CN117402882A - Nucleotide molecules for beta-thalassemia gene therapy and uses thereof - Google Patents

Nucleotide molecules for beta-thalassemia gene therapy and uses thereof Download PDF

Info

Publication number
CN117402882A
CN117402882A CN202210818707.8A CN202210818707A CN117402882A CN 117402882 A CN117402882 A CN 117402882A CN 202210818707 A CN202210818707 A CN 202210818707A CN 117402882 A CN117402882 A CN 117402882A
Authority
CN
China
Prior art keywords
beta
ssodn
sequence
gene therapy
hbb
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210818707.8A
Other languages
Chinese (zh)
Inventor
梁峻彬
徐辉
罗颖
程琳
林思妙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Ruifeng Biotechnology Co ltd
Original Assignee
Guangzhou Ruifeng Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Ruifeng Biotechnology Co ltd filed Critical Guangzhou Ruifeng Biotechnology Co ltd
Priority to CN202210818707.8A priority Critical patent/CN117402882A/en
Publication of CN117402882A publication Critical patent/CN117402882A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795—Porphyrin- or corrin-ring-containing peptides
    • C07K14/805—Haemoglobins; Myoglobins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to a nucleotide molecule for beta-thalassemia gene therapy and application thereof, belonging to the technical field of gene editing. The nucleotide molecule corresponds to Chr11: the negative strand base at position 5226763 is C, the positive strand base is G, and/or at a position corresponding to Chr11: the negative strand base at position 5226764 is a G positive strand base is C and/or corresponds to Chr11: the negative strand base at position 5226766 is a T or G positive strand base is a or C, and/or corresponds to Chr11: the negative strand base at 5226769 site is A and the positive strand base is T. The ssODN containing the nucleotide molecule for beta-earth-lean gene therapy designed by the invention has more obvious mutation repair efficiency than the wild-type ssODN, and the newly-nucleotide-encoded HBB gene obtained by repair has higher transcription and translation levels, so that the number and the expression level of the expression cells of HBB globin and HbA hemoglobin are better improved, the clinical treatment level is hopeful to be achieved, and the ssODN is used in clinical practice, so that the condition of a patient is effectively relieved, and the condition of blood transfusion is continuously relieved.

Description

Nucleotide molecules for beta-thalassemia gene therapy and uses thereof
Technical Field
The invention relates to the technical field of gene editing, in particular to a nucleotide molecule for beta-thalassemia gene therapy and application thereof.
Background
Thalassemia is a monogenic disease, largely divided into alpha, beta, gamma, delta thalassemia, with alpha-thalassemia and beta-thalassemia being the most common. In either type, thalassemia is the most common type of mutation, both in gene deletion and point mutation.
Hemoglobin in a beta-thalassemia patient cannot normally perform the function of carrying oxygen due to mutation on the HBB gene, and the HBB gene of the patient can be edited and repaired in a gene editing mode. However, the editing efficiency in the prior art is low, the transcription and translation level is low, the obtained hemoglobin level can not reach the treatment level, and the expected treatment effect is low.
The HBB gene beta 41-42 is mutated into a codon beta 41/42 (-TCTT /) frame shift mutation to cause abnormal amino acid coding, the mutation of the codon 41/42 (-TCTT) leads to deletion of the TCTT at the 42 th codon of the HBB gene so as to cause disorder of amino acid coding, and a stop codon is formed at a position which is not far behind the deletion site so as to lead to premature termination of protein translation, thus leading to loss of gene functions.
For the beta 41/42 (-TCTT) frameshift mutation, the HBB gene beta 41-42 mutation is repaired by Cas9-ssODN homologous repair in the conventional technology, but the repair efficiency is lower, and the transcription level and the hemoglobin expression level of the HBB gene do not reach clinical treatment standards.
Therefore, the target gene editing efficiency of the homologous repair of the Cas9-ssODN is improved, the transcription and translation efficiency of the repair gene is improved, and the method is very important for the gene therapy of beta 41-42 mutant anemia.
Disclosure of Invention
Based on this, it is necessary to provide a nucleotide molecule for beta-lean gene therapy, which has more remarkable mutation repair efficiency and higher transcription and translation levels of HBB gene encoded by the new nucleotide obtained by repair, thereby improving the number of expression cells and expression levels of HBB globin and HbA hemoglobin, in view of the above-mentioned problems.
A nucleotide molecule for use in beta-earth-lean gene therapy, said nucleotide molecule corresponding to Chr11: the negative strand base at position 5226763 is C, and/or corresponds to Chr11: the plus strand base at position 5226763 is G, and/or corresponds to Chr11: the negative strand base at position 5226764 is G, and/or corresponds to Chr11: the plus strand base at position 5226764 is C, and/or corresponds to Chr11: the negative strand base at position 5226766 is T or G, and/or corresponds to Chr11: the plus strand base at position 5226766 is a or C, and/or corresponds to Chr11: the negative strand base at position 5226769 is a, and/or corresponds to Chr11: the base of the positive strand at the 5226769 site is T.
The chromosomal location of the invention corresponds to NCBI database version GRch 38.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226766 is T, or at a position corresponding to Chr11: the base of the positive strand at the 5226766 site is A.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226766 is T, or at a position corresponding to Chr11: the plus strand base at position 5226766 is a, and/or corresponds to Chr11: the negative strand base at position 5226769 is a, and/or corresponds to Chr11: the base of the positive strand at the 5226769 site is T.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226763 is C, corresponding to Chr11: the base of the positive strand at the 5226763 site is G.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226763 is C, corresponding to Chr11: the plus strand base at position 5226763 is G, and/or corresponds to Chr11: the negative strand base at position 5226766 is T, and/or corresponds to Chr11: the base of the positive strand at the 5226766 site is A.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226766 is G, or at a position corresponding to Chr11: the base of the positive strand at the 5226766 site is C.
In some of these embodiments, the nucleotide molecule corresponds to Chr11: the negative strand base at position 5226764 is G, corresponding to Chr11: the base of the positive strand at the 5226764 site is C.
In some of these embodiments, the nucleotide molecule comprises or is selected from the following sequences:
2-as：5’-AAAAAACCT-3’
2-s：5’-AGGTTTTTT-3’
3-as：5’-AAAAAATCT-3’
3-s：5’-AGATTTTTT-3’
4-as：5’-GAAGAACCT-3’
4-s：5’-AGGTTCTTC-3
5-as：5’-GAAAAACCT-3’
5-s：5’-AGGTTTTTC-3’
6-as：5’-AAACAACCT-3’
6-s：5’-AGGTTGTTT-3’
7-as：5’-ACAGAACCT-3’
7-s：5’-AGGTTCTGT-3’。
in some of these embodiments, the nucleotide molecule comprises or is selected from the sequences set forth in SEQ ID NOS.20-25.
For mutation repair using gene editing techniques, usually an unmutated wild-type sequence is used as a template for editing repair, but the inventors found that when the wild-type sequence is optimized, the codons AGG, TTC and TTT encoding amino acids 40-42 of beta-globin are base optimized during experiments. The comparison experiment shows that the base-optimized mutation has higher editing efficiency than wild sequence (such as ssODN) and higher transcription and translation efficiency, and the obtained hemoglobin has normal function.
Furthermore, the inventors have found that when two non-synonymous mutations of the β41-42 codons are introduced, i.e. the codon TTG replaces the TTC of β41 (Phe > Leu, a naturally occurring mutation, not reported to be pathogenic), in correspondence with Chr11: the negative strand base at 5226766 site is G; or using the codon TGT to replace TTT of β42 (Phe > Cys, naturally occurring mutation, not reported to be pathogenic), in correspondence with Chr11: after the negative strand base at 5226764 site is G; by comparison, it was found that such ssODN was more efficient to edit, and that the transcriptional and translational levels were high, reaching therapeutic levels, and that the obtained hemoglobin was functioning normally. Thereby improving the number and the expression level of the expression cells of the HBB globin and the HbA hemoglobin.
It is understood that since the present invention improves the transcription and translation levels of the HBB gene after codon optimization, it is considered that high-expression HBB protein can be obtained by base conversion of the present invention even in the absence of the β41-42 mutation.
A nucleotide molecule encoding a beta globin, wherein the codon for beta 40 in the nucleotide molecule is selected from the group consisting of: the codons of AGA, β41 are selected from: the codons of TTT or TTG, and/or β42 are selected from: TTC or TGT. The above codons are selected and have higher transcription and translation levels.
In some of these embodiments, the codon for β41 in the nucleotide molecule is selected from: TTT.
In some of these embodiments, the codon for β41 in the nucleotide molecule is selected from: the codons of TTT, and/or β40 are selected from: AGA.
In some of these embodiments, the codon for β42 in the nucleotide molecule is selected from: TTC.
In some of these embodiments, the codon for β41 in the nucleotide molecule is selected from: the codons for TTT, and/or β42 are selected from: TTC.
In some of these embodiments, the codon for β41 in the nucleotide molecule is selected from: TTG.
In some of these embodiments, the codon for β42 in the nucleotide molecule is selected from: TGT.
In some of these embodiments, the nucleotide molecule comprises or is selected from the following sequences:
2-as：5’-AAAAAACCT-3’
2-s：5’-AGGTTTTTT-3’
3-as：5’-AAAAAATCT-3’
3-s：5’-AGATTTTTT-3’
4-as：5’-GAAGAACCT-3’
4-s：5’-AGGTTCTTC-3
5-as：5’-GAAAAACCT-3’
5-s：5’-AGGTTTTTC-3’
6-as：5’-AAACAACCT-3’
6-s：5’-AGGTTGTTT-3’
7-as：5’-ACAGAACCT-3’
7-s：5’-AGGTTCTGT-3’。
in some of these embodiments, the nucleotide molecule comprises or is selected from the sequences set forth in SEQ ID NOS.20-25.
The invention also discloses a method for improving the expression of beta globin, which comprises the following steps: the sense strand or antisense strand of the nucleotide molecule for beta-prime gene therapy is introduced into a target cell by a gene editing technique, so that the genomic sequence of the target cell is edited and converted into the sequence.
The invention also discloses a method for repairing the beta 41-42 mutation of the HBB gene, which comprises the following steps: the sense strand or antisense strand of the nucleotide molecule for beta-prime gene therapy is introduced into a target cell by a gene editing technique, so that the genomic sequence of the target cell is edited and converted into the sequence.
Specifically, the sequence after codon optimization can be used as a replacement sequence, corresponding template nucleic acid such as ssODN, double-stranded nucleotide and the like is designed, and then transferred into target cells through a delivery system, and the genome of the target cells is edited and replaced to obtain the HBB gene sequence with high transcription and translation level. For the delivery system, conventional delivery systems in the art, such as liposome delivery, lipid nanoparticle delivery, exosome EV, viral particles or electroporation, etc., may be employed.
The invention also discloses a donor template for beta-thalassemia gene therapy, which comprises a 5 'homologous arm, a replacement sequence and a 3' homologous arm, wherein the replacement sequence comprises a sense strand or an antisense strand of the HBB gene editing sequence, and the donor template is selected from the following materials: double-stranded DNA, or single-stranded DNA.
It will be appreciated that in the structure of the donor template described above, the homology arms are sequences homologous to the DNA regions flanking the 41-42 mutation site of the HBB genome, and can be designed according to the circumstances.
In some of these embodiments, the template is a Single-stranded donor template (ssODN).
In some of these embodiments, the sequence length of the 5 'homology arm or 3' homology arm is any selected from the group consisting of: 30-100nt. For example, 30-100nt, 30-80nt, 30nt-60nt, 30nt-50nt, 30nt-45nt, 30nt-40nt. The optional 5 'homology arm or 3' homology arm may have different sequence lengths, such as in some embodiments, the 5 'homology arm and 3' homology arm are selected to be 41nt and 39nt in length, respectively.
In some of these embodiments, the donor template has Phosphorothioate (phosphothioate) modifications at the 5 'homology arm and/or 3' homology arm ends. Such modifications may enhance the stability of the ssODN and increase its activity in gene editing.
In some of these embodiments, the 2 nucleotides at the 5 'homology arm and/or 3' homology arm ends of the donor template have phosphorothioate modifications. It will be appreciated that phosphorothioate modifications may be made to 1, 3, 4, 5, etc. nucleotides at the 5 'homology arm or 3' homology arm end of the donor template, depending on the circumstances.
In some of these embodiments, when the donor template sequence corresponds to the HBB gene sense strand, then the 5' homology arm is a sequence comprising 5'-AGGCTGCTGGTGGTCTACCCTTGGACCCAG-3' (SEQ ID No. 1); the 3' homology arm is a sequence comprising 5'-GAGTCCTTTGGGGATCTGTCCACTCCTGAT-3' (SEQ ID No. 2);
when the ssODN sequence corresponds to the HBB gene antisense strand, then the 5' homology arm is a sequence comprising 5'-CATAACAGCATCAGGAGTGGACAGATCCCCAAAGGACTC-3' (SEQ ID No. 3); the 3' homology arm is a sequence comprising 5'-CTGGGTCCAAGGGTAGACCACCAGCAGCCTAAGGGT-3' (SEQ ID NO. 4).
In some of these embodiments, the donor template is selected from the sequences shown in SEQ ID NO.6-SEQ ID NO. 19.
In some of these embodiments, the donor template is ssODN, which corresponds to the HBB cDNA repairing the sequence set forth in SEQ ID No.20-SEQ ID No. 25. The HBB cDNA sequence can be loaded in virus carrier, delivered into hematopoietic stem cell or expressed in vivo, and can achieve the therapeutic purpose of gene repair.
The invention also discloses a composition for beta-thalassemia gene therapy, which comprises the donor template and a gene editing system for targeting HBB genes.
It is understood that the above described gene editing system may be a CRISPR-Cas editing system, a TALEN editing system, a ZFN editing system, or the like.
In some of these embodiments, the gene editing system comprises a gRNA and a Cas enzyme. It will be appreciated that the gRNA and Cas enzyme may be selected using conventional techniques based on CRISPR gene editing systems, e.g., cas enzyme may be Cas9, cas12, or other non-CRISPR nucleases, etc., and the gRNA may be adjusted with the requirements of the Cas enzyme or other nucleases. The guide sequence of the gRNA can also be adjusted in the target editing sequence interval, and a single gRNA or a combination of the gRNA and the editing system can be applicable.
In some of these embodiments, the Cas enzyme is selected from the group consisting of: spCas9, fnCas9, scCas9, spRY.
In some of these embodiments, the Cas9 enzyme is selected from the group consisting of: spCas9. Experiments prove that the spCas9 is used for gene editing, so that the spCas9 has good editing efficiency.
In some embodiments, the gRNA may be a dual gRNA (dgRNA) or a single molecule gRNA (single gRNA).
In some of these embodiments, the sgRNA comprises a guide sequence comprising the sequence set forth in any one of SEQ ID No.28-SEQ ID No.29 and a backbone sequence.
In some of these embodiments, the donor template is selected from the sequences set forth in SEQ ID NO.8-9 and the guide sequence is selected from the sequences set forth in SEQ ID NO. 28. The donor template (i.e., ssODN) is matched with the guide sequence, so that the editing efficiency and the expression level are better.
In some of these embodiments, the guide sequence is 17-24nt.
The invention also discloses a vector for beta-earth-lean gene therapy, which comprises the nucleotide molecule, expresses the ssODN, or expresses the composition. The nucleotide molecules or compositions for beta-prime gene therapy can be prepared, transformed and the like in a genetic engineering mode.
The invention also discloses a cell comprising the nucleotide molecule, donor template, composition or plasmid for beta-thalassemia gene therapy.
In some of these embodiments, the cell is a cell line and/or a primary cell.
In some of these embodiments, the cells are hematopoietic stem/progenitor cells, induced pluripotent stem cells, erythroid progenitor cells, and the like, having the potential to induce differentiation or transdifferentiation or reprogramming to mature erythrocytes.
Compared with the prior art, the invention has the following beneficial effects:
the nucleotide molecule for beta-thalassemia gene therapy disclosed by the invention has the advantages that by optimizing the bases adjacent to the beta 41-42 mutation site of the HBB gene, the gene repair efficiency is improved, simultaneously, the transcription of the HBB gene and the translation of beta globin after the base optimization are promoted, the whole level of hemoglobin is improved, and the treatment efficiency is improved.
In addition, the ssODN containing the nucleotide molecule for beta-earth-lean gene therapy designed by the invention has more obvious mutation repair efficiency than the wild-type ssODN, and the HBB gene coded by the repaired new nucleotide has higher transcription and translation level, so that the number and the expression level of the HbA hemoglobin expression cells are better improved, the clinical treatment level is hopeful to be achieved, and the ssODN is used in clinical practice to effectively relieve the illness state of a patient and continuously get rid of the condition of blood transfusion.
Drawings
FIG. 1 is a schematic diagram of the design of a ssODN in example 1;
FIG. 2 is a schematic representation of the targeting region of the gRNA guide sequence of example 2;
FIG. 3 is a homozygous HUDEP2 of example 3 β41/42 Cell sequencing result diagram;
FIG. 4 is a schematic representation of sequencing results and efficiency analysis results for combination 1 (ssodn#1 and gRNA#2) of example 4;
FIG. 5 is a schematic representation of sequencing results and efficiency analysis results for combination 2 (ssodn#2 and gRNA#2) of example 4;
FIG. 6 is a schematic diagram of sequencing results and efficiency analysis results of combination 1 (ssodn#1 and gRNA#1) in example 5;
FIG. 7 is a schematic representation of sequencing results and efficiency analysis results for combination 2 (ssodn#2 and gRNA#1) of example 5;
FIG. 8 is a graph showing the results of the repair efficiencies of the beta 41/42 mutation of the HBB gene for the Cas9/sgRNA #1 and ssodn# (1-7) -as repair, respectively, in example 6;
FIG. 9 is a diagram of NC set sequencing results in example 6;
FIG. 10 is a graph of sequencing results for combination 1 in example 6;
FIG. 11 is a graph of sequencing results for combination 2 in example 6;
FIG. 12 is a graph of sequencing results for combination 3 in example 6;
FIG. 13 is a graph of sequencing results for combination 4 in example 6;
FIG. 14 is a graph of sequencing results for combination 5 in example 6;
FIG. 15 is a graph of sequencing results for combination 6 in example 6;
FIG. 16 is a graph of sequencing results for combination 7 in example 6;
FIG. 17 is a schematic diagram of sequencing results and efficiency analysis of combination 1 (ssodn#1 and gRNA#1) in example 7;
FIG. 18 is a schematic diagram of sequencing results and efficiency analysis of combination 2 (ssodn#2 and gRNA#1) in example 7;
FIG. 19 is a schematic diagram of sequencing results and efficiency analysis of combination 1 (ssodn#1 and gRNA#1) in example 8;
FIG. 20 is a schematic representation of sequencing results and efficiency analysis of combination 2 (ssodn#2 and gRNA#1) in example 8;
FIG. 21 shows the results of detection of mutant repair HBB mRNA levels in example 8;
FIG. 22 shows the result of electrophoresis of the case of mutant repair HBB protein expression in example 8;
FIG. 23 shows the results of detection of the levels of mutant repair HBB mRNA in example 9.
Detailed Description
In order that the invention may be readily understood, a more complete description of the invention will be rendered by reference to the appended drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.
The reagents used in the following examples, unless otherwise specified, are all commercially available; the methods used in the examples below, unless otherwise specified, are all conventional.
Example 1
Design and construction of donor template ssODN for beta-earth-lean gene therapy.
The wild type HBB gene beta 40 amino acid is arginine, beta 41 and beta 42 amino acid are phenylalanine, and are respectively encoded by codons AGG, TTC and TTT, and the HBB gene beta 41-42 mutation is a deletion of TTCT/TCTT/CTTT base in TTC-TTT codons of beta 41-42, so that frame shift mutation is caused.
Based on the above, the present inventors have optimized the bases adjacent to the ssODN mutation site. ssODNs (single stranded donor oligonucleotides) structurally comprise a 5 'homology arm, a replacement sequence, a 3' homology arm. The homology arms are sequences homologous to the DNA regions on both sides of the 41-42 mutation site of the HBB genome, the length of the single homology arm sequence can be about 30nt-100nt, and the lengths of the 5 'homology arm and the 3' homology arm are respectively 41nt and 39nt in the embodiment. The substitution sequence is a sequence having 1 or more than 2 base substitutions with respect to the wild-type (WB) HBB gene without mutation, and is specifically shown in fig. 1. The ssODN sequences involved are shown in the following table.
TABLE 1 ssodn sequence listing
Note that: wherein bold bases indicate insertion relative to the HBB gene beta 41-42 mutant sequence and underlined bases indicate substitution relative to the HBB gene mutant sequence. S in the number represents the sense strand (sense) of the HBB gene, as represents the antisense strand (antisense) of the HBB gene. While the sense strand of the HBB gene is located on the (Negative) Negative strand of chromosome 11 and the antisense strand of the HBB gene is located on the (Positive) Positive strand of chromosome 11. Sense strand substitution sequence bases 1-9 correspond to Chr11, respectively: 5226771-5226763, the antisense strand substitution sequence bases 1-9 correspond to Chr11, respectively: 5226763-5226771 plus strand bases.
The above-mentioned ssODN sequence corresponds to the codon of wild-type HBB protein, which is ssODN1, relative to wild-type HBB.
TTC (synonymous substitution) using codon TTT instead of β41 in ssODN 2;
AGG (synonymous substitution) with codon AGA to replace β40 in ssODN 3;
TTT (synonymous substitution) using codon TTC to replace β42 in ssODN 4;
TTC with codon TTT instead of β41, TTT with codon TTC instead of β42 (synonymous substitution) in ssODN 5;
substitution of TTC of β41 with codon TTG in ssODN6 (Phe > Leu, naturally occurring mutation, not reported to be pathogenic);
The TTT of beta 42 (Phe > Cys, a naturally occurring mutation) was replaced with the codon TGT in ssODN7, and no pathogenicity was reported.
The ssODN's numbered 1-as, 2-as, 3-as, 4-as, 5-as, 6-as and 7-as used in the examples below are sequences having phosphorothioate modifications of the 2 nucleotides at the ends of the 5' and 3' homology arms, i.e., the sequences are denoted as s. The 2 nucleotides at the ends of the ssODN are modified with phosphorothioates (phosphothiolates) to enhance the stability of the ssODN and to increase its activity in gene editing.
The HBB cDNA (underlined indicates the replacement sequence) for the above ssODN repair is as follows:
HBB cDNA repaired by ssODN 2:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTTTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.20)
ssODN3 repaired HBB cDNA:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGATTTTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.21)
ssODN4 repaired HBB cDNA:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTCGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.22)
ssODN5 repaired HBB cDNA:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTTTTCGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.23)
ssODN6 repaired HBB cDNA:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTGTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.24)
ssODN7 repaired HBB cDNA:
5’-ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTGTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA-3’(SEQ ID NO.25)
after the design was completed, ssODN was submitted to the sequential synthesis company for synthesis, and commercially synthesized ssODN powder (Invitrogen) was centrifugedWith dd H 2 O is dissolved to prepare the storage concentration of 1 mug/ml, and the storage concentration is split charging and preserved at the temperature of minus 20 ℃.
Example 2
gRNA design and CRISPR/Cas-gRNA vector construction.
spCas9 and sgRNA targeting the beta 41-42 mutation site of the HBB gene were expressed using the spCas9-sgRNA vector (PX 459, pSpCas9 (BB) -2A-Puro, addgene, inc. # 62988).
The vector expresses spCas9 protein and can express sgRNA. The sgrnas comprise a guide sequence, a backbone sequence, complementary to the targeting sequence of the HBB gene. In this example, a 100nt long sgRNA was selected, the 5' end of which is a 20nt guide sequence, followed by 80nt of a universal sgRNA backbone sequence, which was: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO. 26), e.g., sgRNA #1 has a complete sequence of 5')TCCCCAAAGGACTCAACCTCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO. 27), the underlined part is the guide sequence, which is the RNA sequence, wherein T is the letter specification in the sequence Listing, and uracil U.
TABLE 2sgRNA and its targeting sequence, PAM site list
Numbering device Guide sequence (5 '. Fwdarw.3') PAM site Sequence numbering
sgRNA#1 TCCCCAAAGGACTCAACCTC TGG SEQ ID NO.28
sgRNA#2 GACCCAGAGGTTGAGTCCTT TGG SEQ ID NO.29
The distribution of the targeting sequences of sgrnas in the above table is shown in figure 2.
The specific construction method of the spCas9-sgRNA carrier targeting the HBB gene beta 41-42 mutation site is as follows:
(1) Synthesizing a guide strand sequence oligonucleotide (identical to the gRNA targeting sequence in the gRNA list) and a complementary strand oligonucleotide corresponding to the sgRNA in the table, respectively, adding cacc at the 5' -end of the guide strand sequence, and adding caccG at the 5' -end of the guide strand if the first nucleotide at the 5' -end of the guide strand is not guanine G; aaac is added to the 5' -end of the complementary strand, and if G is added to the 5' -end of the guide strand, C is added to the 3' -end of the complementary strand to complementarily pair with the guide strand.
(2) According to the annealing reaction system in the following table, 2. Mu.l of each of the sense strand (Oligo-F) and the antisense strand (Oligo-R) of the DNA sequence corresponding to the above gRNA target sequence was mixed, 2. Mu.l of NEB 10x cuttermart buffer was added, 14. Mu.l of H2O was incubated in a PCR apparatus at 95℃for 5 minutes, immediately taken out and incubated on ice for 5 minutes, and double-stranded DNA having cohesive ends was formed by annealing.
TABLE 3 annealing reaction System Table
(3) Then, the plasmid PX459 (containing SpCas9 and the corresponding gRNA skeleton sequence) is cut by using the restriction enzyme Bbs I, and then the linearized PX459 is recovered by cutting, so that the plasmid and annealing primer (containing double-stranded DNA with sticky ends) after cutting and the DNA Ligation Kit Ver.2.1 are sequentially added according to the T4 Ligation system in the following table, and incubated in a PCR instrument at 16 ℃ for 1 hour, and the Ligation of the annealed product and the linearized skeleton is completed, thus obtaining a T4-ligated reaction product.
TABLE 4T4 connection System
(4) All T4-linked reaction products were rapidly added to 1 tube (50. Mu.l) of E.coli Stbl3 competent cells for transformation and plated by shaking.
(5) The correct clones were identified by colony PCR and Sanger sequencing. PCR used 5'-GGACTATCATATGCTTACCGTAAC-3' (SEQ ID NO. 30) and 5'-GGCGGGCCATTTACCGTAAG-3' (SEQ ID NO. 31) as primers. The sequencing primer is universal U6-Promoter-F (ACGATACAAGGCTGTTAGAG).
(6) After successful cloning, 2 plasmids spCas9-sgRNA1-2 are obtained, and the sgRNA1-2 in the sgRNA table is expressed respectively.
Example 3
Human erythroid HUDEP2 mutated by HBB gene beta 41-42 β41/42 Is a construction of (3).
1. RNP electroporation
Commercial spCas9 protein and chemically synthesized sgRNA (sgRNA guide sequence: 5'-CAAAGGACTCAAAGAACCTC-3', SEQ ID NO. 32) were combined at 100pmol:300pmol were mixed and packaged for in vitro incubation to RNP. Introduction of ssODN (1 μl) (ssODN is the β 41-42 mutant ssODN in table 1, SEQ ID No. 5) with spCas9/sgRNA RNP into human erythrocytes HUDEP2 by a lonza-4D electrotransport β41/42 Cell lines were electrotransformed with EO-100.
2、HUDEP2 β41/42 Monoclonal screening and identification
After 72 hours of electrical conversion, a small amount of HUDEP2 was taken β41/42 Cell suspension was counted and the cell suspension was transferred to a graduated centrifuge tube and serially diluted to 10 cells/ml. The diluted cell suspension was inoculated into 96-well plates, and 0.1ml of each well was filled. Then put itCulturing in an incubator. After 96 hours, the cell count of each well of the culture plate was observed under an inverted microscope, and wells containing only a single clonal cell mass were selected, and the culture was continued by supplementing 0.1ml of the culture medium. Expansion passage to reach 5×10 cell number 5 And (3) collecting part of HUDEP2 cells, extracting genome DNA, amplifying HBB gene editing fragments by PCR, and performing whole genome exon sequencing analysis (the forward primer of the PCR is CAGTGCCAGAAGAGCCAAGGA, SEQ ID NO.33, the reverse primer of the PCR is AATCATTCGTCTGTTTCCCATTCT, SEQ ID NO.34, and the sequencing primer of the PCR is CCTGAGGAGAAGTCTGCCGTTAC, SEQ ID NO. 35). Selection of the properly sequenced homozygous HUDEP2 containing the beta 41-42 mutation of the HBB gene β41/42 Cells, homozygous HUDEP2 β41/42 The result of cell sequencing is shown in figure 3, and the cells are amplified, frozen and kept for standby.
Example 4
Evaluation of gene repair was performed in human erythrocytes.
Commercial spCas9 protein and chemically synthesized sgRNA #2 (single molecule gRNA, phosphorothioated and methylation modified at the three ends) were combined at 100pmol:300pmol were mixed and packaged for in vitro incubation to RNP. Introduction of ssODN (1 μl) (sgRNA combined with ssODN see table 5 below) and spCas9/sgRNA RNP into human red blood cells HUDEP2 by lonza-4D electrotransport β41/42 Cell lines were electrotransformed with EO-100.
After 72 hours of electroporation, the cells were harvested for genomic DNA, and HBB gene-edited fragments were PCR amplified for sequencing analysis using the sequencing primer set of example 3.
This experiment was repeated twice and sequencing results were analyzed by Synthesis software and shown in Table 5 and FIGS. 4-5. FIG. 4 is a schematic diagram of sequencing results and efficiency analysis results of combination 1 (ssodn#1 and grna#2), and FIG. 5 is a schematic diagram of sequencing results and efficiency analysis results of combination 2 (ssodn#2 and grna#2).
TABLE 5 combination of ssODN and sgRNA and its target repair efficiency
Gene editing efficiency shows that although ssodn#1 is achieving wild-type HBB repair, theoretically there should be better editing efficiency. However, experimental results show that the repair efficiency of the combination of ssodn#2-grna#2 to hbbβ41-42 mutations is significantly better than that of the ssodn#1-grna#2 combination.
Example 5
Evaluation of gene repair was performed in human erythrocytes.
Commercial spCas9 protein and chemically synthesized sgRNA #1 (single molecule gRNA, phosphorothioated and methylation modified at the three ends) were combined at 100pmol:300pmol were mixed and packaged for in vitro incubation to RNP. Introduction of ssODN (1 μl) (sgRNA combined with ssODN see table 6 below) and spCas9/sgRNA RNP into human red blood cells HUDEP2 by lonza-4D electrotransport β41/42 Cell lines were electrotransformed with EO-100.
72 hours after electroporation, the cells were harvested for genomic DNA, and HBB gene-edited fragments were PCR amplified for sequencing analysis using the sequencing primer set of example 3.
Sequencing results were analyzed by Synthesis software, the experimental results are shown in Table 6 and FIGS. 6-7, FIG. 6 is a schematic diagram of sequencing results and efficiency analysis results for combination 1 (ssodn#1 and gRNA#1), and FIG. 7 is a schematic diagram of sequencing results and efficiency analysis results for combination 2 (ssodn#2 and gRNA#1).
TABLE 6 combination of ssODN and sgRNA and its target repair efficiency
Gene editing efficiency was shown in HUDEP2 β41/42 In the cell line, the repair efficiency of the ssODN#2-gRNA#1 to the HBBβ41-42 mutation is also better than that of the ssODN#1-gRNA#1.
Example 6
Evaluation of Gene repair efficiency of ssODN1-7 in beta 41-42 homozygous mutant hematopoietic Stem cells
Human CD 34-positive cells (batch number: mPBSC#1) derived from mobilized peripheral blood of thalassemia patients containing homozygous mutation of HBB gene beta 41-42 were obtained by certain trimethyl hospital in Guangzhou, and after resuscitating the cells, they were cultured in StemSpan serum-free expansion medium (StemCell Co., stemSpan) enriched with human cytokines (SCF, TPO, flt L, 100ng/ml each) TM SFEM # 09600) for two days.
Commercial spCas9 protein and chemically synthesized sgrnas (single molecule grnas, phosphorothioated and methylation modified at the three terminal nucleotides) were combined at 100pmol:300pmol were mixed and packaged for in vitro incubation to RNP. The ssODN#1-as, ssODN#2-as, ssODN#3-as, ssODN#4-as, ssODN#5-as, ssODN#6-as, ssODN#7-as (1. Mu.L) were delivered to mPBS cells in combination with spCas9/sgRNA#1RNP using the lonza-4D electrotransport device self-contained EO-100 program.
Following electrotransformation, cells were induced to erythroid differentiate using 100X Erythroid Expansion Supplement reagent (StemSpan, cat# 02692). Red line induced differentiation flow: SFEM II medium (StemSpan, cat# 09605) was thawed at room temperature or overnight at 2-8deg.C. Subpackaging, and storing at-20deg.C.
100X Erythroid Expansion Supplement reagent and SFEM II medium were mixed according to 1:99 proportion of the total differentiation culture medium. On day 0 of induced differentiation, electrotransport cells were cultured using differentiation complete medium at a cell density of 1x10 4 Cells/ml. Incubated at 37℃in a 5% CO2 incubator. Fresh SFEM II medium was changed every 3-4 days. The induced differentiation lasts for more than 14 days, and the cells are diluted periodically every 3-4 days to maintain a cell density of 1×10 5 Cells/ml.
Day 4 of induced differentiation, 2X 10 was removed 5 Cells, genomic DNA was extracted, and then HBB gene beta 41-42 sites and adjacent fragments were PCR amplified and sequenced using the sequencing primer set of example 3. The sequencing results were analyzed for gene editing efficiency by synthon software as shown in table 7 and figures 8-9 below. Wherein, FIG. 8 shows the repair efficiency results of the beta 41/42 mutation of the HBB gene repaired by Cas9/sgRNA#1 and ssodn# (1-7) -as, respectively, FIG. 9 shows the sequencing result diagram of NC group, and FIGS. 10-16 show the results of combination 1 (ssODSequencing result graphs of n#1+sgrna#1), combination 2 (ssodn#2+sgrna#1), combination 3 (ssodn#3+sgrna#1), combination 4 (ssodn#4+sgrna#1), combination 5 (ssodn#5+sgrna#1), combination 6 (ssodn#6+sgrna#1), combination 7 (ssodn#7+sgrna#1).
TABLE 7 different ssODN and sgRNA#1 combinations and their target repair efficiencies
The results showed that, although ssodn#1 was a repair HBB gene which was wild-type, it was advantageous in patient-derived cd34+ cell HBB gene repair relative to ssodn#3-as, ssodn#5-as, ssodn#6-as, ssodn#7-as, ssodn#4-as still had similar editing efficiency as ssodn#1, and ssodn#2 even had more significant repair efficiency than ssodn#1.
Example 7
Gene repair efficiency and erythroid differentiation impact assessment was performed in beta 41-42 homozygous mutant hematopoietic stem cells.
Human CD 34-positive cells (batch number: mPBSC#1) derived from mobilized peripheral blood of thalassemia patients containing HBB gene beta 41-42 mutation were obtained by certain trimethyl hospital in Guangzhou, and after resuscitating the cells, they were cultured in StemSpan serum-free expansion medium (StemCell Co., stemSpan) enriched with human cytokines (SCF, TPO, flt L, each 100 ng/ml) TM SFEM # 09600) for two days.
Commercial spCas9 protein and chemically synthesized sgrnas (single molecule grnas, phosphorothioated and methylation modified at the three terminal nucleotides) were combined at 100pmol:300pmol were mixed and packaged for in vitro incubation to RNP. Ssodn#1-as and ssodn#2-as (1 μl) were delivered into mpbcc cells in combination with spCas9/sgrna#1RNP, respectively, using the lonza-4D electrotransport machine's self-contained EO-100 program.
Following electrotransformation, cells were induced to erythroid differentiate using 100X Erythroid Expansion Supplement reagent (StemSpan, cat# 02692). Red line induced differentiation flow: SFEM II medium (StemSpan, cat# 09605) was thawed at room temperature or overnight at 2-8deg.C. Subpackaging, and storing at-20deg.C.
100X Erythroid Expansion Supplement reagent and SFEM II medium were mixed according to 1:99 proportion of the total differentiation culture medium. On day 0 of induced differentiation, electrotransport cells were cultured using differentiation complete medium at a cell density of 1x10 4 Cells/ml. Incubated at 37℃in a 5% CO2 incubator. Fresh SFEM II medium was changed every 3-4 days. The induced differentiation lasts for more than 14 days, and the cells are diluted periodically every 3-4 days to maintain a cell density of 1×10 5 Cells/ml.
Day 4 of induced differentiation, 2X 10 was removed 5 Cells, genomic DNA was extracted, then the HBB gene beta 41-42 site and adjacent fragments were PCR amplified, and the same were sequenced by sanger using the sequencing primer set of example 3, and after 18 days of induced differentiation, the proportion of CD235a positive erythrocytes was analyzed by flow cytometry to investigate whether the new nucleotide-encoded HBB had an effect on erythrocyte differentiation.
The sequencing results were analyzed for gene editing efficiency by synthon software as shown in table 8 and figures 17-18 below. Wherein, FIG. 17 is a schematic diagram of sequencing results and efficiency analysis of combination 1 (ssodn#1 and grna#1), and FIG. 18 is a schematic diagram of sequencing results and efficiency analysis of combination 2 (ssodn#2 and grna#1).
TABLE 8 electric transfer of ssodn and sgRNA combinations, efficiency of target gene repair, and ratio of differentiated erythrocytes results
The result shows that the target repair efficiency of the beta 41-42 mutation realized by the ssodn#2 in the human primary hematopoietic stem cells is higher than that of the ssodn#1, and the proportion of red blood cells for inducing differentiation is higher, so that the ssodn#1 is proved to have higher repair efficiency, and the gene repair product has no influence on red differentiation and even has promotion effect.
Example 8
Evaluation of HBB Gene transcription and translation efficiency after repair of beta 41-42 homozygous mutant hematopoietic Stem cell Gene
Following the procedure described in example 7, the above described peripheral blood-derived human CD34 positive cells (batch number: mPBSC#2) from thalassemia patients containing the HBB gene beta 41-42 mutation were subjected to expansion culture, and then ssodn#1 and ssodn#2 (1 μl) were electroporated into mPBSC#2 cells in combination with spCas9/sgRNA#1 RNP, respectively, followed by erythroid induced differentiation.
On day 4 of induced differentiation, sequencing and repair efficiency analysis were performed on the induced differentiated cells according to the method described in example 7, and the results are shown in table 9 and fig. 19-20, wherein fig. 19 is a schematic diagram of sequencing results and efficiency analysis of combination 1 (ssodn#1 and grna#1), and fig. 20 is a schematic diagram of sequencing results and efficiency analysis of combination 2 (ssodn#2 and grna#1), and it was again verified that the objective repair efficiency of the β41-42 mutation achieved by ssodn#2 is higher than ssodn#1.
TABLE 9 combination of ssODN and sgRNA and its target repair efficiency
Combination numbering ssODN numbering gRNA numbering Destination repair efficiency
1 ssODN#1 gRNA#1 70％
2 ssODN#2 gRNA#1 80％
After 18 days of induced differentiation, both the electroporated mpbcs #2 cells and untreated CD34 positive cells (mpbcs # 2) were seen as a distinct dark red color after centrifugation, which contained a large number of erythrocytes, indicating that the electroporated mpbcs could normally differentiate into erythrocytes. Partially induced differentiated cells were collected, RNA was extracted using SteadyPure Universal RNA Extraction Kit, RNA concentration was determined using QubitTM RNA BR Assay Kit kit, and genomic gDNA was removed using Evo M-MLV RT Kit Kith gRNA Clean for KPCR II and reverse transcription reactions were performed to synthesize cDNA.
The relative expression change of the repaired HBB mRNA was detected by using Accurate SYBR Green Pro TaK HS relative real-time quantitative KPCR, and GAPDH was used as an internal reference. Primer sequences are shown in Table 10 below and KRT-PCR reaction systems are shown in Table 11. Specific primers are designed aiming at the beta 41-42 locus of the HBB gene after editing and repairing, only the correctly repaired sequence can be amplified, and the mRNA after non-editing and non-purpose editing cannot be amplified. Each pair of primers to detect different ssODN repair results was tested on unrepaired mpbcs #2 cell cdnas to avoid non-specific primer amplification. The recombinant plasmid is transfected into cells, RNA is taken, cDNA is synthesized by inversion, KPCR is independently subjected to 3 times of biological repeated experiments, and three times of average results are obtained through a 2-delta CT calculation method. The experimental operation is strictly carried out according to the instruction of the reagent or the kit.
TABLE 10 primer sequence table for KPCR detection
TABLE 11KPCR reaction system
Total volume of reaction 10μl
SYBR Green Pro TaK HS 5μl
forKard primer/10μM 0.2μl
reverse primer/10μM 0.2μl
3-fold dilution of cDNA 3μl
Deionized water 1.2μl
The primer sequence is designed specific primers aiming at the beta 41-42 locus of the HBB gene after editing and repairing, only the correctly repaired sequence can be amplified, and mRNA after non-editing and non-target editing cannot be amplified.
The KRT-PCR results are shown in Table 12 and FIG. 21, and FIG. 21 shows the results of detection of the levels of mutant repair HBB mRNA by KRT-PCR for two ssODN mediated mPBSC#2. Wherein, HBB-TCTT represents HBB-TCTT specific fragment which is subjected to detection of combination 1 induced repair by KPCR primers ssODN1-F and ssODN-R; HBB-TTTT means HBB-TTTT specific fragment that induces repair by detection of combination 2 by KPCR primers ssODN2-F and ssODN-R.
TABLE 12KRT-PCR detection results
The above results show that the repair HBB mRNA-2-DeltaCt value of combination 2 is 2.40 times that of combination 1, and the comparison analysis is carried out on the target repair efficiency of HBB gene in combination with the above Table 9, while the repair efficiency of combination 2 is higher than that of combination 1 by 1.14 times, the transcriptional expression level of HBB-TTTT mRNA in combination 2 is higher than that of HBB-TCTT mRNA in combination 1 to a greater extent, and it is inferred that HBB-TTTT has stronger transcriptional advantage than HBB-TCTT.
Meanwhile, the present example also examined the expression of β -globin in mpbcsc#2 cells that did not undergo gene repair (NC group), undergoing ssodn#1 gene repair, and undergoing ssodn#2 gene repair by protein electrophoresis westem BLOT, and the results are shown in fig. 22.
The result shows that compared with the SSODN#1 and NC groups (the total amount of the sample proteins is 3 ug), the SSODN#2 remarkably improves the expression of beta globin in the gene repair cells, and the HBB-TTTT gene repaired by the SSODN#2 has stronger protein translation efficiency.
Example 9
Evaluation of HBB Gene transcription efficiency after gene repair of beta 41-42 heterozygous mutant hematopoietic Stem cells.
According to the method described in example 7, the above-mentioned thalassemia patients containing HBBβ41-42/IVS 2-654C > T mutation were subjected to amplification culture of peripheral blood-derived human CD34 positive cells (lot number: mPbSC#3), and then ssodn#1 and ssodn#2 (1 μl) were respectively electroporated into mPbSC#2 cells in combination with spCas9/sgRNA#1RNP, followed by erythroid induction differentiation.
After 18 days of induced differentiation, the cells from the different experimental groups after induced differentiation were collected, RNA was extracted separately, reverse transcribed into cDNA, and the transcriptional expression level of the HBB mRNA after gene repair was detected by KRT-PCR according to the method described in example 8.
The KRT-PCR results are shown in Table 13 and FIG. 23, FIG. 23 shows the results of detection of the levels of mutant repair HBB mRNA of two ssODN-mediated mPbSC#3 by KRT-PCR, wherein HBB-TCTT represents the HBB-TCTT specific fragment that was repaired by detection of combination 1 by KPCR primers ssODN1-F and ssODN-R; HBB-TTTT means HBB-TTTT specific fragment that induces repair by detection of combination 2 by KPCR primers ssODN2-F and ssODN-R.
TABLE 13KRT-PCR detection results
The results show that the HBB-TTTT mRNA-2-DeltaDeltaCt value of combination 2 repair is 1.78 times that of HBB-TCTT mRNA of combination 1 repair, further verifying that HBB-TTTT has stronger transcription advantage over HBB-TCTT.
The sample used in this example was mPBSC#3 (containing the HBBβ41-42/IVS2-654C-T mutation), i.e., one chromosome contains the β41-42 mutation in the HBB gene and the other chromosome contains the IVS2-654C-T mutation, and it should be noted that the β41-42 site is the wild-type sequence of the HBB copy containing IVS 2-654C-T.
Thus, the NC control group without gene repair (mPBSC#3) also had higher transcriptional expression of the HBB repair gene when tested using KRT-PCR; whereas example 8 used the beta 41-42 mutant homozygote mpbcc#2, without the beta 41-42 site wild type sequence, the beta 41-42 mutation was undetectable to repair HBB gene transcriptional expression; therefore, the relative transcriptional expression level of the HBB repair gene (HBB-TCTT/HBB-TTTT) of the repair-treated homozygote mPBSC#2 was very high compared to that of the untreated homozygote NC-mPBSC#2.
Furthermore, since a chromosome with no mutation at the beta 41-42 site exists in the mpbsc#3 cell as a donor template for gene repair, the number of donor templates increases during homologous repair of ssodn#1, and thus the repair efficiency of ssodn#1 is improved, approaching to and slightly lower than ssodn#2. Further, by subtracting the KRT-PCR relative quantitative value of the wild type HBB chromosome without mutation at the beta 41-21 locus from 1, and comparing the relative quantitative values of the repaired HBB-TCTT and the repaired HBB-TTTT, the relative expression quantity of the HBB-TTTT is found to be 3.68 times that of the HBB-TCTT.
Therefore, it was found that even in the case where the gene repair efficiency is close, the transcriptional expression efficiency of the HBB gene repaired by ssodn#2 is significantly superior to ssodn#1.
Taken together, the transcriptional expression level of HBB-TTTT repaired by ssodn#2 has significant advantages over HBB-TCTT repaired by ssodn#1, both in homozygote and heterozygote of the β41-42 mutation.
Example 10
Evaluation of hemoglobin percentage and function after gene repair of beta 41-42 mutated hematopoietic stem cells.
On day 18 of induction differentiation of hematopoietic stem/progenitor cells mpbcs #2 from the genetically repaired patient, the erythroid differentiation and globin expression of the genetically repaired cells were analyzed by flow cytometry in this example, and the non-repaired mpbcs #2 induced differentiation erythroid experimental group was used as a negative control.
Taking cell 1.5x10 after differentiation of ssodn#1-mpbcs#2, ssodn#2-mpbcs#2, NC-mpbcs#2 6 After washing with 1ml of PBS, the supernatant was removed by centrifugation, and 150. Mu.l of PBS was resuspended. mu.L of CD235a antibody (Anti-Human CD235a-APC, thermo, cat. No. 17-9987-42) was added and incubated for 30min in the absence of light. Centrifuging at 300g for 5min, and discarding supernatant; 1ml PBS was added and washed once, and 300g was centrifuged for 5min, and the supernatant was discarded. 360 μl PBS was resuspended, 40 μl 10 Xglutaraldehyde fixative was added, mixed well (vortex 15 seconds) and fixed at room temperature in the dark for 10min. Centrifuge at 300g for 10min, discard supernatant. 360 μl PBS was resuspended, and 40 μl 10 XTriton X-100/PBS was added for 5min at room temperature. Centrifuge at 300g for 10min, discard supernatant. 100 μl PBS was added for resuspension, 5 μl HbF antibody (anti-Human Fetal Hemoglobin-FITC, thermo, cat No. MHFH 01) and 5 μl HBB antibody (anti-Human Hemoglobin β -PE, thermo, cat No. Sc-21757) were added and incubated for 30min under light-shielding conditions. PBS was washed twice, resuspended, and differentiated cells were examined for expression of CD235a, hbF and HBB by flow cytometry apparatus, and the results are shown in table 14.
TABLE 14 expression of cells CD235a, hbF and HBB after differentiation by flow cytometry
The above flow cytometry results showed that the hcd235a+ erythrocyte ratio of the ssodn#2-mpbcc#2 experimental group was 1.27 times that of the ssodn#1-mpbcc#2 experimental group, although there was a personalized difference in the efficiency of inducing erythroid differentiation from different samples, the erythroid differentiation results from multiple samples all showed a positive correlation between the HBB-TTTT encoded by the new nucleotide and the erythroid ratio after differentiation.
The results of further analysis of globin expression in CD235a positive cells from different experimental groups are shown in table 15 below.
TABLE 15 flow cytometric analysis of the proportions of red blood cells positive for HBB after repair, induction and differentiation of the same original hematopoietic stem cell HBB gene
Experimental group HBB+％of CD235a
ssODN#2-mPBSC#1 43.03
ssODN#2-mPBSC#2 43.1
ssODN#2-mPBSC#3 49.48
From the above results, it was found that the red blood cell ratio of expressing HBB globin (beta globin, hemoglobin beta subunit) in the experimental group of ssodn#2-mpBSC#2 was 43.1%, which is significantly better than 30.5% of the experimental group of ssodn#1-mpBSC#2 (Table 14), and the HbF-HBB+hCD235a+ cell ratios were 1.33 times and 1.46 times as high as those of the experimental group of ssodn#1-mpBSC#2, respectively.
The result shows that the protein expression level of the HBB-TTTT gene obtained by the beta 41-42 mutation repaired by the ssodn#2 is higher, and the HBB-TTTT coded by the novel nucleotide has obvious advantages in the protein expression level compared with the HBB-TCTT. The ssODN#2 can realize efficient beta 41-42 mutation repair in primary hematopoietic stem/progenitor cells mPBSC#1- #3 of patients, and promote the transcription, translation and protein expression level of the repaired HBB gene, so that the proportion of expressed HBB globin in induced differentiated erythrocytes exceeds 40%.
Example 11
Animal experiment research.
The in vivo efficacy test of ssODN2 is mainly carried out by taking hyperimmune mice as a model for transplantation test. By using cells from alpha-poor patients, we developed in vivo transplantation and hematopoietic reconstitution experiments of multiple batches of highly immunodeficiency mice, and studied the editing efficiency after different editing, hematopoietic reconstitution after the implantation of the cells from the patients into the mice, and HBB expression in the differentiated erythrocytes.
In this example, cd34+ cells of patients after the ssodn#2 gene repair were injected into hyperimmune mice via tail vein, and it was estimated that cells transplanted at week 16 could successfully reconstruct hematopoietic system without significant difference from the unedited group (NC group).
Bone marrow cells were taken at weeks 8 and 16 after transplantation, and the proportion of hbb+ cells was measured by flow cytometry, and the hbb+ cells were not differentiated from the cd34+ cells of the unedited patients, whereas the hbb+ cells were differentiated from the cd34+ cells of the edited patients.
In conclusion, the invention optimizes the codon of the HBB gene sequence, and discovers that the optimized HBB gene sequence can promote HBB transcription and beta globin translation, improve the whole level of hemoglobin and improve the treatment efficiency while improving the gene repair efficiency.
In addition, unexpectedly, the ssODN designed by the invention has more remarkable mutation repair efficiency than the wild-type ssODN, and the HBB gene coded by the repaired new nucleotide has higher transcription and translation levels, so that the number and the expression level of the expression cells of HBB globin and HbA hemoglobin are improved, and the ssODN is hopeful to be applied to clinical practice to effectively relieve the illness state of patients and continuously get rid of the transfusion state.
The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.
The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (19)

1. A nucleotide molecule for use in beta-earth-lean gene therapy, wherein said nucleotide molecule corresponds to Chr11: the negative strand base at position 5226763 is C, and/or corresponds to Chr11: the plus strand base at position 5226763 is G, and/or corresponds to Chr11: the negative strand base at position 5226764 is G, and/or corresponds to Chr11: the plus strand base at position 5226764 is C, and/or corresponds to Chr11: the negative strand base at position 5226766 is T or G, and/or corresponds to Chr11: the plus strand base at position 5226766 is a or C, and/or corresponds to Chr11: the negative strand base at position 5226769 is a, and/or corresponds to Chr11: the base of the positive strand at the 5226769 site is T.
2. A nucleotide molecule encoding a beta globin, wherein the codon for beta 40 in the nucleotide molecule is selected from the group consisting of: the codons of AGA, β41 are selected from: the codons of TTT or TTG, and/or β42 are selected from: TTC or TGT.
3. A method for increasing the expression of β globin, characterized in that the sense strand or the antisense strand of the nucleotide molecule of claim 1 or 2 is introduced into a target cell by gene editing techniques, such that the genomic sequence of the target cell is edited into the nucleotide molecule of claim 1 or 2.
4. A donor template for use in beta-earth-lean gene therapy comprising a 5 'homology arm, a replacement sequence, and a 3' homology arm, the donor template selected from the group consisting of: double-stranded DNA, or single-stranded DNA; the replacement sequence comprises or is selected from the following sequences:
2-as：5’-AAAAAACCT-3’
2-s：5’-AGGTTTTTT-3’
3-as：5’-AAAAAATCT-3’
3-s：5’-AGATTTTTT-3’
4-as：5’-GAAGAACCT-3’
4-s：5’-AGGTTCTTC-3
5-as：5’-GAAAAACCT-3’
5-s：5’-AGGTTTTTC-3’
6-as：5’-AAACAACCT-3’
6-s：5’-AGGTTGTTT-3’
7-as：5’-ACAGAACCT-3’
7-s：5’-AGGTTCTGT-3’。
5. the donor template for beta-earth-lean gene therapy of claim 4, wherein the template is a single-stranded donor template.
6. The donor template for beta-earth-lean gene therapy of claim 4, wherein the sequence length of the 5 'homology arm or 3' homology arm is any selected from the group consisting of: 30-100nt.
7. The donor template for beta-earth-lean gene therapy according to claim 4, wherein the donor template has phosphorothioate modifications at the 5 'homology arm and/or 3' homology arm ends.
8. The donor template for beta-earth-lean gene therapy of claim 7, wherein the 2 nucleotides at the 5 'homology arm and/or the 3' homology arm ends of the donor template have phosphorothioate modifications.
9. The donor template for beta-earth-lean gene therapy according to claim 4, characterized in that when the donor template sequence corresponds to the HBB gene sense strand, the 5' homology arm is a sequence comprising 5'-AGGCTGCTGGTGGTCTACCCTTGGA CCCAG-3' (SEQ ID No. 1);
the 3' homology arm is a sequence comprising 5'-GAGTCCTTTGGGGATCTGTCCACTCCTGAT-3' (SEQ ID No. 2);
when the ssODN sequence corresponds to the HBB gene antisense strand, then the 5' homology arm is a sequence comprising 5'-CATAACAGCATCAGGAGTGGACA GATCCCCAAAGGACTC-3' (SEQ ID No. 3);
the 3' homology arm is a sequence comprising 5'-CTGGGTCCAAGGGTAGACCACCAGCAGCCTAAGGGT-3' (SEQ ID NO. 4).
10. The donor template for beta-earth-lean gene therapy according to claim 4, wherein the sequence is selected from the group consisting of the sequences shown in SEQ ID No.6-SEQ ID No. 19.
11. The donor template for beta-earth-lean gene therapy according to claim 4, wherein the donor template is a ssODN corresponding to the HBB cDNA repairing the sequence shown in SEQ ID No.20-SEQ ID No. 25.
12. A composition for use in beta-thalassemia gene therapy comprising the donor template of any one of claims 4-11 and a gene editing system that targets the HBB gene.
13. The composition for beta-earth-lean gene therapy of claim 12, wherein the gene editing system comprises a gRNA and a Cas enzyme.
14. The composition for beta-earth-lean gene therapy of claim 13, wherein the Cas enzyme is selected from the group consisting of: cas9.
15. The composition for use in beta-earth-lean gene therapy according to claim 13, wherein the sgRNA comprises a guide sequence comprising the sequence set forth in any one of SEQ ID No.28-SEQ ID No.29 and a framework sequence.
16. The composition for use in beta-earth-lean gene therapy according to claim 13, wherein said ssODN is selected from the sequences set forth in SEQ ID nos. 8-9 and said guide sequence is selected from the sequences set forth in SEQ ID No. 28.
17. A vector for use in beta-earth-lean gene therapy, comprising a nucleotide molecule according to claim 1, or expressing a donor template according to any one of claims 4-11, or expressing a composition according to any one of claims 12-16.
18. A cell comprising the nucleotide molecule for beta-lean gene therapy of any one of claims 1-2, the donor template for beta-lean gene therapy of any one of claims 4-11, the composition for beta-lean gene therapy of any one of claims 12-16, or the vector for beta-lean gene therapy of claim 17.
19. Use of a nucleotide molecule according to claim 1 or 2, a donor template according to claims 4-11, a composition according to claims 12-16, a vector according to claim 17, and a cell according to claim 18 for the preparation of a medicament for beta-lean gene therapy.
CN202210818707.8A 2022-07-13 2022-07-13 Nucleotide molecules for beta-thalassemia gene therapy and uses thereof Pending CN117402882A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210818707.8A CN117402882A (en) 2022-07-13 2022-07-13 Nucleotide molecules for beta-thalassemia gene therapy and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210818707.8A CN117402882A (en) 2022-07-13 2022-07-13 Nucleotide molecules for beta-thalassemia gene therapy and uses thereof

Publications (1)

Publication Number Publication Date
CN117402882A true CN117402882A (en) 2024-01-16

Family

ID=89495011

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210818707.8A Pending CN117402882A (en) 2022-07-13 2022-07-13 Nucleotide molecules for beta-thalassemia gene therapy and uses thereof

Country Status (1)

Country Link
CN (1) CN117402882A (en)

Similar Documents

Publication Publication Date Title
US20240002843A1 (en) Compositions and methods for the treatment of hemoglobinopathies
US11634732B2 (en) Pharmaceutical compositions comprising gene-corrected primary cells
KR102630217B1 (en) Compositions and methods for the treatment of hemochromatosis
CN115651927B (en) Methods and compositions for editing RNA
WO2019062522A1 (en) Sgrna, engineered cas9 protein, and kit
EP3155098A1 (en) FACTOR VIII MUTATION REPAIR AND TOLERANCE INDUCTION AND RELATED CDNAs, COMPOSITIONS, METHODS AND SYSTEMS
CN111876416B (en) Methods and compositions for activating gamma-globin gene expression
US20160045575A1 (en) FACTOR VIII MUTATION REPAIR AND TOLERANCE INDUCTION AND RELATED cDNAs, COMPOSITIONS, METHODS AND SYSTEMS
CN112011576A (en) Application of CRISPR gene editing technology in treating thalassemia
CN118056014A (en) Method for repairing HBA2 gene mutation by single base editing and application thereof
CN117402882A (en) Nucleotide molecules for beta-thalassemia gene therapy and uses thereof
EP4079765A1 (en) Fusion protein that improves gene editing efficiency and application thereof
CN113201499A (en) HBB gene CD17 mutant cell and preparation method and application thereof
CN112979823A (en) Product and fusion protein for treating and/or preventing beta-hemoglobinopathy
EP3929294A1 (en) Pyruvate kinase deficiency (pkd) gene editing treatment method
US20220228142A1 (en) Compositions and methods for editing beta-globin for treatment of hemaglobinopathies
RU2812491C2 (en) Compositions and methods of treating hemoglobinopathies
WO2022232839A1 (en) Methods for improved production of primary cd34+ cells
CN117535354A (en) Method and composition for repairing HBA2 gene mutation and application thereof
CN117580942A (en) Genetic modification of hepatocytes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination