CN117388224A - Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence - Google Patents
Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence Download PDFInfo
- Publication number
- CN117388224A CN117388224A CN202311320342.7A CN202311320342A CN117388224A CN 117388224 A CN117388224 A CN 117388224A CN 202311320342 A CN202311320342 A CN 202311320342A CN 117388224 A CN117388224 A CN 117388224A
- Authority
- CN
- China
- Prior art keywords
- dna
- gdyo
- chip
- slide
- cleavage site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000018 DNA microarray Methods 0.000 title claims abstract description 39
- 238000000034 method Methods 0.000 title claims abstract description 27
- 108091028043 Nucleic acid sequence Proteins 0.000 title claims abstract description 26
- -1 mercury ions Chemical class 0.000 title claims abstract description 23
- 238000003776 cleavage reaction Methods 0.000 title claims abstract description 22
- 230000007017 scission Effects 0.000 title claims abstract description 22
- 229910052753 mercury Inorganic materials 0.000 title claims abstract description 21
- RYYWUUFWQRZTIU-UHFFFAOYSA-K thiophosphate Chemical compound [O-]P([O-])([O-])=S RYYWUUFWQRZTIU-UHFFFAOYSA-K 0.000 title claims abstract description 19
- 108020004414 DNA Proteins 0.000 claims abstract description 93
- 239000011521 glass Substances 0.000 claims abstract description 35
- 238000002360 preparation method Methods 0.000 claims abstract description 13
- 239000003298 DNA probe Substances 0.000 claims abstract description 11
- 108020003215 DNA Probes Proteins 0.000 claims abstract description 10
- 125000003277 amino group Chemical group 0.000 claims abstract description 10
- 238000002493 microarray Methods 0.000 claims abstract description 6
- 238000005576 amination reaction Methods 0.000 claims abstract description 5
- 125000000524 functional group Chemical group 0.000 claims abstract description 5
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 25
- 239000012498 ultrapure water Substances 0.000 claims description 25
- 238000005406 washing Methods 0.000 claims description 19
- 239000000243 solution Substances 0.000 claims description 13
- 238000009396 hybridization Methods 0.000 claims description 10
- 239000011259 mixed solution Substances 0.000 claims description 10
- 125000002924 primary amino group Chemical group [H]N([H])* 0.000 claims description 9
- 239000007788 liquid Substances 0.000 claims description 8
- 239000000523 sample Substances 0.000 claims description 7
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 6
- MHAJPDPJQMAIIY-UHFFFAOYSA-N Hydrogen peroxide Chemical compound OO MHAJPDPJQMAIIY-UHFFFAOYSA-N 0.000 claims description 6
- 239000000203 mixture Substances 0.000 claims description 6
- WYTZZXDRDKSJID-UHFFFAOYSA-N (3-aminopropyl)triethoxysilane Chemical compound CCO[Si](OCC)(OCC)CCCN WYTZZXDRDKSJID-UHFFFAOYSA-N 0.000 claims description 5
- 238000007605 air drying Methods 0.000 claims description 5
- 229910002804 graphite Inorganic materials 0.000 claims description 4
- 239000010439 graphite Substances 0.000 claims description 4
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 claims description 3
- 239000006185 dispersion Substances 0.000 claims description 3
- 230000033444 hydroxylation Effects 0.000 claims description 3
- 238000005805 hydroxylation reaction Methods 0.000 claims description 3
- 238000011534 incubation Methods 0.000 claims description 3
- 150000007523 nucleic acids Chemical group 0.000 claims description 3
- 229910052760 oxygen Inorganic materials 0.000 claims description 3
- 239000001301 oxygen Substances 0.000 claims description 3
- 239000000843 powder Substances 0.000 claims description 3
- 238000002791 soaking Methods 0.000 claims description 3
- QAOWNCQODCNURD-UHFFFAOYSA-N sulfuric acid Substances OS(O)(=O)=O QAOWNCQODCNURD-UHFFFAOYSA-N 0.000 claims description 3
- 239000006228 supernatant Substances 0.000 claims description 3
- 238000009210 therapy by ultrasound Methods 0.000 claims description 3
- 230000004913 activation Effects 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 36
- 230000035945 sensitivity Effects 0.000 abstract description 6
- 238000001179 sorption measurement Methods 0.000 abstract description 3
- 238000010828 elution Methods 0.000 abstract description 2
- 230000008859 change Effects 0.000 description 8
- 125000002485 formyl group Chemical class [H]C(*)=O 0.000 description 8
- 229910001385 heavy metal Inorganic materials 0.000 description 7
- 229910021645 metal ion Inorganic materials 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 238000010206 sensitivity analysis Methods 0.000 description 6
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 6
- 230000008901 benefit Effects 0.000 description 4
- 150000002500 ions Chemical class 0.000 description 4
- 239000008399 tap water Substances 0.000 description 4
- 235000020679 tap water Nutrition 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 239000002086 nanomaterial Substances 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 125000003172 aldehyde group Chemical group 0.000 description 2
- 238000007385 chemical modification Methods 0.000 description 2
- 230000003247 decreasing effect Effects 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 238000012544 monitoring process Methods 0.000 description 2
- 238000011084 recovery Methods 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 1
- 102000016911 Deoxyribonucleases Human genes 0.000 description 1
- 108010053770 Deoxyribonucleases Proteins 0.000 description 1
- 108091034117 Oligonucleotide Proteins 0.000 description 1
- 239000007864 aqueous solution Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000011109 contamination Methods 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 230000014509 gene expression Effects 0.000 description 1
- 230000003100 immobilizing effect Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- QSHDDOUJBYECFT-UHFFFAOYSA-N mercury Chemical compound [Hg] QSHDDOUJBYECFT-UHFFFAOYSA-N 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 238000006053 organic reaction Methods 0.000 description 1
- 239000011148 porous material Substances 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000000171 quenching effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Optics & Photonics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence, which comprises the following steps: s1: chemically modifying the surface of the slide, including aminating the slide; s2: immobilization of modified Cy5 fluorophores at different concentrations and Single phosphorothioated RNAHg on modified slides 2+ A DNA probe for cleaving PS site to prepare a DNA chip, comprising: introducing activated GDYO into the modified amination slide to fix a DNA probe with amino groups so as to prepare a DNA I-GDYO chip; NH was introduced on the basis of the DNA I-GDYO chip 2 ‑PEG‑N 3 Layer preparation to give a surface with N 3 Functional group DNA II-GDYO chip; s3: hg detection by microarray scanner 2+ Is a concentration of (3). Hg detection with existing DNA chip 2+ Compared with the prior art, the sensitivity is obviously improved, the nonspecific adsorption of DNA and the surface of the glass slide can be reduced after elution, and the combination of the mould and the surface of the glass slide can be increased by introducing GDYOForce, thereby reducing detection errors.
Description
Technical Field
The invention relates to the field of heavy metal detection by using a DNA sequence, in particular to a method for detecting mercury ions by fixing a single phosphorothioate cleavage site DNA sequence based on a biochip.
Background
DNA microarrays, also known as DNA chips, are an advanced biosensor technology. The technology realizes high-sensitivity and high-flux detection of substances to be detected by orderly and high-density immobilization of oligonucleotide fragments with fluorescent markers on the surface of a carrier. Because of its portability, low cost, high efficiency and high sensitivity, DNA chips have been widely used for gene expression and diagnosis, and detection of proteins. In particular in the field of detection of heavy metal contamination, DNA chip based sensors have shown great potential.
In the previous studies, there have been DNA nanostructure microarrays with tubular three-dimensional structures for rapid sensitive and selective monitoring of various heavy metal ions, and a DNase-based microarray chip for multiplex monitoring of heavy metal ions in aqueous solutions, particularly Cu, has been developed 2+ And Pb 2+ 。
Graphite alkyne oxide (GDYO) is a novel two-dimensional carbon-based nanomaterial that has been widely used in the preparation of DNA sensors because of its high pi-conjugated structure and high hole mobility. GDYO has a strong quenching effect on FAM fluorescence on DNA, so that the sensor based on GDYO has higher sensitivity. Despite the great potential of DNA chip-based sensors for heavy metal ion detection, current technology has some limitations. For example, there is no uniform practice for the method of immobilizing DNA probes. In addition, there is still a need for research on how to most effectively utilize a novel material such as GDYO to improve detection sensitivity.
Disclosure of Invention
In order to solve the defect of heavy metal ion detection by using a DNA chip, the invention provides a method for detecting mercury ions by fixing a single phosphorothioate cleavage site DNA sequence based on a biochip, which comprises the following specific scheme:
a method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence, comprising the steps of:
s1: chemically modifying the surface of the slide, including aminating the slide;
S2：immobilization of modified Cy5 fluorophores at different concentrations and Single phosphorothioated RNAHg on modified slides 2+ A DNA probe for cleaving PS site to prepare a DNA chip, comprising: introduction of activated GDYO into modified aminated slide to immobilize amino-bearing DNA Probe to prepare DNA
I-GDYO chip; NH was introduced on the basis of the DNA I-GDYO chip 2 -PEG-N 3 Layer preparation to give a surface with N 3 Functional group DNA II-GDYO chip;
s3: dropping a sample into the DNA chip obtained in the step S2, and detecting Hg by a microarray scanner 2+ Is a concentration of (3).
Further, the nucleic acid sequence modifying Cy5 fluorescence and PS site is GTCACGAGTCACTAT AGGAAGATGGCGAA/rA/. Times.G-Cy 5, the auxiliary sequence A is ACTCGTGACTTTTTTTTT-NH 2 The auxiliary sequence B is ACTCGTGACTTTTTTTTT-DBCO, the DNA sequences of the PS cleavage site and the Cy5 fluorescent group modified by the same concentration are respectively mixed with the auxiliary sequence and the auxiliary sequence in an equal volume, and react for 12 hours at 4 ℃ to obtain the hybridization DNA I and the hybridization DNA II.
Further, the preparation step of the amination slide in the step S1 comprises the following steps: adding the glass slide into a mixed solution with the volume ratio of concentrated sulfuric acid to hydrogen peroxide of 7:3, and soaking for at least 2 hours; washing with ultrapure water for 3 times for 10min each time, and airing to obtain a hydroxylation glass slide; immersing the dried glass slide in mixed solution containing 95% ethanol and APTES with the concentration of 2% -3% for 30min; washing with ultrapure water for 3 times each for 10min, and air-drying to obtain an aminated glass slide.
Further, the preparation steps of the DNA I-GDYO chip in S2 comprise: adding activated GDYO with the final concentration of 2-8 mug/mL on an amino slide, reacting for 12 hours at normal temperature, sucking the liquid which is not completely reacted by a liquid transferring gun, washing by ultrapure water, airing, adding 35-60 nM hybridized DNA I with modified amino groups, and reacting for 12 hours at 4 ℃ in a dark place, thereby fixing the DNA on the surface of the slide to obtain the DNA I-GDYO chip.
Further, the preparation method of the DNA II-GDYO chip in S2 comprises the following steps: adding 100 mu L of GDYO with the final concentration of 5-15 mu g/mL into an amino glass slide, reacting for 12 hours at normal temperature, washing with ultrapure water, and airing for later use; final concentration100 μg/mL NH 2 -PEG-N 3 And 45-55 nM of the hybridized DNA II is added into PBS solution for 12h of incubation, the mixed solution is added onto a GDYO slide, and the hybridized DNA II is immobilized on the surface of the slide through covalent bonding to obtain the DNA II-GDYO chip.
Further, the preparation method of the activated GDYO comprises the following steps: 5mg of graphite alkyne oxide oxygen powder is weighed and dissolved in 2.5mL of ultrapure water, and after uniform dispersion is carried out by ultrasonic treatment, 2.5mL of GDYO solution with the concentration of 2mg/mL is obtained; to 1.25mL of a mixture containing 50mM NHS and 500mM EDC, 2.5mL of a GDYO solution and 1.25mL of ultrapure water were added and reacted overnight, and the mixture was centrifuged at 12000rpm for 30 minutes, the supernatant was removed, the unreacted complete EDC and NHS were removed, and 2.5mL of ultrapure water was added and mixed to obtain 2mg/mL of an activated GDYO solution.
Further, the final concentration of GDYO after activation was 4. Mu.g/mL.
Further, the modified amino group concentration was 50nM.
Further, the final concentration of GDYO was 10. Mu.g/mL,
further, the concentration of DNA II was 50nM.
The beneficial effects are that:
(1) The invention provides a method for detecting mercury ions based on a biochip fixed single phosphorothioate cleavage site DNA sequence, which comprises the steps of firstly selecting a glass slide as a carrier in a gene chip, carrying out amination modification on the glass slide, and fixing modified Cy5 fluorescent groups with different concentrations and single phosphorothioate RNAHg on the modified glass slide 2+ A DNA probe for cleaving PS site to prepare a DNA chip, comprising: introducing activated GDYO into the modified amination slide to fix a DNA probe with amino groups so as to prepare a DNA I-GDYO chip; NH was introduced on the basis of the DNA I-GDYO chip 2 -PEG-N 3 Layer preparation to give a surface with N 3 Compared with the DNA II-GDYO chip with functional groups, which is easy to have the condition of unsound combination of a model and a glass slide and easy to leak liquid and false positive signals in the operation process, the DNA I-GDYO chip and the DNA II-GDYO chip both introduce nano material GDYO, and the GDYO has better large surfaceThe product structure has the advantages that the surface of the activated GDYO is provided with a plurality of active sites for fixing the DNA probe, nonspecific adsorption of DNA and the surface of a glass slide can be reduced after multiple elution, the sensitivity is high, and the bonding force between a die and the surface of the glass slide can be increased by introducing the GDYO, so that experimental errors are reduced; NH in DNA II-GDYO chip 2 -PEG-N 3 The novel organic reaction has the characteristics of high selectivity, mild reaction conditions and the like, and can further solve the problem of nonspecific adsorption of DNA and the surface of the glass slide, so that the detection sensitivity is further improved.
Drawings
FIG. 1 is a DNA chip-based Hg detection 2+ Technical roadmap.
FIG. 2 is a block diagram of APTES and GA modified slides.
FIG. 3 is a detection of Hg based on aldehyde-based chip 2+ Sensitivity analysis results (a).
FIG. 4 detection of Hg based on aldehyde-based chip 2+ Sensitivity analysis results plot (b).
FIG. 5 is a graph showing the results of the concentration optimization of GDYO in a DNA I-GDYO chip.
FIG. 6 is a graph showing the correspondence of the fluorescence intensity based on the concentration of DNA in the DNA I-GDYO chip.
FIG. 7 is a DNA-based I-GDYO chip versus Hg 2+ And (c) a detection sensitivity analysis result graph (a).
FIG. 8 is a DNA-based I-GDYO chip versus Hg 2+ And (b) a detection sensitivity analysis result graph.
FIG. 9 is a graph showing the result of detection of DNA I-GDYO chip selectivity.
FIG. 10 is a graph showing the results of optimizing the concentration of GDYO in a DNA II-GDYO chip.
FIG. 11 is a graph showing changes in the concentration of DNA in a DNA II-GDYO chip versus the fluorescence intensity.
FIG. 12 is a DNA-based II-GDYO chip versus Hg 2+ And (c) a sensitivity analysis result graph (a) of detection.
FIG. 13 is a DNA-based II-GDYO chip versus Hg 2+ And (b) a sensitivity analysis result graph of detection.
FIG. 14 is a graph showing the results of fluorescence intensity detection of different metal ions based on a DNA II-GDYO chip.
Detailed Description
The present invention will be further described in detail with reference to examples, which are provided for the purpose of illustration only and are not intended to limit the scope of the present invention.
Examples:
FIG. 1 is a DNA chip-based Hg detection 2+ A technical scheme, as shown in fig. 1, is a method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence, comprising the steps of:
s1: chemical modification of the slide surface, including aminated slides and aldehyde slides;
the glass slide is widely used as a carrier in a gene chip due to the advantages of low cost, smooth surface, low background fluorescent signal and the like. Through chemical modification, the DNA sequence of specific groups can be fixed on the surface of a glass slide and further used for heavy metal Hg 2 Detection of +s.
FIG. 2 is a schematic view of APTES and GA modified slides, and the steps for preparing an aminated slide and an aldehyde slide include: adding the glass slide into a mixed solution with the volume ratio of concentrated sulfuric acid to hydrogen peroxide of 7:3, and soaking for at least 2 hours; washing with ultrapure water for 3 times for 10min each time, and airing to obtain a hydroxylation glass slide; immersing the dried glass slide in mixed solution containing 95% ethanol and APTES with the concentration of 2% -3% for 30min; washing with ultrapure water for 3 times for 10min each time, and airing to obtain an aminated glass slide; the aminated glass slide is soaked in 5% GA for 2 hours, washed by ultrapure water for three times for 5 minutes each time, and then dried to obtain the aldehyde group modified glass slide.
S2: immobilization of modified Cy5 fluorophores at different concentrations and Single phosphorothioated RNAHg on modified slides 2+ A DNA probe for cleaving PS site to prepare a DNA chip, comprising: preparing an aldehyde biochip by covalently binding a DNA probe of an amino group on the modified aldehyde slide through Schiff reaction; introduction of activated GDYO into modified aminated slideTo prepare a DNA I-GDYO chip; NH was introduced on the basis of the DNA I-GDYO chip 2 -PEG-N 3 Layer preparation to give a surface with N 3 Functional group DNA II-GDYO chip;
wherein the nucleic acid sequence for modifying Cy5 fluorescence and PS site is GTCACGAGTCACTATAGGA AGATGGCGAA/rA/. Times.G-Cy 5, and the auxiliary sequence A is ACTCGTGACTTTTTTTTT-NH 2 The auxiliary sequence B is ACTCGTGACTTTTTTTTT-DBCO, the DNA sequences of the PS cleavage site and the Cy5 fluorescent group modified by the same concentration are respectively mixed with the auxiliary sequence and the auxiliary sequence in an equal volume, and react for 12 hours at 4 ℃ to obtain the hybridization DNA I and the hybridization DNA II.
The preparation method of the activated GDYO comprises the following steps: 5mg of graphite alkyne oxide oxygen powder is weighed and dissolved in 2.5mL of ultrapure water, and after uniform dispersion is carried out by ultrasonic treatment, 2.5mL of GDYO solution with the concentration of 2mg/mL is obtained; to 1.25mL of a mixture containing 50mM NHS and 500mM EDC, 2.5mL of a GDYO solution and 1.25mL of ultrapure water were added and reacted overnight, and the mixture was centrifuged at 12000rpm for 30 minutes, the supernatant was removed, the unreacted complete EDC and NHS were removed, and 2.5mL of ultrapure water was added and mixed to obtain 2mg/mL of an activated GDYO solution.
S3: the sample was dropped into the DNA chip obtained in S2, and detection was performed by a microarray scanner.
Hg was performed for each of the three DNA chips as follows 2+ And (3) detection:
1. aldehyde-based biochip
(1) Hg based on aldehyde-based biochips 2+ Detection of
Adding 50nM hybridized DNA I of modified amino group and Cy5 fluorescent group to aldehyde chip, reacting overnight at 4deg.C in dark, sucking out unreacted liquid by pipetting gun, washing with PBS, air drying, and measuring fluorescence intensity as F 0 The method comprises the steps of carrying out a first treatment on the surface of the Adding Hg in gradient concentration 2+ Reacting at room temperature for 30min in dark, removing reaction liquid with a pipetting gun, washing with ultrapure water, air drying, and detecting with a scanner to obtain chip with fluorescence intensity of F, wherein 1-F/F 0 The change in fluorescence intensity is shown. ( Scanner set Power:100, pmt:650, resolution: 10 mu M )
Adding different substancesHg concentration of 2+ (0, 10, 50, 100, 500, 1000 and 2000 nM), and the fluorescence intensity was measured after reaction at room temperature for 30min in the absence of light.
The results are shown in FIGS. 3 and 4. Along with Hg 2+ The higher the concentration, the greater the cleavage strength of DNA, and the fluorescence of the hybridized DNA immobilized on the slide glass gradually decreases to a gentle level, when Hg 2+ At a concentration of 1-100nM, the fluorescence intensity of the sensor system is equal to Hg 2+ The concentrations show obvious linear relation, and the linear equation is y= -15.9276x+4383.82946, R 2 =0.987, limit of detection is 0.724nM. However, in the experimental operation process, the situation that the model is not tightly combined with the glass slide easily occurs, so that the problems of liquid leakage, false positive signals and the like easily occur in the operation process.
2. DNA-based I-GDYO chip
(1) Optimizing GDYO concentration and DNA concentration
Adding 100 mu L of GDYO with different concentrations (1, 2, 4, 6, 8 and 10 mu g/mL) to the prepared amino slide, reacting for 12 hours at normal temperature, adding 50nM of DNA I, reacting for 12 hours at 4 ℃ in the absence of light, washing with PBS, airing, adding Hg with the same concentration 2+ (50 nM), change in fluorescence intensity measured by scanner (1-F/F) 0 ) The optimum concentration of GDYO was selected. As is clear from FIG. 5, the fluorescence change rate was optimal when the GDYO concentration was 4. Mu.g/mL, and therefore, GDYO was selected to be 4. Mu.g/mL.
And secondly, optimizing the DNA concentration. When the GDYO concentration was 4. Mu.g/mL. DNA I (0, 10, 20, 30, 50 and 80 nM) was added at various concentrations. As shown in FIG. 6, when the DNA was 50nM, the fluorescence intensity reached the highest, and as the DNA concentration was increased, the fluorescence intensity did not change much, so that the optimum concentration of DNA was selected to be 50nM.
(2) Hg based on DNA I-GDYO chip 2+ Detection of
Adding activated GDYO with a final concentration of 4 mug/mL on an amino slide, reacting for 12 hours at normal temperature, sucking the liquid which is not completely reacted by a pipette, washing with ultrapure water, airing, adding 50nM hybridized DNA I with modified amino groups, reacting for 12 hours at 4 ℃ in a dark place, fixing the DNA on the surface of the slide, washing with PBS, airing, and sweepingThe fluorescence intensity of the fluorescent probe is F 0 The method comprises the steps of carrying out a first treatment on the surface of the Adding Hg in gradient concentration 2+ The reaction is carried out for 30min at normal temperature under the dark condition, after the washing and the airing of ultrapure water, the detection is carried out by a scanner, the fluorescence intensity of the chip is F, and the fluorescence intensity is 1-F/F 0 And indicates addition of Hg 2+ Post fluorescence change. (scanner Power set to 100, PMT set to 650, resolution 10 μm) different concentrations of Hg were added 2+ (0-1. Mu.M), and its fluorescence intensity was measured by a scanner. The results are shown in FIGS. 7 and 8, and are shown as Hg 2+ The concentration increases, the fluorescence intensity measured by the chip forms a decreasing trend and gradually flattens, when Hg is added 2+ At a concentration of 0-20nM, the fluorescence intensity and Hg 2+ The concentration is obviously linear, the linear equation is y= -66.37571x+2733.72, R 2 =0.992, limit of detection 0.589nM.
(3) Selective detection
To ensure the stability of the DNA I-GDYO chip, the DNA I-GDYO chip is subjected to a test method comprising Hg 2+ The selectivity analysis was performed for the different metal ions included, and under optimal conditions, the same concentration (50 nM) of the different metal ions was added. The results are shown in FIG. 9, in which Hg is present in the sensor as compared to other metal ions 2+ The corresponding fluorescence intensity changes greatly, which proves that the biochip is opposite to Hg 2+ Has good selectivity to Hg according to statistical analysis 2+ Is remarkable.
3. DNA II-GDYO-based chip
(1) Optimizing GDYO concentration and DNA II concentration
Adding 100 mu L of GDYO solutions with different concentrations (5, 10, 15, 20 and 30 mu g/mL) to the prepared amino glass slide, and reacting for 12 hours at normal temperature; then NH with different concentrations 2 -PEG-N 3 And final concentration of 50nM of the hybridized DNA II was incubated at 4℃for 12h, maintaining GDYO and NH 2 -PEG-N 3 The concentration ratio of (2) is 1:10; adding the mixed solution to a GDYO glass slide for reaction for 12 hours, washing with ultrapure water, airing, and adding Hg with the same concentration 2+ Changes in fluorescence intensity measured by a scanner (1-F/F 0 ) The optimum concentration of GDYO was selected. As is clear from FIG. 10, the fluorescence change rate was optimal when the GDYO concentration was 10. Mu.g/mL, so we chose to use10. Mu.g/mL was used as the optimal concentration of GDYO.
The DNA concentration was optimized in the same manner under the conditions described above, namely 10. Mu.g/mL GD YO and 100. Mu.g/mL NH 2 -PEG-N 3 100. Mu.L of the hybridization DNA II with final concentrations of 10, 20, 30, 50, 80 and 100nM was added, reacted at 4℃for 12 hours in the absence of light, washed with pure water and dried, and then examined and observed by a scanner. As a result, as shown in FIG. 11, the fluorescence intensity was increased continuously as the concentration of DNA II was increased, the fluorescence intensity was changed more greatly when the concentration of DNA II was 50nM, and the fluorescence intensity was changed less as the concentration of DNA was increased, so that the concentration of DNA was selected to be 50nM in the subsequent experiments following the principle of saving the experimental reagent.
(2) Hg based on DNA II-GDYO chip 2+ Detection of
Adding 100 mu L of GDYO with the final concentration of 10 mu g/mL to an amino glass slide, reacting for 12 hours at normal temperature, washing with ultrapure water, and airing for later use; final concentration of 100. Mu.g/mL NH 2 -PEG-N 3 And 50nM of the hybridized DNA II are added into PBS solution for 12h of incubation, the mixed solution is added onto GDYO glass slide, the hybridized DNA II is fixed on the surface of the glass slide through covalent bonding, the hybridization DNA II reacts for 12h at 4 ℃ in a dark place, and then the hybridization DNA II is washed and dried, and the fluorescence intensity is F at the moment 0 The method comprises the steps of carrying out a first treatment on the surface of the Adding Hg in gradient concentration 2+ Light-shielding reaction at normal temperature for 30min, washing with pure water, air drying, and detecting with scanner to obtain chip fluorescence intensity F, wherein 1-F/F 0 Indicating the change in fluorescence. Different concentrations of Hg were added 2+ (0-2. Mu.M) and detected using a scanner. The results are shown in FIGS. 12 and 13, which show the Hg-dependent results 2+ The concentration increases, the fluorescence intensity measured by the chip shows a decreasing trend and gradually becomes gentle, when Hg is added 2+ Hg at a concentration of 0-20nM 2+ The concentration and the fluorescence intensity are obviously linear, and the linear equation is y= -73.10248x+3309.6477, R 2 =0.985, limit of detection is 0.406nM.
(3) Selective analysis
Ensure the stability of the chip, for the chip including Hg 2+ The metal ions contained therein were subjected to a selective analysis: using 10. Mu.g/mL of activated GDYO, 100. Mu.g/mL of NH 2 -PEG-N 3 After 50nM hybridization DN AII was immobilized100nM of different metal ions were added and their fluorescence intensity was checked. As a result, as shown in FIG. 14, hg was found to be more effective than other metal ions 2+ The corresponding fluorescence intensity change is larger, which indicates that the chip has the function of Hg 2+ Has good selectivity to Hg according to statistical analysis 2+ Is remarkable.
(4) Actual sample detection
In order to further examine the practical application value of the sensor, 5nM Hg and 20nM Hg are taken by a standard sample addition method 2+ Experiments were performed in a DNA II-GDYO chip system, with the buffer solution of the sensor being replaced with daily tap water and Yangtze river water. All water samples were filtered through a 0.2 μm pore size filter, boiled in tap water and allowed to stand for 30min for detection. The results are shown in the following table:
table 1: detection of Hg by DNA II-GDYO chip in tap water 2+ Results of (3)
TABLE 1
Table 2: detection of Hg by DNA II-GDYO chip in Yangtze river water 2+ Results of (3)
TABLE 2
From the above table, the recovery rate in tap water ranges from 100.12% to 106.65% and the relative standard deviation ranges from 3.09% to 4.31%; the recovery rate in the Yangtze river water ranges from 96.53 percent to 108.60 percent, the relative standard deviation is 2.98 percent to 4.05 percent, and the practical application requirements are met. Compared with the defect that GB5009.17-2021 requires expensive large-scale instruments, complex sample treatment and long single sample collection time for detecting total mercury, the DNA chip has the advantages of portability, low cost and high benefit for detecting mercury ions, and can detect a plurality of samples simultaneously.
The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and principles of the invention are intended to be included within the scope of the invention.
Claims (10)
1. A method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence, comprising the steps of:
s1: chemically modifying the surface of the slide, including aminating the slide;
s2: fixing modified Cy5 fluorophores with different concentrations and single thiophosphorylated RNA Hg on modified glass slides 2+ A DNA probe for cleaving PS site to prepare a DNA chip, comprising: introducing activated GDYO into the modified amination slide to fix a DNA probe with amino groups so as to prepare a DNA I-GDYO chip; NH was introduced on the basis of the DNA I-GDYO chip 2 -PEG-N 3 Layer preparation to give a surface with N 3 Functional group DNA II-GDYO chip;
s3: dropping a sample into the DNA chip obtained in the step S2, and detecting Hg by a microarray scanner 2+ Is a concentration of (3).
2. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 1, wherein the nucleic acid sequence modifying Cy5 fluorescence and PS sites is GTCACGAGTCACTATAGGAAGATGGCGAA/rA/. Times.G-Cy 5 and the auxiliary sequence A is ACTCGTGACTTTTTTTTT-NH 2 The auxiliary sequence B is ACTCGTGACTTTTTTTTT-DBCO, the DNA sequences of the PS cleavage site and the Cy5 fluorescent group modified by the same concentration are respectively mixed with the auxiliary sequence and the auxiliary sequence in an equal volume, and react for 12 hours at 4 ℃ to obtain the hybridization DNA I and the hybridization DNA II.
3. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 1, wherein the step of preparing an aminated slide in S1 comprises: adding the glass slide into a mixed solution with the volume ratio of concentrated sulfuric acid to hydrogen peroxide of 7:3, and soaking for at least 2 hours; washing with ultrapure water for 3 times for 10min each time, and airing to obtain a hydroxylation glass slide; immersing the dried glass slide in mixed solution containing 95% ethanol and APTES with the concentration of 2% -3% for 30min; washing with ultrapure water for 3 times each for 10min, and air-drying to obtain an aminated glass slide.
4. The method for detecting mercury ions based on a biochip-immobilized single phosphorothioate cleavage site DNA sequence according to claim 1, wherein the preparation step of the DNA I-GDYO chip in S2 comprises: adding activated GDYO with the final concentration of 2-8 mug/mL on an amino slide, reacting for 12 hours at normal temperature, sucking the liquid which is not completely reacted by a liquid transferring gun, washing by ultrapure water, airing, adding 35-60 nM hybridized DNA I with modified amino groups, and reacting for 12 hours at 4 ℃ in a dark place, thereby fixing the DNA on the surface of the slide to obtain the DNA I-GDYO chip.
5. The method for detecting mercury ions based on a biochip-immobilized single phosphorothioate cleavage site DNA sequence according to claim 1, wherein the preparation step of the DNA II-GDYO chip in S2 comprises: adding 100 mu L of GDYO with the final concentration of 5-15 mu g/mL into an amino glass slide, reacting for 12 hours at normal temperature, washing with ultrapure water, and airing for later use; final concentration of 100. Mu.g/mL NH 2 -PEG-N 3 And 45-55 nM of the hybridized DNA II is added into PBS solution for 12h of incubation, the mixed solution is added onto a GDY O slide, and the hybridized DNA II is immobilized on the surface of the slide through covalent bonding to obtain the DNA II-GDYO chip.
6. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 1, wherein the method for preparing activated GDYO comprises the steps of: 5mg of graphite alkyne oxide oxygen powder is weighed and dissolved in 2.5mL of ultrapure water, and after uniform dispersion is carried out by ultrasonic treatment, 2.5mL of GDYO solution with the concentration of 2mg/mL is obtained; to 1.25mL of a mixture containing 50mM NHS and 500mM EDC, 2.5mL of a GDYO solution and 1.25mL of ultrapure water were added and reacted overnight, and the mixture was centrifuged at 12000rpm for 30 minutes, the supernatant was removed, the unreacted complete EDC and NHS were removed, and 2.5mL of ultrapure water was added and mixed to obtain 2mg/mL of an activated GDYO solution.
7. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 4, wherein the final concentration of GDYO after activation is 4. Mu.g/mL.
8. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 4, wherein the modified amino group concentration is 50nM.
9. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 5, wherein the final concentration of GDYO is 10. Mu.g/mL.
10. The method for detecting mercury ions based on a biochip immobilized single phosphorothioate cleavage site DNA sequence according to claim 5, wherein the concentration of DNA II is 50nM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311320342.7A CN117388224A (en) | 2023-10-12 | 2023-10-12 | Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311320342.7A CN117388224A (en) | 2023-10-12 | 2023-10-12 | Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117388224A true CN117388224A (en) | 2024-01-12 |
Family
ID=89438339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311320342.7A Pending CN117388224A (en) | 2023-10-12 | 2023-10-12 | Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117388224A (en) |
-
2023
- 2023-10-12 CN CN202311320342.7A patent/CN117388224A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10745743B2 (en) | Methods of using inductively coupled plasma mass spectroscopy systems for analyzing a cellular sample | |
| RU2666989C2 (en) | Multiplex analyses based on aptamers | |
| CN112893864B (en) | Silver nanocluster prepared based on hairpin template and application of silver nanocluster in chloramphenicol detection | |
| CN102031284A (en) | Lead ion detection chip based on deoxyribonuclease as well as making and application methods | |
| CN111579614A (en) | Method for detecting lead ions by using DNA enzyme based on magnetic biological composite material and electrochemical biosensor for hybridization chain reaction | |
| CN110860320A (en) | Micro-fluidic chip for simultaneously detecting multiple antibiotic residues in drinking water and application thereof | |
| CN117388224A (en) | Method for detecting mercury ions based on biochip immobilized single phosphorothioate cleavage site DNA sequence | |
| WO2013022203A2 (en) | Method for detecting nucleic acid using intercalator-conjugated metal nanoparticles | |
| CN116004769A (en) | Kit for detecting miRNA Let-7a based on auxiliary action of magnetic beads and graphene oxide and application of kit | |
| CN113584129B (en) | P53 gene detection probe, obtained biosensor and application thereof | |
| CN113960136B (en) | Preparation method and application of fumonisin B1 electrochemical sensor with adjustable dynamic range | |
| CN112143781A (en) | Nucleic acid detection method based on moving reaction interface for nucleic acid amplification-chip electrophoresis titration sensing | |
| KR101731400B1 (en) | Non-Amplification Method for DNA Detection Using Gold Nanoparticle and Magnetic Bead Particle | |
| KR20180061070A (en) | Method for quantitatively profiling nucleic acids | |
| CN107727618B (en) | Biochip and method for detecting mercury ions by using DNA sequence of specific cleavage site | |
| KR101233774B1 (en) | Probes targeting the ribosomal RNA for detecting pathogenic bacteria and method for detecting live pathogenic bacteria by using the same | |
| CA3237161A1 (en) | Magnetic microgel beads, methods of making and uses thereof | |
| Xing et al. | A highly selective and sensitive electrochemical sensor for tetracycline resistant genes detection based on the non-covalent interaction of graphene oxide and nucleobase | |
| WO2020264210A1 (en) | Methods and devices for identifying pathogens and antibodies and treatment device therefore | |
| Barde et al. | Gene expression and its application in biotechnology | |
| CN118256633A (en) | High-performance gene chip and kit for detecting high-specificity 16s rDNA of human intestinal microorganisms and application | |
| CN115046910A (en) | Construction and application of electrochemical system for controlling release based on aptamer 'on-off' conformational change | |
| US20110003308A1 (en) | Nanoparticle-mediated signal amplification | |
| CN117451809A (en) | Preparation method and application of multifunctional integrated fumonisin B1 ratio electrochemical biosensor | |
| CN117214258A (en) | Electrochemical biosensor for detecting staphylococcus aureus in complex matrix and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |