CN117396480A - Pyrazolopyrimidinone compounds - Google Patents

Pyrazolopyrimidinone compounds Download PDF

Info

Publication number
CN117396480A
CN117396480A CN202280037770.6A CN202280037770A CN117396480A CN 117396480 A CN117396480 A CN 117396480A CN 202280037770 A CN202280037770 A CN 202280037770A CN 117396480 A CN117396480 A CN 117396480A
Authority
CN
China
Prior art keywords
pharmaceutically acceptable
compound
acceptable salt
alkyl
optionally substituted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280037770.6A
Other languages
Chinese (zh)
Inventor
尼尔·拉赫加
保罗·克罗
陶海燕
斯科特·撒切尔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Overn Pharmaceuticals
Original Assignee
Overn Pharmaceuticals
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Overn Pharmaceuticals filed Critical Overn Pharmaceuticals
Publication of CN117396480A publication Critical patent/CN117396480A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Endocrinology (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Reproductive Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

Pyrazolopyrimidinone compounds and pharmaceutical compositions comprising the compounds are provided herein.

Description

Pyrazolopyrimidinone compounds
Cross reference
The present application claims the benefit of U.S. provisional patent application No. 63/166,739 filed on 3/26, 2021, which is incorporated herein by reference in its entirety.
Background
Steroid production factor 1 (SF-1, NR5A 1) is a transcriptional regulator of genes involved in the development and function of steroid production tissues. SF-1 modulators provide an opportunity for new therapeutic compounds that modulate the growth and function of SF-1 dependent tissues.
Disclosure of Invention
The present disclosure provides, for example, pyrazolopyrimidine compounds, their use as medicaments for the treatment of cancer, methods of preparation thereof, and pharmaceutical compositions comprising the disclosed compounds as at least one active ingredient. The present disclosure also provides the use of a compound described herein as a medicament and/or in the manufacture of a medicament for the treatment of cancer, endocrinopathy and endometriosis.
In one aspect are compounds of formula (I):
wherein:
x is a bond or C 1 -C 6 An alkylene group;
R 1 selected from C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 4 Substitution;
R 2 selected from C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 5 Substitution;
R 3 is hydrogen, C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 3-8 Cycloalkyl;
each R 4 And each R 5 Each independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 6 、-SR 6 、-C(O)OR 6 、-OC(O)N(R 6 )(R 7 )、-N(R 8 )C(O)N(R 6 )(R 7 )、-N(R 8 )C(O)R 9 、-N(R 8 )C(O)OR 9 、-N(R 8 )S(O) 2 R 9 、-C(O)R 9 、-OC(O)R 9 、-C(O)N(R 6 )(R 7 )、-C(O)C(O)N(R 6 )(R 7 )、-S(O)R 9 、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ) Wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 10 、-SR 10 、-C(O)OR 10 、-OC(O)N(R 10 )(R 11 )、-N(R 12 )C(O)N(R 10 )(R 11 )、-N(R 12 )C(O)R 13 、-N(R 12 )C(O)OR 13 、-N(R 12 )S(O) 2 R 13 、-C(O)R 13 、-OC(O)R 13 、-C(O)N(R 10 )(R 11 )、-C(O)C(O)N(R 10 )(R 11 )、-S(O)R 13 、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 )；
Each R 6 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 7 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 8 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 9 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 10 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 12 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group; and is also provided with
Each R 13 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
or a pharmaceutically acceptable salt or solvate thereof.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Selected from C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment are compounds of formula (I), or a pharmaceutically acceptable thereofSalts of R 1 Is C 1-9 Heteroaryl, optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is pyridinyl, which is optionally substituted by one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 3-8 Cycloalkyl optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodimentIn the scheme are compounds of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is tetrahydropyranyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 6 Independently selected from hydrogen and C 1-6 Alkyl group, C 1-6 The alkyl groups are optionally substituted with one, two or three groups selected from halogen andand (3) substituting a hydroxyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is C 1 -C 6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is a bond. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is C 1 -C 6 An alkylene group.
In another embodiment is a pharmaceutical composition comprising a compound of formula (I), or a pharmaceutically acceptable salt thereof, as described herein, and at least one pharmaceutically acceptable excipient.
In another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from the group consisting of adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenoma, and coixointerstitial tumor. In another embodiment is a method of treating cancer in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is adrenocortical carcinoma.
In another embodiment is a method of treating an endocrine disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In another embodiment is a method of treating an endocrine disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the endocrine disorder is selected from the group consisting of endogenous cushing's syndrome (endogenous Cushing's syndrome), congenital adrenocortical hyperplasia, and polycystic ovary syndrome.
In another embodiment is a method of treating endometriosis in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof.
Detailed Description
Steroid production factor 1 (SF-1, NR5A 1) is a transcriptional regulator of genes involved in the development and function of steroid production tissues. After birth, SF-1 is expressed in the adrenal cortex and gonads, pituitary gonadotrophin cells, hypothalamic ventral medial nucleus (VMH) and spleen vasculature.
Targeted deletion of the SF-1 gene in mice results in adrenal and gonadal hypoplasia and post-partum mortality due to severe adrenal insufficiency. In humans, partial loss of function mutations of SF-1 are associated with sexual dysfunction and severe adrenal insufficiency.
SF-1 plays an important role in steroid hormone synthesis by regulating transcription of steroid-producing genes including StAR, cyp11a1, cyp17, CYP21, cyp11b1, cyp11b2 and 3β -Hsd. The transcriptional activity of SF-1 can be stimulated by binding of corticotropin (ACTH) to melanocortin 2 receptors (MC 2R) in the adrenal cortex.
SF-1 protein has a modular domain structure that includes an N-terminal zinc finger DNA Binding Domain (DBD), a Ligand Binding Domain (LBD), a C-terminal AF-2 activation domain, and an intermediate hinge region. SF-1 also contains a 30 amino acid extension of DBD, which mediates binding to specific DNA recognition motifs. Unlike most other nuclear receptor transcription factors, SF-1 interacts as a monomer with its DNA recognition motif. SF-1 activity is regulated by phosphoinositides and other phospholipids that bind to the large hydrophobic pocket within SF-1 LBD.
SF-1 is highly expressed in ectopic endometrial lesions, at least 1,000-fold at the mRNA level and about 5-fold at the protein level, compared to normal endometrium. Furthermore, SF-1 expression is closely related to aromatase expression in endometriotic tissue, indicating that SF-1 is an important regulator of intracellular estrogen biosynthesis.
Genomic, clinical and pathological studies have shown that SF-1 is a key transcription factor in the pathogenesis of adrenocortical carcinoma (ACC). In adult ACC, higher tumor SF-1 expression levels are associated with higher risk of death. In pediatric ACC SF-1 is overexpressed at protein and/or chromosome level in about 90% of cases. SF-1 is also highly expressed in mesothelioma (e.g., sertoli cell tumor) and ectopic in sub-populations of ovarian serous, head and neck cancers, and widely expressed in endometriosis.
Postpartum loss of SF-1 in VMH results in high fat diet induced obesity due to heat production impairment and leptin signaling retardation, suggesting that SF-1 is an important regulator of energy metabolism.
In addition, SF-1 antagonists may block pituitary gonadotrophin cell release or inhibit the production of adrenal steroids, including cortisol or adrenal androgens. Potential indications include hormone-dependent prostate cancer, endogenous cushing's syndrome, congenital adrenocortical hyperplasia and polycystic ovary syndrome, as well as other endocrine dysfunctional disorders.
SF-1 antagonists may be a promising approach for new therapeutic compounds.
As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an agent" includes a plurality of such agents, and reference to "a cell" includes reference to one or more cells (or cells) and equivalents thereof. When a range is used herein for a physical property, such as molecular weight, or a chemical property, such as a formula, it is intended to include all combinations and subcombinations of the ranges, as well as specific embodiments thereof. When referring to a number or range of values, the term "about" means that the number or range of values referred to is an approximation within experimental variability (or statistical experimental error), and thus the number or range of values varies from 1% to 15% of the number or range of values. The term "comprising" (and related terms such as "comprising" or "including" or "having" or "comprising") is not intended to exclude that in other certain embodiments, for example, embodiments of compositions, methods or processes of any of the substances described herein may "consist of" or "consist essentially of" the features described.
Definition of the definition
As used in the specification and the appended claims, the following terms have the meanings indicated below, unless specified to the contrary.
As used herein, C 1 -C x Comprises C 1 -C 2 、C 1 -C 3 ……C 1 -C x 。C 1 -C x Refers to the number of carbon atoms (excluding optional substituents) that make up a designated portion thereof.
"amino" means-NH 2 A group.
"cyano" refers to a-CN group.
"nitro" means-NO 2 A group.
"oxa" refers to an-O-group.
"oxo" refers to an =o group.
"thio" refers to the = S group.
"imino" refers to a = N-H group.
"oximo" refers to an =n-OH group.
"alkyl" or "alkylene" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, free of unsaturation, having one to eighteen carbon atoms (e.g., C 1 -C 18 Alkyl). In certain embodiments, the alkyl group contains three to eighteen carbon atoms (e.g., C 3 -C 18 Alkyl). In certain embodiments, the alkyl group contains one to fifteen carbon atoms (e.g., C 1 -C 15 Alkyl). In certain embodimentsIn which the alkyl group contains one to twelve carbon atoms (e.g., C 1 -C 12 Alkyl). In certain embodiments, the alkyl group comprises one to eight carbon atoms (e.g., C 1 -C 8 Alkyl). In other embodiments, the alkyl group comprises one to six carbon atoms (e.g., C 1 -C 6 Alkyl). In other embodiments, the alkyl group comprises one to five carbon atoms (e.g., C 1 -C 5 Alkyl). In other embodiments, the alkyl group comprises one to four carbon atoms (e.g., C 1 -C 4 Alkyl). In other embodiments, the alkyl group comprises one to three carbon atoms (e.g., C 1 -C 3 Alkyl). In other embodiments, the alkyl group comprises one to two carbon atoms (e.g., C 1 -C 2 Alkyl). In other embodiments, the alkyl group comprises one carbon atom (e.g., C 1 Alkyl). In other embodiments, the alkyl groups contain five to fifteen carbon atoms (e.g., C 5 -C 15 Alkyl). In other embodiments, the alkyl groups contain five to eight carbon atoms (e.g., C 5 -C 8 Alkyl). In other embodiments, the alkyl groups comprise two to five carbon atoms (e.g., C 2 -C 5 Alkyl). In other embodiments, the alkyl groups comprise three to five carbon atoms (e.g., C 3 -C 5 Alkyl). In other embodiments, the alkyl group is selected from methyl, ethyl, 1-propyl (n-propyl), 1-methylethyl (isopropyl), 1-butyl (n-butyl), 1-methylpropyl (sec-butyl), 2-methylpropyl (isobutyl), 1-dimethylethyl (tert-butyl), and 1-pentyl (n-pentyl). The alkyl group is attached to the remainder of the molecule by a single bond. Unless explicitly stated otherwise in the specification, an alkyl group is optionally substituted with one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximino, trimethylsilyl, -OR a 、-SR a 、-OC(O)-R f 、-N(R a ) 2 、-C(O)R a 、-C(O)OR a 、-C(O)N(R a ) 2 、-N(R a )C(O)OR f 、-OC(O)-NR a R f 、-N(R a )C(O)R f 、-N(R a )S(O) t R f (wherein t is 1 or 2), -S (O) t OR a (wherein t is 1 or 2), -S (O) t R f (wherein t is 1 or 2) and-S (O) t N(R a ) 2 (wherein t is 1 or 2) wherein each R a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f Independently is alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
"alkoxy" refers to a group of formula-O-alkyl bonded through an oxygen atom, wherein alkyl is an alkyl chain as defined above.
"alkenyl" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, containing at least one carbon-carbon double bond, and having from two to eighteen carbon atoms. In certain embodiments, alkenyl groups comprise three to eighteen carbon atoms. In certain embodiments, alkenyl groups comprise three to twelve carbon atoms. In certain embodiments, alkenyl groups comprise six to twelve carbon atoms. In certain embodiments, alkenyl groups comprise six to ten carbon atoms. In certain embodiments, alkenyl groups comprise eight to ten carbon atoms. In certain embodiments, alkenyl groups comprise two to eight carbon atoms. In other embodiments, alkenyl groups comprise two to four carbon atoms. Alkenyl is attached to the remainder of the molecule by a single bond, e.g., vinyl (i.e., vinyl), prop-1-enyl (i.e., allyl), but-1-enyl, pent-1, 4-dienyl, and the like. Unless explicitly stated otherwise in the specification, an alkenyl group is optionally substituted with one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximino, trimethylsilyl, -OR a 、-SR a 、-OC(O)-R f 、-N(R a ) 2 、-C(O)R a 、-C(O)OR a 、-C(O)N(R a ) 2 、-N(R a )C(O)OR f 、-OC(O)-NR a R f 、-N(R a )C(O)R f 、-N(R a )S(O) t R f (wherein t is 1 or 2), -S (O) t OR a (wherein t is 1 or 2), -S (O) t R f (wherein t is 1 or 2) and-S (O) t N(R a ) 2 (wherein t is 1 or 2) wherein each R a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f Independently is alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
"alkynyl" refers to a straight or branched hydrocarbon chain radical consisting of only carbon and hydrogen atoms, containing at least one carbon-carbon triple bond, having from two to eighteen carbon atoms. In certain embodiments, alkynyl groups contain three to eighteen carbon atoms. In certain embodiments, alkynyl groups contain three to twelve carbon atoms. In certain embodiments, alkynyl groups contain six to twelve carbon atoms. In certain embodiments, alkynyl groups contain six to ten carbon atoms. In certain embodiments, alkynyl groups contain eight to ten carbon atoms. In certain embodiments, alkynyl groups contain two to eight carbon atoms. In other embodiments, alkynyl groups have two to four carbon atoms. Alkynyl groups are attached to the remainder of the molecule by single bonds, e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like. Unless explicitly stated otherwise in the specification, alkynyl groups are optionally substituted with one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximino, trimethylsilyl, -OR a 、-SR a 、-OC(O)-R f 、-N(R a ) 2 、-C(O)R a 、-C(O)OR a 、-C(O)N(R a ) 2 、-N(R a )C(O)OR f 、-OC(O)-NR a R f 、-N(R a )C(O)R f 、-N(R a )S(O) t R f (wherein t is 1 or 2), -S (O) t OR a (wherein t is 1 or 2), -S (O) t R f (wherein t is 1 or 2) and-S (O) t N(R a ) 2 (wherein t is 1 or 2)Wherein each R is a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f Independently is alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
"aryl" refers to a group derived from an aromatic monocyclic or multicyclic hydrocarbon ring system by removal of a hydrogen atom from a ring carbon atom. An aromatic monocyclic or polycyclic hydrocarbon ring system containing only hydrogen and carbon of six to eighteen carbon atoms, wherein at least one ring of the ring system is fully unsaturated, i.e. it contains a cyclic, delocalized (4n+2) pi-electron system according to Huckel theory. Ring systems from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetrahydronaphthalene, and naphthalene. Unless explicitly stated otherwise in the specification, the term "aryl" or the prefix "aryl" (such as in "aralkyl") is intended to include aryl groups optionally substituted with one or more substituents selected from the group consisting of alkyl, alkenyl, alkynyl, halo, haloalkyl, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a 、-R b -OC(O)-R a 、-R b -OC(O)-OR a 、-R b -OC(O)-N(R a ) 2 、-R b -N(R a ) 2 、-R b -C(O)R a 、-R b -C(O)OR a 、-R b -C(O)N(R a ) 2 、-R b -O-R c -C(O)N(R a ) 2 、-R b -N(R a )C(O)OR a 、-R b -N(R a )C(O)R a 、-R b -N(R a )S(O) t R a (wherein t is 1 or 2), -R b -S(O) t OR a (wherein t is 1 or 2), -R b -S(O) t R a (wherein t is 1 or 2) and-R b -S(O) t N(R a ) 2 (wherein t is 1 or 2), wherein each R a Independently hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, arylAralkyl, heterocycloalkyl, heteroaryl or heteroarylalkyl, each R b Independently is a direct bond or a linear or branched alkylene or alkenylene chain, and R c Is a straight or branched alkylene or alkenylene chain.
"aryloxy" refers to a group of formula-O-aryl bonded through an oxygen atom, wherein aryl is as defined above.
"aralkyl" means a compound of formula-R c -aryl groups, wherein R c Is an alkylene chain as defined above, e.g., methylene, ethylene, and the like. The alkylene chain portion of the aralkyl group is optionally substituted as described above for the alkylene chain. The aryl portion of the aralkyl group is optionally substituted as described above for the aryl group.
"aralkoxy" refers to a group of formula-O-aralkyl bonded through an oxygen atom, wherein aralkyl is as defined above.
"aralkenyl" means a radical of formula-R d -aryl groups, wherein R d Is an alkenylene chain as defined above. The aryl portion of the arylalkenyl group is optionally substituted as described above for the aryl group. The alkenylene moiety of the aralkenyl group is optionally substituted as defined above for the alkenylene group.
"aralkynyl" means-R e -aryl groups, wherein R e Are alkynylene chains as defined above. The aryl portion of the arynyl group is optionally substituted as described above for the aryl group. The alkynylene chain portion of the arylalkynyl group is optionally substituted as defined above for the alkynylene chain.
"cycloalkyl" refers to a stable, non-aromatic, monocyclic or polycyclic hydrocarbon group consisting of only carbon and hydrogen atoms, which includes fused or bridged ring systems having from three to fifteen carbon atoms. In certain embodiments, cycloalkyl groups comprise three to ten carbon atoms. In other embodiments, cycloalkyl groups comprise five to seven carbon atoms. Cycloalkyl groups are attached to the rest of the molecule by single bonds. Cycloalkyl groups being saturated (i.e. containing only C-C single bonds) or partially unsaturated (i.e. containing one or more double or triple bonds. ) Examples of monocyclic cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In certain embodiments, cycloalkyl groups comprise three to eight carbon atoms (e.g., C 3 -C 8 Cycloalkyl). In other embodiments, cycloalkyl groups contain three to seven carbon atoms (e.g., C 3 -C 7 Cycloalkyl). In other embodiments, cycloalkyl groups comprise three to six carbon atoms (e.g., C 3 -C 6 Cycloalkyl). In other embodiments, cycloalkyl groups comprise three to five carbon atoms (e.g., C 3 -C 5 Cycloalkyl). In other embodiments, cycloalkyl groups comprise three to four carbon atoms (e.g., C 3 -C 4 Cycloalkyl). Partially unsaturated cycloalkyl groups are also referred to as "cycloalkenyl". Examples of monocyclic cycloalkenyl groups include, for example, cyclopentenyl, cyclohexenyl, cycloheptenyl, and cyclooctenyl. Polycyclic cycloalkyl groups include, for example, adamantyl, norbornyl (i.e., bicyclo [ 2.2.1)]Heptyl), norbornenyl, decahydronaphthyl, 7-dimethyl-bicyclo [2.2.1]Heptyl, and the like. Unless explicitly stated otherwise in the specification, the term "cycloalkyl" is intended to include cycloalkyl groups optionally substituted with one or more substituents selected from the group consisting of alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thioxo, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a 、-R b -OC(O)-R a 、-R b -OC(O)-OR a 、-R b -OC(O)-N(R a ) 2 、-R b -N(R a ) 2 、-R b -C(O)R a 、-R b -C(O)OR a 、-R b -C(O)N(R a ) 2 、-R b -O-R c -C(O)N(R a ) 2 、-R b -N(R a )C(O)OR a 、-R b -N(R a )C(O)R a 、-R b -N(R a )S(O) t R a (wherein t is 1 or 2), -R b -S(O) t OR a (wherein t is 1 or 2), -R b -S(O) t R a (wherein t is 1 or 2) and-R b -S(O) t N(R a ) 2 (wherein t is 1 or 2), wherein each R a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, each R b Independently is a direct bond or a linear or branched alkylene or alkenylene chain, and R c Is a straight or branched alkylene or alkenylene chain.
"halo" or "halogen" refers to a bromo, chloro, fluoro or iodo substituent.
"haloalkyl" refers to an alkyl group as defined above substituted with one or more halo groups as defined above.
"haloalkoxy" refers to an alkoxy group as defined above substituted with one or more halo groups as defined above.
"fluoroalkyl" is an alkyl group as defined above substituted with one or more fluoro groups as defined above, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, 2-trifluoroethyl, 1-fluoromethyl-2-fluoroethyl, and the like. The alkyl portion of the fluoroalkyl group is optionally substituted as defined above for the alkyl group.
"heterocycloalkyl" means a stable 3 to 18 membered non-aromatic ring group containing two to twelve carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur. Unless explicitly stated otherwise in the present specification, a heterocycloalkyl group is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, including fused, spiro or bridged ring systems. The heteroatoms in the heterocycloalkyl group are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocycloalkyl group is partially or fully saturated. In some embodiments, the heterocycloalkyl is attached to the remainder of the molecule through any atom in the ring. Examples of such heteroaryl groups include, but are not limited to, dioxolanyl, thienyl [1,3 ] ]Dithiocyclohexenyl (thienyl [1, 3)]dithianyl), decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, and the like,Morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl, tetrahydropyranyl, thiomorpholinyl, 1-oxo-thiomorpholinyl, and 1, 1-dioxo-thiomorpholinyl. Unless explicitly stated otherwise in the specification, the term "heterocycloalkyl" is intended to include heterocycloalkyl groups as defined above optionally substituted with one or more substituents selected from alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thio, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a 、-R b -OC(O)-R a 、-R b -OC(O)-OR a 、-R b -OC(O)-N(R a ) 2 、-R b -N(R a ) 2 、-R b -C(O)R a 、-R b -C(O)OR a 、-R b -C(O)N(R a ) 2 、-R b -O-R c -C(O)N(R a ) 2 、-R b -N(R a )C(O)OR a 、-R b -N(R a )C(O)R a 、-R b -N(R a )S(O) t R a (wherein t is 1 or 2), -R b -S(O) t OR a (wherein t is 1 or 2), -R b -S(O) t R a (wherein t is 1 or 2) and-R b -S(O) t N(R a ) 2 (wherein t is 1 or 2), wherein each R a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, each R b Independently is a direct bond or a linear or branched alkylene or alkenylene chain, and R c Is a straight or branched alkylene or alkenylene chain.
"heteroaryl" refers to a group derived from a 3 to 18 membered aromatic ring group containing one to seventeen carbon atoms and one toSix heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, heteroaryl groups are monocyclic, bicyclic, tricyclic or tetracyclic ring systems, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) pi-electron system according to huckel theory. Heteroaryl groups include fused or bridged ring systems. The heteroatoms in the heteroaryl group are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. Heteroaryl groups are attached to the remainder of the molecule through any atom in the ring. Unless explicitly stated otherwise in the specification, the term "heteroaryl" is intended to include heteroaryl groups as defined above optionally substituted with one or more substituents selected from alkyl, alkenyl, alkynyl, halo, haloalkyl, oxo, thio, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a 、-R b -OC(O)-R a 、-R b -OC(O)-OR a 、-R b -OC(O)-N(R a ) 2 、-R b -N(R a ) 2 、-R b -C(O)R a 、-R b -C(O)OR a 、-R b -C(O)N(R a ) 2 、-R b -O-R c -C(O)N(R a ) 2 、-R b -N(R a )C(O)OR a 、-R b -N(R a )C(O)R a 、-R b -N(R a )S(O) t R a (wherein t is 1 or 2), -R b -S(O) t OR a (wherein t is 1 or 2), -R b -S(O) t R a (wherein t is 1 or 2) and-R b -S(O) t N(R a ) 2 (wherein t is 1 or 2), wherein each R a Independently is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, each R b Independently is a direct bond or a linear or branched alkylene or alkenylene chain, and R c Is a straight or branched alkylene or alkenylene chain.
"N-heteroaryl" refers to a heteroaryl group as defined above containing at least one nitrogen, wherein the point of attachment of the heteroaryl group to the remainder of the molecule is through a nitrogen atom in the heteroaryl group. The N-heteroaryl group is optionally substituted as described above for the heteroaryl group.
"C-heteroaryl" refers to a heteroaryl group as defined above and wherein the point of attachment of the heteroaryl group to the remainder of the molecule is through a carbon atom in the heteroaryl group. The C-heteroaryl group is optionally substituted as described above for the heteroaryl group.
"heteroaryloxy" refers to a group of the formula-O-heteroaryl bonded through an oxygen atom, wherein heteroaryl is as defined above.
"heteroarylalkyl" means a compound of formula-R c -heteroaryl groups, wherein R c Is an alkylene chain as defined above. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally attached to the alkyl group at a nitrogen atom. The alkylene chain of the heteroarylalkyl group is optionally substituted as defined above for the alkylene chain. The heteroaryl portion of the heteroarylalkyl group is optionally substituted as defined above for the heteroaryl group.
"heteroarylalkoxy" means a compound of formula-O-R c -an oxygen atom-bonded group of heteroaryl, wherein R c Is an alkylene chain as defined above. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally attached to the alkyl group at a nitrogen atom. The alkylene chain of the heteroarylalkoxy group is optionally substituted as defined above for the alkylene chain. The heteroaryl portion of the heteroarylalkoxy group is optionally substituted as defined above for the heteroaryl group.
In some embodiments, compounds of the present disclosure contain one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomeric forms, which are defined as (R) -or (S) -, depending on the absolute stereochemistry. All stereoisomeric forms of the compounds of the present disclosure are intended to be contemplated by the present disclosure, unless otherwise indicated. When the compounds described herein contain olefinic double bonds, and unless specified otherwise, the present disclosure is intended to include both E and Z geometric isomers (e.g., cis or trans.) as well as all possible isomers, as well as their racemic and optically pure forms, as well as all tautomeric forms. The term "geometric isomer" refers to the E or Z geometric isomer (e.g., cis or trans) of an olefinic double bond. The term "positional isomer" refers to structural isomers around a central ring, such as ortho, meta and para isomers around a benzene ring.
"tautomer" refers to a molecule in which proton transfer from one atom of the molecule to another atom of the same molecule may occur. In certain embodiments, the compounds presented herein exist as tautomers. In the case where tautomerization is likely to exist, there will be a chemical equilibrium of the tautomers. The exact proportion of tautomers depends on several factors, including physical state, temperature, solvent and pH. Some examples of tautomeric balances include:
"optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted aryl" means that the aryl group is substituted or unsubstituted, and the description includes both substituted aryl groups and unsubstituted aryl groups.
"pharmaceutically acceptable salts" include both acid addition salts and base addition salts.
"pharmaceutically acceptable acid addition salts" refer to those salts that retain the biological effectiveness and properties of the free base, are not biologically or otherwise undesirable, and are formed from mineral acids such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, hydroiodic, hydrofluoric, phosphorous, and the like. Also included are salts formed from organic acids such as aliphatic mono-and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, alkanoic diacids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like, and include, for example, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Thus, exemplary salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, trifluoroacetate, propionate, octanoate, isobutyrate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, mandelate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, phthalate, benzenesulfonate, toluenesulfonate, phenylacetate, citrate, lactate, malate, tartrate, methanesulfonate, and the like. Salts of amino acids such as arginine salts, gluconate, and galacturonate are also contemplated (see, e.g., berge s.m. et al, "Pharmaceutical Salts," Journal of Pharmaceutical Science,66:1-19 (1997)). Acid addition salts of basic compounds are prepared by contacting the free base form with a sufficient amount of the desired acid to produce the salt.
By "pharmaceutically acceptable base addition salts" is meant those salts that retain the biological effectiveness and properties of the free acid, which are not biologically or otherwise undesirable. These salts are prepared by adding an inorganic or organic base to the free acid. In some embodiments, the pharmaceutically acceptable base addition salt is formed from a metal or amine, such as an alkali metal and alkaline earth metal or an organic amine. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. Salts derived from organic bases include, but are not limited to, the following: primary, secondary and tertiary amines, substituted amines include naturally occurring substituted amines, cyclic amines and basic ion exchange resins, for example, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, N-dibenzylethylenediamine, chloroprocaine, hydrabamine, choline, betaine, ethylenediamine, ethylenediphenylamine (ethylenediniine), N-methylglucamine, glucosamine, methylglucamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. See Berge et al, supra.
The term "subject" or "patient" includes mammals. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates, such as chimpanzees and the like, as well as other apes and monkey species; farm animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs, and cats; laboratory animals include rodents such as rats, mice, guinea pigs, and the like. In one aspect, the mammal is a human.
As used herein, "treatment" or "alleviation" or "amelioration" are used interchangeably herein. These terms refer to methods of achieving a beneficial or desired result, including, but not limited to, a therapeutic benefit and/or a prophylactic benefit. By "therapeutic benefit" is meant eradication or amelioration of the underlying disorder being treated. In addition, therapeutic benefit is obtained by eradicating or ameliorating one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, even if the patient is still suffering from the underlying disorder. For prophylactic benefit, the compositions are administered to patients at risk of developing a particular disease, or to patients reporting one or more physiological symptoms of the disease, even if a diagnosis of the disease has not been made.
Compounds of formula (I)
The compounds of formula (I) described herein are SF-1 modulators. In some embodiments, the compounds of formula (I) described herein are SF-1 antagonists. In some embodiments, the compounds of formula (I) and compositions comprising these compounds described herein are SF-1 antagonists useful in the treatment of cancer.
In some embodiments are compounds of formula (I):
wherein:
x is a bond or C 1 -C 6 An alkylene group;
R 1 selected from C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 4 Substitution;
R 2 selected from C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 5 Substitution;
R 3 is hydrogen, C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 3-8 Cycloalkyl;
each R 4 And each R 5 Each independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 6 、-SR 6 、-C(O)OR 6 、-OC(O)N(R 6 )(R 7 )、-N(R 8 )C(O)N(R 6 )(R 7 )、-N(R 8 )C(O)R 9 、-N(R 8 )C(O)OR 9 、-N(R 8 )S(O) 2 R 9 、-C(O)R 9 、-OC(O)R 9 、-C(O)N(R 6 )(R 7 )、-C(O)C(O)N(R 6 )(R 7 )、-S(O)R 9 、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ) Wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 10 、-SR 10 、-C(O)OR 10 、-OC(O)N(R 10 )(R 11 )、-N(R 12 )C(O)N(R 10 )(R 11 )、-N(R 12 )C(O)R 13 、-N(R 12 )C(O)OR 13 、-N(R 12 )S(O) 2 R 13 、-C(O)R 13 、-OC(O)R 13 、-C(O)N(R 10 )(R 11 )、-C(O)C(O)N(R 10 )(R 11 )、-S(O)R 13 、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 )；
Each R 6 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 7 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 8 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 9 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 10 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 12 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group; and is also provided with
Each R 13 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
or a pharmaceutically acceptable salt or solvate thereof.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two, three, four or five R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two or three R 4 Substitution, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one R 4 Substitution, wherein R 4 Selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one, two or three R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, which is substituted by one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, optionally substituted with one R 4 Substitution, wherein R 4 Selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, which is substituted by one R 4 Substitution, wherein R 4 Selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, which is substituted by one R 4 Substitution, wherein R 4 Is C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, which is substituted by one R 4 Substitution, wherein R 4 Is halogen. In another embodiment are compounds of formula (I), or a pharmaceutical thereofSalts of the above acceptable, wherein R 1 Is phenyl, which is substituted by one R 4 Substitution, wherein R 4 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is phenyl, which is substituted by one R 4 Substitution, wherein R 4 is-OR 6 。
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted phenyl.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 4 Substitution, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one R 4 Substitution, wherein R 4 Selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one or two R 4 Substitution, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one R 4 Substitution, wherein R 4 Selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one R 4 Substitution, wherein R 4 Selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one R 4 Substitution, wherein R 4 Is C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one R 4 Substitution, wherein R 4 Is halogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one R 4 Substitution, wherein R 4 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 1-9 Heteroaryl, which is substituted with one R 4 Substitution, wherein R 4 is-OR 6 . In some embodiments compounds of formula (I) described herein, wherein R 1 Is C 1-9 Heteroaryl, C 1-9 Heteroaryl is pyridinyl.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted C 1-9 Heteroaryl groups. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is an unsubstituted pyridyl group.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 is-CH 2 C 6-10 Aryl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is benzyl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted benzyl.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted C 2-9 A heterocycloalkyl group.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is C 3-8 Cycloalkyl optionally substituted with one, two or three R 4 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 Is unsubstituted C 3-8 Cycloalkyl groups.
In another embodiment isA compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 3-8 Cycloalkyl optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen,-OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally substituted with one or two R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, optionally interrupted by one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted and R 5 is-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 is-OR 6 And R is 6 Selected from hydrogen and C 1-6 Alkyl group, itOptionally substituted with one, two or three groups selected from: halogen and hydroxy. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by one, two or three halogens 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by a hydroxy group 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is unsubstituted C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, and R 5 Is C 1-6 Alkyl optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 Is C 1-6 Alkyl optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 and-C (O) N (R) 10 )(R 11 ) And R is 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is cyclohexyl, which is covered by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is an unsubstituted cyclohexyl group.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl group, C 1-6 The alkyl groups are optionally substituted with one, two or three groups selected fromGroup substitution: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one or two R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, optionally substituted with one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group being optionally taken by a group selected fromAnd (3) substitution: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted and R 5 is-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Selected from hydrogen and C 1-6 Alkyl optionally substituted with one, two or three groups selected from: halogen and hydroxy. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by one, two or three halogens 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by a hydroxy group 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is unsubstituted C 1-6 An alkyl group. In another embodiment are compounds of formula (I), or a pharmaceutically acceptable thereofAcceptable salts, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, and R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 and-C (O) N (R) 10 )(R 11 ) And R is 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is phenyl, which is substituted by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is unsubstituted phenyl.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is optionally covered withOne, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one or two R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted and R 5 is-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Selected from hydrogen and C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: halogen and hydroxy. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by one, two or three halogens 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is substituted by a hydroxy group for C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 is-OR 6 And R is 6 Is unsubstituted C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, and R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 and-C (O) N (R) 10 )(R 11 ) And R is 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, which is substituted by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is unsubstituted C 2-9 A heterocycloalkyl group. In some embodiments compounds of formula (I) described herein, wherein R 2 Is C 2-9 Heterocycloalkyl, C 2-9 Heterocyclylalkyl is tetrahydropyranyl.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 5 And (3) substitution. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 ). In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one, two or three R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one or two R 5 Substituted, and each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, optionally substituted with one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, and R 5 Selected from halogen, -OR 6 And C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted and R 5 is-OR 6 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 is-OR 6 And R is 6 Selected from hydrogen and C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: halogen and hydroxy. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 is-OR 6 And R is 6 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 is-OR 6 And R is 6 Is C substituted by one, two or three halogens 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 is-OR 6 And R is 6 Is taken by a hydroxy groupSubstituted C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 is-OR 6 And R is 6 Is unsubstituted C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, and R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 . In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 Is C 1-6 Alkyl group, C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 and-C (O) N (R) 10 )(R 11 ) And R is 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 Is by-OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl, which is substituted with one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is C 1-9 Heteroaryl group, which isIs covered by one R 5 Substituted, R 5 Is by-C (O) OR 10 Substituted C 1-6 Alkyl, and R 10 Is C 1-6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 Is unsubstituted C 1-9 Heteroaryl groups.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is hydrogen. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is C 1 -C 6 An alkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is C 1 -C 6 A haloalkyl group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 Is C 3-8 Cycloalkyl groups.
In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is a bond. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is C 1 -C 6 An alkylene group. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is-C (CH) 3 ) 2 -. In another embodiment are compounds of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is-C (H) (CH 3 ) -. In another embodiment is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein X is-CH 2 -。
Further embodiments provided herein include combinations of one or more of the specific embodiments set forth above.
In some embodiments are compounds selected from the group consisting of:
/>
/>
Or a pharmaceutically acceptable salt thereof.
Preparation of the Compounds
The compounds used in the reactions described herein are made according to organic synthesis techniques, starting from commercially available chemicals and/or compounds described in the chemical literature. "commercially available Chemicals" are obtained from standard commercial sources including Acros Organics (Geel, belgium), aldrich Chemical (Milwaukee, WI, including Sigma Chemical and Fluka), apin Chemicals Ltd. (Milton Park, UK), ark Pharm, inc. (Libertyville, IL), avocado Research (Lancashire, U.K.), BDH Inc. (Toronto, canada), bionet (Cornwall, U.K.), chemservice Inc. (West Chester, pa), combi-blocks (San Diego, calif.), crescent Chemical Co. (Hauppaugue, NY), emolecular (San Diego, calif.), fisher Scientific Co. (Pittsburgh, pa), fischer Chemicals (Leiceshi, uesgash), lo Frontier Scientific, UT), ICN Biomedicals, inc. (Costa measa, CA), key Organics (Cornwall, u.k.), lancaster Synthesis (Windham, NH), matrix Scientific (Columbia, SC), maybridge Chemical co.ltd. (Cornwall, u.k.), pari Chemical co (Orem, UT), pfaltz & Bauer, inc (Waterbury, CN), polyoganix (Houston, TX), pierce Chemical co (Rockford, IL), riedel de Haen AG (hanver, germany), ryan Scientific, inc (Mount plus, SC), spectrum Chemicals (gardnena, CA), sundia media (shaganai, china), TCI (Portland, OR), trans World Chemicals, inc (rockvi, MD) and shaggai (shaggai, wnai).
Suitable references and papers that describe in detail the synthesis of reactants useful in the preparation of the compounds described herein or that provide references describing such preparation include, for example, "Synthetic Organic Chemistry", john Wiley & Sons, inc., new York; S.R. Sandler et al, "Organic Functional Group Preparations," 2 nd edition, academic Press, new York,1983; h.o.house, "Modern Synthetic Reactions", 2 nd edition, W.A.Benjamin, inc.Menlo Park, calif.1972; gilchrist, "Heterocyclic Chemistry", 2 nd edition, john Wiley & Sons, new York,1992; J.March, "Advanced Organic Chemistry: reactions, mechanisms and Structure", 4 th edition, wiley-Interscience, new York,1992. Other suitable references and papers that describe in detail the synthesis of reactants useful in the preparation of the compounds described herein, or that provide references describing such preparation, include, for example, fuhrhop, J.and Penzlin G. "Organic Synthesis: peptides, methods, starting Materials", 2 nd edition, revised supplement (1994) John Wiley & Sons ISBN:3-527-29074-5; hoffman, R.V. "Organic Chemistry, an Intermediate Text" (1996) Oxford University Press, ISBN 0-19-509618-5; larock, R.C. "Comprehensive Organic Transformations: A Guide to Functional Group Preparations" 2 nd edition (1999) Wiley-VCH, ISBN:0-471-19031-4; march, J. "Advanced Organic Chemistry: reactions, mechanisms, and Structure" 4 th edition (1992) John Wiley & Sons, ISBN:0-471-60180-2; otera, J. (edit) "Modern Carbonyl Chemistry" (2000) Wiley-VCH, ISBN:3-527-29871-1; patai, S. "Patai's 1992Guide to the Chemistry of Functional Groups" (1992) Interscience ISBN:0-471-93022-9; solomons, T.W.G. "Organic Chemistry" 7 th edition (2000) John Wiley & Sons, ISBN:0-471-19095-0; stowell, J.C. "Intermediate Organic Chemistry" 2 nd edition (1993) Wiley-Interscience, ISBN:0-471-57456-2; "Industrial Organic Chemicals: starting Materials and Intermediates An Ullmann's encyclopedia" (1999) John Wiley & Sons, ISBN:3-527-29645-X, volume 8 total; "Organic Reactions" (1942-2000) John Wiley & Sons, volume 55; and "Chemistry of Functional Groups" John Wiley & Sons, volume 73 total.
Specific and similar reactants are also identified by indexes of known chemicals compiled by the chemical abstracts of the american society of chemistry (American Chemical Society) (Chemical Abstract Service), which are available in most public and university libraries and by online databases (american society of chemistry, washington, d.c.). Chemicals known in the catalog but not commercialized are optionally prepared by custom chemical synthesis companies, many of which provide custom synthesis services (e.g., those listed above). References for the preparation and selection of pharmaceutical salts of the compounds described herein are p.h.stahl & c.g.weruth "Handbook of Pharmaceutical Salts", verlag Helvetica Chimica Acta, zurich,2002.
Further forms of the compounds disclosed herein
Isomers of
Furthermore, in some embodiments, the compounds described herein exist as geometric isomers. In some embodiments, the compounds described herein have one or more double bonds. The compounds presented herein include all cis (cis), trans (trans), cis (syn), trans (anti), entgegen (E) and zusammen (Z) isomers, and corresponding mixtures thereof. In some cases, the compounds exist as tautomers. The compounds described herein include all possible tautomers within the formulae described herein. In some cases, the compounds described herein have one or more chiral centers and each center exists as an R configuration or an S configuration. The compounds described herein include all diastereoisomers, enantiomers and epimeric forms as well as corresponding mixtures thereof. In additional embodiments of the compounds and methods provided herein, mixtures of enantiomers and/or diastereomers resulting from a single preparation step, combination, or interconversion may be used in the applications described herein. In some embodiments, the compounds described herein are prepared as optically pure enantiomers by chiral chromatographic resolution of a racemic mixture. In some embodiments, the compounds described herein are prepared as their respective stereoisomers by reacting a racemic mixture of the compounds with an optically active resolving agent to form a pair of diastereomeric compounds, separating the diastereomers, and recovering the optically pure enantiomers. In some embodiments, dissociable complexes (e.g., crystalline diastereomeric salts) are preferred. In some embodiments, diastereomers have different physical properties (e.g., melting point, boiling point, solubility, reactivity, etc.), and are separated by taking advantage of these differences. In some embodiments, the diastereomers are separated by chiral chromatography, or preferably by separation/resolution techniques based on solubility differences. In some embodiments, the optically pure enantiomer is then recovered with the resolving agent by any practical method that does not result in racemization.
Labeled compounds
In some embodiments, the compounds described herein exist as isotopically-labeled forms thereof. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically-labeled compounds. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically-labeled compounds as pharmaceutical compositions. Thus, in some embodiments, compounds disclosed herein include isotopically-labeled compounds, which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes incorporated into compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, such as respectively 2 H、 3 H、 13 C、 14 C、 l5 N、 18 O、 17 O、 31 P、 32 P、 35 S、 18 F and F 36 Cl. The compounds described herein, as well as pharmaceutically acceptable salts, esters, solvates, hydrates, or derivatives thereof, containing the foregoing isotopes and/or other isotopes of other atoms are within the scope of this invention. Certain isotopically-labeled compounds, for example those incorporating a radioisotope such as 3 H and 14 the compound of C can be used for medicine and/or substrate tissue distribution determination. Tritiated (i.e., 3 h) And a carbon 14 (i.e., 14 c) Isotopes are particularly preferred for their ease of preparation and detectability. In addition, the use of heavy isotopes such as deuterium (i.e., 2 h) Substitution, due to higher metabolic stability, e.g. increased in vivo half-life or reduced dosage requirements, gives rise to certain therapeutic advantages. In some embodiments, the isotopically-labeled compound, pharmaceutically-acceptable salts, esters, solvates, hydrates, or derivatives thereof, are prepared by any suitable method.
In some embodiments, the compounds described herein are labeled by other means, including, but not limited to, using chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
Pharmaceutically acceptable salts
In some embodiments, the compounds described herein are present as pharmaceutically acceptable salts thereof. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts as pharmaceutical compositions.
In some embodiments, the compounds described herein have acidic or basic groups and thus react with any of a number of inorganic or organic bases and inorganic and organic acids to form pharmaceutically acceptable salts. In some embodiments, these salts are prepared in situ during the final isolation and purification of the compounds described herein, or by separately reacting the purified free form of the compound with a suitable acid or base, and isolating the salt thus formed.
Solvates of the formula
In some embodiments, the compounds described herein exist as solvates. In some embodiments are methods of treating diseases by administering such solvates. Further described herein are methods of treating diseases by administering such solvates as pharmaceutical compositions.
Solvates contain a stoichiometric or non-stoichiometric amount of solvent and, in some embodiments, form with pharmaceutically acceptable solvents such as water, ethanol, and the like during crystallization. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is an alcohol. Solvates of the compounds described herein are readily prepared or formed in the processes described herein. By way of example only, hydrates of the compounds described herein are readily prepared by recrystallization from aqueous/organic solvent mixtures using organic solvents including, but not limited to, dioxane, tetrahydrofuran, or MeOH. Furthermore, the compounds provided herein exist as unsolvated and solvated forms. In general, solvated forms are considered equivalent to unsolvated forms with respect to the compounds and methods provided herein.
Pharmaceutical composition
In certain embodiments, the compounds of formula (I) as described herein are administered as pure chemicals. In some embodiments, a compound of formula (I) described herein is combined with a pharmaceutically suitable or acceptable carrier (also referred to herein as a pharmaceutically suitable (or acceptable) excipient, physiologically suitable (or acceptable) excipient, or physiologically suitable (or acceptable) carrier) selected based on the route of administration selected and standard pharmaceutical practice, for example, in Remington: the Science and Practice of Pharmacy (Gennaro, 21 st edition, mack pub. Co., easton, PA (2005)).
Accordingly, the pharmaceutical compositions provided herein comprise at least one compound of formula (I) as described herein, or a stereoisomer, pharmaceutically acceptable salt, hydrate, solvate or N-oxide thereof, and one or more pharmaceutically acceptable carriers. A carrier (or excipient) is acceptable or suitable if it is compatible with the other ingredients of the composition and not deleterious to the recipient (i.e., subject) of the composition.
One embodiment provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound of formula (I) or a pharmaceutically acceptable salt thereof.
Another embodiment provides a pharmaceutical composition consisting essentially of a pharmaceutically acceptable excipient and a compound of formula (I) or a pharmaceutically acceptable salt thereof.
In certain embodiments, the compound of formula (I) as described herein is substantially pure in that it contains less than about 5% or less than about 1% or less than about 0.1% of other small organic molecules, e.g., contaminating intermediates or byproducts produced, for example, in one or more steps of the synthetic process.
In certain embodiments, the compounds of formula (I) described herein are formulated for oral, rectal, topical, buccal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous), vaginal, ocular, or aerosol administration, although the most suitable form of administration in any given case will depend on the extent and severity of the condition being treated and the nature of the particular compound being used. For example, the disclosed compositions are formulated as unit doses and/or formulated for oral or subcutaneous administration.
Exemplary pharmaceutical compositions are used in the form of pharmaceutical formulations, e.g., in solid, semi-solid or liquid form, comprising as active ingredient one or more of the disclosed compounds in admixture with an organic or inorganic carrier or excipient suitable for external, enteral or parenteral application. In some embodiments, the active ingredient is compounded with, for example, generally non-toxic, pharmaceutically acceptable carriers for tablets, pills, capsules, suppositories, solutions, emulsions, suspensions, and any other form suitable for use. The pharmaceutical compositions comprise an amount of the active subject compound sufficient to produce the desired effect on the course or condition of the disease.
In some embodiments for preparing solid compositions such as tablets, the primary active ingredient is mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, e.g., water, to form a solid preformulation composition containing a homogeneous mixture of the disclosed compounds or non-toxic pharmaceutically acceptable salts thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so as to readily subdivide the composition into equally effective unit dosage forms such as tablets, pills and capsules.
In solid dosage forms (capsules, tablets, pills, dragees, powders, granules, etc.) for oral administration, the subject compositions are admixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) Fillers or extenders, such as starch, cellulose, microcrystalline cellulose, silicified microcrystalline cellulose, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) Binders such as carboxymethyl cellulose, hydroxypropyl methylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and/or acacia; (3) humectants, such as glycerin; (4) Disintegrants, such as crospovidone, croscarmellose sodium, sodium starch glycolate, agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; (5) a slow solvent such as paraffin; (6) absorption enhancers such as quaternary ammonium compounds; (7) Wetting agents such as, for example, docusate sodium, cetyl alcohol and glycerol monostearate; (8) absorbents such as kaolin and bentonite; (9) Lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof; and (10) a colorant. In the case of capsules, tablets and pills, in some embodiments, the compositions comprise buffering agents. In some embodiments, similar types of solid compositions are also used as fillers in soft-filled and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.
In some embodiments, the tablet is made by compression or molding, optionally with one or more accessory ingredients. In some embodiments, a compressed tablet is prepared using a binder (e.g., gelatin or hydroxypropyl methylcellulose), a lubricant, an inert diluent, a preservative, a disintegrant (e.g., sodium starch glycolate or croscarmellose sodium), a surfactant, or a dispersing agent. In some embodiments, molded tablets are made by molding in a suitable machine a mixture of the subject composition moistened with an inert liquid diluent. In some embodiments, tablets and other solid dosage forms such as dragees, capsules, pills and granules are scored and coatings and shells, such as enteric coatings and other coatings, are prepared.
Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, as well as powders. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the subject compositions, in some embodiments, the liquid dosage forms contain inert diluents such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1, 3-butylene glycol, oils (optionally, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, cyclodextrins, and mixtures thereof.
In some embodiments, the suspension contains, in addition to the subject composition, suspending agents such as, for example, ethoxylated isostearyl alcohols, sorbitol polyoxyethylene and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and mixtures thereof.
In some embodiments, the formulation for rectal or vaginal administration is presented as a suppository, which is prepared by mixing the subject composition with one or more suitable non-irritating excipients or carriers including, for example, cocoa butter, polyethylene glycols, a plug wax or a salicylate, which is solid at room temperature but liquid at body temperature, and therefore will melt in the body cavity and release the active agent.
Dosage forms for transdermal administration of the subject compositions include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. In some embodiments, the active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants as required.
In some embodiments, ointments, pastes, creams and gels contain, in addition to the subject compositions, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
In some embodiments, the powders and sprays contain, in addition to the subject compositions, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. In some embodiments, the spray additionally contains conventional propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons such as butane and propane.
In some embodiments, the compounds described herein are formulated as eye drops for ocular administration.
The compositions and compounds disclosed herein are alternatively administered by aerosol. This is achieved by preparing an aqueous aerosol, a liposomal formulation or solid particles containing the compound. In some embodiments, a non-aqueous (e.g., fluorocarbon propellant) suspension is used. In some embodiments, sonic atomizers are used because they minimize exposure of the agent to shear, which can result in degradation of the compounds contained in the subject compositions. Generally, aqueous aerosols are prepared by formulating an aqueous solution or suspension of the subject compositions with conventional pharmaceutically acceptable carriers and stabilizers. The carrier and stabilizer will vary with the requirements of the particular subject composition, but typically includes a nonionic surfactant (Tween, pluronic (Pluronic) or polyethylene glycol), sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols are generally prepared from isotonic solutions.
Pharmaceutical compositions suitable for parenteral administration include the subject compositions in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or as sterile powders which are reconstituted into sterile injectable solutions or dispersions just prior to use, which in some embodiments contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and non-aqueous carriers employed in the pharmaceutical compositions include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate and cyclodextrins. For example, by using a coating material such as lecithin, proper fluidity is maintained, in the case of dispersions, by the maintenance of the required particle size and by the use of surfactants.
Enteral pharmaceutical preparations are also contemplated, including the disclosed compounds, enteric substances, and pharmaceutically acceptable carriers or excipients therefor. An enteric substance refers to a polymer that is substantially insoluble in the acidic environment of the stomach and is primarily soluble in intestinal fluids of a particular pH. The small intestine is the part of the gastrointestinal tract (the intestinal tract) between the stomach and the large intestine, including the duodenum, jejunum and ileum. The pH of the duodenum is about 5.5, the pH of the jejunum is about 6.5, and the pH of the distal ileum is about 7.5. Thus, the enteric material is insoluble, for example, until the pH is about 5.0, about 5.2, about 5.4, about 5.6, about 5.8, about 6.0, about 6.2, about 6.4, about 6.6, about 6.8, about 7.0, about 7.2, about 7.4, about 7.6, about 7.8, about 8.0, about 8.2, about 8.4, about 8.6, about 8.8, about 9.0, about 9.2, about 9.4, about 9.6, about 9.8, or about 10.0. Exemplary enteric materials include Cellulose Acetate Phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate trimellitate, hydroxypropyl methylcellulose succinate, cellulose acetate hexahydrophthalate, cellulose propionate phthalate, cellulose acetate maleate, cellulose acetate butyrate, cellulose acetate propionate, copolymers of methyl methacrylate and methyl methacrylate, copolymers of methyl acrylate, methyl methacrylate and methacrylic acid (Gantrez ES series), ethyl methacrylate-methyl methacrylate-chlorotrimethylammonium ethyl acrylate copolymers, natural resins such as zein, shellac and copal collophorium, and several commercially available enteric dispersion systems (e.g., eudragit L30D55, eudragit D100, eudragit E100, eudragit 35S 30 and Elliac 35S 25). The solubility of each of the above substances is known or readily determined in vitro.
The dosage of a composition comprising at least one compound of formula (I) described herein varies depending on the condition of the patient (e.g., human), i.e., the stage of the disease, general health, age, and other factors.
The pharmaceutical composition is administered in a manner suitable for the disease to be treated (or prevented). The appropriate dosage and appropriate duration and frequency of administration will be determined by factors such as the condition of the patient, the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration. Generally, appropriate dosages and treatment regimens provide compositions in amounts sufficient to provide therapeutic and/or prophylactic benefits (e.g., to improve clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and/or total survival, or to reduce symptom severity). The optimal dose is typically determined using experimental models and/or clinical trials. In some embodiments, the optimal dose depends on the patient's weight, or blood volume.
Method
In some embodiments is a method of treating cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from the group consisting of adrenocortical cancer, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenoma, and coixointerstitial tumor. In some embodiments is a method of treating adrenocortical carcinoma in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating ovarian cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating head and neck cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating endometrial cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating hormone-dependent prostate cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating non-small cell lung cancer (NSCLC) in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating melanoma in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating pituitary gonadotrophin adenomas in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating a sex cord stromal tumor in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, the sex cord stromal tumor is a Leydig cell tumor.
In some embodiments is a method of treating an endocrine disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In another embodiment is a method of treating an endocrine disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the endocrine disorder is selected from the group consisting of endogenous cushing's syndrome, congenital adrenal cortical hyperplasia, and polycystic ovary syndrome. In some embodiments is a method of treating endogenous cushing's syndrome in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating congenital adrenal cortical hyperplasia in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments is a method of treating polycystic ovary syndrome in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof.
In some embodiments is a method of treating endometriosis or endometriosis in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) as described herein, or a pharmaceutically acceptable salt thereof.
In certain embodiments, the disclosed compounds employed by one or more of the foregoing methods are one of the genus, subgenera, or specific compounds described herein, such as a compound of formula (I).
The disclosed compounds are administered to patients (animals and humans) in need of such treatment in dosages that will provide the optimal pharmaceutical effect. It will be appreciated that the required dosage for use in any particular application will vary from patient to patient, not only with the particular compound or composition selected, but also with the route of administration, the nature of the condition being treated, the age and condition of the patient, the concurrent use of drugs or special diets that the patient will follow next, and other factors, the appropriate dosage ultimately being at the discretion of the attendant physician. For the treatment of the above clinical conditions and diseases, contemplated compounds of the present disclosure are administered orally, subcutaneously, topically, parenterally, by inhalation spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles. Parenteral administration includes subcutaneous injections, intravenous or intramuscular injection or infusion techniques.
The following examples are provided merely as illustrations of various embodiments and should not be construed as limiting the invention in any way.
Examples
List of abbreviations
As used above, and throughout the description of the invention, the following abbreviations should be understood to have the following meanings, unless otherwise indicated:
ACN acetonitrile
Bn benzyl
BOC or Boc carbamic acid tert-butyl ester
DCC dichloroethane (ClCH) 2 CH 2 Cl)
DCM N, N' -dicyclohexylcarbodiimide
DIPEA N, N-diisopropylethylamine
DMAP 4- (N, N-dimethylamino) pyridine
DMF dimethylformamide
DMA N, N-dimethylacetamide
DMSO dimethyl sulfoxide
equivalent of equiv
EDCI 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide
Et ethyl group
EtOH ethanol
EtOAc ethyl acetate
HF hydrofluoric acid
HMDS bis (trimethylsilyl) amine
HPLC high performance liquid chromatography
Me methyl group
MeOH methanol
MMTr 4-methoxytrityl radical
MMTrCl 4-methoxytrityl chloride
MS mass spectrum
NMM N-methylmorpholine
NMR nuclear magnetic resonance
TBHP tert-butyl hydroperoxide
TEA triethylamine
TFA trifluoroacetic acid
THF tetrahydrofuran
TLC thin layer chromatography
TBDMSCl tertiary butyl dimethyl silyl chloride
TMSCl trimethylsilyl chloride
TMSOTF trimethylsilyl triflate
Chemical synthesis
Reagents and solvents as received from commercial suppliers were used unless otherwise indicated. Anhydrous solvents and oven-dried glassware are used for moisture and/or oxygen sensitive synthetic transformations. The yield was not optimized. The reaction time is approximate and not optimized. Column chromatography and Thin Layer Chromatography (TLC) were both performed on silica gel unless otherwise indicated. The spectrum is in ppm (delta) and the coupling constant (J) is in hertz. For proton spectra, the solvent peak was used as a reference peak.
Example 1: synthesis of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetic acid (10)
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (50 g,292.2 mmol) in DMF (500 mL) at room temperature was added K 2 CO 3 (80.6 g,584.4 mmol) methyl iodide (20.0 mL,321.4 mmol) was then added and the reaction mixture stirred at the same temperature for 16h. The mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give crude product. The crude product is led throughPurification by silica gel column provided 1-methyl-4-nitro-1H-pyrazole-5-carboxylic acid methyl ester (2) (15.0 g, 27%) as a colorless liquid. 1 H NMR(400MHz,CDCl 3 ):δ8.01(s,1H),4.03(s,6H)；MS(ESI)m/z 186.17[M+H] + 。
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (2) (2x 7.5g,40.54mmol) in MeOH (75 mL) was added 10% Pd/C (3 g) and the reaction mixture was stirred at room temperature under a hydrogen (balloon pressure) atmosphere for 16H. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give methyl 4-amino-1H-pyrazole-5-carboxylate (3) (12.2 g, 97%). 1 H NMR(400MHz,DMSO):δ7.00(s,1H),4.98(brs,2H),3.89(s,3H),3.79(s,3H)；MS(ESI)m/z 156.07[M+H] + 。
To a stirred solution of methyl 4-amino-1H-pyrazole-5-carboxylate (3) (12.2 g,78.70 mmol) in n-butanol (122 mL) was added DIPEA (72.5 mL,393.50 mmol), formamidine acetate (4) (9.80 g,94.45 mmol) at room temperature and the reaction was then stirred at 110 ℃ for 16H. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. Trituration of the solid compound with diethyl ether to afford 1-methyl-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (5) (10.0 g, 84%) as an off-white solid. 1 H NMR(400MHz,DMSO-d 6 ):δ7.95(s,1H),δ7.80(s,1H),δ4.18(s,3H)；MS(ESI)m/z151.09[M+H] + 。
To 1-methyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (4) (10.0 g,66.66 mmol) in DMF (200 mL) was added NBS (15.41 g,86.58 mmol) and the reaction mixture was then stirred at 80℃for 16h. The reaction mixture was cooled to room temperature, quenched with cold water and the precipitated solid was filtered off. The solid was dried under vacuum to afford 3-bromo-1-methyl-1, 6-dihydro-7H-pyrazolo [4,3-d ]Pyrimidin-7-one (5) (11.0 g, 72%) as an off-white solid. 1 H NMR(400MHz,DMSO-d 6 ):δ12.49(brs,1H),7.92(s,1H),δ4.18(s,3H)；MS(ESI)m/z 229.06[M+H] + 。
To 3-bromo-1-methyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at 0deg.C]To a stirred solution of pyrimidin-7-one (5) (11.0 g,48.24 mmol) in DMF (220 mL) was added K 2 CO 3 (13.25g，96.06 mmol) and tert-butyl 2-bromoacetate (6) (8.24 mL,57.64 mmol) and stirred at room temperature for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×1l). The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give a crude product which is purified by flash column chromatography to afford 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) acetic acid tert-butyl ester (7) (12.0 g, 72%) as a white solid. 1 H NMR(400MHz,CDCl 3 ):δ7.79(s,1H),4.61(s,2H),4.28(s,3H),1.49(s,9H)；MS(ESI)m/z 343.22[M+H] + 。
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature in a pressure vessel]To a degassed (argon) solution of tert-butyl pyrimidin-6-yl) acetate (7) (5.0 g,14.619 mmol) in dioxane (100 mL) was added Cs 2 CO 3 (14.24g，43.71mmol)、Pd 2 (dba) 3 (1.32 g,1.45 mmol), xantphos (843 mg,1.45 mmol) and 4- (trifluoromethyl) aniline (8) (2.35 g, 14.612 mmol). The solution was again degassed for 15min and the reaction mixture was heated to 100 ℃ for 5h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The celite pad was washed with ethyl acetate. The filtrate was concentrated under reduced pressure to provide a crude product which was purified by silica gel column chromatography to give 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] ]Pyrimidin-6-yl) acetic acid tert-butyl ester (9) (4.8 g, 77%) as a brown solid. 1 H NMR(400MHz,DMSO-d 6 ):δ9.46(s,1H),8.15(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.4Hz,2H),4.74(s,2H),4.13(s,3H),1.44(s,9H)；MS(ESI)m/z 424.4[M+H] + 。
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (9) (4.8 g,11.34 mmol) in DCM (25 mL) was added 4N HCl/dioxane (50 mL) and stirred at room temperature for 16h. The solvent was evaporated under reduced pressure, triturated with ethyl acetate and dried under reduced pressure to give 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetic acid (10) (4.8 g) as a pale yellow solid. 1 H NMR(400MHz,DMSO-d 6 ):δ9.45(s,1H),8.17(s,1H),7.72(d,J＝8.8Hz,2H),7.57(d,J＝8.4Hz,2H),4.77(s,2H),4.13(s,3H),3.56(s,1H)；MS(ESI)m/z 368.30[M+H] + 。
Example 2: synthesis of N- (3-fluoro-4-methoxyphenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (11)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.81 mmol) in DMF (3 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.45 mL,2.45 mmol) and the reaction mixture was stirred at the same temperature for 5min. 3-fluoro-4-methoxyaniline (126 mg,0.89 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to afford N- (3-fluoro-4-methoxyphenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] ]Pyrimidin-6-yl) acetamide (11) (106 mg, 26%) as an off-white solid. MS (ESI) m/z 491.56[ M+H ]] + ； 1 HNMR(400MHz,DMSO-d 6 ) Delta 10.48 (s, 1H), 9.46 (s, 1H), 8.15 (s, 1H), 7.73 (d, J=8.4 Hz, 2H), 7.60-7.50 (m, 3H), 7.27 (d, J=8.8 Hz, 1H), 7.14 (t, J=9.2 Hz, 1H), 4.86 (s, 2H), 4.13 (s, 3H), 3.80 (s, 3H), 1.44 (s, 6H). Example 3:2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Synthesis of pyrimidin-6-yl) -N- (4- (2- (methylsulfonyl) propan-2-yl) phenyl) acetamide (12)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]A stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.81 mmol) in DMF (3 mL)HATU (460 mg,1.22 mmol), DIPEA (0.4 ml,2.45 mmol) were added and the reaction mixture was stirred at the same temperature for 5min. 4- (2- (methylsulfonyl) propan-2-yl) aniline (2) (208 mg,0.98 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) -N- (4- (2- (methylsulfonyl) propan-2-yl) phenyl) acetamide (12) (110 mg, 23%) as an off-white solid. MS (ESI) m/z 563.43[ M+H ] ] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.58(s,1H),9.47(s,1H),8.17(s,1H),7.74(s,1H),7.72(s,1H),7.65-7.53(m,6H),4.89(s,2H),4.13(s,3H),2.65(s,3H),1.73(s,6H)。
Example 4: synthesis of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (tetrahydro-2H-pyran-4-yl) acetamide (13)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.81 mmol) in DMF (3 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.4 mL,2.45 mmol) and the reaction mixture was stirred at the same temperature for 5min. tetrahydro-2H-pyran-4-amine (99 mg,0.98 mmol) was then added and the reaction stirred at room temperature for 16H. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- (tetrahydro-2H-pyran-4-yl) acetamide (13) (120 mg, 32%) as an off-white solid. MS (ESI) m/z 465.44[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.4Hz,2H),4.66(s,2H),4.12(s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J＝6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H)。
Example 5: synthesis of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- ((tetrahydro-2H-pyran-4-yl) methyl) acetamide (14)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C ]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.817 mmol) in DMF (5 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.56 mL,3.26 mmol) and the reaction mixture was stirred at the same temperature for 5min. (tetrahydro-2H-pyran-4-yl) methylamine (112 mg,0.98 mmol) is then added and the reaction stirred at room temperature for 16H. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to afford 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- ((tetrahydro-2H-pyran-4-yl) methyl) acetamide (14) (130 mg, 34%) as a pale yellow solid. MS (ESI) m/z 465.44[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.4Hz,2H),4.66(s,2H),4.12(s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J＝6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H)。
Example 6: synthesis of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (2- (tetrahydro-2H-pyran-4-yl) propan-2-yl) acetamide (15)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (150 mg,0.40 mmol) in DMF (3 mL) was added HATU (230 mg,0.61 mmol), DIPEA (0.24 mL,1.22 mmol) and the reaction was continuedThe mixture was stirred at the same temperature for 5min. 2- (tetrahydro-2H-pyran-4-yl) propan-2-amine (178 mg,0.48 mmol) is then added and the reaction stirred at room temperature for 16H. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) -N- (2- (tetrahydro-2H-pyran-4-yl) propan-2-yl) acetamide (15) (60 mg, 29%) as an off-white solid. MS (ESI) m/z 493.56[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.05(s,1H),7.83(s,1H),7.71(d,J＝8.8Hz,2H),7.56(d,J＝8.8Hz,2H),4.63(s,2H),4.12(s,3H),4.00-3.90(m,2H),3.30-3.15(m,2H),2.20-2.05(m,1H),1.60-1.50(m,2H),1.40-1.10(m,8H)。
Example 7: synthesis of (R) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (1- (tetrahydro-2H-pyran-4-yl) ethyl) acetamide (16)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (319 mg,0.70 mmol) in DMF (5 mL) was added HATU (307 mg,0.81 mmol), DIPEA (209 mg,1.62 mmol) and the reaction mixture was stirred at the same temperature for 5min. (R) -1- (tetrahydro-2H-pyran-4-yl) ethan-1-amine (70 mg,0.54 mmol) was added and the reaction stirred at room temperature for 16H. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated and the crude product was purified by prep HPLC to give (R) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- (1- (tetrahydro-2H-pyran-4-yl) ethyl) acetamide (16) (45 mg, 17%) as a white solid. MS (ESI) m/z 479.63[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.12(d,J＝8.8Hz,1H),8.08(s,1H),7.72(d,J＝8.8Hz,2H),7.56(d,J＝8.8Hz,2H),4.65(s,2H),4.12(s,3H),3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J＝6.80Hz,3H)。
Example 8: synthesis of (S) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (1- (tetrahydro-2H-pyran-4-yl) ethyl) acetamide (17)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (319 mg,0.70 mmol) in DMF (5 mL) was added HATU (307 mg,0.81 mmol), DIPEA (209 mg,1.62 mmol) and the reaction mixture was stirred at the same temperature for 5min. (S) -1- (tetrahydro-2H-pyran-4-yl) ethan-1-amine (70 mg,0.54 mmol) was added and the reaction stirred at room temperature for 16H. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated and the residue was purified by preparative HPLC to give (S) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) -N- (1- (tetrahydro-2H-pyran-4-yl) ethyl) acetamide (17) (110 mg, 42%) as a white solid. MS (ESI) m/z 479.63[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.12(d,J＝8.8Hz,1H),8.08(s,1H),7.72(d,J＝8.8Hz,2H),7.56(d,J＝8.8Hz,2H),4.65(s,2H),4.12(s,3H),3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J＝6.80Hz,3H)。
Example 9: synthesis of N- (2-methyl-4- (2- (methylsulfonyl) propan-2-yl) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (18)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]Pyrimidin-6-yl) To a stirred solution of acetic acid (10) (500 mg,1.36 mmol) in DMF (3 mL) was added HATU (776 mg,2.04 mmol), DIPEA (0.75 mL,4.08 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2-methyl-4- (2- (methylsulfonyl) propan-2-yl) aniline (371 mg,1.63 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N- (2-methyl-4- (2- (methylsulfonyl) propan-2-yl) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]Pyrimidin-6-yl) acetamide (18) (97 mg, 12%) as an off-white solid. MS (ESI) m/z 577.47[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.82(s,1H),9.45(s,1H),8.17(s,1H),7.72(d,J＝8.8Hz,2H),7.56(d,J＝8.4Hz,2H),7.55-7.35(m,3H),4.95(s,2H),4.14(s,3H),2.68(s,3H),2.29(s,3H),1.73(s,6H)。
Example 10: synthesis of 2-methyl-2- (4- (2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamido) phenyl) propanoic acid (19)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.81 mmol) in DMF (3 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.45 mL,2.45 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2- (4-aminophenyl) -2-methylpropanoic acid (175 mg,0.98 mmol) was then added and the reaction stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2-methyl-2- (4- (2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) acetamido) phenyl) propionic acid (19) (90 mg, 20%) as an off-white solid. MS (ESI) m/z 529.46[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ12.40-12.30(br s,1H),10.45(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J＝8.4Hz,2H),7.60-7.50(m,4H),7.31(d,J＝8.4Hz,1H),4.88(s,2H),4.13(s,3H),1.44(s,6H)。
Example 11: synthesis of N- (4- (2-hydroxy-2-methylpropyloxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (20)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.81 mmol) in DMF (3 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.45 mL,2.45 mmol) and the reaction mixture was stirred at the same temperature for 5min. 1- (4-aminophenoxy) -2-methylpropan-2-ol (177 mg,0.98 mmol) was then added and the reaction stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to afford N- (4- (2-hydroxy-2-methylpropyloxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetamide (20) (160 mg, 36%) as a grey solid. MS (ESI) m/z 531.65[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.8Hz,2H),7.48(d,J＝8.8Hz,2H),6.90(d,J＝9.20Hz,2H),4.87(s,2H),4.59(s,1H),4.13(s,3H),3.69(s,2H),1.18(s,6H)。
Example 12: synthesis of 2-methyl-2- (4- (2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamido) phenyl) propanamide (21)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]Pyrimidin-6-yl) acetic acid (10) (271 mg,0.74 mmol) in DMFTo a stirred solution in (3 mL) was added HATU (424 mg,1.11 mmol), DIPEA (0.37 mL,2.22 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2- (4-aminophenyl) -2-methylpropanamide (196 mg,1.11 mmol) was then added and the reaction stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2-methyl-2- (4- (2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) acetamido) phenyl) propionamide (21) (75 mg, 17%) as an off-white solid. MS (ESI) m/z 526.33[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.42(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.8Hz,2H),7.51(d,J＝8.4Hz,2H),6.83(d,J＝4.4Hz,2H),4.87(s,2H),4.13(s,2H),1.41(s,6H)。
Example 13: synthesis of N- ((1S, 4R) -4- ((S) -2-hydroxypropoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (22) and N- ((1R, 4R) -4- ((R) -2-hydroxypropoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (23)
To a stirred solution of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetic acid (10) (250 mg,0.70 mmol) in DMF (3 mL) was added HATU (400 mg,1.05 mmol) and DIPEA (290 mg,2.10 mmol) at 0 ℃ and the reaction mixture was stirred at the same temperature for 5min. 1- (((1 r,4 r) -4-aminocyclohexyl) oxy) propan-2-ol (142 mg,0.83 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered off and dried to provide N- ((trans) -4- (2-hydroxypropoxy) cyclohexyl) -2- (4-oxo-8- ((5- (trifluoromethyl) pyridin-2-yl) amino) quinazolin-3 (4H) -yl) acetamide (22 and 23) (320 mg) as an off-white solid. Chiral SFC separated the enantiomers to afford (22) (64 mg, 9%) and (23) (63 mg, 9%).
22 peak-1: MS (ESI) m/z 523.51[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.20(d,J＝7.6Hz,1H),8.07(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.4Hz,2H),4.62(s,2H),4.47(s,1H),4.12(s,3H),3.70-3.60(brs,1H),3.60-3.50(brs,1H),3.30-3.10(m,3H),2.11-1.90(m,2H),1.90-1.80(m,2H),1.30-1.15(m,4H),1.01(d,J＝6.0Hz,3H)。
23 peak-2: MS (ESI) m/z 523.51[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.21(d,J＝7.6Hz,1H),8.07(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.4Hz,2H),4.63(s,2H),4.48(s,1H),4.12(s,3H),3.70-3.60。
Example 14: synthesis of N- ((trans) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (24)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (271mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg,1.11 mmol), DIPEA (0.37 mL,2.22 mmol) and the reaction mixture was stirred at the same temperature for 5min. 1- (((trans) -4-aminocyclohexyl) oxy) -2-methylpropan-2-ol (166 mg,0.88 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N- ((trans) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (24) (75 mg, 25%) as an off-white solid. MS (ESI) m/z 537.36[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.20(d,J＝7.2Hz,1H),8.07(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.8Hz,2H),4.63(s,2H),4.20(s,1H),4.12(s,3H),4.54(brs,1H),3.23-3.21(m,1H),3.14(s,2H),1.97-1.93(m,2H),1.83-1.79(m,2H),1.25-1.20(m,4H),1.05(s,6H)。
Example 15: synthesis of (R) -N- (4- ((1-hydroxy-2-yl) oxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (25) and (S) -N- (4- ((1-hydroxy-2-yl) oxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (26)
To a stirred solution of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetic acid (10) (271 mg,0.74 mmol) in DMF (3 mL) was added HATU (424 mg,1.11 mmol), DIPEA (0.37 mL,2.22 mmol) at 0 ℃ and the reaction mixture was stirred at the same temperature for 5min. 2- (4-aminophenoxy) propan-1-ol (185 mg,1.11 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative SFC as (R) -N- (4- ((1-hydroxypropan-2-yl) oxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (25) (85 mg, 22%) and (S) -N- (4- ((1-hydroxypropan-2-yl) oxy) phenyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (26) (77 mg, 20%) as an off-white solid.
25 peak-1: MS (ESI) m/z 517.45[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.8Hz,2H),7.47(d,J＝8.4Hz,2H),6.89(d,J＝9.2Hz,2H),4.85(s,2H),4.82(t,J＝5.6Hz,1H),4.36-4.32(m,1H),4.13(s,3H),3.55-3.50(m,1H),3.45-3.40(m,1H),1.17(d,J＝6.0Hz,3H)。
26 peak-2: MS (ESI) m/z 517.45[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.8Hz,2H),7.47(d,J＝9.2Hz,2H),6.89(d,J＝8.8Hz,2H),4.85(s,2H),4.81(t,J＝5.6Hz,1H),4.36-4.32(m,1H),4.13(s,3H),3.55-3.49(m,1H),3.45-3.40(m,1H),1.17(d,J＝6.0Hz,3H)。
Example 16: synthesis of N- ((trans) -4- (1-hydroxy-2-methylpropan-2-yl) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (27)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (271mg, 0.74 mmol) in DMF (3 mL) was added HATU (424 mg,1.11 mmol), DIPEA (0.37 mL,2.22 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2- ((trans) -4-aminocyclohexyl) -2-methylpropan-1-ol (150 mg,0.88 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N- ((trans) -4- (1-hydroxy-2-methylpropan-2-yl) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (27) (110 mg, 28%) as an off-white solid. MS (ESI) m/z 519.40[ M-H ]] - ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.17(d,J＝7.6Hz,1H),8.07(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.8Hz,2H),4.65(s,2H),4.40(t,J＝5.6Hz,1H),4.13(s,3H),4.46-3.42(m,1H),3.13(d,J＝5.2Hz,2H),1.86-1.83(m,2H),1.71-1.68(m,2H),1.23-0.98(m,4H),0.73(s,6H)。
Example 17: n- ((trans) -4-hydroxycyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (28)
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (250 mg,0.68 mmol) in DMF (5 mL) was added HATU (387 mg,1.02 mmol), DIPEA (0.53 mL,3.06 mmol) and the reaction mixture was stirred at the same temperature for 5min. (trans) -4-aminocyclohex-1-ol (93 mg,0.816 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N- ((trans) -4-hydroxycyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]Pyrimidin-6-yl) acetamide (28) (95 mg, 30%) as an off-white solid. MS (ESI) m/z 465.35[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.16(d,J＝7.6Hz,1H),8.06(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.8Hz,2H),4.62(s,2H),4.52(d,J＝4.4Hz,1H),3.49-3.36(m,2H),1.82-1.76(m,4H),1.23-1.17(m,4H)。
Example 18: n- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (32)
/>
To a stirred solution of trans-4-aminocyclohex-1-ol (5 g,33 mmol) in acetonitrile (100 mL) at 0deg.C was added K 2 CO 3 (18 g,132 mmol) benzyl bromide (8.2 g,69 mmol) was then added and the reaction mixture stirred at room temperature for 18h. The reaction mixture was filtered through a pad of celite and the filtrate was evaporated under reduced pressure. The resulting solid was washed with n-pentane to afford trans-4- (dibenzylamino) cyclohex-1-ol (29) (8 g, 82%) as a white solid. This was used directly in the next step without further purification. MS (ESI) m/z 296.36[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ7.38-7.24(m,8H),7.23-7.14(m,2H),4.41(d,J＝4.2Hz,1H),3.55(s,4H),2.45-2.28(m,1H),1.90-1.70(m,4H),1.50-1.30(m,2H),1.10–0.90(m,2H)。
To a stirred solution of trans-4- (dibenzylamino) cyclohex-1-ol (29) (2 g,6 mmol) in acetonitrile (50 mL) was added CuI (0.258 g,1.3 mmol) at room temperature. The reaction mixture was heated to 45℃and 2, 2-difluoro-2- (fluorosulfonyl) acetic acid (2.4 g,13 mmol) was added. The reaction mixture was then stirred at the same temperature for 1h. 2, 2-difluoro-2- (fluorosulfonyl) acetic acid (2.4 g,13 mmol) was added and stirring continued for another 1h. The reaction mixture was then cooled to room temperature and filtered through a pad of celite. The filtrate was evaporated, the residue was dissolved in EtOAc and saturated NaHCO 3 The aqueous wash is followed by water wash. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give the crude compound, which was purified by flash column chromatography on 100-200 silica gel using 5% etoac/hexanes as eluent to afford trans-N, N-dibenzyl-4- (difluoromethoxy) cyclohex-1-amine (30) (1.8 g, 86%) as a white solid. MS (ESI) m/z 346.39[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ7.38-7.26(m,8H),7.23-7.15(m,2H),6.65(t,J＝77.2Hz,1H),4.05-3.90(m,1H),3.56(s,4H),2.48-2.35(m,1H),1.97(d,J＝10.4Hz,2H),1.82(d,J＝11.6Hz,2H),1.55-1.42(m,2H),1.30-1.15(m,2H)。
To a stirred solution of trans-N, N-dibenzyl-4- (difluoromethoxy) cyclohex-1-amine (30) (0.9 g,2.6 mmol) in EtOH (10 mL) was added 20% Pd (OH) 2/C (0.6 g) and the reaction mixture was stirred under a hydrogenation (50 PSI) atmosphere for 16h. The mixture was passed through a celite pad and the filtrate was concentrated to give trans-4- (difluoromethoxy) cyclohexylamine (31) (350 mg, 81%) as a colorless oil, which was used directly in the next step without purification. MS (ESI) m/z 166.37[ M+H ]] + 。
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (4.8 g,13.07 mmol) in THF (48 mL) was added DIPEA (7.23 mL,39.23 mmol), EDC.HCl (3.74 g,19.61 mmol), HOBT (2.64 g,19.61 mmol) and the reaction mixture was stirred at room temperature for 15min. (1 r,4 r) -4- (difluoromethoxy) cyclohex-1-amine (31) (2.16 g) 13.07 mmol) and the reaction was stirred at room temperature for 12h. After completion of the reaction as determined by TLC, the reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 200 mL). The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give a crude product which was purified by flash column chromatography on 100-200 silica gel using 90% etoac/hexanes as eluent to afford N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (32) (3.5 g, 57%) as an off-white solid. MS (ESI) m/z 515.61[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.23(d,J＝7.2Hz,1H),8.07(s,1H),7.72(d,J＝8.4Hz,2H),7.56(d,J＝8.8Hz,2H),6.69(t,J＝76.6Hz,1H),4.63(s,2H),4.12-4.03(m,4H),3.57-3.55(m,1H),1.96–1.94(m,2H),1.85–1.82(m,2H),1.49-1.41(m,2H),1.34-1.32(m,2H)。
Example 19: synthesis of N- ((1 s,4 s) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (36)
K was added to a stirred solution of (1 s,4 s) -4-aminocyclohex-1-ol (5 g,33.11 mmol) in acetonitrile (100 mL) at ice temperature 2 CO 3 (19.2 g,139.07 mmol) benzyl bromide (17 g,99.33 mmol) was then added and the reaction mixture was stirred at room temperature for 18h. The mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was stirred with petroleum ether (pet ether) and filtered to afford (1 s,4 s) -4- (dibenzylamino) cyclohex-1-ol (33) (7 g, 72.16%) as a white solid. MS (ESI) m/z 296.27[ M+H ] ] + 。
To a stirred solution of (1 s,4 s) -4- (dibenzylamino) cyclohex-1-ol (33) (4.4 g,14.91 mmol) in acetonitrile (45 mL) was added CuI (56 mg,2.98 mmol) and the reaction mixture was heated to 45℃and then 2, 2-difluoro-1-ol was added2- (fluorosulfonyl) acetic acid (9.29 g,52.20 mmol) and stirring for 2h. The reaction mixture was treated with NaHCO 3 The aqueous solution was slowly quenched and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column chromatography to give (1 s,4 s) -N, N-dibenzyl-4- (difluoromethoxy) cyclohex-1-amine (34) (3.2 g, 62%) as a white solid. MS (ESI) m/z 346.70[ M+H ]] + 。
To a stirred solution of (1 s,4 s) -N, N-dibenzyl-4- (difluoromethoxy) cyclohex-1-amine (34) (2 g,5.79 mmol) in EtOH (10 mL) was added 10% Pd/C (8 g) and the reaction mixture was stirred under an atmosphere of hydrogen (70 psi) for 16h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give (1 s,4 s) -4- (difluoromethoxy) cyclohex-1-amine (35) (0.45 g, 47%). MS (ESI) m/z 166.12[ M+H ]] - 。
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (300 mg,0.82 mmol) in DMF (3 mL) was added HATU (460 mg,1.23 mmol), DIPEA (0.43 mL,2.45 mmol) and the reaction mixture was stirred at the same temperature for 15min. (1 s,4 s) -4- (difluoromethoxy) cyclohex-1-amine (35) (150 mg,0.89 mmol) was added and the reaction was stirred at room temperature for 16h. The reaction mixture was diluted with water and extracted with EtOAc (2×50 ml). The organic layer was evaporated and the crude product was purified by column on silica followed by preparative SFC to provide N- ((1 s,4 s) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) acetamide (36) (51 mg, 12%) as an off-white solid. MS (ESI) m/z 515.20[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.27(d,J＝8.00Hz,1H),8.08(s,1H),7.72(d,J＝8.80Hz,2H),7.56(d,J＝8.80Hz,2H),6.71(t,J＝72.8Hz,1H),4.65(s,2H),4.30-4.20(m,1H),4.12(s,3H),3.70-3.60(m,1H),1.90-1.80(m,2H),1.70-1.50(m,6H)。
Example 20: synthesis of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- ((1 r,4 r) -4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohexyl) acetamide (39)
KO was added to a stirred solution of (1 r,4 r) -4- (dibenzylamino) cyclohex-1-ol (29) (2 g,6.77 mmol) in dioxane (20 mL) at ice temperature t Bu (4.0 g,33.89 mmol) was then added 4- (bromomethyl) tetrahydro-2H-pyran (6.0 mL,40.67 mmol) and the reaction mixture was stirred at 120℃for 16H. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column to give (1 r,4 r) -N, N-dibenzyl-4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohex-1-amine (37) (750 mg, crude). MS (ESI) m/z 394.54[ M+H ]] + 。
To a stirred solution of (1 r,4 r) -N, N-dibenzyl-4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohex-1-amine (37) (750 mg,1.91 mmol) in EtOH (2 mL) was added 10% Pd/C (2 g) and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 Psi) for 16H. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give (1 r,4 r) -4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohex-1-amine (38) (390 mg, crude).
To 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (10) (350 mg,0.95 mmol) in DMF (5 mL) was added HATU (720 mg,1.90 mmol), DIPEA (0.52 mL,2.86 mmol) and the reaction mixture was stirred at the same temperature for 5min. (1 r,4 r) -4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohex-1-amine (38) (406 mg,1.90 mmol) was then added and the reaction stirred at room temperature for 16H. The reaction mixture was diluted with water and extracted with EtOAc (2×50 ml). The combined organic layers were evaporated and the residue was purified by silica gel column (60-120 mesh) followed by RP prep HPLC to afford 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) -N- ((1 r,4 r) -4- ((tetrahydro-2H-pyran-4-yl) methoxy) cyclohexyl) acetamide (39) (40 mg,5% yield) as an off-white solid. MS (ESI) m/z 563.61[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.20(d,J＝7.80Hz,1H),8.07(s,1H),7.72(d,J＝8.40Hz,2H),7.56(d,J＝8.40Hz,2H),4.62(s,2H),4.12(s,3H),3.80-3.70(m,2H),3.60-3.50(m,1H),3.30-3.20(m,5H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.80-1.65(m,1H),1.60-1.50(m,2H),1.30-1.10(m,6H)。
Example 21: synthesis of N- ((1S, 3S) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide and N- ((1R, 3R) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (43 and 44)
To a stirred solution of (trans) -3-aminocyclohexyl-1-hydrochloride (6 g,52.17 mmol) in acetonitrile (60 mL) at ice temperature was added K 2 CO 3 (30.28 g,219.13 mmol) benzyl bromide (26.76 g,156.52 mmol) was then added and the reaction mixture stirred at room temperature for 18h. The mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give crude product. The brown crude product thus obtained was stirred with petroleum ether and filtered to afford (trans) -3- (dibenzylamino) cyclohex-1-ol (40) (6.5 g,42% yield) as a brown solid. MS (ESI) m/z 296.43[ M+H ]] - 。
To a stirred solution of (trans) -3- (dibenzylamino) cyclohex-1-ol (40) (4 g,13.55 mmol) in acetonitrile (40 mL) was added CuI (515 mg,2.71 mmol) and the reaction mixture was heated to 45 ℃ and then 2, 2-difluoro-2- (fluorosulfonyl) acetic acid (8.44 g,47.45 mmol) was added and stirred for 2h. The reaction mixture was treated with NaHCO 3 The aqueous solution was quenched slowly and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column to give gum N, N-dibenzyl-3- (difluoromethoxy) cyclohex-1-amine (41) (3 g,65% yield). MS (ESI) m/z 346.28[M+H] - 。
To a stirred solution of N, N-dibenzyl-3- (difluoromethoxy) cyclohex-1-amine (41) (1.5 g,4.34 mmol) in EtOH (22 mL) was added 10% Pd/C (6 g) and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 Psi) for 16h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give 3- (difluoromethoxy) cyclohex-1-amine (42) (0.450 g,63% yield). MS (ESI) m/z 166.08[ M+H ] ] - 。
To a stirred solution of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetic acid (10) (400 mg,1.08 mmol) in DMF (4 mL) was added HATU (6271 mg,1.63 mmol), DIPEA (0.6 mL,3.26 mmol) at 0 ℃ and the reaction mixture was stirred at the same temperature for 5min. 3- (difluoromethoxy) cyclohex-1-amine (42) (178 mg,1.08 mmol) was added and the reaction mixture was stirred at room temperature for 16h. The reaction mixture was diluted with water and extracted with EtOAc (2×50 ml). The organic layer was evaporated and the residue was purified by silica gel column (60-120 mesh) followed by preparative SFC to give the two trans isomers of N- ((1, 3) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide as off-white solids (43) (105 mg,19% yield) and (44) (125 mg,22% yield) with unknown absolute stereochemistry.
Compound 43: MS (ESI) m/z 515.23[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.43(s,1H),8.25(d,J＝8.00Hz,1H),8.07(s,1H),7.72(d,J＝8.80Hz,2H),7.56(d,J＝8.80Hz,2H),6.69(t,J＝72.8Hz,1H),4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H)。
Compound 44: MS (ESI) m/z 515.23[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.26(d,J＝8.00Hz,1H),8.08(s,1H),7.72(d,J＝8.80Hz,2H),7.56(d,J＝8.80Hz,2H),6.69(t,J＝72.8Hz,1H),4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H)。
Example 22: synthesis of N- ((1S, 3R) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide and N- ((1R, 3S) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (48 and 49)
To a stirred solution of (cis) -3-aminocyclohexyl-1-hydrochloride (6 g,52.17 mmol) in acetonitrile (60 mL) at ice temperature was added K 2 CO 3 (30.28 g,219.13 mmol) benzyl bromide (26.76 g,156.52 mmol) was then added and the reaction mixture stirred at room temperature for 18h. The mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give crude product. The brown crude product thus obtained was stirred with petroleum ether and filtered to afford (cis) -3- (dibenzylamino) cyclohex-1-ol (45) (6.5 g,42% yield) as a brown solid. MS (ESI) m/z 296.43[ M+H ]] - 。
To a stirred solution of 3- (dibenzylamino) cyclohex-1-ol (45) (4 g,13.55 mmol) in acetonitrile (40 mL) was added CuI (515 mg,2.71 mmol) and the reaction mixture was heated to 45 ℃ and then 2, 2-difluoro-2- (fluorosulfonyl) acetic acid (8.44 g,47.45 mmol) was added and stirred for 2h. The reaction mixture was treated with NaHCO 3 The aqueous solution was quenched slowly and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column to give gum N, N-dibenzyl-3- (difluoromethoxy) cyclohex-1-amine (46) (3 g,65% yield). MS (ESI) m/z 346.28[ M+H ]] - 。
To a stirred solution of N, N-dibenzyl-3- (difluoromethoxy) cyclohex-1-amine (46) (1.5 g,4.34 mmol) in EtOH (22 mL) was added 10% Pd/C (6 g) and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (70 Psi) for 16h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give 3- (difluoromethoxy) cyclohex-1-amine (47) (0.450 g,63% yield) )。MS(ESI)m/z 166.08[M+H] - 。
To a stirred solution of 2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetic acid (10) (400 mg,1.08 mmol) in DMF (4 mL) was added HATU (6271 mg,1.63 mmol), DIPEA (0.6 mL,3.26 mmol) at 0 ℃ and the reaction mixture was stirred at the same temperature for 5min. 3- (difluoromethoxy) cyclohex-1-amine (47) (178 mg,1.08 mmol) was added and the reaction was stirred at room temperature for 16h. The reaction mixture was diluted with water and extracted with EtOAc (2×50 mL). The organic layer was evaporated and the residue was purified by silica gel column (60-120 mesh) followed by SFC to afford the two cis isomers of N- ((1, 3) -3- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide as an off-white solid (48) (15 mg,3% yield) and as an off-white solid (49) (2 mg,1% yield).
Compound 48: MS (ESI) m/z 515.23[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.32(d,J＝7.20Hz,1H),8.08(s,1H),7.72(d,J＝8.80Hz,2H),7.56(d,J＝8.80Hz,2H),6.70(t,J＝72.8Hz,1H),4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.35-1.23(m,4H)。
Compound 49: MS (ESI) m/z 515.33[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.32(d,J＝8.4Hz,1H),8.08(s,1H),7.73(d,J＝8.4Hz,2H),7.57(d,J＝8.80Hz,2H),6.70(t,J＝76.4Hz,1H),4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.29-1.11(m,4H)。
Example 23: synthesis of N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (52)
To 2- (3-bromo)-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (7) (500 mg,1.46 mmol) in 1, 4-dioxane (15 mL) was added 5- (trifluoromethyl) pyridin-2-amine (190 mg,1.18 mmol) and cesium carbonate (1.42 g,4.38 mmol). The reaction was degassed with argon for 15min before Pd was added 2 (dba) 3 (267 mg,0.29 mmol) and Xantphos (168 mg,0.29 mmol), the reaction mixture was again degassed with argon for 5min and then stirred at 100℃for 16h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2×15 ml). The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by column on silica gel to provide 2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetic acid tert-butyl ester (50) (200 mg,32% yield) as a pale yellow solid. MS (ESI) m/z 425.25[ M+H ]] + 。
To 2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (50) (200 mg,0.47 mmol) in 1, 4-dioxane (2 mL) was added 4M HCl/dioxane (3 mL) and the reaction mixture was stirred at room temperature for 16h. Evaporating the reaction mixture to provide 2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) acetic acid (51) (150 mg, 90%) as an off-white solid. MS (ESI) m/z 369.0[ M+H ]] + 。
To 2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (51) (150 mg,0.40 mmol) in DMF (3 mL) was added HATU (231 mg,0.61 mmol), DIPEA (0.21 mL,1.22 mmol) and the reaction mixture was stirred at the same temperature for 5min. 1- (((1 r,4 r) -4-aminocyclohexyl) oxy) -2-methylpropan-2-ol (114 mg,0.61 mmol) was added and the reaction was stirred at room temperature for 16h. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 ml). The organic layer was evaporated and the residue was purified by preparative SFC to provide N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino)) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (52) (40 mg,10% yield) as an off-white solid. MS (ESI) m/z 538.19[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.65(s,1H),8.42(s,1H),8.20(d,J＝7.2Hz,1H),8.02(s,1H),7.89(d,J＝6.80Hz,1H),7.17(d,J＝8.8Hz,1H),4.62(s,2H),4.20(s,1H),4.14(s,3H),3.60-3.50(m,1H),3.30-3.20(m,1H),3.14(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H)。
Example 24: synthesis of N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (55)
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0deg.C]To a stirred solution of pyrimidin-6-yl) acetic acid (53) (1.2 g,4.18 mmol) in DMF (15 mL) was added HATU (2.3 g,6.27 mmol), DIPEA (2.3 mL,12.54 mmol) and the reaction mixture was stirred at the same temperature for 5min. (1 r,4 r) -4- (difluoromethoxy) cyclohex-1-amine (35) (827 mg,5.017 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and taken up in Et 2 O washing to afford N2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) -N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (54) (1.0 g, 55%) as a pale yellow solid. MS (ESI) m/z 434.27[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.23(d,J＝7.6Hz,1H),8.15(s,1H),6.69(t,J＝76Hz,1H),4.62(s,2H),4.16(s,3H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H)。
To N2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]To a stirred solution of pyrimidin-6-yl) -N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (54) (400 mg,0.921 mmol) in 1, 4-dioxane (5 mL) was added 5- (trifluoromethyl) pyridin-2-amine (149 mg,0.921 mmol) and cesium carbonate (898 mg,2.76 mmol). The reaction was then degassed with argon for 15min before Pd was added 2 (dba) 3 (53 mg,0.09 mmol) and Xantphos (84, 0.09 mmol) and then the reaction mixture was again degassed with argon for 5min and then the reaction mixture was stirred at 100℃for 2h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2×15 ml). The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column to provide N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (55) (90 mg,19% yield) as a white solid. MS (ESI) m/z 516.50[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.70(s,1H),8.42(s,1H),8.24(d,J＝7.6Hz,1H),8.02(s,1H),7.90(d,J＝6.80Hz,1H),7.18(d,J＝8.80Hz,1H),6.69(t,J＝76Hz,1H),4.62(s,2H),4.18(s,3H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H)。
Example 25: synthesis of N- (3-fluoro-4-methoxyphenyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (64)
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g,58.47 mmol) in MeOH (100 mL) was added 10% Pd/C (3.0 g). The reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 16h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give methyl 4-amino-1H-pyrazole-5-carboxylate (56) (8 g,97% yield) as a brown solid. 1 H NMR(400MHz,DMSO-d 6 ):δ12.82(brs,1H),7.09(s,1H),4.87(s,2H),3.77(s,3H)。
To a stirred solution of methyl 4-amino-1H-pyrazole-5-carboxylate (56) (8 g,56.73 mmol) in n-butanol (80 mL) was added DIPEA (48.15 mL,283.8 mmol), formamidine acetate (6.49 g,62.41 mmol) at room temperature and the reaction was then stirred at 110 ℃3h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. Trituration of the solid compound with diethyl ether to afford 1, 6-dihydro-7H-pyrazolo [4,3-d ]Pyrimidin-7-one (57) (7.1 g, 92%) as an off-white solid. MS (ESI) m/z 137.05[ M+H ]] + ； 1 HNMR(400MHz,DMSO-d 6 ):δ13.10(brs,2H),8.11(s,1H),7.85(s,1H)。
To 1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (57) (5 g,3.67 mmol) in DMF (80 mL) was added NBS (10 g,5.51 mmol) and the reaction mixture was stirred at 60℃for 12h. The reaction mixture was cooled to room temperature, quenched with cold water and the precipitated solid was filtered off. The solid was dried under vacuum to afford 3-bromo-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (58) (5.5 g, 64%) as an off-white solid. MS (ESI) m/z 216.97[ M+2 ]] + 。
To 3-bromo-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (58) (3 g,14.31 mmol) in DMF (30 mL) was added pTSA (134 mg,0.7 mmol) followed by DHP (6.05 g,70.42 mmol) and the reaction mixture was stirred at 60℃for 16h. The reaction mixture was cooled to room temperature, quenched with cold water and extracted with EtOAc (3×50 ml). The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by flash column chromatography to give 3-bromo-1- (tetrahydro-2H-pyran-2-yl) -1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (59) (2.6 g, 61%) as an off-white solid. MS (ESI) m/z 298.95[ M+H ] ] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.98(s,1H),6.13(dd,J＝10.4,2.0Hz,1H),3.93(d,J＝12.8Hz,1H),3.64-3.58(m,1H),2.49-2.24(m,1H),2.02-1.91(m,2H),1.70-1.55(m,4H)。
To 3-bromo-1- (tetrahydro-2H-pyran-2-yl) -1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (59) (2.6 g,8.69 mmol) in DMF (30 mL) was added K 2 CO 3 (3.6 g,26.03 mmol) then 2-chloro-N- (3-fluoro-4-methoxyphenyl) acetamide (60) (2.83 g,13.04 mmol) was added and the reaction mixture stirred at 60℃for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The organic layer was treated with anhydrous Na 2 SO 4 Drying and passingFiltered and concentrated. The residue was purified by flash column chromatography on 100-200 silica gel using 70% etoac/hexanes as eluent to provide 2- (3-bromo-7-oxo-1- (tetrahydro-2H-pyran-2-yl) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (61) (1.5 g,30% yield) as an off-white solid. MS (ESI) m/z 482.01[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.31(s,1H),7.53(dd,J＝13.6,2.4Hz,1H),7.27-7.20(m,1H),7.14(t,J＝9.8Hz,1H),6.11(dd,J＝10.4,2.0Hz,1H),4.88(s,2H),4.0-3.90(m,1H),3.80(s,3H),3.62–3.56(m,1H),2.32-2.24(m,1H),2.01–1.92(m,2H),1.70-1.50(m,3H)。
To 2- (3-bromo-7-oxo-1- (tetrahydro-2H-pyran-2-yl) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (61) (200 mg,0.417 mmol) in toluene (6 mL) in degassed (argon) was added Cs 2 CO 3 (406mg，1.25mmol)、Pd 2 (dba) 3 (38 mg,0.04 mmol), xantphos (24 mg,0.041 mmol) and 5- (trifluoromethyl) pyridin-2-amine (101 mg,0.626 mmol). The solution was again degassed for 15min and the mixture was heated in microwaves at 130 ℃ for 1.5h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The pad was filled with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure to provide a crude product which was purified by preparative HPLC to provide N- (3-fluoro-4-methoxyphenyl) -2- (7-oxo-1- (tetrahydro-2H-pyran-2-yl) -3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (62) (50 mg, 24%) as a pale yellow solid. MS (ESI) m/z 562.14[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.56(brs,1H),9.80(brs,1H),8.45(s,1H),8.19(s,1H),7.95(dd,J＝8.8,2.4Hz,1H),7.55(dd,J＝13.2,2Hz,1H),7.26(d,J＝8.8Hz,2H),7.15(t,J＝9.2Hz,1H),6.12(dd,J＝8,2Hz,1H),4.87(s,2H),3.95(d,J＝7.6Hz,1H),3.80(s,3H),3.63 -3.56(m,1H),2.39-2.31(m,1H),2.03-1.93(m,2H),1.72-1.56(m,1H),1.55-1.53(m,2H)。
To N- (3-fluoro-4-methoxyphenyl) -2- (7-oxo-1- (tetrahydro-2H-pyran-2-yl) -3- ((5- (trifluoromethyl) pyridin-2-yl) amino at 0 ℃C) -1, 7-dihydro-6H-pyrazolo [4,3-d]To a stirred solution of pyrimidin-6-yl) acetamide (62) (45 mg,0.08 mmol) in DCM (2 mL) was added 4N HCl/dioxane (2 mL). The reaction mixture was stirred at room temperature for 16h. The reaction mixture was concentrated and the residue was purified by preparative HPLC to provide N- (3-fluoro-4-methoxyphenyl) -2- (7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (63) (12 mg,31% yield) as an off-white solid. MS (ESI) m/z 478.05[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ13.92(brs,1H),10.49(s,1H),9.77(brs,1H),8.44(s,1H),8.09(s,1H),7.90(d,J＝8.8Hz,1H),7.55(dd,J＝13.2,2Hz,1H),7.26(d,J＝9.2Hz,1H),7.21–7.12(m,2H),4.86(s,2H),3.80(s,3H)。
To N- (3-fluoro-4-methoxyphenyl) -2- (7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature ]To a stirred solution of pyrimidin-6-yl) acetamide (63) (50 mg,0.104 mmol) in DMF (2 mL) was added Cs 2 CO 3 (68 mg,0.209 mmol) followed by methyl iodide (18 mg,0.125 mmol). The reaction mixture was stirred at the same temperature for 16h. The reaction mixture was quenched with water (50 ml) and extracted with EtOAc (2 x 25 ml). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by preparative HPLC to provide N- (3-fluoro-4-methoxyphenyl) -2- (1-methyl-7-oxo-3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (64) (10 mg, 14%) as a white solid. MS (ESI) m/z 492.09[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.60(s,1H),9.68(s,1H),8.50(brs,2H),8.43(s,1H),8.10(s,1H),7.90(d,J＝8.8Hz,1H),7.55(d,J＝13.6Hz,1H),7.27(d,J＝8.8Hz,1H),7.19–7.12(m,2H),4.85(s,2H),4.15(s,3H),3.80(s,3H)。
Example 26: synthesis of N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (65)
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]To a stirred solution of pyrimidin-6-yl) -N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (54) (300 mg,0.69 mmol) in 1, 4-dioxane (5 mL) was added 6- (trifluoromethyl) pyridin-3-amine (111 mg,0.69 mmol) and cesium carbonate (673 mg,2.07 mmol). The reaction was degassed with argon for 15min before Pd was added 2 (dba) 3 (63 mg,0.06 mmol) and Xantphos (39 mg,0.06 mmol), the reaction mixture was again degassed with argon for 5min and then the reaction mixture was stirred at 100℃for 2h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2×15 ml). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give a crude product which is purified by SFC to provide N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) acetamide (65) (100 mg,28% yield) as a light brown solid. MS (ESI) m/z 516.50[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.80(s,1H),8.89(s,1H),8.30-8.20(m,2H),8.10(s,1H),7.76(d,J＝8.80Hz,1H),6.69(t,J＝76Hz,1H),4.64(s,2H),4.30(s,3H),4.10-4.00(m,1H),3.65-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H)。
Example 27: synthesis of N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (68)
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (7) (500 mg,1.46 mmol) in 1, 4-dioxane (15 mL) was added 6- (trifluoromethyl) pyridin-3-amine (284 mg,1.75 mmol) and cesium carbonate (1.42 g,4.38 mmol). The reaction was degassed with argon for 15min before Pd was added 2 (dba) 3 (133 mg,0.14 mmol) and Xantphos (84 mg,0.14 mmol). The reaction mixture was again degassed with argon for 5min, and then stirred at 100 ℃ for 16h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2×15 ml). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by column on silica gel to provide 2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) tert-butyl acetate (66) (600 mg,70% yield) as a pale yellow solid. MS (ESI) m/z 425.4[ M+H ]] + 。
To 2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (66) (600 mg,1.45 mmol) in 1, 4-dioxane (2 mL) was added 4M HCl/dioxane (10 mL). The reaction mixture was stirred at room temperature for 16h. Evaporating the reaction mixture to obtain 2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetic acid (67) (500 mg,90% yield) as a pale yellow solid. MS (ESI) m/z 369.33[ M+H ]] + 。
To 2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (67) (300 mg,0.81 mmol) in DMF (10 mL) was added HATU (460 mg,1.22 mmol), DIPEA (0.31 mL,2.44 mmol). The reaction mixture was stirred at the same temperature for 5min. 1- (((1 r,4 r) -4-aminocyclohexyl) oxy) -2-methylpropan-2-ol (182 mg,0.97 mmol) was added and the reaction was stirred at room temperature for 16h. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 ml). The combined organic layers were evaporated and the residue was purified by preparative HPLC to provide N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (1-methyl-7-oxo-3- ((6- (trifluoromethyl) pyridin-3-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]Pyrimidin-6-yl) acetamide (68) (120 mg,27% yield) as an off-white solid. MS (ESI) m/z 538.15[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.80(s,1H),8.89(s,1H),8.21(d,J＝7.2Hz,2H),8.09(s,1H),7.76(d,J＝8.80Hz,1H),4.63(s,2H),4.20(s,1H),4.13(s,3H),3.60-3.50(m,1H),3.30-3.20(m,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H)。
Example 28: synthesis of N- (3-fluoro-4-methoxyphenyl) -2- (7-oxo-1- (tetrahydro-2H-pyran-2-yl) -3- ((5- (trifluoromethyl) pyridin-2-yl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (70)
To 3-bromo-1-methyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (5) (2 g,8.70 mmol) in DMF (30 mL) was added K 2 CO 3 (3.6 g,26.03 mmol) then 2-chloro-N- (3-fluoro-4-methoxyphenyl) acetamide (60) (2.83 g,13.04 mmol) was added. The reaction mixture was stirred at 60℃for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by flash column chromatography to give 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (69) (2.91 g,81% yield) as a pale yellow solid. MS (ESI) m/z 412.20[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.49(brs,1H),8.31(s,1H),7.53(dd,J＝9.6,2.4Hz,1H),7.25(1H,J＝10.0Hz,1H),7.13(t,J＝9.2Hz,1H),4.85(s,2H),4.17(s,3H),3.80(s,3H)。
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]Pyrimidine-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (69) (343 mg,0.82 mmol) in dioxane (10 mL) in degassed (argon) was added Cs 2 CO 3 (812mg，2.50mmol)、Pd 2 (dba) 3 (76 mg,0.08 mmol), xantphos (48 mg,0.082 mmol) and 4-isopropoxy-aniline (186 mg,1.34 mmol). The reaction mixture was again degassed for 15min and the mixture was heated at 100 ℃ for 16h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The pad was filled with 5% MeOH/CH 2 Cl 2 Washing. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide N- (3-fluoro-4-methoxyphenyl) -2- (3- ((4-isopropoxyphenyl) amino) -1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetamide (70) (30 mg, 8%) as an off-white solid. MS (ESI) m/z 481.50[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.47(s,1H),8.66(s,1H),8.10(s,1H),7.58-7.53(m,4H),7.27(d,J＝8.8Hz,1H),7.14(t,J＝9.2Hz,1H),6.82(d,J＝8.8Hz,2H),4.85(s,2H),4.48-4.44(m,1H),4.07(s,3H),3.80(s,3H),1.23(d,J＝6.0Hz,6H)。
Example 29: synthesis of 2- (3- ((4-chlorophenyl) amino) -1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (71)
To 2- (3-bromo-1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]Pyrimidine-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (69) (343 mg,0.82 mmol) in dioxane (10 mL) in degassed (argon) solution adding Cs 2 CO 3 (812mg，2.5mmol)、Pd 2 (dba) 3 (76 mg,0.08 mmol), xantphos (48 mg,0.082 mmol) and 4-chloroaniline (160 mg,1.34 mmol). The reaction mixture was again degassed for 15min and the mixture was heated at 100 ℃ for 16h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The pad was filled with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide 2- (3- ((4-chlorophenyl) amino) -1-methyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (71) (50 mg, 13%) as an off-white solid. MS (ESI) m/z 455.26[ M-H ]] - ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.47(s,1H),9.12(s,1H),8.13(s,1H),7.64(dd,J＝9.2,2.4Hz,2H),7.54(dd,J＝13.6,2.4Hz,1H),7.28(d,J＝9.2Hz,3H),7.14(t,J＝9.2Hz,1H),4.85(s,2H),4.10(s,3H),3.80(s,3H)。
Example 30: synthesis of 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (77)
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5.0 g,29.22 mmol) in DMF (50 mL) at room temperature was added K 2 CO 3 (12.07 g,87.66 mmol) followed by iodoethane (2.58 mL,32.14 mmol). The reaction mixture was stirred at the same temperature for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by a silica gel column to give methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.7 g, 29%). MS (ESI) m/z 200.07[ M+H ]] + 。 1 H NMR(400MHz,DMSO-d 6 ):δ8.39(s,1H),4.75-4.70(m,1H),4.29(q,J＝7.2Hz,2H),3.99(s,3H),1.38(d,J＝7.2Hz,3H)。
To a stirred solution of methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.8 g,9.04 mmol) in MeOH (100 mL) was added 10% Pd/C (3.0 g). The reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 8h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give methyl 4-amino-1-ethyl-1H-pyrazole-5-carboxylate (73) (1.5 g,98% yield) as a brown solid. MS (ESI) m/z 170.2[ M+H ] ] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ7.02(s,1H),5.00(brs,2H),4.31(q,J＝7.2Hz,2H),3.80(s,3H),1.20(d,J＝7.2Hz,3H)。
To a stirred solution of ethyl 4-amino-1H-pyrazole-5-carboxylate (73) (1.8 g,10.64 mmol) in n-butanol (80 mL) was added DIPEA (9.2 mL,53.2 mmol), formamidine acetate (1.21 g,11.70 mmol) at room temperature. The reaction mixture was stirred at 110℃for 3h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. Trituration of the solid compound with diethyl ether to afford 1-ethyl-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (74) (1.2 g, 69%) as an off-white solid. MS (ESI) m/z 165.11[M+H] + ； 1 HNMR(400MHz,DMSO-d 6 ):δ7.97(s,1H),7.79(s,1H),4.57(q,J＝7.2Hz,2H),1.38(d,J＝7.2Hz,3H)。
To ethyl 1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (74) (1.2 g,7.31 mmol) in DMF (80 mL) was added NBS (2.86 g,16.08 mmol). The reaction mixture was stirred at 80℃for 12h. The reaction mixture was cooled to room temperature, quenched with cold water and the precipitated solid was filtered off. The solid was dried under vacuum to afford 3-bromo-1-ethyl-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (75) (1.0 g, 56%) as an off-white solid. MS (ESI) m/z 243.08[ M+2 ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ12.51(s,1H),7.93(s,1H),4.55(q,J＝7.2Hz,2H),1.39(d,J＝7.2Hz,3H)。
To 3-bromo-1-ethyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (75) (500 mg,2.06 mmol) in DMF (30 mL) was added K 2 CO 3 (854 mg,6.18 mmol) then 2-chloro-N- (3-fluoro-4-methoxyphenyl) acetamide (60) (537.9 mg,2.47 mmol) was added. The reaction mixture was stirred at 60℃for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by flash column chromatography on 100-200 silica gel to provide 2- (3-bromo-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (76) (400 mg,46% yield) as an off-white solid. MS (ESI) m/z 424.29[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.24(s,1H),7.53(d,J＝10.8Hz,1H),7.26(d,J＝4.4Hz,1H),7.13(d,J＝8.0Hz,1H),4.86(s,2H),4.56(q,J＝7.2Hz,2H),3.80(s,3H),1.39(d,J＝7.2Hz,3H)。
To 2- (3-bromo-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]Pyrimidine-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (76) (330 mg,0.777 mmol) in dioxane (6 mL) in degassed (argon) solution adding Cs 2 CO 3 (406mg，1.25mmol)、Pd 2 (dba) 3 (70.5 mg,0.077 mmol), xantphos (44.5 mg,0.077 mmol) and 5- (trifluoromethyl) pyri-dinePyridin-2-amine (188 mg,1.165 mmol). The solution was again degassed for 15min and the reaction mixture was heated in the microwave at 100 ℃ for 3h. The reaction mixture was cooled to room temperature and filtered through a celite pad. Pad celite with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure to provide a crude product which was purified by preparative HPLC to provide 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (77) (103 mg, 26%) as a pale yellow solid. MS (ESI) m/z 505.31[ M+H ] ] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.47(s,1H),9.44(s,1H),8.16(s,1H),7.72(d,J＝8.8Hz,2H),7.57(d,J＝8.8Hz,2H),7.53(s,1H),7.27(d,J＝8.8Hz,1H),7.14(t,J＝9.2Hz,1H),4.81(s,2H),4.52(q,J＝7.2Hz,2H),3.80(s,3H),1.39(t,J＝7.2Hz,3H)。
Example 31: synthesis of N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (80)
To 3-bromo-1-ethyl-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidine-7-one (75) (600 mg,2.46 mmol), 2-bromo-N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (78) (640 mg,2.96 mmol) in DMF (20 mL) was added K 2 CO 3 (509 mg,3.66 mmol) and stirred at room temperature for 16h. The reaction mixture was diluted with water (10 mL) to give a solid which was filtered and washed with water to afford 2- (3-bromo-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (79) (300 mg, 27%) as a white solid. MS (ESI) m/z 448.48[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.26(d,J＝7.6Hz,1H),8.15(s,1H),6.68(t,J＝76.4Hz,1H),4.63(s,2H),4.50(q,J＝7.6Hz,2H),4.10-4.00(m,1H),3.60-3.50(m,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.60-1.20(s,7H)。
To 2- (3-bromo)-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d]To a stirred solution of pyrimidin-6-yl) -N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) acetamide (79) (500 mg,1.12 mmol) in 1, 4-dioxane (5 mL) was added 4- (trifluoromethyl) aniline (216 mg,1.34 mmol) and cesium carbonate (1.1 g,3.45 mmol). The reaction mixture was degassed with argon for 15min before Pd was added 2 (dba) 3 (103 mg,0.11 mmol) and Xantphos (63 mg,0.11 mmol). The reaction mixture was again degassed with argon for 5min and then stirred at 100 ℃ for 16h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2×15 ml). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated to give a crude product which is purified by silica gel column to provide N- ((1 r,4 r) -4- (difluoromethoxy) cyclohexyl) -2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) acetamide (80) (120 mg,20% yield) as a white solid. MS (ESI) m/z 529.56[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.23(d,J＝7.6Hz,1H),8.08(s,1H),7.71(d,J＝8.4Hz,2H),7.56(d,J＝8.4Hz,2H),6.69(t,J＝76.4Hz,1H),4.64(s,2H),4.50(q,J＝7.6Hz,2H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.30(s,7H)。
Example 32: synthesis of 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) -N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) acetamide (84)
To 3-bromo-1-ethyl-1, 6-dihydro-7H-pyrazolo [4,3-d]To a stirred solution of pyrimidin-7-one (75) (1.9 g,7.81 mmol) in DMF (100 mL) was added K 2 CO 3 (2.1 g,15.6 mmol) followed by t-butyl bromoacetate (1.4 mL,9.38 mmol). The reaction mixture was stirred at room temperature for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Drying, filtering and concentrating. The residue was purified by flash column chromatography on silica gel (100-200) to afford 2- (3-bromo-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) acetic acid tert-butyl ester (81) (2.3 g,82% yield) as an off-white solid. MS (ESI) m/z 357.42[ M+H ] ] + ； 1 H NMR(400MHz,CDCl 3 ):δ8.24(s,1H),4.74(s,2H),4.57(q,J＝7.2Hz,2H),1.41(s,9H)。
To 2- (3-bromo-1-ethyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]To a degassed (argon) solution of tert-butyl pyrimidin-6-yl) acetate (81) (2.3 g,6.46 mmol) in dioxane (25 mL) was added Cs 2 CO 3 (6.2g，19.38mmol)、Pd 2 (dba) 3 (591 mg,0.64 mmol), xantphos (373 mg,0.64 mmol) and 4- (trifluoromethyl) aniline (1.0 g,6.46 mmol). The solution was degassed again for 15min and the mixture was heated in a sealed tube at 100 ℃ for 3h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The pad was filled with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column to give 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetic acid tert-butyl ester (82) (1.8 g, 64%) as a pale yellow solid. MS (ESI) m/z 438.09[ M+H ]] + ； 1 HNMR(400MHz,DMSO-d 6 ):δ9.46(s,1H),8.16(s,1H),7.72(d,J＝8.4Hz,2H),7.57(d,J＝8.4Hz,2H),4.74(s,2H),4.50(q,J＝7.2Hz,2H),1.44(s,9H),1.38(t,J＝7.2Hz,3H)。
To 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0deg.C]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (82) (1.8 g,4.11 mmol) in DCM (10 mL) was added a 4M HCl/dioxane (10 mL). The reaction mixture was stirred at room temperature for 16h. The reaction mixture was evaporated under reduced pressure and triturated with ether and dried under reduced pressure to give 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] ]Pyrimidin-6-yl) acetic acid (83) (1.1 g, 7.3%) as a pale yellow solid. MS (ESI) m/z 382.46[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.46(s,1H),8.17(s,1H),7.71(d,J＝8.4Hz,2H),7.57(d,J＝8.4Hz,2H),4.77(s,2H),4.52(q,J＝7.2Hz,2H),1.40(t,J＝7.2Hz,3H)。
To 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0deg.C]To a stirred solution of pyrimidin-6-yl) acetic acid (83) (250 mg,0.65 mmol) in DMF (3 mL) was added HATU (374mg, 0.98 mmol), DIPEA (0.36 mL,1.96 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2- (((1 r,4 r) -4-aminocyclohexyl) methoxy) propan-2-ol (147 mg,0.78 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to afford 2- (1-ethyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4, 3-d)]Pyrimidin-6-yl) -N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) acetamide (84) (39 mg, 10%) as an off-white solid. MS (ESI) m/z 551.72[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.44(s,1H),8.20(d,J＝7.6Hz,1H),8.07(s,1H),7.71(d,J＝8.4Hz,2H),7.56(d,J＝8.8Hz,2H),4.63(s,2H),4.51(q,J＝4.4Hz,1H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.39(t,J＝7.2Hz,3H),1.30-1.20(m,4H),1.05(s,6H)。
Example 33: synthesis of N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (92)
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g,58.4 mmol) in DMF (100 mL) at room temperature was added K 2 CO 3 (16.1 g,116.9 mmol) followed by 2, 2-trifluoroethyl triflate (12.7 mL,87.7 mmol). The reaction mixture was stirred at the same temperature for 16h. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by silica gel column to afford 4-nitro group-methyl 1- (2, 2-trifluoroethyl) -1H-pyrazole-5-carboxylate (85) (4 g,32% yield) as a colourless liquid and further eluted to give the other isomer methyl 4-nitro-1- (2, 2-trifluoroethyl) -1H-pyrazole-3-carboxylate (85 a) (5 g). MS (ESI) m/z 254.14[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.57(s,1H),5.41(q,J＝7.20Hz,2H),3.98(s,3H)。
To a stirred solution of 4-nitro-1- (2, 2-trifluoroethyl) -1H-pyrazole-5-carboxylic acid methyl ester (85) (3.3 g,13.04 mmol) in MeOH (33 mL) was added 10% Pd/C (2 g) and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 16H. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give 4-amino-1- (2, 2-trifluoroethyl) -1H-pyrazole-5-carboxylic acid methyl ester (86) (2.3 g,82% yield). MS (ESI) M/z224.09[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ7.24(s,1H),5.09(q,J＝7.20Hz,2H),4.20(s,2H),3.93(s,3H)。
To a stirred solution of 4-amino-1- (2, 2-trifluoroethyl) -1H-pyrazole-5-carboxylic acid methyl ester (86) (2.3 g,10.31 mmol) in n-butanol (23 mL) was added DIPEA (9.5 mL,51.56 mmol) and formamidine acetate (2.1 g,20.62 mmol) at room temperature. The reaction mixture was stirred at 110℃for 16h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. Trituration of the solid compound with diethyl ether to afford 1- (2, 2-trifluoroethyl) -1, 6-dihydro-7H-pyrazolo [4,3-d ]Pyrimidin-7-one (87) (2 g,89% yield) as an off-white solid. MS (ESI) m/z 218.04[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ12.52(brs,1H),8.21(s,1H),7.98(s,1H),5.46(q,J＝7.20Hz,2H)。
To a stirred solution of 1- (2, 2-trifluoroethyl) -1, 6-dihydro-7H-pyrazolo [4,3-d ] pyrimidin-7-one (87) (1.6 g,7.33 mmol) in DMF (16' mL) was added NBS (6.5 g,36.69 mmol) at room temperature. The reaction mixture was stirred at 110℃for 30h. The reaction mixture was cooled to room temperature, quenched with cold water and the precipitated solid was filtered off. The solid was dried under vacuum to afford 3-bromo-1- (2, 2-trifluoroethyl) -1, 6-dihydro-7H-pyrazolo [4,3-d ] pyrimidin-7-one (88) (1.0 g,46% yield) as an off-white solid.
MS(ESI)m/z 297.04[M+H] - ； 1 H NMR(400MHz,DMSO-d 6 ):δ12.79(brs,1H),8.04(s,1H),5.46(q,J＝7.20Hz,2H)。
To 3-bromo-1- (2, 2-trifluoroethyl) -1, 6-dihydro-7H-pyrazolo [4,3-d]To a stirred solution of pyrimidin-7-one (88) (1.0 g,3.3 mmol) in DMF (10 mL) was added K 2 CO 3 (935 g,6.77 mmol) followed by t-butyl bromoacetate (0.7 mL,5.08 mmol). The reaction mixture was stirred at room temperature for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by flash column chromatography on silica gel (100-200) to afford 2- (3-bromo-7-oxo-1- (2, 2-trifluoroethyl) -1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) acetic acid tert-butyl ester (89) (600 mg,43% yield) as an off-white solid. MS (ESI) m/z 410.02[ M+H ]] + ；411.20。
To 2- (3-bromo-7-oxo-1- (2, 2-trifluoroethyl) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]T-butyl pyrimidin-6-yl) acetate (89) (400 mg,0.97 mmol) to a degassed (argon) solution of dioxane (5 mL) was added Cs 2 CO 3 (951g，2.92mmol)、Pd 2 (dba) 3 (89 mg,0.09 mmol), xantphos (56 mg,0.09 mmol) and 4- (trifluoromethyl) aniline (157 g,0.97 mmol). The solution was degassed again for 15min and the mixture was heated in a sealed tube at 100 ℃ for 3h. The reaction mixture was cooled to room temperature and filtered through a celite pad. The pad was filled with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column to give 2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetic acid tert-butyl ester (90) (250 mg,52% yield) as a pale yellow solid. MS (ESI) m/z 491.13[ M+H ]] + ；492.27。
To 2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of tert-butyl pyrimidin-6-yl) acetate (90) (250 mg,0.50 mmol) in 1, 4-dioxane (3 mL) was added a 4M HCl/dioxane (3 mL) solution. The reaction mixture was stirred at room temperature for 48h. Mixing the reaction The compound was evaporated under reduced pressure and triturated with ether and dried under reduced pressure to give 2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ]]Pyrimidin-6-yl) acetic acid (91) (200 mg, 90%) as a pale yellow solid. MS (ESI) m/z 435.07[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ13.32(br s,1H),9.71(s,1H),8.30(s,1H),7.99(d,J＝8.40Hz,2H),7.61(d,J＝8.8Hz,2H),5.35(q,J＝8.80Hz,2H),4.78(s,2H)。
To 2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] at 0 DEG C]To a stirred solution of pyrimidin-6-yl) acetic acid (91) (200 mg,0.45 mmol) in DMF (3 mL) was added HATU (262 mg,0.68 mmol), DIPEA (0.25 mL,1.37 mmol) and the reaction mixture was stirred at the same temperature for 5min. 2- (((1 r,4 r) -4-aminocyclohexyl) methoxy) propan-2-ol (103 mg,0.55 mmol) was then added and the reaction was stirred at room temperature for 16h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N- ((1 r,4 r) -4- (2-hydroxy-2-methylpropyloxy) cyclohexyl) -2- (7-oxo-1- (2, 2-trifluoroethyl) -3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (92) (50 mg,18% yield) as an off-white solid. MS (ESI) m/z 605.36[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ9.70(s,1H),8.30-8.20(m,2H),7.81(d,J＝8.4Hz,2H),7.60(d,J＝8.8Hz,2H),5.34(q,J＝8.80Hz,2H),4.64(s,2H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.14(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H)。
Example 34: synthesis of N- (3-fluoro-4-methoxyphenyl) -2- (1-isopropyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d ] pyrimidin-6-yl) acetamide (98)
To a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5 g,29.22 mmol) in DMF (50 mL) at room temperature was added K 2 CO 3 (8.04 g,58.44 mmol) then 2-iodopropane (5.46 g,32.11 mmol) was added and the reaction mixture stirred at the same temperature for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by a silica gel column to give methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g, 32%). MS (ESI) m/z 213.07[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ8.41(s,1H),4.75-4.70(m,1H),4.00(s,2H),1.44(d,J＝6.8Hz,6H)。
To a stirred solution of methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g,9.38 mmol) in MeOH (20 mL) was added 10% Pd/C (1.0 g). The reaction mixture was stirred at room temperature under an atmosphere of hydrogen (50 PSI) for 8h. The reaction mixture was filtered through celite pad and the filtrate was concentrated to give 4-amino-1-isopropyl-1H-pyrazole-5-carboxylic acid methyl ester (94) (1.4 g,81% yield) as a brown solid. MS (ESI) m/z 184.20[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ7.05(s,1H),5.30-5.15(m,1H),4.99(s,2H),3.79(s,3H),1.31(d,J＝6.8Hz,6H)。
To a stirred solution of methyl 4-amino-1-isopropyl-1H-pyrazole-5-carboxylate (94) (1.4 g,7.64 mmol) in n-butanol (80 mL) was added DIPEA (6.65 mL,38.2 mmol), formamidine acetate (874.9 mg,8.40 mmol) at room temperature. The reaction mixture was stirred at 110℃for 3h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. Trituration of the solid compound with diethyl ether to afford 1-isopropyl-1, 6-dihydro-7H-pyrazolo [4,3-d ]Pyrimidin-7-one (95) (1.0 g, 73%) as an off-white solid. MS (ESI) m/z 179.18[ M+H ]] + 。
To 1-isopropyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (95) (1 g,5.61 mmol) in DMF (10 mL) was added NBS (2.19 g,12.34 mmol). The reaction mixture was stirred at 80℃for 12h. The reaction mixture was cooled to room temperature, quenched with cold water and the precipitated solid was filtered off. The solid was dried under vacuum to afford 3-bromo-1-isopropyl-1, 6-dihydro-7H-pyrazolo [4,3-d]Pyrimidin-7-one (96) (700 mg, 49%) as an off-white solid. MS (ESI) m/z 257.21[M+H] + ； 1 HNMR(400MHz,DMSO-d 6 ):δ12.51(s,1H),7.92(s,1H),5.40-5.30(m,1H),4.87(s,2H),1.47(d,J＝6.8Hz,6H)。
To 3-bromo-1-isopropyl-1, 6-dihydro-7H-pyrazolo [4,3-d ] at room temperature]To a stirred solution of pyrimidin-7-one (96) (500 mg,1.94 mmol) in DMF (10 mL) was added K 2 CO 3 (803.1 mg,5.82 mmol) then 2-chloro-N- (3-fluoro-4-methoxyphenyl) acetamide (60) (423 mg,1.94 mmol) was added. The reaction mixture was stirred at 60℃for 16h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2×250 mL). The combined organic layers were treated with anhydrous Na 2 SO 4 Dried, filtered and concentrated. The residue was purified by flash column chromatography on 100-200 silica gel to provide 2- (3-bromo-1-isopropyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4, 3-d) ]Pyrimidin-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (97) (350 mg,41% yield) as an off-white solid. MS (ESI) m/z 438.28[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.57(brs,1H),8.24(s,1H),7.54(d,J＝10.8Hz,1H),7.26(d,J＝8.8Hz,1H),7.15(d,J＝8.8Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.45(d,J＝6.8Hz,6H)。
To 2- (3-bromo-1-isopropyl-7-oxo-1, 7-dihydro-6H-pyrazolo [4,3-d ] at room temperature]Pyrimidine-6-yl) -N- (3-fluoro-4-methoxyphenyl) acetamide (97) (330 mg,0.752 mmol) in dioxane (6 mL) in degassed (argon) solution adding Cs 2 CO 3 (735mg，2.25mmol)、Pd 2 (dba) 3 (68 mg,0.075 mmol), xantphos (43 mg,0.075 mmol) and 5- (trifluoromethyl) pyridin-2-amine (181 mg,1.12 mmol). The solution was again degassed for 15min and the reaction mixture was heated in the microwave at 100 ℃ for 3h. The reaction mixture was cooled to room temperature and filtered through a celite pad. Pad celite with 5% MeOH/CH 2 Cl 2 And (5) washing. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide N- (3-fluoro-4-methoxyphenyl) -2- (1-isopropyl-7-oxo-3- ((4- (trifluoromethyl) phenyl) amino) -1, 7-dihydro-6H-pyrazolo [4,3-d]Pyrimidin-6-yl) acetamide (98) (74 mg, 19%) as a pale yellow solid. MS (ESI) m/z 519.17[ M+H ]] + ； 1 H NMR(400MHz,DMSO-d 6 ):δ10.49(s,1H),9.46(s,1H),8.16(s,1H),7.70(d,J＝8.8Hz,2H),7.57(d,J＝8.8Hz,2H),7.53(s,1H),7.27(d,J＝8.8Hz,1H),7.14(t,J＝9.2Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.47(d,J＝6.8Hz,6H)。
Example 35: SF-1Luc assay
Carrier structure:pGal4 DBD-SF-1 LBD is produced by cloning a polymerase chain reaction fragment encoding either SF-1 (aa 198-462) Ligand Binding Domain (LBD) in-frame with the DNA Binding Domain (DBD) of the yeast transcription factor Gal4 encoded by the pFA-CMV vector (Stratagene, la Jolla, calif.). SF-1 (aa 198-462) was amplified from Invitrogen expressed sequence tag clone (San Diego, calif.). The BamHI and XbaI sites introduced by primers GATCGGATCCCCGGAGCCTTATGCCAGCCC (forward) and GATCTCTAGATCAAGTCTGCTTGGCTTGCAGCATTTCGATGAG (reverse) were used to subclone the amplicon into pFA-CMV.
Cell culture and transient transfection conditions:chinese Hamster Ovary (CHO) cells of subtype K1 (American Type Culture Collection, manassas, va.) were cultured in a T-175 flask (Corning Life Sciences, acton, mass.) in Ham's F-12 medium (Gibco, carlsbad, calif.) supplemented with 10% (v/v) fetal bovine serum (Gemini Bio-Products, west sacrameo, calif.) and 1% (v/v) penicillin/streptomycin mixture (Gibco) at 37℃in 5% CO 2 Culturing under 95% relative humidity. Cells were routinely cultured by dividing cells at 1:10 to 1:20. The day before transfection, cells were rinsed with PBS and trypsinized with 0.25% trypsin-EDTA solution (Gibco) and then 6X 10 6 Each CHO-K1 cell was seeded into T-175 flasks containing 20ml of the supplemented Ham's F-12 medium as described above. The cells were incubated at 37℃with 5% CO 2 And incubated at 95% Relative Humidity (RH) overnight. The following day, CHO-K1 cells were transiently co-transfected with 250ng of pGal4DBD_SF-1LBD plasmid or 125ng of pGal4DBD_RORALBD in 1.2mL of ham's F-12 medium containing 54. Mu.l of TransIT-CHO reagent and 9. Mu.l of TransIT-CHO Mojo reagent according to the manufacturer's protocol (Mirus Bioproducts, madison, wis.) in combination with 9. Mu.g of pG5luc (Promega, madison, wis.) and 8.75. Mu.g of empty pcDNA 3.1 (Invitrogen). Then will contain transfected fines The flask of cells was returned to 37℃with 5% CO 2 And 95% relative humidity in an incubator. 4 hours after transfection, cells were trypsinized and suspended to 1.6X10 in supplemented Ham's F-12 medium 5 Concentration of individual cells/ml.
And (3) measuring:the harvested cells were resuspended in medium and plated into 384 Kong Baiban (Corning Life Sciences, acton, MA) at 8,000 cells/50 μl/well. 384 plates were incubated for 1 hour at room temperature, then at 37℃with 5% CO 2 Further incubation was performed for 3 hours. The test article solution was added to 384 plates and at 37℃6% CO 2 Incubate for 40 hours.
Cell viability was tested by fluorescence methods using resazurin. After incubation of transfected CHO cells with test article solutions, 10 μl of 20 μmol/L resazurin solution was added to 384 well plates. Fluorescence was then measured immediately at 615nm (0 hour reading) at an excitation wavelength of 570 nm. At 37℃6% CO 2 After 2 hours of incubation, fluorescence was again measured at 615nm at an excitation wavelength of 570nm (2 hour reading). The fluorescence count (2-0 hours) was calculated by subtracting the 0 hour reading from the 2 hour reading.
Measurement of SF-1 transcriptional Activity:SF-1 transcriptional activity was detected as Luc activity in cells using a SteadyLite Plus HTS reporter assay system. After measuring cell viability, the medium in 384 well plates was completely removed. Then, 30. Mu.L of Luc substrate solution was added to each well and incubated at room temperature for 10min. After incubation, luminescence from each well was measured by a microplate reader.
Calculation of cell viability (%):cell viability (%) was calculated according to the following formula:
the formula: cell viability (%) = (a/B) ×100
A: average fluorescence counts in test article groups (2-0 hours)
B: average fluorescence counts in vehicle group (2-0 hours)
Calculation of SF-1 transcriptional Activity (percentage of control):the percentage of transcriptional activity to control was calculated according to the following formula:
the formula: percentage of control = a/B x 100
A: luminescence counts in CHO cells treated with GAL4-SF-1 plasmid transfected test article
B: luminosity counts in CHO cells treated with GAL4-SF-1 plasmid transfected vehicle
50 EC calculation:half maximum Effective Concentration (EC) was calculated by embedded software from Collaborative Drug Discovery inc (CDD) 50 ). The potency of the compounds is shown in table 1:
TABLE 1
++++＝EC 50 <200nM；+++＝200nM≤EC 50 <1μM；
++＝1μM≤EC 50 ≤10μM；+＝10μM<EC 50 ≤20μM
Example 36: R2C proliferation assay for SF-1 antagonists
SF-1 regulates the formation and survival of progenitor cells in adult Leydig cells. The antiproliferative effect of SF-1 antagonists was investigated using the SF-1+ rat Leydig tumor cell line R2C. Cell proliferation is measured by detecting DNA incorporation of EdU, a nucleoside analog that can be fluorescently labeled after cell fixation.
Method
Assessment of rat Leydig tumor cell line R2C using 5-ethynyl-2' -deoxyuridine (EdU) CCL-97 TM ) EdU is a nucleoside analog incorporated during DNA synthesis and can be fluorescently labeled after cell immobilization. Cycloheximide is a protein synthesis inhibitorAs a positive control for the assay.
R2C cells were maintained according to the protocol provided by the American type culture Collection (American Type Culture Collection, ATCC). At the time of assay, R2C cells were diluted to 100 ten thousand cells/mL with medium (F12 medium supplemented with 2% fbs and 1% penicillin-streptomycin) and 50uL of cell suspension was inoculated into each well of 384-well transparent bottom plates. The assay plate was exposed to 6% CO at 37℃in moisture 2 Incubate in atmosphere for 24 hours. Serial dilutions of SF-1 antagonist, cycloheximide or vehicle (DMSO) were then applied to R2C cells and incubated at 37 ℃ with 6% CO 2 Incubate for two days in atmosphere. EdU (Invitrogen), at a final concentration of 5 μm, was added to the cells and incubated for an additional 16 hours, after which the cells were fixed with 10% formalin.
Cells were then washed and permeabilized in 0.5% Triton X-100/PBS for 1 hour at room temperature. EdU incorporation was detected by labeling EdU with 6-FAM azide (Lumiprobe) using a copper (I) -catalyzed Click reaction between azide and alkyne. The reaction mixture was prepared from 5mM ascorbic acid, 1mM CuSO in PBS buffer 4 1. Mu.M 6-FAM azide. Fluorescence signals were detected using an Envision 2104 multimode microplate reader. For data normalization, the mean fluorescence of DMSO wells was defined as 100% and the mean fluorescence of 10 μm cycloheximide wells was defined as 0%. Curve fitting and EC using variable slope sigmoidal dose response analysis 50 And (5) measuring.
Preparation of various media and reagents
Preparation of R2C Medium
The preparation method comprises the following steps: the medium was prepared by adding 92mL horse serum (Invitrogen), 15.5mL fetal bovine serum, and 6.1mL penicillin (10,000 units/mL) streptomycin (10 mg/mL) solution to 500mL Ham's F-12 medium (Invitrogen). The medium was stored in a refrigerator (set at 4 ℃) and used within one month after preparation.
Preparation of R2C plating Medium
The preparation method comprises the following steps: the medium was prepared by adding 10mL of fetal bovine serum and 5.1mL of penicillin (10,000 units/mL) streptomycin (10 mg/mL) solution to 500mL of Ham's F-12 medium. The medium was stored in a refrigerator (set at 4 ℃) and used within one month after preparation.
Preparation of R2C daughter board culture medium
The preparation method comprises the following steps: the medium was prepared by adding 50mL of fetal bovine serum and 5.5mL of penicillin (10,000 units/mL) streptomycin (10 mg/mL) solution to 500mL of Ham's F-12 medium. The medium was stored in a refrigerator (set at 4 ℃) and used within one month after preparation.
Preparation of cycloheximide (positive control) solution
The preparation method comprises the following steps: cycloheximide was dissolved in DMSO to give a concentration of 5mmol/L. The 5mmol/L solution was diluted 20-fold into the R2C daughter board medium to obtain daughter boards. The daughter board was then added to the assay board to obtain the final test conditions.
Preparation of test article solutions
The preparation method comprises the following steps: the test article was dissolved in DMSO to obtain a concentration of 10mmol/L. 10mmol/L was further diluted in DMSO to obtain a concentration of 256. Mu. Mol/L. 10mmol/L and/or 256. Mu. Mol/L solutions were serially diluted 2.5-fold into the vehicle to obtain 10 dilutions. These solutions were 20-fold diluted into R2C daughter board media to obtain serial dilutions of test article daughter boards. The daughter board was then added to the assay board to obtain the final test conditions.
Preparation of EdU plating solution
The preparation method comprises the following steps: edU was dissolved in DMSO to obtain a stock solution of EdU at a concentration of 30mmol/L. 30mmol/L of EdU stock solution was stored in a refrigerator (set at-20 ℃). In use, 25 μl of 30mM EdU stock solution was added to 25ml of R2C plating medium to obtain an EdU plating solution.
Preparation of 6-FAM azide solutions
The preparation method comprises the following steps: the 6-FAM azide was dissolved in DMSO to give a concentration of 30mmol/L. The 30mmol/L stock solution was further diluted to 1mmol/L to obtain a working solution.
25mL preparation of 2X sealing Mixed solution
The preparation method comprises the following steps: ascorbic acid was dissolved in PBS to obtain a concentration of 1mol/L. Copper (II) sulfate was dissolved in water to obtain a concentration of 0.2mol/L. 25mL of a 2x lock mixed solution was prepared by adding: 1.24.4mL of PBS,2.0.25mL of 1M ascorbic acid solution, 3.0.25mL of 0.2M CuSO 4 Solution, 4.0.05mL of 1mM 6-FAM azide DMSO solution. The 2x mounting mixture was used at the time of preparation.
Hoechst 33258 dyeing solution
The preparation method comprises the following steps: ascorbic acid was dissolved in PBS to obtain a concentration of 1mol/L. Copper (II) sulfate was dissolved in water to obtain a concentration of 0.2mol/L. 25mL of a 2x lock mixed solution was prepared by adding: 1.24.4mL of PBS,2.0.25mL of 1M ascorbic acid solution, 3.0.25mL of 0.2M CuSO 4 Solution, 4.0.05mL of 1MM 6-FAM azide DMSO solution. The 2x mounting mixture was used at the time of preparation.
Study procedure
Incubating R2C cells with test article
R2C cells are routinely cultured in R2C medium. To determine SF-1 antagonist inhibitory activity, R2C cells were resuspended in R2C plating medium and plated at 20,000 cells/50 μL/well into 384 well clear bottom blackboard. 384 plates were incubated at 37℃with 6% CO 2 Incubate for 24 hours to allow cells to attach to the assay plate. Serial dilutions of test article solutions, cycloheximide positive control solutions or vehicle solutions were then added to 384 plates and incubated at 37 ℃ with 6% CO 2 Incubate for two days. Then 10. Mu.L of EdU plating solution was dispensed to 6% CO at 37deg.C 2 Incubate in each well of the assay plate for two days.
Measurement of R2C cell proliferation
R2C proliferation was measured by detecting fluorescently labeled EdU. The R2C assay plates were fixed by dispensing 60 μl of 10% formalin into each well and the plates were incubated for 1 hour at room temperature on an orbital shaker. Plates were washed three times with 80. Mu.L of PBS and cells permeabilized by treatment with 100. Mu.L of PBS-0.5% Triton X-100 for 1 hour at room temperature on an orbital shaker. Plates were washed three times with 80 μl of PBS, and after the last wash, 25 μl of PBS was dispensed into each well. Then 25 μl of 2x mounting mix solution was added to each well of the fixed cells and the plate incubated at room temperature in the dark on an orbital shaker for 30min. Cells were washed 3 times with 80 μl of PBS, and after the last wash, 25 μl of PBS was dispensed into each well. mu.L of Hoechst 33258 staining solution was then added to each well of the fixed cells and the plates were incubated for 30min at room temperature on an orbital shaker in the dark. Cells were washed three times with 80 μl of PBS, and after the last wash, 50 μl of PBS was dispensed into each well. The assay plates were sealed with aluminum foil and fluorescence measured using an Envision microplate reader.
Calculation of proliferation Activity of R2C (percentage of control)
The percentage of proliferative activity to the control was calculated as follows:
the formula: percentage of control = 100× (a-C)/(B-C)
A: fluorescence count in R2C cells treated with test article
B: mean fluorescence count in vehicle treated R2C cells
C: average fluorescence count in 10. Mu.M cycloheximide treated R2C cells
50 EC calculation:half maximum Effective Concentration (EC) was calculated by embedded software from Collaborative Drug Discovery inc (CDD) 50 ). The potency of the compounds is shown in table 2:
TABLE 2
++++＝EC 50 <200nM；+++＝200nM≤EC 50 <1μM；
++＝1μM≤EC 50 ≤10μM；+＝10μM<EC 50 ≤20μM。

Claims (34)

1. A compound having the structure of formula (I):
wherein:
x is a bond or C 1 -C 6 An alkylene group;
R 1 selected from C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocyclylalkyl, -CH 2 C 6-10 Aryl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 4 Substitution;
R 2 selected from C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 3-8 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 5 Substitution;
R 3 is hydrogen, C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl or C 3-8 Cycloalkyl;
each R 4 And each R 5 Each independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 6 、-SR 6 、-C(O)OR 6 、-OC(O)N(R 6 )(R 7 )、-N(R 8 )C(O)N(R 6 )(R 7 )、-N(R 8 )C(O)R 9 、-N(R 8 )C(O)OR 9 、-N(R 8 )S(O) 2 R 9 、-C(O)R 9 、-OC(O)R 9 、-C(O)N(R 6 )(R 7 )、-C(O)C(O)N(R 6 )(R 7 )、-S(O)R 9 、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 ) Wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl, C 1-9 Heteroaryl, -OR 10 、-SR 10 、-C(O)OR 10 、-OC(O)N(R 10 )(R 11 )、-N(R 12 )C(O)N(R 10 )(R 11 )、-N(R 12 )C(O)R 13 、-N(R 12 )C(O)OR 13 、-N(R 12 )S(O) 2 R 13 、-C(O)R 13 、-OC(O)R 13 、-C(O)N(R 10 )(R 11 )、-C(O)C(O)N(R 10 )(R 11 )、-S(O)R 13 、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 )；
Each R 6 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, hydroxy, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 7 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 8 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 9 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 10 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group;
each R 12 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group; and is also provided with
Each R 13 Independently selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two or three groups selected from: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, C 2-9 Heterocycloalkyl, C 6-10 Aryl and C 1-9 Heteroaryl;
or a pharmaceutically acceptable salt or solvate thereof.
2. The compound of claim 1, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Selected from C 6-10 Aryl and C 1-9 Heteroaryl, wherein C 6-10 Aryl and C 1-9 Heteroaryl is optionally substituted with one, two, three, four or five R 4 And (3) substitution.
3. The compound of claim 1 or claim 2, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 4 And (3) substitution.
4. The compound of any one of claims 1-3, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Is phenyl, optionally substituted with one, two, three, four or five R 4 And (3) substitution.
5. The compound of any one of claims 1-4, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Is phenyl, optionally substituted with one, two or three R 4 And (3) substitution.
6. As claimed in claim 1 or claim 2 Or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Is C 1-9 Heteroaryl, optionally substituted with one, two, three, four or five R 4 And (3) substitution.
7. The compound of claim 6, or a pharmaceutically acceptable salt or solvate thereof, wherein R 1 Is pyridinyl, which is optionally substituted by one, two, three, four or five R 4 And (3) substitution.
8. The compound of any one of claims 1-7, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 4 Independently selected from halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 and-S (O) 2 N(R 6 )(R 7 )。
9. The compound of any one of claims 1-8, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 4 Independently selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl and-OR 6 。
10. The compound of any one of claims 1-9, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is C 3-8 Cycloalkyl optionally substituted with one, two, three, four or five R 5 And (3) substitution.
11. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is cyclohexyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution.
12. The compound of any one of claims 1-11, or a pharmaceutically acceptable thereofWherein R is a salt or solvate of 2 Is cyclohexyl, optionally substituted with one, two or three R 5 And (3) substitution.
13. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is C 6-10 Aryl, optionally substituted with one, two, three, four or five R 5 And (3) substitution.
14. The compound of claim 13, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is phenyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution.
15. The compound of claim 14, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is phenyl, optionally substituted with one, two or three R 5 And (3) substitution.
16. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is C 2-9 Heterocycloalkyl, optionally substituted with one, two, three, four or five R 5 And (3) substitution.
17. The compound of claim 16, or a pharmaceutically acceptable salt or solvate thereof, wherein R 2 Is tetrahydropyranyl, optionally substituted with one, two or three R 5 And (3) substitution.
18. The compound of any one of claims 1-17, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 5 Independently selected from halogen, -CN, C 1-6 Haloalkyl, -OR 6 、-C(O)OR 6 、-C(O)R 9 、-C(O)N(R 6 )(R 7 )、-S(O) 2 R 9 、-S(O) 2 N(R 6 )(R 7 ) And C 1-6 Alkyl, said C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from: -OR 10 、-C(O)OR 10 、-C(O)R 13 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 )。
19. The compound of any one of claims 1-18, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 5 Independently selected from halogen, C 1-6 Haloalkyl, -OR 6 And C 1-6 Alkyl, said C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 )、-S(O) 2 R 13 and-S (O) 2 N(R 10 )(R 11 )。
20. The compound of any one of claims 1-19, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 5 Independently selected from halogen, -OR 6 And C 1-6 Alkyl, said C 1-6 The alkyl group is optionally substituted with one selected from the group consisting of: -OR 10 、-C(O)OR 10 、-C(O)N(R 10 )(R 11 ) and-S (O) 2 R 13 。
21. The compound of any one of claims 1-20, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 6 Independently selected from hydrogen and C 1-6 Alkyl, said C 1-6 The alkyl group is optionally substituted with one, two or three groups selected from halogen and hydroxy.
22. The compound of any one of claims 1-21, or a pharmaceutically acceptable salt or solvate thereof, wherein each R 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 A haloalkyl group.
23. The compound of any one of claims 1-22, or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 Is C 1 -C 6 An alkyl group.
24. The compound of any one of claims 1-22, or a pharmaceutically acceptable salt or solvate thereof, wherein R 3 Is hydrogen.
25. The compound of any one of claims 1-24, or a pharmaceutically acceptable salt or solvate thereof, wherein X is a bond.
26. The compound of any one of claims 1-24, or a pharmaceutically acceptable salt or solvate thereof, wherein X is C 1 -C 6 An alkylene group.
27. The compound of claim 1, selected from the group consisting of:
or a pharmaceutically acceptable salt or solvate thereof.
28. A pharmaceutical composition comprising a pharmaceutically acceptable diluent, excipient or binder and a compound according to any one of claims 1-27; or a pharmaceutically acceptable salt or solvate thereof.
29. A method of treating cancer in a mammal comprising administering to the mammal a compound of any one of claims 1-27; or a pharmaceutically acceptable salt or solvate thereof.
30. The compound of claim 29, wherein the cancer is selected from the group consisting of adrenocortical cancer, ovarian cancer, head and neck cancer, endometrial cancer, hormone dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotroph adenoma, and coixoplasma tumor.
31. The compound of claim 29, wherein the cancer is adrenocortical cancer.
32. A method of treating an endocrine disorder in a mammal comprising administering to the mammal a compound of any one of claims 1-27; or a pharmaceutically acceptable salt or solvate thereof.
33. The method of claim 32, wherein the endocrine disorder is selected from the group consisting of endogenous cushing's syndrome, congenital adrenocortical hyperplasia, and polycystic ovary syndrome.
34. A method of treating endometriosis in a mammal comprising administering to the mammal a compound of any one of claims 1-27; or a pharmaceutically acceptable salt or solvate thereof.
CN202280037770.6A 2021-03-26 2022-03-25 Pyrazolopyrimidinone compounds Pending CN117396480A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202163166739P 2021-03-26 2021-03-26
US63/166,739 2021-03-26
PCT/US2022/021890 WO2022204481A1 (en) 2021-03-26 2022-03-25 Pyrazolopyrimidinone compounds

Publications (1)

Publication Number Publication Date
CN117396480A true CN117396480A (en) 2024-01-12

Family

ID=83397930

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280037770.6A Pending CN117396480A (en) 2021-03-26 2022-03-25 Pyrazolopyrimidinone compounds

Country Status (7)

Country Link
EP (1) EP4313988A1 (en)
JP (1) JP2024511518A (en)
CN (1) CN117396480A (en)
AU (1) AU2022243555A1 (en)
CA (1) CA3213381A1 (en)
IL (1) IL307230A (en)
WO (1) WO2022204481A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008133866A1 (en) * 2007-04-25 2008-11-06 Merck & Co., Inc. Polymorph of dihydropyrazolopyrimidinone derivative as weel kinase.inhibitor
CA3034705C (en) * 2016-08-31 2021-08-03 Agios Pharmaceuticals, Inc. Inhibitors of cellular metabolic processes
EP3694861A4 (en) * 2017-10-09 2021-05-19 Nuvation Bio Inc. Heterocyclic compounds and uses thereof
US11479555B2 (en) * 2018-02-23 2022-10-25 Newave Pharmaceutical Inc. Substituted 1,2-dihydro-3H-pyrazolo[3,4-D]pyrimidin-3-ones as inhibitors of WEE-1 kinase

Also Published As

Publication number Publication date
EP4313988A1 (en) 2024-02-07
JP2024511518A (en) 2024-03-13
IL307230A (en) 2023-11-01
WO2022204481A1 (en) 2022-09-29
AU2022243555A1 (en) 2023-10-12
CA3213381A1 (en) 2022-09-29

Similar Documents

Publication Publication Date Title
EP3728207B1 (en) Quinazolinones as parp14 inhibitors
CN110267962B (en) MAGL inhibitors
EP3675848B1 (en) Spirocycle compounds and methods of making and using same
CA2939081A1 (en) Cyclopropylamines as lsd1 inhibitors
JP2016537369A (en) Substituted 4,5,6,7-tetrahydropyrazolo [1,5-A] pyrazine derivatives as casein kinase 1D / E inhibitors
EP4134364A2 (en) Bromodomain inhibitors
MX2014013549A (en) TETRAHYDRONAPHTHYRIDINE AND RELATED BICYCLIC COMPOUNDS FOR INHIBITION OF RORgamma ACTIVITY AND THE TREATMENT OF DISEASE.
CZ299561B6 (en) Quinazolinamine derivative and pharmaceutical composition
EA017442B1 (en) 2-ARYL-6-PHENYLIMIDAZO[1,2-a]PYRIDINE DERIVATIVES, PREPARATION THEREOF AND THERAPEUTIC USE THEREOF
JP7440572B2 (en) Dual MAGL and FAAH inhibitor
KR20150130426A (en) Ship1 modulators and methods related thereto
KR20200010440A (en) Glucuronide Prodrug of Janus Kinase Inhibitor
CN114269734A (en) JAK inhibitors
US20230312557A1 (en) P2x3 modulators
TW479058B (en) 2,7-substituted octahydro-pyrrolo[1,2-a]pyrazine derivatives
CN112105355B (en) ABHD12 inhibitors and methods of making and using the same
CN117396480A (en) Pyrazolopyrimidinone compounds
US9127007B2 (en) FSH receptor antagonists
TW202122400A (en) Jak inhibitors
JP2020534312A (en) 2-substituted pyrazole amino-4-substituted amino-5-pyrimidineformamide compounds, compositions and their use
US10155259B2 (en) FSH receptor antagonists
CN115003300A (en) JAK inhibitors
NZ723817B2 (en) Cyclopropylamines as lsd1 inhibitors

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination