic acid nanostructure of claim 77, wherein the plurality of tertiary structures comprises a first tertiary structure comprising a first axis of symmetry and a second tertiary structure comprising a second axis of symmetry, wherein the first tertiary structure is adjacent to the second tertiary structure, and wherein the constrained position of the first tertiary structure relative to the second tertiary structure comprises an average angular offset between the first axis of symmetry and the second axis of symmetry of no more than 90 °.

81. The nucleic acid nanostructure of any one of claims 77-80, wherein the dense structure comprises a nucleic acid fold.

82. The nucleic acid nanostructure of claim 81, wherein the nucleic acid paper break comprises a first side and a second side, wherein the first side is offset from the second side by an average angle of 180 °.

83. The nucleic acid nanostructure of claim 82, wherein the first face comprises a display moiety, wherein the display moiety is configured to couple to a target analyte.

84. The nucleic acid nanostructure of claim 83, wherein the display moiety is coupled to the target analyte.

85. The nucleic acid nanostructure of any one of claims 82-84, wherein the second face is coupled to the permeable structure.

86. The nucleic acid nanostructure of any one of claims 77-85, wherein the permeable structure comprises a plurality of overhang portions.

87. The nucleic acid nanostructure of claim 86, wherein the plurality of overhang portions comprises a capture portion, wherein the capture portion is configured to couple the nucleic acid nanostructure to a solid support.

88. The nucleic acid nanostructure of any one of claims 77-87, wherein the anisotropic volume distribution comprises a portion of hemispherical volume surrounding a dense structure.

89. The nucleic acid nanostructure of any one of claims 77-88, wherein the anisotropic volume distribution comprises a portion of a spherical volume surrounding a dense structure that excludes a volume comprising a target analyte coupled to the dense structure.

90. The nucleic acid nanostructure of any one of claims 77-89, wherein the volume occupied by the dense structure is greater than the volume occupied by the permeable structure.

91. The nucleic acid nanostructure of any one of claims 77-89, wherein the volume occupied by the permeable structure is greater than the volume occupied by the dense structure.

92. A nucleic acid nanostructure, comprising:

a. A compact structure, wherein the compact structure comprises a scaffold strand and a first plurality of staple oligonucleotides, wherein at least 80% of the nucleotides of the scaffold strand hybridize to the nucleotides of the first plurality of staple oligonucleotides, wherein the first plurality of staple oligonucleotides hybridize to the scaffold strand to form a plurality of tertiary structures, wherein the plurality of tertiary structures comprises adjacent tertiary structures connected by single-stranded regions of the scaffold strand, wherein the relative positions of the adjacent tertiary structures are subject to positional constraints, and wherein the compact structure comprises an effective surface area; and

b. a permeable structure, wherein the permeable structure comprises a second plurality of staple oligonucleotides, wherein the staple oligonucleotides are coupled to the scaffold strands of the dense structure, and wherein the permeable structure comprises at least 50% single stranded nucleic acids; and wherein (i) the effective surface area of the nucleic acid nanostructure is greater than the effective surface area of the dense structure, or ii) the ratio of the effective surface area to the volume of the nucleic acid nanostructure is greater than the ratio of the effective surface area to the volume of the dense structure.

93. The nucleic acid nanostructure of claim 92, wherein the permeable structure comprises an effective surface area.

94. The nucleic acid nanostructure of claim 93, wherein the effective surface area of the permeable structure is the same as the effective surface area of the nucleic acid nanostructure.

95. The nucleic acid nanostructure of claim 93, wherein the effective surface area of the permeable structure is less than the effective surface area of the nucleic acid nanostructure.

96. The nucleic acid nanostructure of any one of claims 93-95, wherein the effective surface area of the permeable structure is less than the effective surface area of the dense structure.

97. The nucleic acid nanostructure of any one of claims 93-96, wherein the effective surface area of the permeable structure is greater than the effective surface area of the dense structure.

98. The nucleic acid nanostructure of any one of claims 92-97, further comprising a solid support.

99. The nucleic acid nanostructure of claim 98, wherein the permeable structure is coupled to the solid support.

100. The nucleic acid nanostructure of claim 99, wherein the nucleic acid nanostructure comprises a footprint, wherein the footprint of the nucleic acid nanostructure is greater than the effective surface area of the nucleic acid nanostructure.

101. The nucleic acid nanostructure of claim 100, wherein the footprint of the dense structure is the same as the effective surface area of the dense structure.

102. The nucleic acid nanostructure of claim 99, wherein the nucleic acid nanostructure comprises a footprint, wherein the footprint of the nucleic acid nanostructure is the same as the effective surface area of the nucleic acid nanostructure.

103. A nucleic acid nanostructure, the nucleic acid nanostructure comprising a plurality of nucleic acid strands, wherein each nucleic acid strand of the plurality of nucleic acid strands hybridizes to another nucleic acid strand of the plurality of nucleic acid strands to form a plurality of tertiary structures, and wherein a nucleic acid strand of the plurality of nucleic acid strands comprises a first nucleotide sequence that hybridizes to a second nucleic acid strand of the plurality of nucleic acid strands, wherein a nucleic acid strand of the plurality of nucleic acid strands further comprises a second nucleotide sequence of at least 100 consecutive nucleotides, and wherein at least 50 nucleotides of the second nucleotide sequence are single stranded.

104. The nucleic acid nanostructure of claim 103, wherein the first nucleotide sequence comprises at least 5 nucleotides.

105. The nucleic acid nanostructure of claim 103 or 104, wherein the second nucleotide sequence comprises at least 500 nucleotides.

106. The nucleic acid nanostructure of claim 105, wherein the second nucleotide sequence comprises at least 1000 nucleotides.

107. The nucleic acid nanostructure of claim 105 or 106, wherein the second nucleotide sequence comprises a polynucleotide repeat sequence selected from the group consisting of a poly-T repeat sequence, a poly-a repeat sequence, a poly-G repeat sequence, and a poly-C repeat sequence.

108. The nucleic acid nanostructure of claim 107, wherein the polynucleotide repeat sequence comprises at least 50 nucleotides.

109. The nucleic acid nanostructure of claim 108, wherein the polynucleotide repeat sequence comprises at least 500 nucleotides.

110. The nucleic acid nanostructure of claim 108 or 109, wherein one or more residues of the polynucleotide repeat are substituted with nucleotides other than the nucleotides of the polynucleotide repeat.

111. The nucleic acid nanostructure of any one of claims 108-110, wherein the second nucleotide sequence further comprises a second polynucleotide repeat sequence.

112. The nucleic acid nanostructure of claim 111, wherein the polynucleotide repeat and the second polynucleotide repeat are separated by an intervening nucleotide sequence.

113. The nucleic acid nanostructure of any one of claims 103-112, further comprising a solid support, wherein the solid support comprises a plurality of surface-linking moieties, wherein each surface-linking moiety of the plurality of surface-linking moieties comprises a complementary polynucleotide repeat sequence, wherein the complementary polynucleotide repeat sequence is configured to couple with the polynucleotide repeat sequence.

114. The nucleic acid nanostructure of claim 113, wherein the solid support further comprises a complementary intermediate nucleotide sequence, wherein the intermediate nucleotide sequence is configured to be coupled to the intermediate nucleotide sequence.

115. A composition comprising:

a. a solid support comprising a plurality of sites; and

b. a plurality of Structured Nucleic Acid Particles (SNAP), wherein each SNAP is coupled to or configured to be coupled to an analyte, and wherein each SNAP of the plurality of SNAP is coupled to a site of the plurality of sites;

wherein the plurality of sites comprises a first subset comprising a first number of sites and a second subset comprising a second number of sites, wherein each site in the first subset comprises two or more coupled SNAP, wherein each site in the second subset comprises one and only one coupled SNAP, and wherein the ratio of the number of sites of the first subset to the number of sites of the second subset is less than the ratio predicted by poisson distribution.

116. The composition of claim 115, wherein the ratio of the number of sites of the first subset to the number of sites of the second subset is no more than 0.7.

117. The composition of claim 116, wherein the ratio of the number of sites of the first subset to the number of sites of the second subset is no more than 0.1.

118. The composition of any one of claims 115-117, wherein the plurality of sites further comprises a third subset, wherein each site of the third subset comprises sites of SNAP that are not coupled.

119. The composition of claim 118, wherein a ratio of the number of sites of the third subset to the number of sites of the second subset is less than a ratio predicted by poisson distribution.

120. The composition of claim 119, wherein the ratio of the number of sites of the third subset to the number of sites of the second subset is less than 1.

121. The composition of claim 120, wherein the ratio of the number of sites of the third subset to the number of sites of the second subset is less than 0.5.

122. The composition of any of claims 115-121, wherein a first SNAP of the plurality of SNAP is configured to block binding of a second SNAP of the plurality of SNAP to the site of the plurality of sites.

123. The composition of claim 122, wherein the site comprises a SNAP complex, wherein the SNAP complex comprises the first SNAP and one or more additional nucleic acid nanostructures coupled to the first SNAP.

124. The composition of claim 123, wherein the SNAP complex comprises a footprint, wherein the footprint is greater than at least half of the surface area of the site.

125. The composition of claim 124, wherein the SNAP comprises a footprint, wherein the footprint is greater than at least half of the surface area of the site.

126. The composition of claim 124 or 125, wherein the SNAP comprises a permeable structure, wherein the permeable structure is configured to block binding of a second SNAP of the plurality of sites to a site of the plurality of sites.

127. The composition of claim 126, wherein the permeable structure comprises an oligonucleotide.

128. The composition of claim 127, wherein the oligonucleotide comprises a polynucleotide repeat selected from the group consisting of a poly-T repeat, a poly-a repeat, a poly-G repeat, and a poly-C repeat.

129. The composition of claim 126, wherein the permeable structure comprises a polymer chain selected from the group consisting of a linear polymer chain, a branched polymer chain, and a dendritic polymer chain.

130. An analyte array, comprising:

a. a solid support comprising a plurality of sites;

b. a plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure is coupled to an analyte of interest, and wherein each nucleic acid nanostructure of the plurality of nucleic acid nanostructures is coupled to a site of the plurality of sites, wherein at least 40% of the sites of the plurality of sites comprise one and only one analyte of interest.

131. The analyte array of claim 130, wherein at least 80% of the plurality of sites comprise target analytes.

132. The analyte array of claim 131, wherein at least 90% of the plurality of sites comprise target analytes.

133. The analyte array of any of claims 130-132, wherein at least 80% of the plurality of sites comprise no more than one analyte of interest.

134. The analyte array of claim 133, wherein at least 90% of the plurality of sites comprise no more than one analyte of interest.

135. A composition comprising:

a. a solid support comprising sites configured to couple nucleic acid nanostructures;

b. The nucleic acid nanostructure, wherein the nucleic acid nanostructure is coupled to the site, wherein the nucleic acid nanostructure is coupled to an analyte of interest; and wherein the nucleic acid nanostructure is configured to prevent contact between the target analyte and the solid support.

136. The composition of claim 135, wherein the nucleic acid nanostructure comprises a permeable structure, wherein the permeable structure is configured to prevent contact between the target analyte and the solid support.

137. The composition of claim 136, wherein the permeable structure comprises a portion configured to prevent contact between the target analyte and the solid support.

138. The composition of claim 137, wherein the moiety is configured to prevent contact between the target analyte and the solid support by steric blocking of the solid support.

139. The composition of claim 138, wherein the moiety comprises a chemical property configured to prevent contact between the target analyte and the solid support.

140. The composition of claim 139, wherein the moiety is an electrically repulsive moiety, magnetically repulsive moiety, hydrophobic moiety, hydrophilic moiety, amphiphilic moiety, or a combination thereof.

141. The composition of any one of claims 135-140, wherein the nucleic acid nanostructure is coupled to a site of the solid support.

142. The composition of claim 141, wherein the target analyte is not coupled to a site of the solid support.

143. The composition of any one of claims 135-142, wherein the nucleic acid nanostructure is not coupled to a site of the solid support.

144. The composition of claim 143, wherein the site comprises a moiety configured to prevent the target analyte from coupling to the site.

145. The composition of claim 144, wherein said moiety comprises an oligonucleotide.

146. The composition of claim 144, wherein the moiety comprises a polymer chain selected from the group consisting of a linear polymer chain, a branched polymer chain, and a dendritic polymer chain.

147. The composition of claim 144, wherein the moiety comprises a chemical property configured to prevent contact between the target analyte and the solid.

148. The composition of claim 147, wherein the moiety is an electrically repulsive moiety, magnetically repulsive moiety, hydrophobic moiety, hydrophilic moiety, amphiphilic moiety, or a combination thereof.

149. The composition of claim 147 or 148, wherein the site further comprises a second moiety, wherein the moiety and the second moiety comprise different chemical structures.

150. The composition of claim 147 or 148, wherein the site further comprises a second moiety, wherein the moiety and the second moiety comprise different chemical characteristics.

151. A composition comprising:

a. a solid support comprising sites configured to couple nucleic acid nanostructures, wherein the sites comprise a surface area; and

b. the nucleic acid nanostructure, wherein the nucleic acid nanostructure is coupled to the site, wherein the nucleic acid nanostructure is coupled to or configured to be coupled to an analyte of interest; wherein the nucleic acid nanostructure comprises a total effective surface area in an unbound configuration, wherein the nucleic acid nanostructure comprises a dense structure having an effective surface area, wherein the effective surface area of the dense structure in the unbound configuration is less than 50% of the surface area of the site, and wherein the unbound configuration comprises nucleic acid nanostructures uncoupled from the site.

152. The composition of claim 151, wherein the effective surface area of the dense structure is less than 25% of the surface area of the site.

153. The composition of claim 151 or 152, wherein the nucleic acid nanostructure comprises a permeable region, wherein the permeable region is configured to couple with a site of the solid support.

154. The composition of claim 153, wherein the permeable region comprises an effective surface area that is greater than an effective surface area of the densified region.

155. The composition of claim 153, wherein the permeable region comprises an effective surface area that is less than an effective surface area of the densified region.

156. The composition of any one of claims 151-155, wherein the nucleic acid nanostructure is coupled to a site of the solid support.

157. The composition of claim 156, wherein the nucleic acid nanostructure comprises a total footprint that is greater than the total effective surface area.

158. The composition of claim 157, wherein the total footprint is at least 50% of the surface area of the site.

159. The composition of claim 158, wherein the total footprint is at least 90% of the surface area of the locus.

160. The composition of claim 159, wherein said total footprint is greater than 100% of the surface area of said locus.

161. The composition of any of claims 151-160, wherein the locus comprises a first shape and the dense structure comprises a second shape.

162. The composition of claim 161, wherein said second shape is substantially the same shape as said first shape.

163. The composition of claim 161, wherein said second shape is different from said first shape.

164. A method of coupling a nucleic acid nanostructure to an array site, comprising:

a. contacting an array comprising sites with a nucleic acid nanostructure, wherein the sites comprise a plurality of surface-linking moieties, and wherein the nucleic acid nanostructure comprises a plurality of capture moieties;

b. coupling the nucleic acid nanostructure to the site in an initial configuration, wherein the initial configuration does not comprise a stable configuration, and wherein the nucleic acid nanostructure is coupled by coupling a capture moiety of the plurality of capture moieties to a surface-connecting moiety of the plurality of surface-connecting moieties;

c. uncoupling the capture moiety of the plurality of capture moieties from the surface-attachment moiety of the plurality of surface-attachment moieties; and

d. changing the nucleic acid nanostructure from the initial configuration to the stable configuration, wherein each capture moiety of the plurality of capture moieties is coupled to a surface-connecting moiety of the plurality of surface-connecting moieties.

165. The method of claim 164, wherein coupling the capture moiety of the plurality of capture moieties to the surface-attachment moiety of the plurality of surface-attachment moieties further comprises heating the solid support and the nucleic acid nanostructure.

166. The method of claim 164 or 165, wherein contacting an array comprising the sites with the nucleic acid nanostructures comprises contacting the array with a fluid medium comprising the nucleic acid nanostructures.

167. The method of claim 166, wherein transitioning the nucleic acid nanostructure from the initial configuration to the stable configuration further comprises changing the fluidic medium.

168. The method of claim 167, wherein altering the fluid medium comprises altering a concentration of ionic species of the fluid medium.

169. The method of claim 167 or 168, wherein changing the fluid medium comprises changing a pH of the fluid medium.

170. The method of any one of claims 164-169, wherein the capture moiety comprises a polynucleotide repeat sequence.

171. The method of claim 170, wherein one or more residues of the polynucleotide repeat sequence are substituted with nucleotides other than the nucleotides of the polynucleotide repeat sequence.

172. The method of claim 170 or 171, wherein the capture moiety comprises a first polynucleotide repeat and a second polynucleotide repeat, wherein the first polynucleotide repeat and the second polynucleotide repeat are coupled by an intervening nucleotide sequence.

173. The method of claim 172, wherein the plurality of surface-linking moieties comprises a first surface-linking moiety complementary to the polynucleotide repeat sequence and a second surface-linking moiety complementary to the intermediate nucleotide sequence.

174. The method of any one of claims 164-173, wherein the surface-coupled moiety comprises self-complementarity.

175. The method of any one of claims 164-174, wherein the initial configuration comprises a non-maximized amount of coupling of the capture moiety to the surface-attachment moiety.

176. The method of claim 175, wherein the stable configuration comprises a maximized amount of coupling of the capture moiety to the surface-attachment moiety.

177. The method of any one of claims 164-176, wherein the initial configuration comprises a non-maximized footprint of the nucleic acid nanostructure on the site.

178. The method of claim 177, wherein the stable configuration comprises a maximized footprint of the nucleic acid nanostructure on the site.

179. The method of any one of claims 164-178, wherein the initial configuration comprises an asymmetric arrangement of the nucleic acid nanostructures at the site.

180. The method of claim 179, wherein the stable configuration comprises a symmetrical arrangement of the nucleic acid nanostructures at the site.

181. A method of forming a multiplexed analyte array, comprising:

a. contacting an array comprising a plurality of sites with a first plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures is coupled to a target analyte of a first plurality of target analytes;

b. contacting an array comprising the plurality of sites with a second plurality of nucleic acid nanostructures, wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures is coupled to a target analyte of a second plurality of target analytes;

c. depositing the first plurality of nucleic acid nanostructures at a first subset of the plurality of sites; and

d. depositing the second plurality of nucleic acid nanostructures at a second subset of the plurality of sites;

Wherein the first subset of sites and the second subset of sites comprise a random spatial distribution.

182. The method of claim 181, wherein each nucleic acid nanostructure of the first plurality of nucleic acid nanostructures comprises a first functional nucleic acid, wherein the first functional nucleic acid comprises a first nucleotide sequence, wherein each nucleic acid nanostructure of the second plurality of nucleic acid nanostructures comprises a second functional nucleic acid, wherein the second functional nucleic acid comprises a second nucleotide sequence, and wherein the first nucleotide sequence is different from the second nucleotide sequence.

183. The method of claim 181, further comprising contacting the array with a first plurality of detectable nucleic acids, wherein each first detectable nucleic acid of the first plurality of detectable nucleic acids comprises a first complementary nucleotide sequence and a detectable label, wherein the first complementary nucleotide sequence is complementary to the first nucleotide sequence.

184. The method of claim 183, further comprising coupling a first detectable nucleic acid to each first functional nucleic acid.

185. The method of claim 184, further comprising detecting each address of an array comprising the first detectable nucleic acid.

186. The method of claim 185, further comprising heating the nucleic acid nanostructure to at least the melting temperature of the first functional nucleic acid, thereby uncoupled the first detectable nucleic acid from the first functional nucleic acid.

187. The method of any one of claims 181-186, further comprising contacting the array with a second plurality of detectable nucleic acids, wherein each second detectable nucleic acid of the second plurality of detectable nucleic acids comprises a second complementary nucleotide sequence and a detectable label, wherein the second complementary nucleotide sequence is complementary to the second nucleotide sequence.

188. The method of claim 187, further comprising coupling a second detectable nucleic acid to each second functional nucleic acid.

189. The method of claim 188, further comprising detecting each address of an array comprising a second detectable nucleic acid.

190. The method of claim 189, further comprising heating the nucleic acid nanostructure to at least a melting temperature of the second functional nucleic acid, thereby uncoupled the second detectable nucleic acid from the first functional nucleic acid.

191. The method of claim 186 or 190, where the nucleic acid nanostructure remains coupled to a site after heating to at least the melting temperature.