CN117397574A - Low-cost rape hybrid seed production method - Google Patents

Abstract

The invention discloses a low-cost rape hybrid seed production method, and relates to the field of cabbage type rape hybrid vigor utilization. Hybridization of an Ogura CMS sterile line serving as a female parent with a plant containing a sulfonylurea herbicide resistance site to obtain the Ogura CMS sterile line containing the sulfonylurea herbicide resistance site; (2) the Ogura CMS sterile line containing sulfonylurea herbicide resistance site is used as female parent and Ogura CMS restorer line is used as male parent according to the following 5:1, mixedly planting in a seed production field, and mixedly harvesting cabbage type rape seeds during maturation by adopting a conventional field management method; (3) the harvested seeds are planted in a common field, and the cabbage type rape hybrid with higher purity is obtained by spraying sulfonylurea herbicide in the seedling stage. The invention mixes the improved Ogura CMS sterile line and the female sterile restorer line in the seed production field to obtain the first filial generation, and the herbicide is sprayed in the seedling stage to obtain the rape hybrid with higher purity, thus the seed production cost can be greatly reduced; the invention also provides an effective method for the reproduction of restorer 9538R.

Description

Low-cost rape hybrid seed production method

Technical Field

The invention relates to the field of cabbage type rape hybrid vigor utilization, in particular to a low-cost rape hybrid seed production method, and in particular relates to an application of cabbage type rape female sterility 9538R serving as a restorer line in rape hybrid seed production.

Background

The heterosis utilization is an effective measure (Kempe & Gils 2011,Wang&Deng 2018) for improving the yield of crops, and compared with other crops, the heterosis utilization of rape is more remarkable, and the yield can be increased by 30-50%. The utilization of rape heterosis comprises four ways of artificial emasculation, chemical emasculation, male sterility and self-incompatibility seed production, wherein the male sterility is widely applied to rape hybrid seed production. Male sterility is largely divided into three types, photo-thermo-sensitive sterility, nuclear male sterility (GMS) and Cytoplasmic Male Sterility (CMS). Photo-thermo-sensitive sterility is realized by controlling photo-thermo conditions to reproduce sterile materials and produce hybrid seeds, and micro-powder phenomenon easily appears in a certain illumination and temperature variation range, so that the purity of the hybrid seed offspring is affected; the sterile line of thorough abortion can be obtained through nuclear male sterility, but the propagation of the sterile line needs a temporary maintainer line, and in addition, 50% of fertile plants need to be removed when the hybrid seeds are produced, so that the seed production cost is increased (Xia et al 2016); early cytoplasmic male sterility utilization was mainly based on Polima CMS (Singh & Brown 1991,Liu et al2016) and shan 2A CMS (Liao Zhijiang et al 2010), both belonging to homologous cytoplasmic sterility. Although their recovery sources are ubiquitous, these two sterile lines are susceptible to temperature effects to produce micropowder that affects the purity of the hybrid offspring. In recent years, the heterologous cytoplasmic sterile Ogura CMS has been widely used for rape hybrid production (Brown et al 2003,Desloire et al 2003,Duroc et al 2005,Yamagishi&Bhat 2014). On one hand, the sterile line is thoroughly aborted and is not affected by the environment; on the other hand, the mechanism of the Ogura CMS system is analyzed, namely, the expression of a mitochondrial gene ORF138 causes mitochondrial dysplasia to cause pollen abortion (Bellaoui et al 1999), the PPR-B protein coded by the restoring gene RFO thereof is transferred to mitochondria and can specifically bind ORF138 mRNA to block translation and extension thereof, thereby inhibiting the synthesis of the ORF138 protein and enabling the hybrid offspring to be fertile (Uyttewaal et al 2008). The male sterile line is a common method for producing seeds by modern hybridization, and a three-line two-field method is generally adopted, namely a male sterile line, a maintainer line, a restorer line, a parent propagation field (the male sterile line is hybridized with the maintainer line), and a hybridization seed production field (the male sterile line is hybridized with the restorer line).

The hybrid vigor is utilized to ensure the purity of the male sterile line and the restoring line, and the sterile line reproduction and hybrid seed production are simple and easy to operate, and the cost is low. In rape heterosis utilization, scientists usually use sterile lines with higher purity to hybridize with restorer lines to produce hybrids. In theory, this method is relatively easy to implement, but it also has disadvantages. Firstly, different materials need to be sown in a drill way during sowing; secondly, parents and parents need to harvest respectively during harvesting, otherwise, the purity of the hybrid seeds can be influenced, and the seed production cost is greatly increased. In order to reduce the seed production cost to the maximum extent, a new idea is provided: the female sterile restorer line is used as the male parent to hybridize with the sterile line, the restorer line can provide enough pollen and is not firm, the mixed harvest of the male parent and the female parent can be realized, the purity of the hybrid seeds is not affected, and the manpower, material resources and financial resources required by the production of the rape hybrid seeds are reduced.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provide a low-cost rape hybrid seed production method.

The object of the present invention is thus achieved.

Specifically, the invention comprises the following steps:

(1) hybridizing the Ogura CMS sterile line serving as a female parent with a plant containing a sulfonylurea herbicide resistance site to obtain the Ogura CMS sterile line containing the sulfonylurea herbicide resistance site;

(2) the Ogura CMS sterile line containing sulfonylurea herbicide resistance site is used as female parent and Ogura CMS restorer line is used as male parent according to the following 5:1, mixedly planting in a seed production field, and mixedly harvesting cabbage type rape seeds during maturation by adopting a conventional field management method;

(3) planting the harvested seeds in a common field, and spraying sulfonylurea herbicide in a seedling stage to obtain cabbage type rape hybrid with higher purity;

wherein:

the Ogura CMS sterile line in step (1) is Z11A, and the modified Ogura CMS sterile line is Z11AH, which contains sulfonylurea herbicide resistance;

the Ogura CMS restorer line in step (2) was 9538R, which was not different from the wild type in vegetative growth; during reproductive growth, 9538R pollen viability was normal; compared with the wild type, the radial width of the 9538R pistil is increased by 10-50%, and the longitudinal length is shortened by 7.4-21.8%; the length of the flower column of 9538R is reduced by 40.4-57.1% compared with the wild type; at maturity, the pod length of 9538R is 1.47cm significantly lower than wild-type 4.68cm; in addition, the average fruit grain per corner of 9538R (Wuhan, 0.95.+ -. 0.18; lanzhou, 3.83.+ -. 0.34) was reduced by 93.4-96.1% compared to wild type (Wuhan, 19.28.+ -. 0.68; lanzhou, 19.15.+ -. 0.94); the setting rate of 9538R is extremely low, and the labor, material and financial resources required by cutting off the male parent in the mature period can be saved when the seed is used as a restorer; in addition, the setting rate of 9538R can be increased whether the bagging is self-intersecting or double-layer tent is covered, so that the restoring line with low setting rate can be propagated by artificially increasing the environmental humidity;

the purity of the hybrid in the step (3) is identified by adopting a dominant marker BnRfo-AS2F/BnRfo-AS2S linked with the RFO gene.

Compared with the prior art, the invention has the following advantages and positive effects:

the improved Ogura CMS sterile line and female sterile restorer line are mixed and harvested in a seed production field to obtain a sub-generation, herbicide is sprayed in a seedling stage to obtain high-purity rape hybrid seeds, and the method can save different material drill sowing and manpower, material resources and financial resources required by cutting off male parent in a mature stage, and is suitable for mechanization. In addition, the biggest problem of low setting rate 9538R as a restorer line is self-propagation. The invention verifies through two points of Wuhan and Lanzhou that increasing the environmental humidity can obviously improve the setting percentage of 9538R, which lays a solid foundation for 9538R as rape hybrid seed production restorer. The invention also provides an effective method for the reproduction of restorer 9538R.

Drawings

FIG. 1 is an optimization of Ogura CMS sterile line Z11A and seed production of a rape hybrid;

FIG. 2 is the average fruit grain per corner for 9538R and wild type under different conditions;

FIG. 3 is the growth of the Ogura CMS sterile line and the 9538R restorer line at field maturity;

FIG. 4 is a schematic representation of seed production patterns for rape hybrids;

FIG. 5 shows that 9538R has a large difference in pistil development from the wild type.

Reference to the literature

1. Guan Wenjie, zhang Fugui, guixin, ma Qiming, wu Xiaoming. Development of research on herbicide resistance mechanism of rape and germplasm creation. Report of Chinese oil crop, 2021,43:1159-1173

2. Liao Zhijiang, kuang Chenguang, xu Lifang, zhou Chengyong. Main types of cytoplasmic male sterility of Brassica napus in China and application thereof in breeding practice. Chinese agronomic bulletin, 2010,26 (3): 105-110

3. Peng Hai, zhang Jing, zhou Junfei A. Chinese patent, NC 102910 A.2013-02-06

4. Song Fengshun, tiger, ni Jinlong, li Li, yang Jianbo. Methods for detecting purity of hybrid rice seed reviewed in Jiangsu agricultural science 2016 (6): 6

5、Kempe K&Gils M.Pollination control technologies for hybrid breeding.Molecular Breeding,2011,27:417-437

6、Wang H&Deng XW.Development of the"Third-Generation"Hybrid Rice in China.Genomics Proteomics Bioinformatics,2018,16(6):393-396

7、Xia S,Wang Z,Zhang H,Hu K,Zhang Z,Qin M,Dun X,Yi B,Wen J,Ma C.Altered Transcription and Neofunctionalization of Duplicated Genes Rescue the Harmful Effects of a Chimeric Gene in Brassica napus.Plant Cell,2016,28:tpc.00281.02016

8、Singh M&Brown GG.Suppression of cytoplasmic male sterility by nuclear genes alters expression of a novel mitochondrial gene region.Plant Cell,1991,3(12):1349-62

9、Liu Z,Yang Z,Wang X,Li K,An H,Liu J,Yang G,Fu T,Yi B,Hong D.A Mitochondria-targeted PPR protein restores pol cytoplasmic male sterility by reducing orf224 transcript levels in oilseed rape.Molecular Plant,2016,9(7):1082-4

10、Brown GG,FormanováN,Jin H,Wargachuk R,Dendy C,Patil P,Laforest M,Zhang J,Cheung WY,Landry BS.The radish Rfo restorer gene of Ogura cytoplasmic male sterility encodes a protein with multiple pentatricopeptide repeats.Plant Journal,2003,35(2):262-72

11、Desloire S,Gherbi H,Laloui W,Marhadour S,Clouet V,Cattolico L,Falentin C,Giancola S,Renard M,Budar F,Small I,Caboche M,Delourme R,Bendahmane A.Identification of the fertility restoration locus,Rfo,in radish,as a member of the pentatricopeptide-repeat protein family.EMBO Reports,2003,4(6):588-94

12、Duroc Y,Gaillard C,Hiard S,Defrance MC,Pelletier G,Budar F.Biochemical and functional characterization of ORF138,a mitochondrial protein responsible for Ogura cytoplasmic male sterility in Brassiceae.Biochimie,2005,87(12):1089-100

13、Yamagishi H&Bhat SR.Cytoplasmic male sterility in Brassicaceae crops.Breeding Science,2014,64(1):38-47

14、Bellaoui M,Grelon M,Pelletier G,Budar F.The restorer Rfo gene acts post-translationally on the stability of the ORF138 Ogura CMS-associated protein in reproductive tissues of rapeseed cybrids.Plant Mol Biol,1999,40:893-902

15、Uyttewaal M,Arnal N,Quadrado M,Martin-Canadell A,Vrielynck N,Hiard S,Gherbi H,Bendahmane A,Budar F,Mireau H.Characterization of Raphanus sativus pentatricopeptide repeat proteins encoded by the fertility restorer locus for Ogura cytoplasmic male sterility.Plant Cell,2008,20:3331-3345

16、Hu XY,Sullivan-Gilbert M,Kubik T,Danielson J,Hnatiuk N,Marchione W,Greene T,Thompson SA.Mapping of the Ogura fertility restorer gene Rfo and development of Rfo allele-specific markers in canola(Brassica napus L.).Molecular Breeding,2008,22:663-674

17、Guo Y,Cheng L,Long W,Gao J,Zhang J,Chen S,Pu H,Hu M.Synergistic mutations of two rapeseed AHAS genes confer high resistance to sulfonylurea herbicides for weed control.Theoretical and Applied Genetics,2020,133(10):2811-2824

Detailed Description

The invention is further defined below in connection with specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

1. Method of

1. Optimization of Ogura CMS sterile line Z11A and seed production of rape hybrid

As shown in fig. 1, the seed production includes the following steps:

(1) the Ogura CMS sterile line Z11A is used as a female parent, hybridized with the germplasm 5N containing sulfonylurea herbicides to generate F1, the F1 is subjected to prospect selection, and F1 single plants containing herbicide resistance are screened out and named as F1 (H);

(2) f1 (H) is hybridized with a maintainer line Z11, and a target single plant with herbicide resistance and higher background recovery rate is screened out through foreground selection and background selection;

(3) backcrossing the target single plant with a maintainer line Z11, continuously backcrossing for 3 generations, screening a target singular number which contains herbicide resistance and has a background recovery rate of more than 95%, and naming the target singular number as a Z11AH sterile line;

(4) the Z11AH sterile line was crossed with Ogura CMS restorer 9538R to obtain a child generation as a hybrid.

2. Average fruit grain number per corner of 9538R and wild type under different conditions

As shown in fig. 2, specifically: hybridizing in the natural state in the field, wherein the average number of fruits per horn of 9538R in the Wuhan is 0.95+/-0.18, and the average number of fruits per horn of the wild type in the Wuhan is 19.28+/-0.68; by bagging selfing, 9538R had an average number of grains per corner of 3.89.+ -. 0.56 in Wuhan and wild type had an average number of grains per corner of 19.+ -. 1.68 in Wuhan; outside the double layer account, 9538R had an average number of no corner pieces in lan of 3.83±0.34, and inside the double layer account, 9538R had an average number of pieces per corner in lan of 7.76±0.53.

3. Growth conditions of the Ogura CMS sterile line and 9538R restorer line at field maturity;

as shown in fig. 3, specifically: the 9538R restorer line has long flowering phase and normal pollen activity, and can provide enough pollen for the Ogura CMS sterile line Z11 AH. When the Ogura CMS sterile line received 9538R restorer pollen development to mature horn, the 9538R restorer was still in full bloom.

4. Rape hybrid seed production mode

As shown in fig. 4, specifically:

the optimized Ogura CMS sterile line Z11AH was used as female parent and 9538R restorer line as male parent, their seeds were prepared according to 5:1, sowing in a seed field after mixing, and mixing and harvesting seeds after the seeds are ripe; sowing the seeds obtained by mixing in a common field, and eliminating a small amount of restorer hybrid plants by spraying sulfonylurea herbicide in a seedling stage, thereby obtaining the rape hybrid seeds with higher purity.

2. Others

1. The identification of sulfonylurea herbicide resistance in the improved Ogura CMS sterile line Z11AH is carried out by Hi-Tom high throughput sequencing technology using ALS1F/R and ALS3F/R primers. When the sequencing result shows that the ALS1 and ALS3 genes both contain target mutation sites, the single plant carries sulfonylurea herbicide resistance sites.

ALS1F GTGGATATTGACGGTGATGGAAG——SEQ ID NO.1，

ALS1R CCCGAGATAAGTGTGAGCTCTG——SEQ ID NO.2；

ALS3F GGACATTGACGGTGATGGAAG——SEQ ID NO.3，

ALS3R GTCCCCGAGATAAGTGTGAGC——SEQ ID NO.4。

2. The Ogura CMS restorer 9538R has no difference in pollen viability from the wild type

As shown in fig. 5, 9538R showed a large difference from the development of the wild type pistil, which is expressed in: the radial width of the 9538R pistil is increased by 10-50% compared with the wild type, and the longitudinal length is shortened by 7.4-21.8% compared with the wild type; the length of the flower column of 9538R is reduced by 40.4-57.1% compared with the wild type; at maturity, the kerb fruit length of 9538R is 1.47cm significantly lower than that of wild type 4.68cm.

3. Purity identification of the obtained hybrid adopts dominant marker BnRfo-AS2F/BnRfo-AS2S linked with Ogura CMS restorer gene RFO. The primer sequences are as follows:

BnRfo-AS2F：CATGCTTCGATCTCGTCCTTTA，——SEQ ID NO.5

BnRfo-AS2S：GGTAACAACATCAGGGTGGAGT，——SEQ ID NO.6。

3. examples

1. Example 1: optimization of Ogura CMS sterile line Z11A

The radish cytoplasmic male sterile line Z11A is a sterile line with thorough pollen abortion and excellent agronomic characters, and is widely applied in agricultural production. With the expansion of the rape planting area and the continuous increase of the types of field weeds, the cost for manually controlling the field weeds of the rape is increased sharply, thereby affecting the wide popularization of the rape. The chemical herbicide (such as sulfonylurea herbicide) can effectively prevent and treat dicotyledonous broadleaf weeds, but no herbicide which only aims at broadleaf weeds but does not harm rape exists at present, so that the bred Ogura CMS sterile line with sulfonylurea herbicide resistance is beneficial to the healthy development of the rape industry. Resistance genes that are widely used today include ALS and EPSPS, which confer herbicide resistance to plants by inhibiting the binding of the herbicide to a target site. The 5N material controlled by 2 pairs of incomplete dominant nuclear genes (ALS 1) showed excellent herbicide resistance in the experiments, the present invention hybridized 5N as donor material with Z11A. And (3) performing prospect selection on the filial generation by using Hi-Tom high-throughput sequencing technology to obtain an ALS1 and ALS2 gene simultaneous mutation single plant. F1 containing herbicide resistance and maintainer line Z11 are subjected to background selection by using an AFLP molecular marker assisted selection technology, and the single plants which are more similar to Z11A are screened.

2. Example 2: breeding application of restorer 9538R

9538R was derived from Ogura restorer recurrent population and contained PPR-B protein blocking orf138 mRNA translation and extension, rendering the plants viable. The result of the acetate magenta staining shows that 9538R has no difference in pollen viability from the wild type and can provide enough pollen for the Ogura CMS sterile line. The field data of two years of Wuhan and Lanzhou show that the average fruit grain number per corner of 9538R is 0.95+/-0.18 and 3.83+/-0.34 respectively, which are extremely obviously lower than that of a wild type (19.28+/-0.68 and 19.15+/-0.94), and the 9538R can be mixed with a sterile line for harvest when being used as a restorer, so that the manpower, material resources and financial resources required by sowing different materials and cutting off male parent in a mature period are reduced, the mechanical seed production is suitable, and the seed production cost is greatly reduced. 9538R has a long flowering period, and the mixing ratio of the restorer seed 9538R can be properly reduced when the sterile line and the restorer are mixed.

The setting rate of 9538R is extremely low, and a core problem of this as a restorer is propagation of seeds. Through a pollen tube germination test, the mature pollen grains cannot normally pass through mastoid cells after falling on a 9538R column head, so that the setting rate is reduced; paraffin section results showed that 9538R had insufficient conduit at the junction of the stigma and style relative to the wild type, presumably 9538R had significantly reduced firmness due to insufficient moisture to provide pollen tube elongation. The test results of the field bagging selfing and the double-layer covering net show that the average fruit grain number per corner after 9538R bagging is 3.89, the average fruit grain number per corner of the double-layer covering net is 7.77, and the field bagging selfing and the double-layer covering net are remarkably higher than the setting rate of the free cross (the average fruit grain number per corner is 1), which shows that the setting rate of 9538R can be increased to a certain extent by increasing the environmental humidity.

3. Example 3: the optimized Ogura CMS sterile line Z11AH is taken as a female parent, the female sterile restorer line 9538R is taken as a male parent, and the seeds are mixed and sowed in a seed field according to a proper proportion, and the seeds are mixed and harvested in a mature period.

To ensure the purity of the hybrid seeds to a greater extent, the herbicide-resistant gene is transferred into the Ogura CMS sterile line Z11A, after herbicide is sprayed in the seedling stage, the hybrid F1 survives due to the herbicide-resistant gene, and a small amount of hybrid plants generated by the self-maturing of the female sterile restorer line 9538R can be eliminated due to the screening of chemical herbicide, so that the high-purity rape hybrid seeds are obtained. Sterile lines were propagated by crossing the optimized Ogura CMS sterile line Z11AH with the maintainer line Z11, and restorer lines were propagated by increasing the humidity of the female sterile restorer line 9538R during anthesis.

4. The working mechanism and creativity of the invention

The improved Ogura CMS sterile line and female sterile restorer line are mixed and harvested in a seed production field to obtain a sub-generation, herbicide is sprayed in a seedling stage to obtain high-purity rape hybrid seeds, and the method can save different material drill sowing and manpower, material resources and financial resources required by cutting off male parent in a mature stage, and is suitable for mechanization. In addition, the biggest problem of low setting rate 9538R as a restorer line is self-propagation. The invention verifies through two points of Wuhan and Lanzhou that increasing the environmental humidity can obviously improve the setting percentage of 9538R, which lays a solid foundation for 9538R as rape hybrid seed production restorer.

Claims (3)

1. A low-cost rape hybrid seed production method is characterized by comprising the following steps:

(1) hybridizing the Ogura CMS sterile line serving as a female parent with a plant containing a sulfonylurea herbicide resistance site to obtain the Ogura CMS sterile line containing the sulfonylurea herbicide resistance site;

(2) the Ogura CMS sterile line containing sulfonylurea herbicide resistance site is used as female parent and Ogura CMS restorer line is used as male parent according to the following 5:1, mixedly planting in a seed production field, and mixedly harvesting cabbage type rape seeds during maturation by adopting a conventional field management method;

(3) the harvested seeds are planted in a common field, and the cabbage type rape hybrid with higher purity is obtained by spraying sulfonylurea herbicide in the seedling stage.

2. The low cost canola hybrid seed production method of claim 1, wherein:

the propagation method of the low-setting-rate restorer 9538R can obviously improve the setting-rate of 9538R by increasing the environmental humidity, and is used for the propagation of the restorer. Wherein:

the Ogura CMS sterile line in step (1) is Z11A, and the modified Ogura CMS sterile line is Z11AH, which contains sulfonylurea herbicide resistance;

the Ogura CMS restorer line in step (2) was 9538R, which decreased the setting rate by 93.4% -96.1% compared to the wild type.

The purity of the hybrid in the step (3) is identified by adopting a dominant marker BnRfo-AS2F/BnRfo-AS2S linked with the RFO gene.

3. The low cost canola hybrid seed production method of claim 1, wherein:

9538R has an average number of grains per corner of 0.95+ -0.18 in Wuhan, which increases to 3.89+ -0.56 by increasing ambient humidity; similarly, 9538R had an average number of fruit pieces per corner in lan of 3.83±0.34, which increased to 7.76±0.53 by increasing ambient humidity.