CN117402837A

CN117402837A - Recombinant oncolytic virus and application thereof

Info

Publication number: CN117402837A
Application number: CN202210838779.9A
Authority: CN
Inventors: 周国庆; 张凡; 马良; 田婷
Original assignee: Shanghai Rongrui Pharmaceutical Technology Co ltd
Current assignee: Shanghai Rongrui Pharmaceutical Technology Co ltd
Priority date: 2022-07-14
Filing date: 2022-07-14
Publication date: 2024-01-16
Also published as: WO2024012278A1

Abstract

The application relates to the technical field of biological medicines, and particularly discloses a recombinant oncolytic virus and application thereof. The recombinant oncolytic virus comprises M protein and an antigen coded by a foreign gene; compared with the amino acid sequence shown in SEQ ID NO 1, the M protein comprises the following site mutations: methionine at position 51 to arginine (M51R); valine at position 221 to phenylalanine (V221F); serine at position 226 is mutated to arginine (S226R). The recombinant oncolytic virus provided by the application has better infectivity and in-vitro killing capacity on abnormal proliferation (tumor) LLC cells, is not easy to clear in LLC cells, and greatly reduces infectivity on normal cells.

Description

Recombinant oncolytic virus and application thereof

Technical Field

The application relates to the technical field of biological medicine, in particular to a recombinant oncolytic virus and application thereof.

Background

Oncolytic viruses are a class of replication-competent tumor-killing viruses, which have been currently accepted by the general public as an important branch of tumor immunotherapy. Oncolytic viruses are capable of specifically targeting infected tumor cells, for example, using inactivation or defect of an oncogene in the tumor cells, thereby selectively infecting tumor cells; after oncolytic viruses infect tumor cells, they replicate in large numbers within the tumor cells and eventually destroy the tumor cells, thereby killing them. At the same time, oncolytic viruses can also provide the immunostimulatory signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells.

Although oncolytic viruses have better application prospects in tumor immunotherapy, wild oncolytic viruses often cause problems of organism nervous system inflammation and the like, and have larger pathogenic risks in the process of infecting tumor cells by using the wild oncolytic viruses. Therefore, to further advance the clinical application of oncolytic viruses, wild-type oncolytic viruses need to be engineered to obtain attenuated oncolytic viruses. The attenuated oncolytic virus is used for clinical application, so that the pathogenic risk of the oncolytic virus is reduced, and the safety of the oncolytic virus is improved.

However, in the process of modifying the oncolytic virus, if only the wild oncolytic virus is subjected to random genetic modification, although the toxicity of the oncolytic virus can be reduced, the modified oncolytic virus may have poor cure rate effect, even the modified oncolytic virus cannot be packaged, and the clinical application of the oncolytic virus is not facilitated.

Disclosure of Invention

In order to further improve the killing capacity of oncolytic viruses on tumor cells in vitro and in vivo and ensure the safety of oncolytic viruses on normal cells, the application provides a recombinant oncolytic virus and application thereof.

The recombinant oncolytic virus provided by the application adopts the following technical scheme:

A recombinant oncolytic virus comprising an antigen encoded by an M protein and a foreign gene; compared with the amino acid sequence shown in SEQ ID NO 1, the M protein comprises the following site mutations: methionine at position 51 to arginine (M51R); valine at position 221 to phenylalanine (V221F); serine at position 226 is mutated to arginine (S226R).

Further, the antigen is selected from solid tumors or hematological tumors.

Further, the method comprises the steps of, the solid tumor antigens include, but are not limited to, 5T4, RORl, EGFR, fc gamma RI (CD 64), fcgammaRIIA (CD 32 a), fcgammaRIIB (CD 32 b), CD28, CD137 (4-1 BB), CTLA-4, HER-2, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR 1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) proteins, lymphotoxin-beta receptor (LTbeta R), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate Specific Membrane Antigen (PSMA) proteins, prostate Stem Cell Antigen (PSCA) proteins tumor associated protein Carbonic Anhydrase IX (CAIX), EGFR1 (EGFR 1), EGFRvIII, erbB3 (HER 3), folate receptor, ephrin receptor, PDGFRa, erbB-2, CD40, CD74, CD80, CD86, CCAM5 (CD 66 e), CCAM6 (CD 66C), p53, cMet (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, CD86, CCAM5 (CD 66 e) MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA-88-A, NY-ESO-1, BRCA2, MART-1, MC1R, gp, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (GDF 8), cripto (TDGF 1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, beta-catenin/m, caspase-8/m, CDK-4/m, ELF2M, gnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin/m, RAGE, SART-2, TRP-2/INT2, 707-AP, annexin II, CDC27/m, TPI/mbcr-abl, ETV6/AML, LDLR/FUT, pml/RARα, TEL/AML1, CD28, CD137, canAg, mesothelin (MSLN), DR5, PD-1, pmPD-L1, IGF-1, nepal-1, nepalin (Nepalin) 1, NRP-1), glypican (glypican 2/3, GPC 2/3), ephA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP, FOLR1, AXL;

Further, the hematological tumor antigens include, but are not limited to, BCMA (TNFRSF 17), CD4, CD5 (Leu-1), CD7, CD10, fcgammaRIIIa (CD 16A), fcgammaRIIIb (CD 16B), CD19, CD20 (MS 4A 1), CD22 (Siglec-2), CD23, CD30 (TNFRSF 8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM 1), CD70, CD117, CD123 (IL 3 RA), CD138 (SDC 1), CD174, CLL-1, ROR1, NKG2DL1/2 (ULBP 1/2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A/B, CSNK A1, FLI1, ZF1/3, ki3-35-319, SLAMF3, SLAMF 229, SLAMK 7, SLAMB 1, and SLITB-gG, TACI, TRBCI, leY, MUC.

Further, the antigen is selected from any one or more of the following: CD19, BCMA, NY-ESO-1, MUC-1, MSLN, EGFR, VEGFR, MAGE A4, cMet, HGFR, claude 18.2.18.2.

Further, the recombinant oncolytic virus also includes a cytokine encoded by a foreign gene.

Further, the cytokine is selected from the group consisting of interleukins, interferons, tumor necrosis factors, colony stimulating factors, transforming growth factor beta, and chemokine families.

Further, the cytokine is selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-alpha, IFN-beta, IFN-gamma, IFN-beta, TGF-beta and TNF-alpha.

Further, the cytokine is selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF- α, IFN- β.

Further, the M protein further comprises one or more of the following site mutations: asparagine at position 32 is mutated to serine (N32S); and/or asparagine at position 49 is mutated to aspartic acid (N49D); and/or, the histidine at position 54 is mutated to tyrosine (H54Y); and/or valine at position 225 to isoleucine (V225I).

Further, the M protein further comprises one or more of the following site mutations: knocking out the 111 th leucine coding base; or, leucine at position 111 is mutated to alanine (L111A).

Further, the M protein further comprises one or more of the following site mutations: glycine at position 21 to alanine (G21E); and/or, methionine at position 33 to alanine (M33A); and/or, alanine at position 133 is mutated to threonine (a 133T).

In a specific embodiment, the site mutation of the M protein comprises a mutation of methionine at position 51 to arginine (M51R).

In a specific embodiment, the site mutation of the M protein comprises a valine to phenylalanine (V221F) mutation at position 221.

In a specific embodiment, the site mutation of the M protein comprises a mutation of serine to arginine at position 226 (S226R).

In a specific embodiment, the site mutation of the M protein comprises an asparagine mutation at position 32 to serine (N32S).

In a specific embodiment, the site mutation of the M protein comprises an asparagine mutation at position 49 to aspartic acid (N49D).

In a specific embodiment, the site mutation of the M protein comprises a histidine mutation at position 54 to tyrosine (H54Y).

In a specific embodiment, the site mutation of the M protein comprises a valine to isoleucine (V225I) mutation at position 225.

In a specific embodiment, the site mutation of the M protein comprises a knockout of leucine encoding base 111.

In a specific embodiment, the site mutation of the M protein comprises a leucine to alanine mutation at position 111 (L111A).

In a specific embodiment, the site mutation of the M protein comprises a glycine to alanine mutation at position 21 (G21E).

In a specific embodiment, the site mutation of the M protein comprises a methionine to alanine mutation at position 33 (M33A).

In a specific embodiment, the site mutation of the M protein comprises a mutation of alanine at position 133 to threonine (a 133T).

In a specific embodiment, the M protein has an amino acid substitution of M51R, V221F, S226R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, N49D, M R, H54Y, V221F, V225I, S226R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, N49D, M R, H Y, knockout of leucine encoding base 111, V221F, V225I, S226R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, N49D, M R, H54Y, L111A, V221F, V225I, S226R.

In a specific embodiment, the M protein has an amino acid substitution of G21E, N32S, N49D, M R, H Y, V221F, V225I, S226R.

In a specific embodiment, the M protein has an amino acid substitution of G21E, N32S, M3533A, N49D, M51R, H54Y, V221F, V225I, S R.

In a specific embodiment, the M protein has an amino acid substitution of G21E, N32S, M3533A, N49D, M51R, H54Y, A133T, V221F, V225I, S R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, M33A, N49D, M R, H Y, V221F, V225I, S226R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, M33A, N49D, M R, H54Y, A133T, V221F, V225I, S R.

In a specific embodiment, the M protein has an amino acid substitution of N32S, N49D, M R, H54Y, A133T, V221F, V225I, S226R.

In this application, wild-type VSV virus Indiana MuddSummer subtype M protein comprises the amino acid sequence shown in SEQ ID NO 1.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 2.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 3.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 4.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 5.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 6.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 7.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 8.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 9.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 10.

In a specific embodiment, the M protein comprises the amino acid sequence shown as SEQ ID NO 11.

In a specific embodiment, the antigen is CD19.

In a specific embodiment, the antigen is BCMA.

In a specific embodiment, the antigen is NY-ESO-1.

In a specific embodiment, the antigen is MUC-1.

In a specific embodiment, the antigen is MSLN.

In a specific embodiment, the antigen is EGFR.

In a specific embodiment, the antigen is VEGFR2.

In a specific embodiment, the antigen is MAGE A4.

In a specific embodiment, the antigen is cMet.

In a specific embodiment, the antigen is Claude 18.2.

In a specific embodiment, the antigen is CD22.

In a specific embodiment, the antigen CD19 comprises the amino acid sequence shown as SEQ ID NO 28.

In a specific embodiment, the antigen BCMA comprises the amino acid sequence shown in SEQ ID NO 29.

In a specific embodiment, the antigen NY-ESO-1 comprises the amino acid sequence shown as SEQ ID NO 30.

In a specific embodiment, the antigen MUC-1 comprises the amino acid sequence as shown in SEQ ID NO 31.

In a specific embodiment, the antigen MSLN comprises the amino acid sequence shown as SEQ ID NO 32.

In a specific embodiment, the antigen EGFR comprises the amino acid sequence shown in SEQ ID NO 33.

In a specific embodiment, the antigen VEGFR2 comprises the amino acid sequence shown as SEQ ID NO 34.

In a specific embodiment, the antigen MAGE A4 comprises the amino acid sequence shown as SEQ ID NO 35.

In a specific embodiment, the antigen cMet comprises the amino acid sequence shown as SEQ ID NO 36.

In a specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown as SEQ ID NO 37.

In a specific embodiment, the antigen CD22 comprises the amino acid sequence shown as SEQ ID NO 38.

In a specific embodiment, the antigen CD19 comprises the amino acid sequence shown as SEQ ID NO 39.

In a specific embodiment, the antigen MAGE A4 comprises the amino acid sequence shown as SEQ ID NO 40.

In a specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown as SEQ ID NO 41.

In a specific embodiment, the cytokine is GM-CSF.

In a specific embodiment, the cytokine is IL-2.

In a specific embodiment, the cytokine is IL-12.

In a specific embodiment, the cytokine is IL-15.

In a specific embodiment, the cytokine is IL-18.

In a specific embodiment, the cytokine is TNF- α.

In a specific embodiment, the cytokine is IFN- β.

In a specific embodiment, said cytokine GM-CSF comprises the amino acid sequence shown in SEQ ID NO 20.

In a specific embodiment, the cytokine IL-2 comprises an amino acid sequence as set forth in SEQ ID NO 21.

In a specific embodiment, the cytokine IL-12-A comprises an amino acid sequence as shown in SEQ ID NO 22.

In a specific embodiment, the cytokine IL-12-B comprises an amino acid sequence as shown in SEQ ID NO 23.

In a specific embodiment, the cytokine IL-15 comprises an amino acid sequence as set forth in SEQ ID NO 24.

In a specific embodiment, the cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO 25.

In a specific embodiment, the cytokine TNF- α comprises the amino acid sequence as set forth in SEQ ID NO 26.

In a specific embodiment, the cytokine IFN- β comprises the amino acid sequence depicted as SEQ ID NO 27.

A recombinant oncolytic virus comprising the above-described M protein; the recombinant oncolytic virus further comprises a G protein; the G protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 12: valine at position 53 to isoleucine (V53I); and/or, alanine at position 141 is mutated to valine (a 141V); and/or aspartic acid at position 172 to tyrosine (D172Y); and/or, a lysine at position 217 is mutated to glutamic acid (K217E); and/or aspartic acid at position 232 to glycine (D232G); and/or valine at position 331 to alanine (V331A); and/or, valine at position 371 is mutated to glutamic acid (V371E); and/or, glycine at position 436 is mutated to aspartic acid (G436D); and/or, threonine at position 438 is mutated to serine (T438S); and/or phenylalanine at position 453 is mutated to leucine (F453L); and/or threonine at position 471 is mutated to isoleucine (T471I); and/or tyrosine at position 487 is mutated to histidine (Y487H).

In a specific embodiment, the site mutation of the G protein comprises a valine to isoleucine (V53I) mutation at position 53.

In a specific embodiment, the site mutation of the G protein comprises a mutation of alanine to valine (a 141V) at position 141.

In a specific embodiment, the site mutation of the G protein comprises an aspartic acid mutation at position 172 to tyrosine (D172Y).

In a specific embodiment, the site mutation of the G protein comprises a lysine mutation at position 217 to glutamic acid (K217E).

In a specific embodiment, the site mutation of the G protein comprises a mutation of aspartic acid at position 232 to glycine (D232G).

In a specific embodiment, the site mutation of the G protein comprises a valine to alanine mutation at position 331 (V331A).

In a specific embodiment, the site mutation of the G protein comprises a valine mutation at position 371 to glutamic acid (V371E).

In a specific embodiment, the site mutation of the G protein comprises a glycine mutation at position 436 to aspartic acid (G436D).

In a specific embodiment, the site mutation of the G protein comprises a threonine to serine mutation at position 438 (T438S).

In a specific embodiment, the site mutation of the G protein comprises a phenylalanine mutation at position 453 to leucine (F453L).

In a specific embodiment, the site mutation of the G protein comprises a threonine at position 471 mutated to isoleucine (T471I).

In a specific embodiment, the site mutation of the G protein comprises a tyrosine mutation at position 487 to histidine (Y487H).

In a specific embodiment, the G protein has an amino acid substitution of V53I.

In a specific embodiment, the G protein has an amino acid substitution of V53I, A141V.

In a specific embodiment, the G protein has an amino acid substitution of V53I, A141V, D Y.

In a specific embodiment, the G protein has an amino acid substitution of V53I, A141V, D172Y, K217E.

In a specific embodiment, the G protein has an amino acid substitution of V53I, A141V, D172Y, K217E, D G.

In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A.

In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E.

In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D.

In a specific embodiment, the G protein has the amino acid substitution of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S.

In a specific embodiment, the G protein has the amino acid substitution V53I, A141V, D Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L.

In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T I.

In a specific embodiment, the G protein has the amino acid substitutions V53I, A141V, D Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of a141V, D172Y, K217E, D G, V331A, V371E, G436D, T438S, F L, T471I, Y487H.

In a specific embodiment, the G protein has an amino acid substitution of D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has an amino acid substitution of K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of V371E, G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of G436D, T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of T438S, F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of F453L, T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of T471I, Y487H.

In a specific embodiment, the G protein has amino acid substitutions of Y487H.

In this application, wild-type VSV virus Indiana MuddSummer subtype G protein comprises the amino acid sequence shown in SEQ ID NO 12.

In a specific embodiment, the G protein has the amino acid sequence shown in SEQ ID NO 13.

A recombinant oncolytic virus comprising the above M protein, or the above M protein and G protein; the recombinant oncolytic virus further comprises an N protein; the N protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 14: isoleucine at position 14 to valine (I14V); and/or, arginine at position 155 is mutated to lysine (R155K); and/or, serine at 353 is mutated to asparagine (S353N).

In a specific embodiment, the site mutation of the N protein comprises a mutation of isoleucine at position 14 to valine (I14V).

In a specific embodiment, the site mutation of the N protein comprises an arginine mutation at position 155 to lysine (R155K).

In a specific embodiment, the site mutation of the N protein comprises a serine mutation at position 353 to asparagine (S353N).

In a specific embodiment, the N protein has amino acid substitutions of I14V.

In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K.

In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K, S353N.

In a specific embodiment, the N protein has an amino acid substitution of R155K, S353N.

In a specific embodiment, the N protein has an amino acid substitution of S353N.

In this application, wild-type VSV virus Indiana MuddSummer subtype N protein comprises the amino acid sequence shown in SEQ ID NO 14.

In a specific embodiment, the N protein comprises the amino acid sequence shown as SEQ ID NO 15.

A recombinant oncolytic virus comprising the above-described M protein; or the M protein and the G protein; or the M protein, G protein and N protein described above; the recombinant oncolytic virus further comprises a P protein; the P protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 16: arginine at position 50 is mutated to lysine (R50K); and/or valine at position 76 to alanine (V76A); and/or asparagine at position 99 to glutamic acid (D99E); and/or, leucine at position 126 is mutated to serine (L126S); and/or, leucine at position 140 is mutated to serine (L140S); and/or, the histidine at position 151 is mutated to tyrosine (H151Y); and/or, isoleucine at position 168 is mutated to methionine (I168M); and/or, lysine at position 170 is mutated to glutamic acid (K170E); and/or, tyrosine at position 189 is mutated to serine (Y189S); and/or asparagine at position 237 is mutated to aspartic acid (N237D).

In a specific embodiment, the site mutation of the P protein comprises an arginine mutation at position 50 to lysine (R50K).

In a specific embodiment, the site mutation of the P protein comprises a valine to alanine mutation at position 76 (V76A).

In a specific embodiment, the site mutation of the P protein comprises an asparagine mutation at position 99 to glutamic acid (D99E).

In a specific embodiment, the site mutation of the P protein comprises a leucine to serine mutation at position 126 (L126S).

In a specific embodiment, the site mutation of the P protein comprises a leucine to serine mutation at position 140 (L140S).

In a specific embodiment, the site mutation of the P protein comprises a histidine mutation at position 151 to tyrosine (H151Y).

In a specific embodiment, the site mutation of the P protein comprises a mutation of isoleucine at position 168 to methionine (I168M).

In a specific embodiment, the site mutation of the P protein comprises a lysine mutation at position 170 to glutamic acid (K170E).

In a specific embodiment, the site mutation of the P protein comprises a tyrosine mutation at position 189 to serine (Y189S).

In a specific embodiment, the site mutation of the P protein comprises an asparagine mutation at position 237 to aspartic acid (N237D).

In a specific embodiment, the P protein has an amino acid substitution of R50K.

In a specific embodiment, the P protein has an amino acid substitution of R50K, V a.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D E.

In a specific embodiment, the P protein has an amino acid substitution of R50K, V76A, D99E, L126S.

In a specific embodiment, the P protein has an amino acid substitution of R50K, V76A, D E, L126S, L S.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D E, L126S, L140S, H151Y.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D3599E, L126S, L140S, H151Y, I168M.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D3599E, L126S, L140S, H151Y, I168M, K170E.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D3599E, L126S, L140S, H151Y, I168M, K170E, Y S.

In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of V76A, D99E, L126S, L S, H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of D99E, L126S, L E, Y S, H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of L140S, H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of H151Y, I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has amino acid substitutions of I168M, K170E, Y189S, N237D.

In a specific embodiment, the P protein has an amino acid substitution of K170E, Y189S, N237D.

In a specific embodiment, the P protein has an amino acid substitution of Y189S, N237D.

In a specific embodiment, the P protein has an amino acid substitution of N237D.

In this application, wild-type VSV virus Indiana MuddSummer subtype P protein comprises the amino acid sequence shown in SEQ ID NO 16.

In a specific embodiment, the N protein comprises the amino acid sequence shown as SEQ ID NO 17.

A recombinant oncolytic virus comprising the above-described M protein; or the M protein and the G protein; or the M protein, G protein and N protein described above; or the M protein, G protein, N protein and P protein; the recombinant oncolytic virus further comprises an L protein; the L protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 18: serine at position 87 is mutated to proline (S87P); and/or, isoleucine at position 487 is mutated to threonine (I487T).

In a specific embodiment, the site mutation of the L protein comprises a serine to proline mutation at position 87 (S87P).

In a specific embodiment, the site mutation of the L protein comprises a mutation of isoleucine at position 487 to threonine (I487T).

In a specific embodiment, the L protein has an amino acid substitution of S87P, I487T.

In this application, wild-type VSV virus Indiana MuddSummer subtype L protein comprises the amino acid sequence shown in SEQ ID NO 18.

In a specific embodiment, the L protein comprises the amino acid sequence shown as SEQ ID NO 19.

In some specific embodiments, the recombinant oncolytic virus is obtained after site-directed mutagenesis based on a rhabdovirus.

In some specific embodiments, the recombinant oncolytic virus is obtained after site-directed mutagenesis based on Vesicular Stomatitis Virus (abbreviated "VSV") virus.

In some specific embodiments, the recombinant oncolytic virus is obtained after site-directed mutagenesis based on the VSV virus Indiana MuddSummer subtype.

In some specific embodiments, the recombinant oncolytic virus further comprises or expresses an exogenous protein of interest.

In some specific embodiments, the recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with the site mutation, and/or a nucleic acid sequence encoding the G protein with the site mutation, and/or a nucleic acid sequence encoding the N protein with the site mutation, and/or a nucleic acid sequence encoding the P protein with the site mutation, and/or a nucleic acid sequence encoding the L protein with the site mutation, and a nucleic acid sequence encoding the cytokine.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having the site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein with a site mutation, the nucleic acid sequence encoding the N protein with a site mutation, or the nucleic acid sequence encoding the P protein with a site mutation and the nucleic acid sequence encoding the L protein with a site mutation.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding a cytokine is located between the nucleic acid sequence encoding the G protein having the site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein with the site mutation, the nucleic acid sequence encoding the N protein with the site mutation, or the nucleic acid sequence encoding the P protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the site-mutated L protein.

In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding a cytokine is located between the nucleic acid sequence encoding the site-mutated G protein and the nucleic acid sequence encoding an antigen.

In a second aspect, the present application provides a recombinant oncolytic virus expression vector, which adopts the following technical scheme:

a recombinant oncolytic virus expression vector capable of expressing the recombinant oncolytic virus described above.

In a third aspect, the present application provides a virus-producing cell, which adopts the following technical scheme:

a virus-producing cell capable of producing the recombinant oncolytic virus described above.

In a fourth aspect, the present application provides a vaccine, which adopts the following technical scheme:

a vaccine prepared using the recombinant oncolytic virus described above.

In a fifth aspect, the present application provides a pharmaceutical composition, which adopts the following technical scheme:

a pharmaceutical composition comprising the recombinant oncolytic virus described above, or the vaccine described above, and optionally a pharmaceutically acceptable carrier.

In a sixth aspect, the present application provides methods for preparing the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine, and the pharmaceutical composition.

In a seventh aspect, the present application provides the use of the recombinant oncolytic virus described above, the recombinant oncolytic virus expression vector described above, the virus-producing cell described above, the vaccine described above, the pharmaceutical composition described above for the manufacture of a medicament for the prevention and/or treatment of diseases and/or disorders.

In some specific embodiments, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine, and/or the pharmaceutical composition are used in a method of sustained killing of an abnormally proliferative cell.

In some specific embodiments, the aberrant proliferative cell is selected from a tumor cell or a cell associated with a tumor tissue.

In an eighth aspect, the present application provides the use of the recombinant oncolytic virus, the vaccine, the pharmaceutical composition described above for the preparation of a medicament for the treatment of a tumor.

In some specific embodiments, the tumor comprises a solid tumor or a hematological tumor.

In some embodiments of the present invention, in some embodiments, such tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-hodgkin's lymphoma, anal carcinoma, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder carcinoma, breast carcinoma, cervical carcinoma, chronic myeloproliferative neoplasm, colorectal carcinoma, endometrial carcinoma, ependymoma, esophageal carcinoma, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, ewing's sarcoma, fallopian tube carcinoma, gall bladder carcinoma, gastric carcinoma, gastrointestinal carcinoid, hepatocellular carcinoma, hypopharyngeal carcinoma, kaposi's sarcoma, renal carcinoma, langerhans' cell hyperplasia, laryngeal carcinoma, liver carcinoma, lung carcinoma, melanoma, mercker cell carcinoma, mesothelioma, oral carcinoma, neuroblastoma, non-small cell lung carcinoma, osteosarcoma, ovarian carcinoma, pancreatic adenocarcinoma, pancreatic neuroendocrine tumor, pharyngeal carcinoma, pituitary carcinoma, prostate carcinoma, rectal carcinoma, renal cell carcinoma, retinoblastoma, skin carcinoma, small cell lung carcinoma, small intestine carcinoma, squamous carcinoma, testicular carcinoma, breast carcinoma, thyroid carcinoma, and vascular carcinoma.

In summary, the present application has the following beneficial effects:

the recombinant oncolytic virus provided by the application has better in-vitro killing capacity on abnormal proliferation (tumor) LLC cells, and is not easy to clear in LLC cells. In addition, the recombinant oncolytic viruses provided by the application have poor in-vitro killing capacity on normal MEF cells, and are easy to clear in the normal MEF cells. Therefore, the recombinant oncolytic virus provided by the application can be better used for infecting and killing cells such as tumors and cancers, is not easy to clear in the cells such as the tumors and the cancers, and further improves the cure rate of the recombinant oncolytic virus to the cells such as the tumors and the cancers; meanwhile, the recombinant oncolytic virus provided by the invention can not damage normal cells, is easier to clear in normal cells, and further ensures the safety of the normal cells.

Drawings

FIG. 1 shows the results of the in vitro killing ability of LLC cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 1-50 and 121-130 of the present application.

FIG. 2 shows the results of the in vitro killing ability of MEF cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 1-50 and 121-130 of the present application.

FIG. 3 shows the results of the in vitro killing ability of LLC cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 51-120 of the present application.

FIG. 4 shows the results of the in vitro killing ability of MEF cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 51-120 of the present application.

FIG. 5 shows the induction of IFN- β expression in LLC cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 1-50 and 121-130 of the present application.

FIG. 6 shows the induction of IFN- β expression in MEF cells by recombinant oncolytic viruses prepared in preparation examples 1-50, 121-130 of the present application.

FIG. 7 shows the induction of IFN- β expression in LLC cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 51-120 of the present application.

FIG. 8 shows the induction of IFN- β expression in MEF cells by recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 51-120 of the present application.

In the above figures, the number 0 on the abscissa represents the wild-type oncolytic virus; the abscissa numbers 1 to 130 represent the recombinant oncolytic viruses prepared in preparation examples 1 to 130, respectively.

The ordinate OD570 represents the OD value of the cell, and the larger the value of OD570, the worse the killing ability of the recombinant oncolytic virus to the cell; the smaller the value of OD570, the better the killing ability of the cell by the recombinant oncolytic virus.

The ordinate IFN- β level indicates the expression of the IFN- β gene, and the greater the value of the IFN- β level, the weaker the reproductive capacity of the recombinant oncolytic virus in the cell, and the easier the clearance; the smaller the value of IFN- β levels, the more productive the recombinant oncolytic virus is in the cell, the less susceptible it is to clearance.

Other aspects and advantages of the present application will become readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present application are shown and described in the following detailed description. As those skilled in the art will recognize, the present disclosure enables one skilled in the art to make modifications to the disclosed embodiments without departing from the spirit and scope of the invention as described herein. Accordingly, the drawings and descriptions herein are to be regarded as illustrative in nature and not as restrictive.

Detailed Description

Further advantages and effects of the invention of the present application will be readily apparent to those skilled in the art from the disclosure of the present application by describing embodiments of the invention with specific examples.

Definition of terms

In this application, the term "oncolytic virus" generally refers to a virus that is capable of replicating in and killing tumor cells. Oncolytic viruses include, but are not limited to: vesicular stomatitis virus (Vesicular Stomatitis Virus, abbreviated as "VSV virus"), poxvirus, herpes Simplex Virus (HSV), measles virus, semliki forest virus, poliovirus, reovirus, sain-kagu virus (SVV), enterovirus, coxsackievirus, newcastle Disease Virus (NDV), and maraba virus. In certain embodiments, the oncolytic virus is engineered to increase selectivity for tumor cells. In certain embodiments, the oncolytic virus is engineered to reduce its immunogenicity.

In some embodiments, the oncolytic virus described herein is a VSV virus.

In some embodiments, the VSV virus is a mutant of VSV virus subtype Indiana MuddSummer strain, which may be used to treat tumors. The virus does not interact with endogenous IFN- β in normal cells, but can only selectively amplify and grow in tumor cells.

VSV viruses are capable of expressing a variety of cell surface molecules, including low density lipoprotein receptors, phosphatidylserine, sialyl (sialolipid), and heparan sulfate, and can be attached to cell surfaces by these molecules. Compared to other oncolytic viral platforms currently under development, VSV virus has the following advantages: (1) The genome is small, the replication time is short, and the synapse crossing speed is high; (2) Exogenous genes are extremely high in expression, so they can have high titers, allowing large-scale production; (3) There is an independent cell cycle and there is no risk of transformation in the cytoplasm of the host cell. The oncolytic virus can not be integrated into DNA, and can avoid nervous system inflammation caused by wild virus after attenuation. In view of the above characteristics, VSV has great potential in tumor immunotherapy.

In some embodiments, site-directed gene mutations may be made to the M protein, and/or G protein, and/or N protein, and/or P protein, and/or L protein of VSV virus.

In certain embodiments, the recombinant oncolytic viruses described herein may be genetically engineered oncolytic viruses, such as modified by one or more genetic modifications, to increase their tumor selectivity and/or preferential replication in dividing cells. The modification of the gene level can be modification of genes involved in DNA/RNA replication, nucleic acid metabolism, host tropism, surface adhesion, virulence, cleavage and diffusion processes, or modification of integration of exogenous genes. The exogenous genes may include exogenous immunomodulating genes, exogenous screening genes, exogenous reporter genes, and the like. The engineered oncolytic virus may also be an oncolytic virus engineered at the amino acid level, such as insertions, deletions, substitutions of one or more amino acids.

In this application, the term "M protein" generally refers to VSV viral matrix proteins. The M protein is an important virulence factor of VSV virus and is also a protein known to interfere with the natural immune response of mice in VSV virus. The term "M protein" also includes homologues, orthologs, variants, functionally active fragments and the like thereof. In this application, wild-type VSV virus Indiana MuddSummer subtype M protein may comprise the amino acid sequence shown in SEQ ID NO 1. In the present application, the M protein of the oncolytic virus may comprise the amino acid sequence as shown in SEQ ID NO 2-11.

In the present application, the term "G protein" generally refers to the glycoprotein, also referred to as envelope protein, of VSV virus. The term "G protein" also includes homologues, orthologs, variants, functionally active fragments and the like thereof. In this application, wild-type VSV virus Indiana MuddSummer subtype G protein may comprise the amino acid sequence shown in SEQ ID NO 12. In the present application, the G protein of the oncolytic virus may comprise the amino acid sequence shown as SEQ ID NO 13.

In this application, the term "N protein" generally refers to the nucleocapsid protein of VSV virus. The term "N protein" also includes homologues, orthologs, variants, functionally active fragments and the like thereof. In this application, wild-type VSV virus Indiana MuddSummer subtype N protein may comprise the amino acid sequence shown as SEQ ID NO 14. In the present application, the N protein of the oncolytic virus may comprise the amino acid sequence as shown in SEQ ID NO 15.

In this application, the term "P protein" generally refers to the phosphoprotein of VSV virus. The term "protein P" also includes homologues, orthologs, variants, functionally active fragments and the like thereof. In this application, wild-type VSV virus Indiana MuddSummer subtype P protein may comprise the amino acid sequence shown as SEQ ID NO 16. In the present application, the P protein of the oncolytic virus may comprise the amino acid sequence as shown in SEQ ID NO 17.

In this application, the term "L protein" generally refers to VSV viral RNA polymerase protein. The L gene of VSV virus encodes an RNA poly E protein. The term "L protein" also includes homologues, orthologs, variants, functionally active fragments and the like thereof. In this application, wild-type VSV virus Indiana MuddSummer subtype L protein may comprise the amino acid sequence shown as SEQ ID NO 18. In the present application, the L protein of the oncolytic virus may comprise the amino acid sequence as shown in SEQ ID NO 19.

In the present application, the expression of a protein mutation site is generally expressed by "amino acid+number of amino acid positions+amino acid after mutation". In the present application, the mutations may include, but are not limited to, amino acid additions, substitutions, deletions and/or deletions. For example, the term "M51R" generally refers to a mutation of methionine M at position 51 to arginine R.

In the present application, the term "amino acid substitution" generally refers to the replacement of one amino acid residue present in a parent sequence with another amino acid residue. Amino acids in the parent sequence may be substituted, for example, via chemical synthesis or by recombinant methods known in the art. Thus, "substitution at a xx position" generally refers to the substitution of an amino acid present at position xx with an alternative amino acid residue. In the present application, the amino acid substitutions may include amino acid mutations.

In the present application, the term "mutation" generally refers to an alteration of the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include substitutions, deletions, insertions, additions, truncations, or processing or cleavage of the protein.

In the present application, the recombinant oncolytic virus integrates a foreign gene while site-directed gene mutation is performed on the M protein, and/or G protein, and/or N protein, and/or P protein, and/or L protein of VSV virus. The exogenous gene is specifically a gene encoding a cytokine.

In the present application, the term "antigen" refers to a substance that causes the production of antibodies or immune cells, and is any substance that can induce an immune response in the body. I.e., a substance that is specifically recognized and bound by antigen receptors (TCR/BCR) on the surface of T/B lymphocytes, activates T/B cells, proliferates and differentiates them, generates immune response products (sensitized lymphocytes or antibodies), and specifically binds to the corresponding products in vivo and in vitro. Thus, the antigenic substance possesses two important properties: immunogenicity (immunogenicity) and immunoreactivity (immunoreactivity). Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body to produce antibodies and/or sensitized lymphocytes; immunoreactivity refers to the ability to specifically bind to a corresponding immune effector substance (antibody or sensitized lymphocyte) in vivo or in vitro.

In a specific embodiment, the oncolytic virus is engineered to carry a coding sequence for an antigen that can be recognized by CAR T cells.

In some specific embodiments, the antigen is exogenous, meaning that the antigen is from a different species.

In some specific embodiments, the antigen is an endogenous antigen. In particular, the antigen is an antigen that is normally expressed on tumor cells.

In a specific embodiment, the antigen is a tumor associated antigen (Tumor Associated Antigen: TAA) or a tumor specific antigen (Tumor Specific Antigen: TSA).

In a specific embodiment, the TAA or TSA encompasses a molecule or portion thereof that is presented on the surface of a cell or is present in a tumor environment (e.g., in a tumor microenvironment).

In some specific embodiments, the cell is a tumor cell.

In some specific embodiments, the TAA or TSA comprises a tumor-associated antigen or a tumor-specific antigen on the cell surface or within the cell membrane.

In some specific embodiments, the cell is a non-tumor cell present in a tumor environment. Such as, but not limited to, cells present in the vasculature tissue associated with a tumor or cancer.

In some specific embodiments, the TAA or TSA is an antigen of angiogenesis in a tumor microenvironment.

In some specific embodiments, the TAA or TSA is an antigen on a blood vessel in a tumor microenvironment.

In some specific embodiments, the cell is a stromal cell present in the tumor environment.

In some specific embodiments, the TAA or TSA is a stromal cell antigen in a tumor microenvironment.

In some embodiments, the TAA or TSA comprises an extracellular epitope of a tumor cell surface antigen, a tetramer inside and outside of a tumor cell membrane, or other structure that is recognized by an antibody or immune cell.

In some specific embodiments, the TAA or TSA comprises an extracellular matrix antigen.

In some specific embodiments, the TAA or TSA comprises an antigen present in a Tumor Microenvironment (TME).

In some specific embodiments, the TAA or TSA comprises a molecule secreted into the TME by a tumor cell.

In some specific embodiments, the TAA or TSA comprises an effector molecule secreted into the TME by a tumor cell.

In some specific embodiments, the TAA or TSA comprises an effector molecule secreted by a tumor cell into the TME to down-regulate or inhibit the activity of a cytotoxic Natural Killer (NK) cell or T cell.

In some specific embodiments, the TAA or TSA comprises a soluble activating receptor ligand secreted by a tumor cell into the TME to block NK cell or T cell recognition of the tumor cell.

In some specific embodiments, examples of TAAs or TSAs include, but are not limited to, 5T4, RORl, EGFR, fc γri, fcγriia, fcγriib, fcγriiia, fcγriiib, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2aR, fibroblast growth factor receptor 1 (FGFR 1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) proteins, lymphotoxin- β receptor (ltβr), toll-like receptor (TLR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) proteins, prostate Stem Cell Antigen (PSCA) proteins, tumor-related protein Carbonic Anhydrase IX (CAIX), growth factor receptor 1 (EGFR 1), EGFRvIII, human epidermal growth factor receptor 2 (Her 2/neu; erb 2), erbB3 (Her 3), folate receptor, ephrin receptor, PDGFRa, erbB2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, cMet (tyrosine protein kinase Met), a Hepatocyte Growth Factor Receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA-A, NY-ESO-1, BRCA1, GAGE-3, GAGE-2, GAGE-35, GAGE-6, GAGE-35, BRCA1, GAGE-2, GAGE-35, GAGE-ESO-1, GAGE-2, GAGE-35, GAGE-6, and GAGE-6, BRCA2, MART-1, MC1R, gp100, PSA, PSM, tyrosinase, wilms tumor antigen (WT 1), TRP-1, TRP-2, ART-4, CAMEL, cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, P-cadherin, myostatin (GDF 8), cripto (TDGF 1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, beta-catenin/m, caspase-8/m, CDK-4/m, ELF2M, gnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1 MUM-2, MUM-3, myoglobin/m, RAGE, SART-2, TRP-2/INT2, 707-AP, annexin II, CDC27/m, TPI/mbcr-abl, ETV6/AML, LDLR/FUT, pml/RARα, TEL/AML1, CD28, CD137, canag, mesothelin, DR5, PD-1, PD-L1, HER-2, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycans, ephA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2 or VEGF-R2.

In this application, the term "cytokines" (cytokins) is a biologically active substance synthesized and secreted by immune cells (lymphocytes, monocytes macrophages, etc.) and their associated cells (vascular endothelial cells, fibroblasts, etc.) that modulates the function of other immune cells or target cells, belonging to small molecule polypeptides or glycoproteins. Cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. According to its main functions, cytokines are divided into: interleukin (IL), interferon (IFN), tumor necrosis factor (tumor necrosis factor, TNF), colony stimulating factor (colony stimulating factor, CSF), transforming growth factor-beta family (transforming growth factor-beta family), growth Factor (GF), chemokine family (chemokine family).

Interleukin includes IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, IL-18.

Specifically, interleukin 1 (IL-1): IL-1 is a pleiotropic cytokine, involved in inflammatory response of the cortex, cell growth and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, IL-18, and the like. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 stimulates proliferation of CD4+ T cells in vitro, induces IL-2 production, co-stimulates CD8+/IL1R+ T cell activation, and stimulates proliferation of mature B cells and secretion of immunoglobulins.

Specifically, interleukin 2 (IL-2): IL-2, also known as a T cell growth factor, produced by T cells in response to antigens or mitotic stimuli, is widely used to promote activation and proliferation of T cells and NK cells. IL-2 is capable of stimulating NK cell proliferation, increasing cytotoxicity and stimulating NK cells to secrete a variety of cytokines. However, further studies have found that IL-2 can cause T-cell excessive differentiation and induce apoptosis of activated T-cells, and can activate CD4+FoxP3 Treg regulatory cells, thereby inhibiting activation of T-cells and tumor killing activity, and thus IL-2 is considered to be a T-cell regulator rather than an activator alone, so that the current studies have replaced IL-2 with IL-7, IL-15, and IL-21.

Specifically, interleukin 7 (IL-7): IL-7 belongs to a hematopoietic growth factor, is secreted by stromal cells in the bone marrow and thymus, shares the yc receptor subunit with IL-2, and stimulates the proliferation of lymphoprogenitors. IL-7 may beT cells and memory T cells provide a sustained stimulation signal. As described above, IL-7 does not activate CD4+FoxP3+ Treg cells during activation of CD8+ T cells. Clinically, IL-7 alsoCan be used for the recovery of T cell number after chemotherapy or hematopoietic stem cell transplantation. And IL-7 plays an important role in some stages of B cell maturation, which can affect proliferation. IL-7 can also act as a regulator of intestinal mucosal lymphocytes.

Specifically, interleukin 15 (IL-15): IL-15 has a similar structure to IL-2 and shares the yc receptor subunit, belonging to the family of 4 alpha-helix bundles (others such as IL-2, IL-4, IL-7, IL-9,G-CSF and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 primarily kills virus-infected cells in the innate immune system. IL-15 also activates NKT cells and γδ T cells. In immune cell therapy, IL-15 does not cause apoptosis of activated T cells, activating CD8+ effector T cells. IL-15 maintains memory T cell survival and thus plays an important role in long-term antitumor activity.

Specifically, interleukin 21 (IL-21): IL-21 belongs to the IL-2 family, shares the gamma c receptor subunit, has strong regulation function on cells of an immune system, and can induce cell division and proliferation in target cells. In cellular immunotherapy, IL-21 can promote proliferation of CD4+ and CD8+ T cells, enhance cytotoxicity of CD8+ T cells and NK cells, and prevent apoptosis caused by activation. IL-21 preferentially expands "young" CD27+CD28+ CD8+ T cells, which are more cytotoxic. Of course, IL-21 does not cause Treg expansion, and therefore, IL-21 is increasingly used in cellular immunotherapy.

Specifically, interleukin 4 (IL-4): IL-4 activates proliferation of activated B cells and T cells, regulating Fc receptor expression on lymphocytes and monocytes. IL-4 induces the transformation of Th1 cells into Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10 and IL-13.IL-4 directs the differentiation of monocytes toward DC by inhibiting the growth of macrophages. Monocytes will differentiate into macrophages without IL-4 in the culture system. IL-4 plays a key role in regulating humoral and adaptive immunity, inducing B cell antibody class switching to IgE, up-regulating the production of MHC class II molecules. IL-4 and GM-CSF act together to direct differentiation of monocytes into immature DCs where DCs have greater antigen uptake and processing capacity but less antigen presentation capacity and IL-4 and TNF- α use in sequence can promote DC maturation.

Specifically, interleukin 12 (IL-12): IL-12 acts on activated T and NK cells, has a broad range of biological activities, acting on lymphocytes through activator mediation of the transcriptional protein STAT 4. IL-12 is essential for the T cell independent induction of IFN-gamma and has an important role in the differentiation of Th1 and Th2 cells. IL12B binds IL23A to form IL-23 interleukins, which have innate and adaptive immune functions. IL-12 belongs to the drug target. In cellular immunotherapy, IL-12 promotes differentiation of CD4+ T cells into CD4+ Th 1T cells, enhancing CD8+ CTLs cell activity. The therapeutic effects of IL-12 are related to its dose, duration of action, and other interacting cytokines, etc., which promote tumor killing activity of immune cells through a variety of mechanisms. In the mouse anti-melanoma model, high doses of IL-12 act through NK cells, while low doses of IL-12 act through NKT to kill tumors.

Specifically, interleukin 18 (IL-18): IL-18, also known as an interferon-gamma inducer, is a pro-inflammatory cytokine produced by macrophages and other cells. IL-18 can stimulate NK cells and CD8+ T cells to secrete IFN-gamma, enhancing the cytotoxic effect of NK cells and CD8+ T cells. IL-18 also activates macrophages, promotes the development of Th1 CD4+ T cells, and promotes the expression of FasL by lymphocytes. IL-18 may provide a potential therapeutic target for allergic diseases. In addition, IL-18, IL-12 and IL-15 synergy can maintain Th1 responses and monokine production in autoimmune diseases.

Gamma interferon belongs to type II interferon, is mainly produced by NK and NKT cells, and has antiviral, antitumor and immunoregulatory effects, including IFN- γ, IFN- β. IFN-gamma has antiproliferative effect on transformed cells, and can enhance antiviral and antitumor effects of type I interferon. IFN-gamma induces MHC I, MHC II and coactivator expression on Antigen Presenting Cells (APCs) by activating macrophages. In addition, IFN-gamma can induce changes in expression of proteasome to enhance antigen presentation. IFN-gamma can also promote differentiation of CD4+ T cells into Th1 cells, repressing IL-4 dependent B cell subtype switching. IFN-gamma activates the JAK-STAT cellular pathway by phosphorylating the JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-gamma acts on host immune cells, and has certain effects on macrophages, T cells, B cells, NK cells and the like. IFN-gamma enhances antigen presenting capacity by promoting the expression of MHC class II molecules by macrophages, or by allowing certain cells that normally do not express MHC class II molecules (e.g., vascular endothelial cells, certain epithelial cells, and connective tissue cells) to express MHC class II molecules. IFN-gamma can promote differentiation of B cells and CD8+ T cells, but cannot promote proliferation thereof. IFN-gamma can enhance the activity and immune function of TH1 cells. IFN-gamma enhances neutrophil phagocytic capacity and activates NK cells, enhancing their cytotoxic effects. IFN-gamma expression abnormalities are associated with a number of auto-inflammatory and autoimmune diseases.

Tumor necrosis factor belongs to TNF superfamily cytokines, and is a multifunctional molecule for biological process regulation, including cell proliferation, differentiation, apoptosis, lipid metabolism, coagulation, etc. TNF-alpha is involved in anti-tumor. In cellular immunotherapy, TNF- α differentiates immature DCs into mature DCs. This is accomplished by TNF- α down-regulating megacytosis of immature DCs and expression of surface Fc receptors, up-regulating expression of cell surface MHC class I, class II molecules and B7 family molecules (CD 80, CD86, etc.). Mature DCs have significantly reduced antigen uptake and processing capacity, but significantly enhanced antigen presentation capacity, and can activate T cells very strongly. TNF- α can also affect the production of other cytokines, such as stimulating IL-1 secretion by monocytes and macrophages, enhancing IL-2 dependent thymocytes, T cell proliferation, promoting the production of lymphokines such as IL-2, CSF and IFN- γ, enhancing proliferation and Ig secretion by mitogens or foreign antigens stimulating B cells.

Granulocyte macrophage colony-stimulating factor (GM-CSF) has a key role in embryo transfer and development. GM-CSF is one of the earliest cytokines found to be active on DCs. In DC culture, GM-CSF promotes differentiation of monocytes into megaloblastic-like cells, promoting expression of MHC class II molecules on the cell surface, and thus enhancing antigen presenting function of the cells. In addition, GM-CSF can also promote survival of DCs. In cellular immunotherapy, GM-CSF can activate immune responses, generating antitumor activity by activating macrophages and DCs. In terms of antigen presentation, GM-CSF can promote DC cell maturation, promote costimulatory molecule up-regulation and CD1d receptor expression. Recent studies have found that GM-CSF stimulates hematopoietic progenitor cells to differentiate into monocytes and neutrophils, thereby reducing the risk of febrile neutropenia in cancer patients. Also, it has been demonstrated that GM-CSF can induce differentiation of bone marrow DCs, promote Th1 cell biased immune responses, promote angiogenesis, and affect development of allergic inflammation and autoimmune diseases. Thus, GM-CSF is used clinically to treat malignant tumors.

In the present application, the term "nucleic acid molecule" generally refers to nucleotides of any length. In the present application, the term "nucleic acid molecule" may encode a protein comprised by said oncolytic virus. In the present application, the nucleic acid molecule may comprise DNA and/or RNA. In some cases, the RNA may comprise single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA may comprise sense RNA or antisense RNA (anti-sense RNA) or antisense RNA.

In this application, the term "expression vector" generally refers to a nucleic acid vector. Under appropriate conditions, it is generally capable of expressing the gene of interest and/or the protein of interest. In certain embodiments of the present application, the expression vector comprises a nucleic acid molecule for expressing one or more components of a virus (e.g., an oncolytic virus). For example, the expression vector may include at least one viral genomic element and may be packaged into a virus or packaged as a viral particle.

In the present application, the term "virus-producing cell" generally refers to a cell, cell line or cell culture that may or may already contain a nucleic acid molecule or expression vector comprising or capable of expressing a recombinant oncolytic virus as described herein. The cell may comprise progeny of a single host cell. The cells may be obtained by transfection in vitro using the expression vectors described herein.

In the present application, the term "pharmaceutical composition" generally refers to a formulation which is present in a form which allows the biological activity of the active ingredient to be effective, and which does not contain additional ingredients which are unacceptably toxic to the subject to which the formulation is to be administered. In certain embodiments, these formulations may comprise an active component of a drug and a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical product comprises a pharmaceutical product for parenteral, transdermal, endoluminal, intra-arterial, intrathecal and/or intranasal administration or direct injection into tissue. The pharmaceutical product may be administered by different means, for example intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intratissue.

In the present application, the term "prevention" generally refers to the prevention of the occurrence and onset, recurrence, and/or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treating" generally refers to the elimination or amelioration of a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment is generally directed to the administration of one or more drugs to a patient suffering from such a disease such that the disease is eliminated or alleviated. In certain embodiments, "treating" may be administering the pharmaceutical combination and/or pharmaceutical product with or without the presence of other drugs after onset of symptoms of the particular disease. For example, the use of the pharmaceutical combinations and/or pharmaceutical products described herein prevents the development, progression, recurrence and/or metastasis of tumors.

In this application, the term "tumor" generally refers to any new pathological tissue proliferation. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and/or a hematological tumor. For research, these tissues may be isolated from readily available sources by methods well known to those skilled in the art.

In some specific embodiments, the tumor includes, but is not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-hodgkin's lymphoma, anal carcinoma, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder carcinoma, breast carcinoma (BRCA), cervical carcinoma, chronic myeloproliferative neoplasm, colorectal carcinoma, endometrial carcinoma, ependymoma, esophageal carcinoma, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, ewing's sarcoma, fallopian tube carcinoma, gall bladder carcinoma, gastric carcinoma, gastrointestinal carcinoid, hepatocellular carcinoma, hypopharynx carcinoma, kaposi's sarcoma, kidney carcinoma, langerhans ' cell hyperplasia, laryngeal carcinoma, liver carcinoma, lung carcinoma, melanoma, merker's cell carcinoma, mesothelioma, oral carcinoma, neuroblastoma, non-small cell lung carcinoma, osteosarcoma, ovarian carcinoma, pancreatic neuroendocrine tumor, pharyngeal carcinoma, prostate carcinoma, rectal carcinoma, renal cell carcinoma, retinoblastoma, skin carcinoma, small cell lung carcinoma, testicular carcinoma, small cell carcinoma, testicular carcinoma, thyroid carcinoma, squamous carcinoma, uterine carcinoma, carcinoma.

Detailed Description

A wild-type VSV virus, specifically the Indiana strain of VSV virus, subtype Indiana MuddSummer strain of VSV virus. The amino acid sequence of the M protein is shown in SEQ ID NO 1; the amino acid sequence of the G protein is shown as SEQ ID NO 12; the amino acid sequence of the N protein is shown as SEQ ID NO 14; the amino acid sequence of the P protein is shown as SEQ ID NO 16; the amino acid sequence of the L protein is shown as SEQ ID NO 18. In the present application, the M protein, G protein, N protein, P protein, L protein may be modified.

An oncolytic virus obtained by mutating the amino acid sequence of M protein, G protein, N protein, P protein, L protein of the wild type VSV virus.

The present application provides a recombinant oncolytic virus. The recombinant oncolytic virus is obtained by introducing exogenous genes encoding antigens on the basis of the oncolytic virus.

The recombinant oncolytic virus comprises M protein and an antigen coded by a foreign gene; compared with the amino acid sequence shown in SEQ ID NO 1, the M protein comprises the following site mutations: methionine at position 51 to arginine (M51R); valine at position 221 to phenylalanine (V221F); serine at position 226 is mutated to arginine (S226R).

Further, the recombinant oncolytic virus is obtained by introducing a foreign gene encoding an antigen based on the recombinant oncolytic virus.

Further, the antigen is selected from the group consisting of hematological cancers and solid tumors.

Further, the solid tumors include, but are not limited to, 5T4, RORl, EGFR, fc γri (CD 64), fcγriia (CD 32 a), fcγriib (CD 32 b), CD28, CD137 (4-1 BB), CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2aR, fibroblast growth factor receptor 1 (FGFR 1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) proteins, lymphotoxin- β receptor (ltβr), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate Specific Membrane Antigen (PSMA) proteins, prostate Stem Cell Antigen (PSCA) proteins, tumor-related protein Carbonic Anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR 1), EGFRvIII, human epidermal growth factor receptor 2 (Her 2/neu; erb 2), erb 3 (HER 3), folate receptor, ephrin receptor, PDGFRa, erbB-2, CD40, CD74, CD80, CD86, CCAM5 (CD 66 e), CCAM6 (CD 66C), p53, cMet (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA-A, NY-ESO-1, BRCA2, MART-1, MC1 62100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myosin (Myostatin) (GDF 8), cripto (TDGF 1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, beta-catenin/m, caspase-8/m, CDK-4/m, ELF2M, gnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin/m, RAGE, SART-2, TRP-2/INT2, 707-AP, annexin II, CDC27/m, TPI/mbcr-abl, ETV 6/RU, LDLR/FUT, pml/RAR alpha, TEL/AML1, CD28, CD137, canAg, mesothelin (MSLN), 5, PD-1, PD-651, neil-95, neil-1, neil-95, NRP-1), glypican (glypican 2/3, GPC 2/3), ephA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP, FOLR1, AXL;

Further, the hematological neoplasms include, but are not limited to, BCMA (TNFRSF 17), CD4, CD5 (Leu-1), CD7, CD10, fcgammaRIIIa (CD 16A), fcgammaRIIIb (CD 16B), CD19, CD20 (MS 4A 1), CD22 (Siglec-2), CD23, CD30 (TNFRSF 8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM 1), CD70, CD117, CD123 (IL 3 RA), CD138 (SDC 1), CD174, CLL-1, ROR1, NKG2DL1/2 (ULBP 1/2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC A, WT1, FLT3, 8 TLR 2, T6A/8581A 1, FLI1, ZF1/3, PI 3-35-Kit, SLF 229, SLAMF3 (CD 319), SLAMK 7, SLAMK 1, SLITK 1, and SLAMB 1.

Further, the cytokine is selected from the group consisting of interleukins, interferons, tumor necrosis factors, colony stimulating factors, transforming growth factor beta, chemokine families, growth factors.

The M protein further comprises one or more of the following site mutations: asparagine at position 32 is mutated to serine (N32S); and/or asparagine at position 49 is mutated to aspartic acid (N49D); and/or, the histidine at position 54 is mutated to tyrosine (H54Y); and/or valine at position 225 to isoleucine (V225I).

The M protein further comprises one or more of the following site mutations: knocking out the 111 th leucine coding base; or, leucine at position 111 is mutated to alanine (L111A).

The M protein further comprises one or more of the following site mutations: glycine at position 21 to alanine (G21E); and/or, methionine at position 33 to alanine (M33A); and/or, alanine at position 133 is mutated to threonine (a 133T). For example: the M protein has an amino acid sequence shown as SEQ ID NO 2-11.

In the present application, the M protein comprises amino acid substitutions at positions 51, 221 and 226.

In the present application, the M protein comprises amino acid substitutions at positions 32, 49, 51, 54, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 32, 49, 51, 54, 111, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 21, 32, 49, 51, 54, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 133, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 32, 33, 49, 51, 54, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 32, 33, 49, 51, 54, 133, 221, 225, 226.

In the present application, the M protein comprises amino acid substitutions at positions 32, 49, 51, 54, 133, 221, 225, 226.

In the present application, the M protein may also comprise amino acid substitutions at other positions.

A recombinant oncolytic virus comprising the M protein described above, the recombinant oncolytic virus further comprising a G protein; the G protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 12: valine at position 53 to isoleucine (V53I); and/or, alanine at position 141 is mutated to valine (a 141V); and/or aspartic acid at position 172 to tyrosine (D172Y); and/or, a lysine at position 217 is mutated to glutamic acid (K217E); and/or aspartic acid at position 232 to glycine (D232G); and/or valine at position 331 to alanine (V331A); and/or, valine at position 371 is mutated to glutamic acid (V371E); and/or, glycine at position 436 is mutated to aspartic acid (G436D); and/or, threonine at position 438 is mutated to serine (T438S); and/or phenylalanine at position 453 is mutated to leucine (F453L); and/or threonine at position 471 is mutated to isoleucine (T471I); and/or tyrosine at position 487 is mutated to histidine (Y487H). For example, the G protein has the amino acid sequence shown in SEQ ID NO 13.

In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

In the present application, the G protein may also comprise amino acid substitutions at other positions.

In certain embodiments, the G protein comprises at least one or more amino acid substitutions in a conserved region. For example, the conserved region may comprise amino acids 437-461 of the G protein. In certain embodiments, the G protein comprises at least one or more amino acid substitutions in a truncated region of the cytoplasmic domain. For example, the truncated region of the cytoplasmic domain may comprise amino acids 483-511 of the G protein.

A recombinant oncolytic virus comprising the above M protein, or the above M protein and G protein; the recombinant oncolytic virus further comprises an N protein; the N protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 14: isoleucine at position 14 to valine (I14V); and/or, arginine at position 155 is mutated to lysine (R155K); and/or, serine at 353 is mutated to asparagine (S353N). For example, the N protein comprises the amino acid sequence shown as SEQ ID NO 15.

In the present application, the N protein may comprise amino acid mutations at positions 14, 155 and 353.

In the present application, the N protein may also comprise amino acid substitutions at other positions.

A recombinant oncolytic virus comprising the above-described M protein; or the M protein and the G protein; or the M protein, G protein and N protein described above; the recombinant oncolytic virus further comprises a P protein; the P protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 16: arginine at position 50 is mutated to lysine (R50K); and/or valine at position 76 to alanine (V76A); and/or asparagine at position 99 to glutamic acid (D99E); and/or, leucine at position 126 is mutated to serine (L126S); and/or, leucine at position 140 is mutated to serine (L140S); and/or, the histidine at position 151 is mutated to tyrosine (H151Y); and/or, isoleucine at position 168 is mutated to methionine (I168M); and/or, lysine at position 170 is mutated to glutamic acid (K170E); and/or, tyrosine at position 189 is mutated to serine (Y189S); and/or asparagine at position 237 is mutated to aspartic acid (N237D). For example, the P protein comprises the amino acid sequence shown as SEQ ID NO 17.

In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170, 189 and 237.

In the present application, the P protein may also comprise amino acid substitutions at other positions.

A recombinant oncolytic virus comprising the above-described M protein; or the M protein and the G protein; or the M protein, G protein and N protein described above; or the M protein, G protein, N protein and P protein; the recombinant oncolytic virus further comprises an L protein; the L protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 18: serine at position 87 is mutated to proline (S87P); and/or, isoleucine at position 487 is mutated to threonine (I487T). For example, the L protein comprises the amino acid sequence shown as SEQ ID NO 19.

In the present application, the P protein may comprise amino acid mutations at positions 87 and 487.

The recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with the site mutation, and/or a nucleic acid sequence encoding the G protein with the site mutation, and/or a nucleic acid sequence encoding the N protein with the site mutation, and/or a nucleic acid sequence encoding the P protein with the site mutation, and/or a nucleic acid sequence encoding the L protein with the site mutation, and a nucleic acid sequence encoding the cytokine.

Further, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having the site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

Further, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein with the site mutation, the nucleic acid sequence encoding the N protein with the site mutation, or the nucleic acid sequence encoding the P protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.

Further, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having the site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

Further, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein with the site mutation, and/or the nucleic acid sequence encoding the N protein with the site mutation, and/or the nucleic acid sequence encoding the P protein with the site mutation, and/or the nucleic acid sequence encoding the L protein with the site mutation.

Further, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the site-mutated L protein.

Further, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the site-mutated G protein and the nucleic acid sequence encoding the antigen.

In the present application, the recombinant oncolytic viruses described herein can be obtained by a viral packaging process and a viral rescue process. The specific process may include inoculation of BSR-T7 cells with poxvirus vTF7-3 expressing T7 RNA polymerase, lipofectamine transfection with expression plasmids and backbone plasmids, which clone the VSV N, VSV P, VSV L genes, respectively, to obtain the oncolytic virus of interest.

The present application also provides a recombinant oncolytic viral expression vector, a viral producer cell, a vaccine and a pharmaceutical composition.

The recombinant oncolytic virus expression vector may comprise nucleic acid sequences encoding the M and G proteins of the recombinant oncolytic virus; the recombinant oncolytic viral expression vector may further comprise nucleic acid sequences encoding the N, P and L proteins of the recombinant oncolytic virus.

The virus-producing cell is capable of producing the recombinant oncolytic virus described above; the virus-producing cells may comprise BSR-T7 cells, vero cells, 293 cells, MRC-5 cells, WI38 cells.

The vaccine is prepared by using the recombinant oncolytic virus.

The pharmaceutical composition comprises the recombinant oncolytic virus described above, and optionally a pharmaceutically acceptable carrier.

In certain embodiments, the pharmaceutical compositions may include one or more (pharmaceutically effective) suitable formulations of adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and/or preservatives. The acceptable ingredients of the pharmaceutical composition are preferably non-toxic to the recipient at the dosages and concentrations employed. Pharmaceutical compositions of the present application include, but are not limited to, liquid, frozen and lyophilized compositions.

In certain embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delaying agents compatible with drug administration, generally safe, non-toxic.

The pharmaceutical composition includes the recombinant oncolytic viruses described above, and optionally other pharmaceutically acceptable drugs.

The above pharmaceutical compositions are useful in the treatment of diseases in combination, including but not limited to the treatment of tumors.

In certain embodiments, the pharmaceutical composition may comprise parenteral, subcutaneous, intracavity, intra-arterial, intravenous, intrathecal and/or intranasal administration or direct injection into tissue. For example, the pharmaceutical composition may be administered to a patient or subject by infusion or injection. In certain embodiments, the administration of the pharmaceutical composition may be performed by different means, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal, or intratissue administration. In certain embodiments, the pharmaceutical composition may be administered without interruption. The uninterrupted (or continuous) administration may be achieved by a small pump system worn by the patient to measure the therapeutic agent flowing into the patient, as described in WO 2015/036583.

The present application also provides methods for producing the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine, and the pharmaceutical composition. Any method suitable for producing an oncolytic virus may be used to produce a recombinant oncolytic virus of the present application. For example, a cell may be transfected with a poxvirus expressing T7 RNA polymerase, and plasmids expressing the recombinant oncolytic virus N, L, and P proteins, as well as a backbone plasmid, to obtain the recombinant oncolytic virus of the present application by a viral rescue process.

The application also provides application of the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus production cell, the vaccine and the pharmaceutical composition in preparing medicines for preventing and/or treating diseases and/or symptoms.

The recombinant oncolytic virus provided by the application respectively carries out site-directed mutagenesis on the amino acids on M protein, G protein, N protein, P protein and L protein of the oncolytic virus, and simultaneously inserts antigens and/or cytokines encoded by exogenous genes, thereby further improving the infection capability of the oncolytic virus on abnormal proliferative (tumor) LLC cells. Meanwhile, the prepared recombinant oncolytic virus has poor infection capability on normal cells (normal MEF cells), so that the recombinant oncolytic virus prepared by the application can be better used for infection of cells such as tumors and cancers, and meanwhile, the normal cells cannot be damaged, and the recombinant oncolytic virus has a wide application prospect.

The recombinant oncolytic virus provided by the application respectively carries out site-directed mutagenesis on amino acids on M protein, G protein, N protein, P protein and L protein of the oncolytic virus, and simultaneously inserts antigens and/or cytokines encoded by exogenous genes, thereby further improving the in vitro killing capacity of the oncolytic virus on abnormal proliferation (tumor) LLC cells. Meanwhile, the prepared recombinant oncolytic virus has almost no influence on normal MEF cells, which shows that the recombinant oncolytic virus prepared by the application can be better used for damaging and killing abnormal cells such as tumors, cancers and the like, and meanwhile, normal cells cannot be damaged.

The recombinant oncolytic virus provided by the application is not easy to clear in abnormal proliferation (tumor) LLC cells. In contrast, wild-type oncolytic viruses are easier to clear within LLC cells. The recombinant oncolytic virus provided by the application respectively carries out site-directed mutagenesis on amino acids on M protein, G protein, N protein, P protein and L protein of the oncolytic virus, and simultaneously inserts antigens and/or cytokines encoded by exogenous genes, so that the oncolytic virus is not easy to clear in LLC cells, and the oncolytic virus can better exert infection and killing capability in the LLC cells; meanwhile, the recombinant oncolytic virus is easier to clear in normal MEF cells, so that the safety of the normal MEF cells is further ensured, and the safety of the recombinant oncolytic virus is improved.

The present application is further described in detail below in connection with preparations 1-131 and examples 1-2.

Preparation example

Preparation examples 1 to 10

Preparation examples 1-10 each provide a recombinant oncolytic virus. The recombinant oncolytic virus includes an M protein and an antigen.

The preparation examples differ in that: the types of antigens are different, and are shown in Table 1.

The construction method of the recombinant oncolytic virus provided by each preparation example is as follows:

(1) Construction of vectors

The M protein mutation sites shown in Table 1 were introduced by PCR technique using pRV-core plasmid (Biovector NTCC plasmid vector cell Collection) as a template.

And synthesizing a gene fragment containing the protein mutation site and containing XbaI and MluI enzyme cleavage sites, carrying out PCR amplification by taking the gene fragment as a template, then carrying out 1% agarose gel electrophoresis on a PCR product, carrying out double enzyme digestion by using XbaI and MluI, and carrying out rubber cutting recovery by using a gel recovery kit to obtain the gene fragment with the protein mutation site.

The pRV-core plasmid is digested with XbaI and MluI, and the gel recovery kit is used for rubber cutting recovery to obtain pRV-core digested and recovered skeleton fragment.

And (3) connecting, converting and plating the gene fragment with the protein mutation site and pRV-core enzyme digestion recovery skeleton fragment, selecting monoclonal shaking bacteria for PCR verification, extracting plasmids to obtain constructed plasmids pRV-core Mut, and sending the plasmids pRV-core Mut to a sequencing company for sequencing.

(2) Insertion of foreign genes

The plasmid pRV-core Mut obtained in step (1) was subjected to double cleavage with Xho I and Mlu I to recover a long fragment.

The exogenous gene for encoding antigen is synthesized by a gene synthesis company and amplified by a corresponding primer, target gene fragments are recovered by double digestion treatment of XhoI and NheI, pRV-core Mut and exogenous gene fragments subjected to double digestion treatment are connected and transformed, monoclonal is selected, PCR or digestion identification is carried out, and then the obtained product is sent to a sequencing company for sequencing, and specifically shown in a table 1, so that plasmid pRV-core Mut carrying exogenous gene is obtained.

TABLE 1 mutation status table of recombinant oncolytic viruses in preparation examples 1-10

(3) Virus rescue

Plasmid pRV-core Mut carrying exogenous genes was transfected into BSR-T7 cells (purchased from ATCC, american type culture Collection, also known as American type culture Collection) by cell transfection technique using a calcium phosphate transfection kit (Thermo Fisher Scientific).

Mixing four plasmids according to the mass ratio of pRV-core Mut, pP, pN and pL of 10:5:4:1, wherein the total amount of the plasmids is 5 mug; the plasmid was diluted with 200. Mu.l opti-MEM medium (Thermo Fisher Scientific) and 7.5. Mu.l transfection Reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix; wherein, pP (plasmid carrying a rhabdovirus phosphoprotein gene), pN (plasmid carrying a rhabdovirus nucleoprotein gene), pL (plasmid carrying a rhabdovirus polymerase protein gene); the parent vectors corresponding to the three plasmids pN, pP and pL are pCAGGS (purchased from ATCC);

Lipofectamine LTX 10 mu l (Thermo Fisher Scientific) was diluted with 200. Mu.l opti-MEM medium to obtain an LTX mixture;

plasmid transfection was performed according to the method described in Lipofectamine LTX instructions, and after 6h BSR-T7 cells were washed twice with PBS and further inoculated in DMEM medium (Thermo Fisher Scientific) with 10% fetal bovine serum for 3 days;

transferring a cell supernatant obtained by culturing BSR-T7 cells into Vero cells (Thermo Fisher Scientific), culturing the Vero cells for 3 days at 37 ℃ and observing green fluorescence in the cells by a fluorescence microscope to determine the condition of virus rescue; the rescued mutant rhabdovirus pool was further passaged through Vero cells and monoclonal strains were picked up in the established plaque screening system.

(4) And (5) sequencing genes. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA reversely transcribed by using primers designed for M protein gene sequences and primers designed for encoding antigen gene sequences;

the primer sequences designed for the M protein gene sequence are as follows:

PF:ATGAGTTCCTTAAAGAA；

PR:TCATTTGAAGTGG。

the primer sequences for coding the antigen gene sequence are as follows:

CD19 F：ACGCTCGAGATGCCACCTCCTCGCCTCC；

CD19 R：TCTGGCTAGCTCATCTTTTCCTCCTCAGG。

BCMA F：ACGCTCGAGATGTTGCAGATGGCTGGGC；

BCMA R：TCTGGCTAGCTTATAGCAAAAACATTAGC。

NY-ESO-1 F：ACGCTCGAGATGCAGGCAGAAGGAAG；

NY-ESO-1 R：TCTGGCTAGCTCATCTTCTCTGTCCGCTA。

MUC-1 F：ACGCTCGAGATGTCTGGTCATGCAAGC；

MUC-1-R：TCTGGCTAGCTTACAAGGCAATGAGATAG。

MSLN F：ACGCTCGAGATGGAAGTGGAGAAGACAG；

MSLN R：TCTGGCTAGCTCAGGCCAGGGTGGAGGCT。

EGFR F：ACGCTCGAGATGCGACCCTCCGGGACGG；

EGFR R：TCTGGCTAGCTTACATGAAGAGGCCGAT。

VEGFR2 F：ACGCTCGAGATGCAGAGCAAGGTGCTG；

VEGFR2 R：TCTGGCTAGCTCAGATGATGACAAGAAGT。

MAGE A4 F：ACGCTCGAGACAGAGGAGCACCAAGGAG；

MAGE A4 R：TCTGGCTAGCATAGACTGAGGCATAAGGC。

cMet F：ACGCTCGAGATGGAGTGCAAGGAGGCC；

cMet R：TCTGGCTAGCTTACAGCCACAGGAAGAAG。

Claude 18.2 F：ACGCTCGAGATGGACCAGTGGAGCACCC；

Claude 18.2 R：TCTGGCTAGCTTAGGCGATGCACATCATC。

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 1.

Preparation examples 11 to 20

Preparation examples 11-20 each provide a recombinant oncolytic virus. The recombinant oncolytic virus includes an M protein, a G protein, and an antigen.

Wherein the mutation site of the M protein is the same as the corresponding mutation site in preparation example 1, and the G protein comprises an amino acid sequence shown as SEQ ID NO 13 as shown in Table 2. The preparation examples differ in that: the types of antigens included are different, as shown in Table 2.

The construction method of the recombinant oncolytic virus provided in the preparation example is the same as that of the preparation example 2, and the difference is that: also included are the G proteins having mutation sites as shown in Table 2. The construction method is characterized in that:

introducing mutation sites shown in table 2 into the constructed plasmid of the step (1) by using a PCR technique;

step (4) is G protein gene sequencing. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA reversely transcribed by using primers designed for G protein gene sequences;

the primer sequences designed for the G protein gene sequences are as follows:

PF:ATGAAGTGCCTTTTGTACTTAG；

PR:TTACTTTCCAAGTCGGTTCATCT。

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 2.

TABLE 2 mutation status of recombinant oncolytic viruses in preparation examples 11-20

Preparation examples 21 to 30

Preparation examples 21-30 each provide a recombinant oncolytic virus. The recombinant oncolytic virus includes an M protein, a G protein, an N protein, and an antigen.

Wherein the mutation sites of the M protein and the G protein are the same as the corresponding mutation sites in preparation example 11, and the N protein comprises an amino acid sequence shown as SEQ ID NO 15, as shown in Table 3. The preparation examples differ in that: the types of antigens included are different, as shown in Table 3.

The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as that of preparation example 11, except that: also included are N proteins with mutation sites as shown in Table 3. The construction method is characterized in that:

introducing mutation sites shown in table 3 into the constructed plasmid of the step (1) by using a PCR technique;

step (4) is N protein gene sequencing. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA reversely transcribed by using primers designed for N protein gene sequences;

the primer sequences designed for the N protein gene sequences are as follows:

PF:ATGTCTGTTACAGTCAAGAG；

PR:TCATTTGTCAAATTCTGACTT。

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 3.

TABLE 3 mutation status of recombinant oncolytic viruses in preparation examples 21-30

Preparation examples 31 to 40

Preparation examples 31-40 each provide a recombinant oncolytic virus. The recombinant oncolytic virus comprises M protein, G protein, N protein, P protein and antigen.

Wherein the mutation sites of the M protein, the G protein and the P protein are the same as the corresponding mutation sites in preparation example 21, and the P protein comprises an amino acid sequence shown in SEQ ID NO 17 as shown in Table 4. The preparation examples differ in that: the types of antigens included are different, as shown in Table 4.

The construction method of the recombinant oncolytic virus provided in the preparation example is the same as that of the preparation example 21, except that: also included are the P proteins at the mutation sites shown in table 4. The construction method is characterized in that:

introducing mutation sites shown in table 4 into the constructed plasmid of step (1) by using a PCR technique;

step (4) is P protein gene sequencing. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA reversely transcribed by using primers designed for P protein gene sequences;

the primer sequence designed for the P protein gene sequence is as follows:

PF:ATGGATAATCTCACAAAAGTTCG；

PR:CTACAGAGAATATTTGACTCTCG。

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 4.

TABLE 4 mutation status of recombinant oncolytic viruses in preparation examples 21-30

PREPARATION EXAMPLES 41 to 50

Preparation examples 41-50 each provide a recombinant oncolytic virus. The recombinant oncolytic virus comprises M protein, G protein, N protein, P protein, L protein and antigen.

Wherein the mutation sites of the M protein, the G protein, the P protein and the N protein are the same as the corresponding mutation sites in preparation example 31, and the L protein comprises an amino acid sequence shown in SEQ ID NO 19 as shown in Table 5. The preparation examples differ in that: the types of antigens included are different, as shown in Table 5.

The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as that of preparation example 31, except that: also included are the L proteins having mutation sites as shown in Table 5. The construction method is characterized in that:

introducing mutation sites shown in table 5 into the constructed plasmid of step (1) by using PCR technique;

step (4) is L protein gene sequencing. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA reversely transcribed by using primers designed for the gene sequence of L protein;

the primer sequences designed for the L protein gene sequence are as follows:

PF:ATGGAAGTCCACGATTTTGAGA；

PR:TTAATCTCTCCAAGAGTTTTCCT。

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 5.

TABLE 5 mutation status of recombinant oncolytic viruses in PREPARATIVE EXAMPLES 41-50

PREPARATION EXAMPLES 51 to 120

Preparation examples 51-120 each provide a recombinant oncolytic virus. The recombinant oncolytic virus comprises M protein, G protein, N protein, L protein, P protein, antigen and cytokine.

The recombinant oncolytic viruses provided in the above preparation differ from those in preparations 41-50 in that: the recombinant oncolytic virus also includes cytokines.

The method comprises the following steps:

the recombinant oncolytic viruses provided in preparation examples 51-60, respectively, included a cytokine of GM-CSF. The cytokine GM-CSF comprises the amino acid sequence shown in SEQ ID NO 20, and is specifically shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 61-70 respectively comprise a cytokine IL-2, wherein the cytokine IL-2 comprises an amino acid sequence shown in SEQ ID NO 21, and the amino acid sequence is specifically shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 71-80 respectively comprise a cytokine IL-12, wherein the cytokine IL-12 comprises an amino acid sequence shown as SEQ ID NO 22 and SEQ ID NO 23, and the specific amino acid sequence is shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 81-90 respectively comprise a cytokine IL-15, wherein the cytokine IL-15 comprises an amino acid sequence shown in SEQ ID NO 24, and the amino acid sequence is specifically shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 91-100 respectively comprise a cytokine IL-18, wherein the cytokine IL-18 comprises an amino acid sequence shown in SEQ ID NO 25, and the amino acid sequence is specifically shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 101-110 respectively comprise a cytokine TNF- α comprising the amino acid sequence shown in SEQ ID NO 26, as shown in Table 6.

The recombinant oncolytic viruses provided in preparation examples 111-120 respectively comprise a cytokine IFN- β comprising the amino acid sequence shown in SEQ ID NO 27, as specifically shown in Table 6.

The construction method of the recombinant oncolytic virus provided in the preparation example is the same as that of the preparation example 1, and the difference is that: also included are insertion of exogenous genes encoding cytokines. The construction method is characterized in that:

the construction plasmid of step (1) was introduced with the mutation site shown in Table 6 by PCR technique, as in preparation examples 41-50.

Step (2) further comprises inserting an exogenous gene encoding a cytokine.

Step (4) also includes sequencing of the cytokines. Extracting viral genome RNA by using a Trizol kit, carrying out reverse transcription reaction by using random primers, and carrying out PCR on cDNA which is reversely transcribed by using primers designed for cytokine gene sequences;

The sequence of the primer designed for coding the gene sequence of the cytokine is as follows:

GMCSF F：CCCTCGAGATGTGGCTGCAGAGCCT，

GMCSF R：CGGCTAGCTCACTCCTGGACTGGCTCC。

IL-2 F：CCGATGTACAGGATGCAACTCC，

IL-2 R：CGGCTAGCTCAAGTCAGTGTTG。

IL12 F：CCCTCGAGATGTGGCCCCCTGGGT，

IL12 R：CGGCTAGCTTAACTGCAGGGCACAGATG。

IL-15 F:CCGCTCGAGATGAGAATTTCGAAACC，

IL-15 R:CGGCTAGCTCAAGAAGTGTTGATGAAC。

IL-18 F:CCCTCGAGATGGCTGCTGAACCAGTAG，

IL-18 R:CGGCTAGCCTAGTCTTCGTTTTGAAC。

TNFαF:CCGCTCGAGATGAGCACTGAAAGC，

TNFαR:CGGCTAGCTCACAGGGCAATGATCC。

IFNβF:CCTCGAGATGACCAACAAGTGTC，

IFNβR:CGGCTAGCTCAGTTTCGGAGG。

TABLE 6 mutation status table of recombinant oncolytic viruses in PREPARATIVE EXAMPLES 51-120

/>

PREPARATION EXAMPLES 121 to 130

Preparation examples 121-130 provide a recombinant oncolytic virus. The recombinant oncolytic virus is obtained by introducing exogenous genes encoding antigens on the basis of wild oncolytic viruses.

(1) Insertion of foreign genes

The pRV-core plasmid (Biovector NTCC plasmid vector cell gene collection center) is used as a template, xho I and Mlu I are used for double digestion, then an exogenous gene for encoding an antigen is inserted (the exogenous gene for encoding the antigen is synthesized by a gene synthesis company and then amplified by a corresponding primer), the target gene fragment is recovered by double digestion treatment with Xho I and NheI, the pRV-core and the exogenous gene fragment subjected to double digestion treatment are subjected to connection transformation, single clone is selected, PCR or enzyme digestion identification is carried out, and then the sequence is sent to a sequencing company, and specifically, the plasmid pRV-core Mut carrying the exogenous gene is obtained as shown in a table 7.

(2) Virus rescue

(3) And (5) sequencing genes. Extracting viral genome RNA by using Trizol kit, performing reverse transcription reaction by using random primer, and performing PCR on the reverse transcribed cDNA by using primer designed for coding cytokine gene sequence (the primer sequence is the same as that shown in example 1);

the product was recovered by 1% agarose gel electrophoresis and sent to sequencing company for sequencing. The sequencing results are shown in Table 7.

TABLE 7 mutation status table of recombinant oncolytic viruses in PREPARATIVE EXAMPLES 121-130

PREPARATION 131

The preparation example provides a packaging process of the recombinant oncolytic virus prepared by using any one of the preparation examples 1-120, and specifically comprises the following steps:

1) Vant BSR-T7 cells (purchased from ATCC) were inoculated with poxvirus vTF7-3 (Biovector NTCC plasmid vector cell Gene Collection) expressing T7 RNA polymerase

The method comprises the following specific steps: spreading BSR-T7 cells on 6-well plate, and controlling cell quantity per well to 3×10 ⁵ A plurality of; after 14-16h of plating, poxvirus vTF7-3 expressing T7 RNA polymerase is added to carry out infection of BSR-T7 cells by poxvirus vTF 7-3; after 6h of infection, BSR-T7 cells were rinsed once with DPBS buffer (Thermo Fisher Scientific) for transfection.

2) Transfection procedure

The method specifically comprises the following steps: mixing four plasmids according to the mass ratio of pRV-core Mut, pP, pN and pL of 10:5:4:1, wherein the total amount of the plasmids is 5 mug; the plasmid was diluted with 200. Mu.l opti-MEM medium (Thermo Fisher Scientific) and 7.5. Mu.l transfection Reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix; wherein, pP (plasmid carrying a rhabdovirus phosphoprotein gene), pN (plasmid carrying a rhabdovirus nucleoprotein gene), pL (plasmid carrying a rhabdovirus polymerase protein gene); the parent vectors corresponding to the three plasmids pN, pP and pL are pCAGGS (purchased from ATCC);

mixing 200 mu l of the LTX mixed solution with 200 mu l of the transfection plasmid premix solution, and incubating for 15min at room temperature to obtain an LTX-DNA mixed solution;

changing the DPBS buffer solution in the 6-hole plate in the step 1) into an Opti-MEM culture medium, dropwise adding the LTX-DNA mixed solution into the 6-hole plate for culturing BSR-T7 cells, and gently shaking the 6-hole plate to ensure that the LTX-DNA mixed solution is uniformly distributed in the 6-hole plate; after 6-8h of transfection, the transfection reagent was aspirated and 3ml of fresh complete medium (Thermo Fisher Scientific) was added; after 72 hours, the cell supernatants of BSR-T7 cells were harvested and filtered using a 0.22 μm filter to obtain recombinant oncolytic viruses corresponding to each of preparation examples 1-130.

Examples

Example 1

In this example, the recombinant oncolytic viruses and wild oncolytic viruses prepared in preparation examples 1-130 were used to perform in vitro killing test detection on different cells.

The detection method is MTT detection method, namely, in the culture solution of different cells, the preparation examples 1-130 and the wild oncolytic virus are respectively added for 200pfu and 24h, and then the MTT detection method is used for detecting the activity of the cells.

The cells detected included: LLC cells, MEF cells.

The specific detection method comprises the following steps:

(1) 100 μl of Vero (LLC/MEF) cell suspension was added to each 96-well plate to achieve a cell volume of 1×10 ⁴ Each well, 96-well plates were placed at 37℃in 5% CO ₂ Is cultured for 16 hours under the environmental condition;

(2) Diluting the recombinant oncolytic virus prepared in preparation example to MOI (multiplicity of infection) of 0.001, 0.01, 0.1, 1.0 respectively, inoculating the recombinant oncolytic virus of each dilution gradient to 96-well culture plate of step (1) respectively, inoculating 4 wells per dilution gradient, 100 μl per well, placing 96-well culture plate at 37deg.C, 5% CO ₂ Is cultured for 40 hours under the environmental condition;

(3) Removing the cell supernatant from the 96-well culture plate of step (2), and adding fresh medium and MTT solution to the 96-well culture plate in an amount of 20. Mu.L/well 96-well plates were placed at 37℃in 5% CO ₂ Is cultured for 4 hours under the environmental condition;

(4) Centrifuging the 96-well culture plate at room temperature for 5min, setting the rotation speed to 2500rpm/min, and gently sucking the supernatant by using a 1mL disposable sterile syringe; DMSO was then added to each well of a 96-well plate in an amount of 100 ul/well and allowed to stand at 37 ℃ for 10min. The OD value of each well on a 96-well plate was measured at 570nm or 490nm wavelength by shaking for 2min using a multifunctional microplate reader.

The detection results are shown in FIGS. 1-4. Wherein the abscissa 0 represents the wild-type oncolytic virus; the abscissa 1 to 130 represents the recombinant oncolytic viruses prepared in preparation examples 1 to 130, respectively; ordinate OD ₅₇₀ Represents the OD value of the cell, OD ₅₇₀ The larger the value of (2) is, the worse the killing ability of the recombinant oncolytic virus to the cell is; OD (optical density) ₅₇₀ The smaller the value of (c) is, the better the killing ability of the recombinant oncolytic virus to the cell is.

As can be seen from the above figures, the recombinant oncolytic viruses prepared in preparation examples 1-120 of the present application have better in vitro killing ability on LLC cells than the recombinant oncolytic viruses prepared in preparation examples 121-130 by using wild oncolytic virus binding antigen. In particular, preparation examples 111-120 provided recombinant oncolytic viruses that have greater in vitro killing capacity on LLC cells than wild-type oncolytic viruses.

From the detection results, the recombinant oncolytic virus provided by the application has better in-vitro killing capacity on LLC cells. It can be judged that the recombinant oncolytic virus provided by the application has better in vitro killing capacity on cancer cells (4T 1 cells, MC38 cells, hela cells and the like). Meanwhile, the prepared recombinant oncolytic virus has almost no killing effect on MEF cells, which proves that the recombinant oncolytic virus prepared by the application can be better used for damaging and killing abnormal cells such as tumors, cancers and the like, and can not damage normal cells.

Although the wild type oncolytic virus has better in vitro killing capacity on LLC cells, the wild type oncolytic virus damages and kills MEF cells to a great extent while damaging and killing the cells, and the clinical application of the wild type oncolytic virus is limited. Therefore, the transformation of the wild oncolytic virus ensures the safety of the oncolytic virus to normal cells, and simultaneously ensures the killing capacity of the oncolytic virus to tumor and cancer cells, thereby having wide clinical application prospect.

Example 2

This example demonstrates the experimental detection of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in preparation examples 1-130 inducing IFN- β expression in different cells.

The detection index is the expression condition of the gene IFN-beta in different cells. The gene IFN-beta is a soluble glycoprotein gene with wide antiviral, antitumor and immunoregulatory effects, and the expression condition of the gene IFN-beta can judge the clearance of the cell to the recombinant oncolytic virus: when the expression of the gene IFN-beta is higher, the recombinant oncolytic virus is easy to clear in cells; when the expression of the gene IFN- β is low, it means that the recombinant oncolytic virus is not easily cleared in the cell.

The cells detected included: LLC cells, MEF cells.

The specific detection method comprises the following steps:

(3) The cells of each group obtained by the culture in the step (2) were disrupted, total RNA was extracted from each cell by TRIzol (Invitrogen), reverse transcribed into cDNA by PrimeScript RT Reagent Kit with DNA Eraser (Takara) reverse transcription kit, stained with LightCycler 480SYBR Green I Master (Roche) dye, and Ct value of each gene was detected on a LightCycler 480 quantitative PCR instrument. The relative expression level of IFN- β of the target gene was calculated by the ΔΔCt method.

The detection results are shown in FIGS. 5 to 8. Wherein the abscissa 0 represents the wild-type oncolytic virus; the abscissa 1 to 130 represents the recombinant oncolytic viruses prepared in preparation examples 1 to 130, respectively; the ordinate IFN- β level indicates the expression of the IFN- β gene, and the greater the value of the IFN- β level, the weaker the reproductive capacity of the recombinant oncolytic virus in the cell, and the easier the clearance; the smaller the value of IFN- β levels, the more productive the recombinant oncolytic virus is in the cell, the less susceptible it is to clearance.

As can be seen from the above figures, the recombinant oncolytic viruses and the wild-type oncolytic viruses provided in preparation examples 1-120 of the present application have strong propagation ability in LLC cells, are not easy to be cleared, and are superior to the propagation ability in LLC cells of the recombinant oncolytic viruses prepared by using the wild-type oncolytic virus binding antigen in preparation examples 121-130. In particular, the recombinant oncolytic viruses provided in preparation examples 111-120 are not easy to clear in LLC cells, and the better infection and killing ability of the oncolytic viruses in LLC cells is further ensured.

From the detection results, the recombinant oncolytic virus provided by the application has strong propagation capacity in LLC cells and is not easy to remove. It can be judged that the recombinant oncolytic virus provided by the application has stronger reproductive capacity in cancer cells (4T 1 cells, MC38 cells, hela cells and the like) and is not easy to clear. Meanwhile, the recombinant oncolytic virus is easier to clear in MEF cells, so that the safety of the MEF cells is further ensured, and the safety of the oncolytic virus is improved.

The present embodiment is merely illustrative of the present application and is not intended to be limiting, and those skilled in the art, after having read the present specification, may make modifications to the present embodiment without creative contribution as required, but is protected by patent laws within the scope of the claims of the present application.

Claims

1. A recombinant oncolytic virus, characterized in that the recombinant oncolytic virus comprises an M protein and an antigen encoded by a foreign gene; compared with the amino acid sequence shown in SEQ ID NO 1, the M protein comprises the following site mutations: methionine at position 51 to arginine (M51R); valine at position 221 to phenylalanine (V221F); serine at position 226 is mutated to arginine (S226R).

2. The recombinant oncolytic virus of claim 1, wherein: the antigen is selected from the group consisting of hematological tumors and solid tumors.

3. The recombinant oncolytic virus of claim 2, wherein:

the solid tumor antigens include, but are not limited to, 5T4, RORl, EGFR, fc gamma RI, fcgammaRIIa, fcgammaRIIb, CD28, CD137, CTLA-4, HER-2, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-associated protein, LT beta R, TRAIL receptor 1, TRAIL receptor 2, prostate specific membrane antigen protein, prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, erbB3, folate receptor, hepaplin receptor, PDGFRa, erbB-2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, P53, cMet, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, GE-A12 BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA-88-A, NY-ESO-1, BRCA2, MART-1, MC1R, gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, cyp-B, hTERT, hTRT, iCE, MUC, P-cadherin, myosin, cripto, MUC5AC, PRAME, P, RU1, RU2, SART-1, SART-3, AFP, beta-catenin/m, caspase-8/m, CDK-4/m, ELF2M, gnT-V, G, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin/m, RAGE, SART-2, INT-2/2, INT-2, CDC-27/707, CDC-27, and the like, TPI/mbcr-abl, ETV6/AML, LDLR/FUT, pml/RARα, TEL/AML1, CD28, CD137, canAg, mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycans, ephA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL; the hematological tumor antigens include, but are not limited to, BCMA, CD4, CD5, CD7, CD10, fcgammaRIIIa, fcgammaRIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1/2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A/B, CSNK1A1, FLI1, IKZF1/3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, leY, MUC1.

4. The recombinant oncolytic virus of claim 3, wherein: the antigen is selected from any one or more of the following: CD19, BCMA, NY-ESO-1, HER-2, MUC-1, MSLN, EGFR, VEGFR2, MAGE A4, cMet, claude 18.2.

5. The recombinant oncolytic virus of any one of claims 1-4, wherein: the recombinant oncolytic virus also includes a cytokine encoded by an exogenous gene.

6. The recombinant oncolytic virus of any one of claim 5, wherein: the cytokine is selected from the group consisting of interleukins, interferons, tumor necrosis factors, colony stimulating factors, transforming growth factor beta, and chemokine families.

7. The recombinant oncolytic virus of claim 6, wherein: the cytokine is selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-alpha, IFN-beta, IFN-gamma, IFN-beta, TGF-beta and TNF-alpha.

8. The recombinant oncolytic virus of claim 7, wherein: the cytokine is selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN- β, TNF- α.

9. The recombinant oncolytic virus of any one of claims 1-8, wherein: the M protein further comprises one or more of the following site mutations: asparagine at position 32 is mutated to serine (N32S); and/or asparagine at position 49 is mutated to aspartic acid (N49D); and/or, the histidine at position 54 is mutated to tyrosine (H54Y); and/or valine at position 225 to isoleucine (V225I).

10. The recombinant oncolytic virus of claim 9, wherein: the M protein further comprises one or more of the following site mutations: knocking out the 111 th leucine coding base; or, leucine at position 111 is mutated to alanine (L111A).

11. The recombinant oncolytic virus of claim 9 or 10, wherein: the M protein further comprises one or more of the following site mutations: glycine at position 21 to alanine (G21E); and/or, methionine at position 33 to alanine (M33A); and/or, alanine at position 133 is mutated to threonine (a 133T).

12. The recombinant oncolytic virus of any one of claims 1-11, wherein: the site mutation of the M protein is selected from any one of the following groups:

1) The site mutation of the M protein comprises M51R, V221F, S226R;

2) The site mutation of the M protein comprises N32S, N49D, M51R, H Y, V221F, V225I, S226R;

3) The site mutation of the M protein comprises N32S, N49D, M51R, H Y, a leucine coding base 111 is knocked out, and V221F, V225I, S226R;

4) The site mutation of the M protein comprises N32S, N49D, M51R, H Y, L111A, V221F, V35225I, S226R;

5) The site mutation of the M protein comprises G21E, N S, N49D, M49R, H54Y, V221F, V35225I, S226R;

6) The site mutation of the M protein comprises G21E, N S, M A, N49D, M51R, H54Y, V221F, V225I, S226R;

7) The site mutation of the M protein comprises G21E, N32S, M A, N49D, M R, H54Y, A133T, V221F, V225 37226R;

8) The site mutation of the M protein comprises N32S, M A, N49D, M49R, H54Y, V221F, V35225I, S226R;

9) The site mutation of the M protein comprises N32S, M33A, N49D, M R, H Y, A133T, V221F, V225I, S R;

10 A site-directed mutation of the M protein comprises N32S, N49D, M51R, H Y, A133T, V221F, V35225I, S226R.

13. The recombinant oncolytic virus of claim 12, wherein: the M protein comprises an amino acid sequence shown as SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 or SEQ ID NO 11.

14. A recombinant oncolytic virus characterized in that: the recombinant oncolytic virus comprises the M protein of any one of claims 1-13; the recombinant oncolytic virus further comprises a G protein; the G protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 12: valine at position 53 to isoleucine (V53I); and/or, alanine at position 141 is mutated to valine (a 141V); and/or aspartic acid at position 172 to tyrosine (D172Y); and/or, a lysine at position 217 is mutated to glutamic acid (K217E); and/or aspartic acid at position 232 to glycine (D232G); and/or valine at position 331 to alanine (V331A); and/or, valine at position 371 is mutated to glutamic acid (V371E); and/or, glycine at position 436 is mutated to aspartic acid (G436D); and/or, threonine at position 438 is mutated to serine (T438S); and/or phenylalanine at position 453 is mutated to leucine (F453L); and/or threonine at position 471 is mutated to isoleucine (T471I); and/or tyrosine at position 487 is mutated to histidine (Y487H).

15. The recombinant oncolytic virus of claim 14, wherein: the G protein comprises an amino acid sequence shown as SEQ ID NO 13.

16. A recombinant oncolytic virus characterized in that: the recombinant oncolytic virus comprises the M protein of any one of claims 1-13, or the M protein and G protein of any one of claims 14-15; the recombinant oncolytic virus further comprises an N protein; the N protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 14: isoleucine at position 14 to valine (I14V); and/or, arginine at position 155 is mutated to lysine (R155K); and/or, serine at 353 is mutated to asparagine (S353N).

17. The recombinant oncolytic virus of claim 16, wherein: the N protein comprises an amino acid sequence shown as SEQ ID NO 15.

18. A recombinant oncolytic virus characterized in that: the recombinant oncolytic virus comprises the M protein of any one of claims 1-13; or the M and G proteins of any one of claims 14-15; or the M, G and N proteins of any one of claims 16-17; the recombinant oncolytic virus further comprises a P protein; the P protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 16: arginine at position 50 is mutated to lysine (R50K); and/or valine at position 76 to alanine (V76A); and/or asparagine at position 99 to glutamic acid (D99E); and/or, leucine at position 126 is mutated to serine (L126S); and/or, leucine at position 140 is mutated to serine (L140S); and/or, the histidine at position 151 is mutated to tyrosine (H151Y); and/or, isoleucine at position 168 is mutated to methionine (I168M); and/or, lysine at position 170 is mutated to glutamic acid (K170E); and/or, tyrosine at position 189 is mutated to serine (Y189S); and/or asparagine at position 237 is mutated to aspartic acid (N237D).

19. The recombinant oncolytic virus of claim 18, wherein: the P protein comprises an amino acid sequence shown as SEQ ID NO 17.

20. A recombinant oncolytic virus characterized in that: the recombinant oncolytic virus comprises the M protein of any one of claims 1-13; or the M and G proteins of any one of claims 14-15; or the M, G and N proteins of any one of claims 16-17; or the M, G, N and P proteins of any one of claims 18-19; the recombinant oncolytic virus further comprises an L protein; the L protein comprises one or more of the following site mutations compared with the amino acid sequence shown in SEQ ID NO 18: serine at position 87 is mutated to proline (S87P); and/or, isoleucine at position 487 is mutated to threonine (I487T).

21. The recombinant oncolytic virus of claim 20, wherein: the L protein comprises an amino acid sequence shown as SEQ ID NO 19.

22. The recombinant oncolytic virus of any one of claims 1-21, further comprising a rhabdovirus.

23. The recombinant oncolytic virus of any one of claims 1-21, further comprising vesicular stomatitis virus (Vesicular Stomatitis Virus, VSV for short).

24. The recombinant oncolytic virus of any one of claims 1-21, further comprising a VSV virus Indiana MuddSummer subtype.

25. The recombinant oncolytic virus of any one of claims 1-24, further comprising or expressing an exogenous protein of interest.

26. The recombinant oncolytic virus of any one of claims 1-25, wherein the recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with the site mutation, and/or a nucleic acid sequence encoding the G protein with the site mutation, and/or a nucleic acid sequence encoding the N protein with the site mutation, and/or a nucleic acid sequence encoding the P protein with the site mutation, and/or a nucleic acid sequence encoding the L protein with the site mutation, and a nucleic acid sequence encoding the cytokine.

27. The recombinant oncolytic virus of claim 26, wherein in the nucleic acid molecule the nucleic acid sequence encoding an antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

28. The recombinant oncolytic virus of claim 27, wherein in the nucleic acid molecule the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein having a site mutation, the nucleic acid sequence encoding the N protein having a site mutation, or the nucleic acid sequence encoding the P protein having a site mutation and the nucleic acid sequence encoding the L protein having a site mutation.

29. The recombinant oncolytic virus of claim 26, wherein in the nucleic acid molecule the nucleic acid sequence encoding a cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

30. The recombinant oncolytic virus of claim 29, wherein in the nucleic acid molecule the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein with the site mutation, the nucleic acid sequence encoding the N protein with the site mutation, or the nucleic acid sequence encoding the P protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.

31. The recombinant oncolytic virus of claim 26, wherein in the nucleic acid molecule the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the site-mutated L protein or between the nucleic acid sequence encoding the site-mutated G protein and the antigen.

32. A recombinant oncolytic virus expression vector capable of expressing the recombinant oncolytic virus of any one of claims 1-31.

33. A virus-producing cell, characterized in that: the virus-producing cell is capable of producing the recombinant oncolytic virus of any one of claims 1-31.

34. A vaccine prepared using the recombinant oncolytic virus of any one of claims 1-31.

35. A pharmaceutical composition characterized in that: the pharmaceutical composition comprises the recombinant oncolytic virus of any one of claims 1-31, or the vaccine of claim 34, and optionally a pharmaceutically acceptable carrier.

36. The recombinant oncolytic virus of any one of claims 1-31, the recombinant oncolytic virus expression vector of claim 32, the virus-producing cell of claim 33, the vaccine of claim 34, the method of preparing the pharmaceutical composition of claim 35.

37. Use of a recombinant oncolytic virus of any one of claims 1-31, a recombinant oncolytic virus expression vector of claim 32, a virus-producing cell of claim 33, a vaccine of claim 34, a pharmaceutical composition of claim 35 in the manufacture of a medicament for the prevention and/or treatment of a disease and/or disorder.

38. Use according to claim 37, characterized in that: the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine and/or the pharmaceutical composition are used in a method for sustained killing of abnormally proliferative cells.

39. Use according to claim 38, characterized in that: the abnormally proliferative cell is selected from a tumor cell or a cell associated with a tumor tissue.

40. Use of a recombinant oncolytic virus of any one of claims 1-31, a vaccine of claim 34, a pharmaceutical composition of claim 35 in the manufacture of a medicament for treating a tumor.

41. The use according to claim 40, wherein: the tumor comprises a solid tumor or a hematological tumor.

42. The use according to claim 40, wherein: such tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-hodgkin's lymphoma, anal carcinoma, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder carcinoma, breast carcinoma, cervical carcinoma, chronic myeloproliferative neoplasm, colorectal carcinoma, endometrial carcinoma, ependymoma, esophageal carcinoma, diffuse large B-cell lymphoma, sensory neuroblastoma, ewing's sarcoma, oviduct carcinoma, gall bladder carcinoma, gastric carcinoma, gastrointestinal carcinoid carcinoma, hepatocellular carcinoma, hypopharyngeal carcinoma, kaposi's sarcoma, renal carcinoma, langerhans's cell hyperplasia, laryngeal carcinoma, liver carcinoma, lung carcinoma, melanoma, mercker cell carcinoma, mesothelioma, oral carcinoma, neuroblastoma, non-small cell lung carcinoma, osteosarcoma, ovarian carcinoma, pancreatic neuroendocrine tumors, pharyngeal carcinoma, pituitary carcinoma, prostate carcinoma, rectal carcinoma, renal cell carcinoma, retinoblastoma, skin carcinoma, small cell lung carcinoma, small intestine carcinoma, squamous carcinoma, testicular carcinoma, breast carcinoma, thyroid carcinoma, uterine carcinoma, vascular carcinoma, and carcinoma.