CN117384960B

CN117384960B - TL1A gene humanized non-human animal and construction method and application thereof

Info

Publication number: CN117384960B
Application number: CN202311667117.0A
Authority: CN
Inventors: 李冲; 张芝; 张淑金
Original assignee: Baccetus Beijing Pharmaceutical Technology Co ltd
Current assignee: Baccetus Beijing Pharmaceutical Technology Co ltd
Priority date: 2023-12-07
Filing date: 2023-12-07
Publication date: 2024-03-12
Anticipated expiration: 2043-12-07
Also published as: CN117384960A

Abstract

The invention belongs to the fields of animal genetic engineering, genetic modification and biological medicine, and in particular relates to a TL1A gene humanized non-human animal, a construction method thereof and application thereof in the field of biological medicine. The construction method utilizes a homologous recombination mode to introduce all or part of nucleotide sequences for encoding the human TL1A protein into a genome of a non-human animal, and the obtained non-human animal can normally express the human or humanized TL1A protein, can be used as an animal model for researching a human TL1A signal mechanism and screening tumor or inflammatory medicaments, and has important application value for developing new medicaments of immune targets.

Description

TL1A gene humanized non-human animal and construction method and application thereof

Technical Field

The invention belongs to the fields of animal genetic engineering, genetic modification and biological medicine, and in particular relates to a TL1A gene humanized non-human animal, a construction method thereof and application thereof in the field of biological medicine.

Background

TL1A, also known as TNFSF15, is a member of the Tumor Necrosis Factor (TNF) ligand superfamily, also known as vascular growth inhibitor (VEGI), and is a cytokine secreted primarily by vascular endothelial cells. TNFSF15 is capable of up-regulating the expression of free form VEGFR1 while promoting the degradation of VEGF's membrane receptor VEGFR1, and therefore, is capable of converting the VEGF/VEGFR1 induced pro-angiogenic signals into anti-angiogenic signals. TNFSF15 is capable of inhibiting VEGF-induced VEGFR2 phosphorylation, thus blocking VEGFR 2-mediated increases in vascular permeability, which allows TNFSF15 to be used to treat diseases associated with pathological increases in vascular permeability. Meanwhile, TNFSF15 protein has physiological activities of activating T cells, promoting secretion of inflammatory factors and the like, and plays an important role in immunoregulation and inflammatory diseases. By targeting this target antibody, inflammation-related disorders can be treated.

However, due to differences in physiology and pathology between animals and humans, coupled with the complexity of genes, e.g., human-murine homology of TL1A is only 66%, it remains the greatest challenge how to construct "effective" humanized animal models for new drug development.

In view of the great application value of TL1A in the field of inflammatory immunotherapy and the potential value of the field of anti-tumor therapy, in order to further explore the related biological characteristics, the effectiveness of preclinical pharmacodynamic tests is improved, the success rate of research and development is improved, preclinical tests are more effective, research and development failure is minimized, and the development of a non-human animal model of a TL1A related signal path is urgently needed in the field. In addition, the non-human animal obtained by the method can also be mated with other humanized non-human animals to obtain a polygenic humanized animal model, which is used for screening and evaluating the study of the drug effect of the human drug and the combined drug aiming at the signal path. The invention has wide application prospect in academic and clinical research.

Disclosure of Invention

The application replaces homologous genes of animal genome with human normal or mutant genes, and can establish normal or mutant gene animal models which are more similar to human physiological or disease characteristics. The humanized animal has important application value, such as the humanized animal model transplanted by cells or tissues can be improved and promoted by gene humanized, and more importantly, the humanized protein can be expressed or partially expressed in the animal body due to the insertion of human gene fragments, can be used as a target spot of a medicament capable of only recognizing human protein sequences, and provides possibility for screening anti-human antibodies and other medicaments at animal level.

In a first aspect of the invention, a method of constructing a non-human animal humanized with a TL1A gene is provided.

Preferably, the non-human animal expresses human or humanized TL1A protein in vivo and/or the non-human animal genome comprises a portion of a human TL1A gene or a humanized TL1A gene.

Preferably, the non-human animal has reduced or absent expression of endogenous TL1A proteins.

Preferably, the genome of the non-human animal comprises a part of the human TL1A gene, preferably comprises all or part of the 1 st to 4 th exons of the human TL1A gene, further preferably comprises one or a combination of two or more of the 1 st, 2 nd, 3 rd or 4 th exons of the human TL1A gene, more preferably comprises all or part of the 1 st, 2 nd to 3 rd exons and all or part of the 4 th exons of the human TL1A gene, preferably further comprises an 1-2 nd and/or 3-4 rd introns, wherein the part of the 1 st exons of the human TL1A gene comprises at least 5bp to 237bp, e.g. 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 237 consecutive nucleotide sequences, preferably further comprises an amino acid sequence of the 1 st to 30bp, preferably further comprises an amino acid sequence of the 1 st to 237bp, e.g. of the amino acid sequence of the 1 st to 30 bp. The portion of exon 4 of the human TL1A gene comprises at least 50bp to 6255bp, e.g. 50, 100, 150, 200, 250, 300, 350, 400, 450, 452, 455, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6100, 6200 or 6255bp of contiguous nucleotide sequences, preferably the portion of exon 4 of said human TL1A gene comprises the nucleotide sequence of the coding region of exon 4.

In one embodiment of the invention, the portion of the human TL1A gene comprised in the genome of said non-human animal comprises the amino acid sequence of SEQ ID NO: 7; alternatively, comprising a sequence identical to SEQ ID NO:7 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence differing by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence comprising one or more substitutions, deletions and/or insertions.

Preferably, the genome of the non-human animal comprises a nucleotide sequence encoding all or part of a human or humanized TL1A protein, more preferably comprises a nucleotide sequence encoding all or part of an extracellular, transmembrane and/or cytoplasmic region of a human TL1A protein; further preferred comprises a nucleotide sequence encoding at least 20 to 251, e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, 195, 200, 210, 220, 230, 240, 250, or 251 consecutive amino acid sequences of a human TL1A protein; more preferably, a nucleotide sequence comprising all or part of an extracellular region encoding a human TL1A protein; even more preferably a nucleotide sequence comprising at least 20 to 195, e.g. at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 consecutive amino acid sequences encoding a human TL1A protein; it is further preferred that the nucleotide sequence encoding the extracellular region of human TL1A protein is N-terminally deleted by 0-10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acids.

In one embodiment of the invention, the non-human animal genome comprises a sequence encoding SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity to the amino acid sequence shown at positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, the nucleotide sequences of the amino acid sequences shown at positions 61-251, 58-251 or 57-251 differ by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, and a nucleotide sequence comprising one or more nucleotide substitutions, deletions and/or insertions as shown in the nucleotide sequence of the amino acid sequence shown at positions 61-251, 58-251 or 57-251.

Preferably, the genome of at least one cell of the non-human animal comprises a nucleotide sequence encoding a human or humanized TL1A protein, a portion of a human TL1A gene or a humanized TL1A gene.

Preferably, the nucleotide sequence encoding a human or humanized TL1A protein, a portion of a human TL1A gene or a nucleotide sequence of a humanized TL1A gene is operably linked to endogenous regulatory elements at endogenous TL1A loci in at least one chromosome of a non-human animal.

Preferably, the non-human animal is obtained by constructing a targeting vector targeting the endogenous TL1A gene of the non-human animal.

Preferably, the construction method comprises introducing a donor nucleotide sequence into a non-human animal endogenous TL1A locus, said donor nucleotide sequence comprising any one of the group of:

a) A portion of the human TL1A gene, preferably comprising all or part of the 1 st to 4 th exons of the human TL1A gene, further preferably comprising one or a combination of two or more of the 1 st, 2 nd, 3 rd or 4 th exons of the human TL1A gene, more preferably comprising all or part of the 1 st, 2 nd to 3 rd exons and all or part of the 4 th exons of the human TL1A gene, preferably further comprising 1-2 nd and/or 3-4 rd introns, wherein a portion of the 1 st exons of the human TL1A gene comprises at least 5bp to 237bp, e.g. 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 237 contiguous nucleotide sequences, preferably wherein a portion of the 1 st exons of the human TL1A gene comprises, e.g. a contiguous nucleotide sequence encoding a contiguous nucleotide sequence of an outer region of, e.g. 5-30 bp; the portion of exon 4 of the human TL1A gene comprises at least 50bp to 6255bp, e.g. 50, 100, 150, 200, 250, 300, 350, 400, 450, 452, 455, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6100, 6200 or 6255bp of contiguous nucleotide sequences, preferably the portion of exon 4 of the human TL1A gene comprises the nucleotide sequence of the coding region in exon 4; still further preferred comprises SEQ ID NO: 7; alternatively, comprising a sequence identical to SEQ ID NO:7 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence differing by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence comprising one or more substitutions, deletions and/or insertions;

B) A nucleotide sequence encoding all or part of a human TL1A protein, preferably comprising a nucleotide sequence encoding all or part of an extracellular, transmembrane and/or cytoplasmic region of a human TL1A protein; further preferred comprises a nucleotide sequence encoding at least 20 to 251, e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, 195, 200, 210, 220, 230, 240, 250, or 251 consecutive amino acid sequences of a human TL1A protein; more preferably, a nucleotide sequence comprising all or part of an extracellular region encoding a human TL1A protein; even more preferably a nucleotide sequence comprising at least 20 to 195, such as at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 consecutive amino acid sequences encoding a human TL1A protein, even more preferably a nucleotide sequence encoding an extracellular region of a human TL1A protein with an N-terminal removal of 0-10 (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acids; still further preferred comprises a sequence encoding SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity to the amino acid sequence shown at positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, the nucleotide sequences of the amino acid sequences shown at positions 61-251, 58-251 or 57-251 differ by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, a nucleotide sequence comprising one or more substitutions, deletions and/or insertions as indicated by the nucleotide sequence of amino acid sequence set forth at positions 61-251, 58-251 or 57-251;

C) A nucleotide sequence encoding a humanized TL1A protein; or alternatively, the first and second heat exchangers may be,

d) Humanized TL1A gene.

Preferably, the introducing includes inserting or replacing.

The insertion is that a target fragment is placed between two adjacent bases on the premise of not deleting nucleotides, wherein the target fragment is, for example, a human TL1A gene, a humanized TL1A gene, a nucleotide sequence for encoding human or humanized TL1A protein, a nucleotide sequence obtained by splicing the human TL1A gene with a non-human animal endogenous TL1A gene, and can be a part of the nucleotide sequence of the human TL1A gene.

In one embodiment of the invention, the nucleotide sequence introduced at the endogenous TL1A locus of the non-human animal further comprises a resistance gene, preferably the nucleotide sequence introduced at the endogenous TL1A locus of the non-human animal further comprises two Frt recombination sites flanking the resistance gene.

In one embodiment of the present invention, the resistance gene is neomycin phosphotransferase encoding gene Neo.

Preferably, in the genome of the non-human animal, a portion comprising a human TL1A gene and a portion of a non-human animal endogenous TL1A gene, the sequence of the 5' end of the portion of the human TL1A gene linked to the portion of the non-human animal endogenous TL1A gene comprises the sequence as set forth in SEQ ID NO:10, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:10 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%. The sequence linking the 3' end of the portion of the human TL1A gene to the portion of the non-human animal endogenous TL1A gene comprises the sequence as set forth in SEQ ID NO:11, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:11 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

In a specific embodiment of the invention, the nucleotide sequence introduced at the endogenous TL1A locus of the non-human animal further comprises the nucleotide sequence of SEQ ID NO:12 and/or 13; alternatively, comprising a sequence identical to SEQ ID NO:12 and/or 13 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

Preferably, any nucleotide sequence introduced at the endogenous TL1A locus of a non-human animal is operably linked to a regulatory element, further preferably, said regulatory element is an endogenous regulatory element or an exogenous regulatory element. Preferably, the regulatory elements include, but are not limited to, promoters.

Preferably, the endogenous regulatory element is derived from a TL1A gene endogenous to the non-human animal and the exogenous regulatory element is derived from a human TL1A gene.

Preferably, the construction method comprises modifying the coding box of the non-human animal TL1A gene, inserting a nucleotide sequence comprising the human TL1A gene into an endogenous regulatory element of the non-human animal endogenous TL1A gene, wherein the coding box of the modified non-human animal endogenous TL1A gene can be a functional region of the non-human animal endogenous TL1A gene knocked out or a sequence inserted into the coding box, so that the non-human animal endogenous TL1A protein is not expressed or the expression of the protein is reduced or expressed is not functional.

Preferably, the insertion may also disrupt the coding box of the endogenous TL1A gene of the non-human animal or disrupt the coding box of the endogenous TL1A gene after the insertion sequence, followed by an insertion procedure, or the insertion step may be performed to both frame shift mutate the endogenous TL1A gene and to insert the human sequence, as desired in particular embodiments.

Preferably, the insertion site is behind an endogenous regulatory element of an endogenous TL1A gene of the non-human animal.

In one embodiment of the invention, the construction method comprises inserting a nucleotide sequence encoding a human or humanized TL1A protein, a nucleotide sequence of a human or humanized TL1A gene, and/or an auxiliary sequence into an endogenous regulatory element of a non-human animal endogenous TL1A gene, said auxiliary sequence being a sequence having a termination function such that the humanized animal model of the TL1A gene expresses the human or humanized TL1A protein in vivo, but not the non-human animal endogenous TL1A protein. Further preferably, the helper sequence may be a WPRE and/or STOP sequence.

Wherein the replacement includes a replacement of a corresponding location or a replacement of a non-corresponding location. The substitution at the corresponding position not only represents the substitution directly corresponding to the base site of the TL1A gene in human and non-human animals mechanically, but also comprises the substitution of the corresponding functional region.

Preferably, the non-human animal endogenous TL1A locus is introduced to replace a corresponding region of the non-human animal, more preferably to replace all or part of the nucleotide sequence encoding the non-human animal endogenous TL1A protein in the non-human animal genome, and even more preferably to replace all or part of the extracellular region encoding the non-human animal endogenous TL1A protein in the non-human animal genome.

Preferably, all or part of exons 1 to 4, more preferably all of exons 1, 2 to 3 and part of exons 4, preferably introns 1-2 and/or 3-4 of the endogenous TL1A gene of the non-human animal are replaced.

Preferably, the non-human animal genome encodes SEQ ID NO:1, further preferably the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 from position 61-252, 63-252 or 66-252.

In one embodiment of the invention, the construction method comprises inserting or replacing a nucleotide sequence comprising all or part of the extracellular, transmembrane and/or cytoplasmic regions of the TL1A protein encoding the human TL1A protein.

In one embodiment of the invention, the construction method comprises inserting or replacing a nucleotide sequence comprising all or a portion of an extracellular region encoding a TL1A protein of a non-human animal endogenous to the human.

In one embodiment of the invention, the construction method comprises inserting or replacing all or part of exons 1 to 4 of a non-human animal endogenous TL1A gene with all or part of exons 1 to 4 comprising a human TL1A gene.

In one embodiment of the invention, the construction method comprises inserting or replacing all or part of exon 1, all or part of exon 2 to 3 (preferably also comprising intron 1-2 and/or intron 3-4) and all or part of exon 4 (preferably also comprising intron 1-2 and/or intron 3-4) of the human TL1A gene into or with all or part of exon 1, all or part of exon 2 to 3 (preferably also comprising intron 1-2 and/or intron 3-4) of the non-human animal endogenous TL1A gene.

In one embodiment of the invention, the construction method comprises inserting or replacing a genomic DNA, cDNA sequence or CDS sequence comprising the human TL1A gene into or into the genome of a non-human animal encoding the sequence of SEQ ID NO:1, and a nucleotide sequence of the amino acid shown in 1.

In one embodiment of the invention, the construction method comprises the steps of: 2 into or replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1, and a nucleotide sequence of the amino acid sequence shown in 1.

In one embodiment of the invention, the construction method comprises the steps of: 2, the nucleotide sequence encoding the amino acid sequence shown in positions 61-251 of the non-human animal genome is inserted into or replaced with the nucleotide sequence shown in SEQ ID NO:1 from positions 66 to 252.

In one embodiment of the invention, the construction method comprises the steps of: 7 into or replacing the nucleotide sequence encoding SEQ ID NO:1 from positions 66 to 252.

Preferably, the construction of the non-human animal is performed using gene editing techniques including gene targeting techniques using embryonic stem cells, CRISPR/Cas9 techniques, zinc finger nuclease techniques, transcription activator-like effector nuclease techniques, homing endonucleases or other molecular biology techniques.

Preferably, the construction method comprises constructing the non-human animal by using a targeting vector targeting the TL1A gene endogenous to the non-human animal or sgRNA targeting the TL1A gene endogenous to the non-human animal.

In one embodiment of the invention, the construction method comprises introducing a targeting vector targeting the TL1A gene endogenous to a non-human animal into non-human animal cells (preferably embryonic stem cells), screening out correct positive cloned cells, introducing the correct positive cloned cells into the separated blastula, culturing the blastula, transplanting the cultured blastula into a female non-human animal oviduct, allowing the development of the blastula, and identifying and screening to obtain the non-human animal humanized by the TL1A gene.

Preferably, to increase recombination efficiency, the construction of the non-human animal can also be performed using a targeting vector that targets the endogenous TL1A gene of the non-human animal, together with sgrnas that target the endogenous TL1A gene of the non-human animal.

In one embodiment of the invention, the construction method comprises introducing a targeting vector targeting the TL1A gene endogenous to the non-human animal, sgRNA targeting the TL1A gene endogenous to the non-human animal and Cas9 into a non-human animal cell, culturing the cell (preferably fertilized egg), transplanting the cultured cell into the oviduct of a female non-human animal, allowing the female non-human animal to develop, and identifying and screening the non-human animal to obtain the TL1A gene humanized.

According to some embodiments of the invention, the method further comprises mating the TL1A humanized non-human animal with other genetically modified non-human animals, in vitro fertilization, or direct gene editing, and screening to obtain the polygenic modified non-human animal.

Preferably, the additional genes include, but are not limited to, at least one of IL23A, IL12B, TNFA, TNFR, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3 or LAG 3.

Preferably, the non-human animal further expresses at least one of human or humanized IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, or LAG3 proteins.

Preferably, the portion of the human TL1A gene, the humanized TL1A gene and/or the other gene is homozygous for the endogenous modified (preferably replacement) locus.

Preferably, the portion of the human TL1A gene, the humanized TL1A gene and/or the other gene is heterozygous for the endogenous modified (preferably replaced) locus.

Preferably, each of the plurality of genes modified in the genome of the polygenously modified non-human animal is homozygous for the endogenous modified (preferably replacement) locus.

Preferably, each of the plurality of genes modified in the genome of the polygenously modified non-human animal is heterozygous for the endogenous modified (preferably alternative) locus.

Preferably, the non-human animal is selected from any non-human animal that can be genetically edited to produce a humanized gene, such as rodents, zebra fish, pigs, chickens, rabbits, monkeys, etc.

Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Still more preferably, the rodent is a rat or mouse.

Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferred, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit or an immunodeficient monkey. Still more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Still further preferred, the immunodeficient mouse is NOD-Prkdc ^scid IL-2rγ ^null Mouse, NOD-Rag 1 ^-/- -IL2rg ^-/- Mouse, rag 2 ^-/- -IL2rg ^-/- Mice, NOD/SCID mice or nude mice.

In a second aspect of the invention, a non-human animal humanized with a TL1A gene is provided.

In one embodiment of the invention, the non-human animal genome comprises a sequence encoding SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity to the amino acid sequence shown at positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, the nucleotide sequences of the amino acid sequences shown at positions 61-251, 58-251 or 57-251 differ by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, a nucleotide sequence comprising one or more nucleotide substitutions, deletions and/or insertions, as shown in the nucleotide sequence of the amino acid sequence shown at positions 61-251, 58-251 or 57-251

Preferably, the non-human animal comprises a construct obtained by introducing a donor nucleotide sequence into the non-human animal endogenous TL1A locus, said donor nucleotide sequence comprising any one of the following group of nucleotide sequences:

d) Humanized TL1A gene.

Preferably, the non-human animal is obtained by the above-described construction method.

Preferably, in the genome of the non-human animal, a portion comprising a human TL1A gene and a portion of a non-human animal endogenous TL1A gene, the sequence of the 5' end of the portion of the human TL1A gene linked to the portion of the non-human animal TL1A gene comprises the sequence as set forth in SEQ ID NO:10, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:10 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%. The sequence linking the 3' end of the portion of the human TL1A gene to the portion of the non-human animal TL1A gene comprises the sequence as set forth in SEQ ID NO:11, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:11 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

In one embodiment of the invention, the genome of the non-human animal further comprises SEQ ID NO:12 and/or 13; alternatively, comprising a sequence identical to SEQ ID NO:12 and/or 13 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

Preferably, the non-human animal further comprises additional genetic modifications, further preferably, the additional genes include, but are not limited to, at least one of IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, or LAG 3.

In a third aspect of the invention, a non-human animal with a TL1A gene deleted is provided.

Preferably, the non-human animal lacks all or part of exons 1 to 4, more preferably all or part of exons 1, all or part of exons 2 to 3 and all or part of exons 4 of the TL1A gene, more preferably also 1-2 and/or 3-4 introns.

In a fourth aspect of the invention, a method of constructing a non-human animal with a TL1A gene deleted is provided.

Preferably, the construction method comprises constructing the non-human animal with the TL1A gene deleted by adopting a targeting vector targeting the endogenous TL1A gene of the non-human animal and/or sgRNA targeting the endogenous TL1A gene of the non-human animal.

In a fifth aspect of the invention, there is provided a TL1A gene-deleted cell.

Preferably, the cell lacks all or part of exons 1 to 4, more preferably all or part of exons 1, all or part of exons 2 to 3, and all or part of exons 4 of the TL1A gene, more preferably also 1-2 and/or 3-4 introns.

In a sixth aspect of the present invention, there is provided a method for constructing a TL1A gene-deleted cell.

Preferably, the construction method comprises constructing cells with the TL1A gene deleted by adopting a targeting vector for targeting the TL1A gene endogenous to the non-human animal and/or sgRNA for targeting the TL1A gene endogenous to the non-human animal.

In a seventh aspect of the present invention, there is provided a method of constructing a polygenically modified non-human animal, the method comprising:

1) Providing a non-human animal as described in any of the above, or obtaining a non-human animal using any of the above described methods of construction;

2) Mating the non-human animal provided in the step 1) with other non-human animals modified by genes, performing in vitro fertilization or directly performing gene editing, and screening to obtain the non-human animal modified by multiple genes.

Preferably, the polygene modified non-human animal is a double-gene humanized non-human animal, a three-gene humanized non-human animal, a four-gene humanized non-human animal, a five-gene humanized non-human animal, a six-gene humanized non-human animal, a seven-gene humanized non-human animal, an eight-gene humanized non-human animal or a nine-gene humanized non-human animal.

In an eighth aspect of the present invention, there is provided a non-human animal or a progeny thereof humanized by the TL1A gene obtained by the above construction method, or a polygenic modified non-human animal or a progeny thereof.

In a ninth aspect of the present invention, there is provided an animal model derived from the above-described non-human animal or its progeny, or derived from the non-human animal or its progeny obtained by the above-described construction method.

Preferably, the animal model is a tumor-bearing model or an inflammatory animal model.

In a tenth aspect of the present invention, there is provided a method for producing a tumor-bearing animal model or an inflammatory animal model, which comprises the step of constructing a non-human animal humanized with the TL1A gene described above or constructing a non-human animal or a progeny thereof by using the above construction method, preferably further comprising the step of implanting tumor cells and/or introducing inflammatory factors.

According to an eleventh aspect of the invention, there is provided the use of the above TL1A gene humanized non-human animal or its progeny, polygenic modified non-human animal or its progeny, non-human animal obtained by the above construction method or its progeny in the preparation of an animal model.

In a twelfth aspect of the invention, there is provided a humanized TL1A protein, said humanized TL1A protein comprising all or part of a human TL1A protein.

Preferably, the humanized TL1A protein comprises all or part of the extracellular, transmembrane and/or cytoplasmic regions of a human TL1A protein.

In a specific embodiment of the invention, the humanized TL1A protein comprises at least 20 to 251, e.g. at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, 195, 200, 210, 220, 230, 240, 250 or 251 consecutive amino acid sequences of a human TL1A protein.

Further preferred, the humanized TL1A protein comprises all or part of the extracellular domain of a human TL1A protein.

In a specific embodiment of the invention, the humanized TL1A protein comprises at least 20 to 195, for example at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 consecutive amino acid sequences of the extracellular domain of a human TL1A protein.

In one embodiment of the invention, the humanized TL1A protein comprises an extracellular domain of a human TL1A protein with N-terminal removal of 0-10 (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acids.

In one embodiment of the invention, the humanized TL1A protein comprises the amino acid sequence of SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, comprising a sequence identical to SEQ ID NO:2 from position 61-251, 58-251 or 57-251 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

Preferably, the humanized TL1A protein further comprises a portion of a TL1A protein endogenous to a non-human animal.

Further preferred, the humanized TL1A protein comprises all or part of the cytoplasmic domain of a TL1A protein endogenous to a non-human animal.

Preferably, the cytoplasmic region of the non-human animal endogenous TL1A protein comprises SEQ ID NO:1 to 39; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 1-39.

Further preferred, the humanized TL1A protein comprises all or part of the transmembrane region of a TL1A protein endogenous to a non-human animal.

Preferably, the transmembrane region of the endogenous TL1A protein of said non-human animal comprises the amino acid sequence of SEQ ID NO:1 from position 40 to 60; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 40-60 of 1.

Further preferred, the humanized TL1A protein comprises a portion of an extracellular domain of a TL1A protein endogenous to a non-human animal.

Preferably, the portion of the extracellular region of the endogenous TL1A protein of said non-human animal comprises the amino acid sequence of SEQ ID NO:1 from position 61 to 65; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 61-65 of 1.

Preferably, the humanized TL1A protein comprises the amino acid sequence of SEQ ID NO:1 to the amino acid sequence shown in positions 1-65; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 1-65.

Preferably, the portion of the humanized TL1A protein that is the human TL1A protein is directly linked to the portion of the non-human animal TL1A protein or is linked via a linker, preferably a peptide linker.

In one embodiment of the invention, the sequence from the N-terminus to the C-terminus of the humanized TL1A protein comprises the entire cytoplasmic region, the entire transmembrane region, a portion of the extracellular region of the non-human animal endogenous TL1A protein, and a portion of the extracellular region of the human TL1A protein.

In one embodiment of the invention, the humanized TL1A protein comprises the amino acid sequence of SEQ ID NO:1, and the amino acid sequence shown at positions 1-65 of SEQ ID NO:2 from position 61 to 251. For example, the order from N-terminus to C-terminus comprises SEQ ID NO:1, and the amino acid sequence shown at positions 1-65 of SEQ ID NO:2 from position 61 to 251.

Preferably, the humanized TL1A protein comprises all or part of the amino acid sequence encoded by the human TL1A gene.

Preferably, the humanized TL1A protein comprises an amino acid sequence encoded by all or part of exons 1 to 4 of a human TL1A gene, more preferably comprises an amino acid sequence encoded by one or a combination of two or more of exons 1, 2, 3, 4 of a human TL1A gene, even more preferably comprises an amino acid sequence encoded by part of exons 1, 2 to 4 of a human TL1A gene, wherein part of exons 1 of a human TL1A gene comprises at least 5bp to 237bp, e.g. 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 237bp consecutive nucleotide sequences, preferably wherein part of exons 1 of a human TL1A gene comprises an extracellular region encoded by all or part of a consecutive nucleotide sequence, e.g. 5-30 bp.

In a specific embodiment of the invention, the humanized TL1A protein comprises a human or humanized TL1A extracellular region, preferably comprises a human or humanized TL1A transmembrane region, further preferably also comprises a human or humanized TL1A cytoplasmic region.

Preferably, the humanized TL1A extracellular region comprises all or part of an extracellular region of a human TL1A protein, preferably comprises at least 20 to 195, such as at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 consecutive amino acid sequences of an extracellular region of a human TL1A protein, further preferably an extracellular region of a human TL1A protein comprising 191 consecutive amino acids, more preferably an extracellular region of a human TL1A protein comprising SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, comprising a sequence identical to SEQ ID NO:2 at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% amino acid sequence identity as shown at positions 61-251, 58-251 or 57-251; alternatively, comprising a sequence identical to SEQ ID NO:2 of no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid from the amino acid sequence shown at positions 61-251, 58-251 or 57-251; alternatively, comprising a sequence identical to SEQ ID NO:2, positions 61-251, 58-251 or 57-251, comprising substitutions, deletions and/or insertions of one or more amino acid residues.

Further preferred, the humanized TL1A extracellular region further comprises all or part of an extracellular region of a non-human animal endogenous TL1A protein, preferably comprises at least 1 to 192, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 192 consecutive amino acid sequences of an extracellular region of a non-human animal TL1A protein, further preferred comprises 5 consecutive amino acids of an extracellular region of a non-human animal endogenous TL1A protein; still more preferably, the portion of the extracellular region comprising exon 1 codes. More preferably comprises SEQ ID NO:1 from position 61 to 65; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 61-65 of 1; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence differences shown at positions 61-65 of 1 of no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; alternatively, comprising a sequence identical to SEQ ID NO:1, comprising substitution, deletion and/or insertion of one or more amino acid residues.

In one embodiment of the invention, the humanized TL1A extracellular region comprises an extracellular region of a 191 contiguous amino acids human TL1A protein and an extracellular region of a 5 contiguous amino acids non-human animal endogenous TL1A protein; preferably, the humanized TL1A extracellular region comprises the amino acid sequence of SEQ ID NO:2 and amino acid sequence shown in positions 61-251 of SEQ ID NO:1 from position 61 to 65; wherein the part of the extracellular region of the human TL1A protein (SEQ ID NO:1 at positions 61-251) and the part of the extracellular region of the endogenous TL1A protein of the non-human animal (SEQ ID NO:1 at positions 61-65) are directly linked or linked by a linker, preferably a peptide linker.

Preferably, the humanized TL1A transmembrane region comprises all or part of a transmembrane region of a human TL1A protein, preferably comprises at least 1 to 21, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 consecutive amino acid sequences of a transmembrane region of a human TL1A protein, further preferably comprises the amino acid sequence of SEQ ID NO:2 from position 36 to position 56; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown at positions 36-56 of 2; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence difference of no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid at positions 36-56 of 2; alternatively, comprising a sequence identical to SEQ ID NO:2, comprising substitution, deletion and/or insertion of one or more amino acid residues.

Preferably, the humanized TL1A cytoplasmic region comprises all or part of a cytoplasmic region of a human TL1A protein, preferably comprises at least 1 to 35, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 consecutive amino acid sequences of a cytoplasmic region of a human TL1A protein, further preferably comprises SEQ ID NO:2 amino acid sequence shown in positions 1-35; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence identity of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% of the amino acid sequence shown in positions 1-35 of 2; alternatively, comprising a sequence identical to SEQ ID NO: amino acid sequence difference of not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or not more than 1 amino acid at positions 1-35 of 2; alternatively, comprising a sequence identical to SEQ ID NO:2, comprising substitution, deletion and/or insertion of one or more amino acid residues.

Preferably, the humanized TL1A protein comprises any one of the following groups:

1) A human or humanized TL1A extracellular region, a transmembrane region of a TL1A protein endogenous to the non-human animal, and a cytoplasmic region of a TL1A protein endogenous to the non-human animal;

2) An extracellular region of a TL1A protein endogenous to a non-human animal, a human or humanized TL1A transmembrane region, and a cytoplasmic region of a TL1A protein endogenous to a non-human animal;

3) An extracellular region of a TL1A protein endogenous to the non-human animal, a transmembrane region of a TL1A protein endogenous to the non-human animal, and a human or humanized TL1A cytoplasmic region;

4) A human or humanized TL1A extracellular region, a human or humanized TL1A transmembrane region, and a cytoplasmic region of a TL1A protein endogenous to a non-human animal;

5) A human or humanized TL1A extracellular region, a transmembrane region of a non-human animal endogenous TL1A protein, and a human or humanized TL1A cytoplasmic region;

6) An extracellular region of a TL1A protein endogenous to a non-human animal, a human or humanized TL1A transmembrane region, and, a human or humanized TL1A cytoplasmic region;

7) A human or humanized TL1A extracellular region, a human or humanized TL1A transmembrane region, and a human or humanized TL1A cytoplasmic region.

In one embodiment of the invention, the humanized TL1A protein comprises a cytoplasmic region of a TL1A protein endogenous to the non-human animal (preferably SEQ ID NO:1 st-39 th), a transmembrane region of a TL1A protein endogenous to the non-human animal (preferably SEQ ID NO:1 st-60 th), a portion of an extracellular region of a TL1A protein endogenous to the non-human animal (preferably SEQ ID NO:1 st-65 th), and a portion of an extracellular region of a human TL1A protein (preferably SEQ ID NO:2 st-61 st-251 th).

In a specific embodiment of the present invention, the humanized TL1A protein comprises a humanized TL1A protein obtained by substituting amino acid sequence from position 66 to 252 of a TL1A protein (preferably SEQ ID NO: 1) endogenous to a non-human animal, preferably, the substitution comprises a complete or partial substitution of the extracellular region of a human TL1A protein, more preferably, the substitution comprises amino acid sequence from position 61 to 251 of a human TL1A protein (preferably SEQ ID NO: 2).

In a specific embodiment of the invention, the amino acid sequence of the humanized TL1A protein comprises any one of the group of:

(A) SEQ ID NO:9, all or part of;

(B) And SEQ ID NO:9 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% amino acid sequence identity;

(C) And SEQ ID NO:9, the amino acid sequence of which differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or alternatively, the first and second heat exchangers may be,

(D) And SEQ ID NO:9, comprising substitution, deletion and/or insertion of one or more amino acid residues.

Preferably, the humanized TL1A protein comprises a sequence of at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 amino acids identical to the corresponding amino acid sequence of human TL1A protein, and more preferably, the sequence of at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 amino acids is derived from an extracellular domain of human TL1A protein.

In a specific embodiment of the invention, the humanized TL1A protein comprises a sequence of at least 191 amino acids which is identical to the corresponding amino acid sequence of a human TL1A protein.

In a thirteenth aspect of the present invention, there is provided a nucleic acid encoding the humanized TL1A protein of the twelfth aspect above.

In a fourteenth aspect of the present invention, there is provided a humanized TL1A gene encoding the humanized TL1A protein of the twelfth aspect above.

In a fifteenth aspect of the present invention, there is provided a humanized TL1A gene, said humanized TL1A gene comprising a portion of a human TL1A gene.

Preferably, the humanized TL1A gene comprises all or part of the 1 st to 4 th exons of the human TL1A gene, more preferably comprises one or a combination of two or more of the 1 st, 2 nd, 3 rd or 4 th exons of the human TL1A gene, even more preferably comprises all or part of the 1 st, 2 nd to 3 rd exons of the human TL1A gene and all or part of the 4 th exons, preferably further comprises 1-2 nd and/or 3-4 rd introns, wherein part of the 1 st exons of the human TL1A gene comprises at least 5bp to 237bp, e.g. 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 237 consecutive nucleotide sequences, preferably wherein part of the 1 st exons of the human TL1A gene comprises, e.g. a consecutive nucleotide sequence, e.g. a 5bp to 30bp, consecutive nucleotide sequence of the coding region of the 1 st or the entire nucleotide sequence of the 5 th to 30 bp. The portion of exon 4 of the human TL1A gene comprises at least 50bp to 6255bp, e.g. 50, 100, 150, 200, 250, 300, 350, 400, 450, 452, 455, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6100, 6200 or 6255bp of contiguous nucleotide sequences, preferably the portion of exon 4 of said human TL1A gene comprises the nucleotide sequence of the coding region of exon 4.

In one embodiment of the invention, the portion of the human TL1A gene comprised in the humanized TL1A gene comprises the amino acid sequence of SEQ ID NO: 7; alternatively, comprising a sequence identical to SEQ ID NO:7 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence differing by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; alternatively, comprising a sequence identical to SEQ ID NO:7, a nucleotide sequence comprising one or more substitutions, deletions and/or insertions.

Preferably, in the humanized TL1A gene, the humanized TL1A gene comprises a part of a human TL1A gene and a part of a non-human animal endogenous TL1A gene, and the sequence of the 5' end of the part of the human TL1A gene linked to the part of the non-human animal endogenous TL1A gene comprises the sequence as set forth in SEQ ID NO:10, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:10 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%. The sequence linking the 3' end of the portion of the human TL1A gene to the portion of the non-human animal endogenous TL1A gene comprises the sequence as set forth in SEQ ID NO:11, a nucleotide sequence shown in seq id no; alternatively, comprising a sequence identical to SEQ ID NO:11 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

In one embodiment of the invention, the humanized TL1A gene further comprises the amino acid sequence of SEQ ID NO:12 and/or 13; alternatively, comprising a sequence identical to SEQ ID NO:12 and/or 13 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

Preferably, the humanized TL1A gene further comprises a portion of a non-human animal endogenous TL1A gene, further preferably the portion of the non-human animal endogenous TL1A gene comprises all or a portion of exons No. 1 to 4 of the non-human animal endogenous TL1A gene, further preferably comprises a portion of exons No. 1 and/or a portion of exons No. 4 of the non-human animal endogenous TL1A gene, wherein the portion of exons No. 1 of the non-human animal endogenous TL1A gene comprises at least a nucleotide sequence of a 5' utr and/or a portion encoding all of the cytoplasmic region, all of the transmembrane region and/or a portion of the extracellular region of the non-human animal endogenous TL1A protein; the portion of exon 4 of the endogenous TL1A gene of the non-human animal comprises at least the 3' utr.

In one embodiment of the invention, the humanized TL1A gene comprises, in order from the 5 'end to the 3' end, a part of a non-human animal endogenous TL1A gene (preferably a part comprising exon 1 of a non-human animal endogenous TL1A gene), a part of a human TL1A gene (preferably all or part of exon 1 of a human TL1A gene, all or part of exons No. 2 to 3 and all or part of exon 4, preferably further comprising intron No. 1-2 and/or intron No. 3-4), a part of a non-human animal TL1A gene (preferably a part of exon 4 of a non-human animal TL1A gene).

In one embodiment of the invention, the humanized TL1A gene comprises, in order from the 5 'end to the 3' end, a portion of a non-human animal endogenous TL1A gene (preferably a portion comprising exon 1 of a non-human animal endogenous TL1A gene), SEQ ID NO:7 or encodes SEQ ID NO:2, the nucleotide sequence of the amino acid sequence shown in positions 61-251, the 3' UTR of the non-human animal TL1A gene.

In one embodiment of the invention, the humanized TL1A gene further comprises a resistance gene, preferably the humanized TL1A gene further comprises two Frt recombination sites flanking the resistance gene.

Preferably, the humanized TL1A gene comprises a nucleotide sequence encoding all or part of a human TL1A protein, more preferably comprises a nucleotide sequence encoding all or part of an extracellular region, a transmembrane region and/or a cytoplasmic region of a human TL1A protein, even more preferably comprises a nucleotide sequence encoding all or part of an extracellular region of a human TL1A protein, even more preferably comprises a nucleotide sequence encoding at least 20 to 195, e.g. at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194 or 195 consecutive amino acid sequences of a human TL1A protein. Even more preferably, it comprises a nucleotide sequence encoding an extracellular region of a human TL1A protein with an N-terminal removal of 0-10 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acids.

In one embodiment of the invention, the humanized TL1A gene comprises a sequence encoding SEQ ID NO:2 from positions 61-251, 58-251 or 57-251; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:2, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity to the amino acid sequence shown at positions 61-251, 58-251 or 57-251.

Preferably, the humanized TL1A gene comprises a nucleotide sequence encoding all or part of a non-human animal endogenous TL1A protein, further preferably comprises within it a nucleotide sequence encoding all cytoplasmic, all transmembrane and part of an extracellular region of a non-human animal endogenous TL1A protein, wherein part of the extracellular region of a non-human animal endogenous TL1A protein comprises at least 0-10 (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) consecutive amino acids of the extracellular region of a non-human animal endogenous TL1A protein, preferably comprises the amino acid sequence of SEQ ID NO:1 or comprises the amino acid sequence shown in positions 61-65 of SEQ ID NO: amino acid sequence identity shown at positions 61-65 of 1 is 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% amino acid sequence.

In one embodiment of the invention, the humanized TL1A gene comprises a sequence encoding SEQ ID NO:1, from positions 1 to 39, 40 to 60, 61 to 65 or 1 to 65; alternatively, it comprises a sequence identical to the sequence encoding SEQ ID NO:1, from positions 1-39, 40-60, 61-65 or 1-65, is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

Preferably, the humanized TL1A gene is regulated in a non-human animal by a regulatory element, and more preferably, the regulatory element is an endogenous regulatory element or an exogenous regulatory element.

Preferably, the regulatory element is a promoter.

Preferably, the humanized TL1A gene comprises the 5'utr and/or the 3' utr of a TL1A gene endogenous to the non-human animal.

Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, said immunizationThe deficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit or an immunodeficient monkey. Still more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Still further preferred, the immunodeficient mouse is NOD-Prkdc ^scid IL-2rγ ^null Mouse, NOD-Rag 1 ^-/- -IL2rg ^-/- Mouse, rag 2 ^-/- -IL2rg ^-/- Mice, NOD/SCID mice or nude mice.

In one embodiment of the invention, the mRNA transcribed from the humanized TL1A gene comprises any one of the following groups:

(A) SEQ ID NO:8 or a part or all of the nucleotide sequence shown in figure 8;

(B) And SEQ ID NO:8 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity;

(C) And SEQ ID NO:8, a nucleotide sequence differing by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; or alternatively, the first and second heat exchangers may be,

(D) And SEQ ID NO:8, a nucleotide sequence comprising one or more substitutions, deletions and/or insertions.

Preferably, the humanized TL1A gene further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor may be a substance that is conventionally inducible or repressible. In one embodiment of the invention, the specific inducer is selected from the group consisting of the tetracycline System (Tet-Off System/Tet-On System) and the Tamoxifen System (Tamoxifen System).

In a sixteenth aspect of the invention, there is provided a targeting vector for targeting an endogenous TL1A gene of a non-human animal, said targeting vector comprising a donor nucleotide sequence.

The donor nucleotide sequence comprises any one of the following groups:

d) Humanized TL1A gene.

In one embodiment of the present invention, the targeting vector comprises SEQ ID NO:10 and/or 11; alternatively, comprising a sequence identical to SEQ ID NO:10 and/or 11 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

In one embodiment of the present invention, the targeting vector comprises SEQ ID NO:12 and/or 13; alternatively, comprising a sequence identical to SEQ ID NO:12 and/or 13 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

In a specific embodiment of the present invention, the targeting vector further comprises a resistance gene, preferably, the targeting vector further comprises two Frt recombination sites arranged in a co-orientation on both sides of the resistance gene.

Preferably, the targeting vector further comprises a 5 'arm and/or a 3' arm.

Wherein the 5' arm (or 5' homology arm) is a DNA fragment homologous to the 5' end of the transition region to be changed. Which is selected from 100-10000 nucleotides in length of genomic DNA of the endogenous TL1A gene of a non-human animal; preferably, the 5' arm has at least 90% nucleotides of homology to NCBI accession No. nc_ 000070.7; further preferred, said 5' arm comprises the amino acid sequence as set forth in SEQ ID NO:3 or 5, or comprises a nucleotide sequence that hybridizes to SEQ ID NO:3 or 5, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%.

The 3' arm (or 3' homology arm) is a DNA fragment homologous to the 3' end of the transition region to be changed. Which is selected from 100-10000 nucleotides in length of genomic DNA of the endogenous TL1A gene of a non-human animal; preferably, the 3' arm has at least 90% nucleotides of homology to NCBI accession No. nc_ 000070.7; further preferred, the 3' arm comprises the amino acid sequence as set forth in SEQ ID NO:4 or 6, or comprises a nucleotide sequence that hybridizes to SEQ ID NO:4 or 6, at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% nucleotide sequence identity.

Preferably, the transition region to be altered is located on exons 1 to 4 of the endogenous TL1A gene of the non-human animal.

In a seventeenth aspect of the invention, there is provided an sgRNA targeting a non-human animal endogenous TL1A gene.

Preferably, the target site of sgRNA targeting the endogenous TL1A gene of the non-human animal is located on intron 1-2 and/or exon 4 of the endogenous TL1A gene of the non-human animal.

Preferably, the target site of sgRNA targeting the endogenous TL1A gene of the non-human animal comprises the sequence of SEQ ID NO:14 and/or 15.

In an eighteenth aspect of the invention, there is provided a DNA molecule encoding the above sgRNA targeting the endogenous TL1A gene of a non-human animal.

Preferably, the double strand of the DNA molecule is the upstream and downstream sequence of the sgRNA, or a forward oligonucleotide or a reverse oligonucleotide after adding an enzyme cleavage site.

IN one embodiment of the invention, the double stranded nucleotide sequence of the DNA molecule comprises SEQ IN NO:16 and SEQ IN NO:18, SEQ IN NO:17 and SEQ IN NO:19, SEQ ID NO:20 and SEQ IN NO:22, seq IN NO:21 and SEQ IN NO:23.

in a nineteenth aspect of the invention, there is provided an sgRNA vector comprising the above-described targeting a TL1A gene endogenous to a non-human animal.

In a twentieth aspect of the invention, there is provided a cell comprising the above-described targeting vector targeting a TL1A gene endogenous to a non-human animal, the above-described sgRNA targeting a TL1A gene endogenous to a non-human animal, the above-described DNA molecule and/or the above-described vector.

In a twenty-first aspect of the invention, there is provided a targeting vector as described above for targeting a TL1A gene endogenous to a non-human animal, an sgRNA as described above for targeting a TL1A gene endogenous to a non-human animal, a DNA molecule as described above, a use of the vector as described above and/or a use of the cell as described above for TL1A gene modification.

Preferably, the application includes, but is not limited to, knockout, insertion, or replacement.

In a twenty-second aspect of the present invention, there is provided a cell humanized with a TL1A gene, said cell expressing a human TL1A protein or said humanized TL1A protein and/or comprising in the genome of said cell a part of a human TL1A gene or said nucleic acid or said humanized TL1A gene.

Preferably, the cell further comprises additional genetic modifications, further preferably, the additional genes include, but are not limited to, at least one of IL23A, IL12B, TNFA, TNFR, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, or LAG 3.

Preferably, the cells can develop into an individual animal or the cells cannot develop into an individual animal, as desired in particular embodiments.

In a twenty-third aspect of the present invention, there is provided a method for producing a cell humanized with a TL1A gene, the method comprising introducing into the cell a nucleotide sequence comprising any one of the group consisting of:

d) Humanized TL1A gene.

Preferably, the preparation of cells humanized for the TL1A gene is performed using the targeting vector described above that targets the endogenous TL1A gene of the non-human animal.

In a twenty-fourth aspect of the present invention, there is provided a cell, tissue or organ, which expresses a human TL1A protein or a humanized TL1A protein as described above, or a part of the genome of said cell, tissue or organ comprising a human TL1A gene as described above or a humanized TL1A gene as described above, or which is derived from a non-human animal as described above or a progeny thereof or an animal model as described above obtained by a method of constructing any of the above.

In a twenty-fifth aspect of the present invention, there is provided a tumor tissue after tumor, said tumor tissue expressing human TL1A protein or said humanized TL1A protein, or said tumor tissue comprising a part of the human TL1A gene or said humanized TL1A gene in its genome, or said tumor tissue being derived from any one of said non-human animals or their progeny or any one of said construction methods or said animal model.

In a twenty-sixth aspect of the invention, there is provided a non-human animal genome humanized with a TL1A gene.

Preferably, the gene comprises all or part of a human or humanized TL1A gene and/or comprises all or part of a nucleotide sequence encoding a human or humanized TL1A protein.

Preferably, the humanized TL1A gene is the humanized TL1A gene described above.

Preferably, the humanized TL1A protein is a humanized TL1A protein as described above.

Preferably, the genome comprises a genomic fragment of a human TL1A gene at a non-human animal endogenous TL1A locus (preferably comprising all or part of exons 1 to 4 of a human TL1A gene, further preferably comprising part of exons 1, all of exons 2 to 3 and part of exons 4, preferably further comprising introns 1-2 and/or introns 3-4) replacing a genomic fragment of a non-human animal endogenous TL1A gene to form a modified TL1A gene.

Preferably, the genomic fragment of the replaced non-human animal endogenous TL1A gene comprises all or part of exons 1 to 4 of the non-human animal endogenous TL1A gene, further preferably comprises part of exons 1, all of exons 2 to 3 and part of exons 4, preferably further comprises introns 1-2 and/or introns 3-4.

Preferably, the modified TL1A gene encodes a humanized TL1A protein.

Preferably, the expression of the modified TL1A gene is regulated by regulatory elements endogenous to the non-human animal.

Preferably, the genome comprises a humanized endogenous TL1A locus in which a fragment of the endogenous TL1A locus has been deleted and replaced with the corresponding human TL1A sequence.

Preferably, the humanized TL1A locus comprises an endogenous TL1A promoter, wherein the human TL1A sequence is operably linked to the endogenous TL1A promoter.

Preferably, all or part of exons 1 to 4 (preferably comprising part of exons 1, all of exons 2 to 3 and part of exons 4, preferably further comprising introns 1-2 and/or introns 3-4) of the endogenous TL1A locus have been deleted and replaced with the corresponding human TL1A sequence.

In a specific embodiment of the invention, all or part of the nucleotide sequence encoding the extracellular region of the endogenous TL1A locus has been deleted and replaced with the corresponding human TL1A sequence.

In a specific embodiment of the invention, the nucleotide sequence encoding the transmembrane region, cytoplasmic region, 3'utr and/or 5' utr of the endogenous TL1A locus has not been deleted and has not been replaced with the corresponding human TL1A sequence.

Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferred, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit or an immunodeficient monkey. Still more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Still further preferred, the immunodeficient mouse is NOD-Prkdc ^scid IL-2rγ ^null Mouse, NOD-Rag 1 ^-/- -IL2rg ^-/- Mouse, rag 2 ^-/- -IL2rg ^-/- Mouse, NOD/SCID mice or nude mice.

In a twenty-seventh aspect of the present invention, there is provided an application of the above-mentioned humanized TL1A protein, or the above-mentioned humanized TL1A gene, or the above-mentioned cell, or the above-mentioned non-human animal or its progeny obtained by the above-mentioned construction method, or the above-mentioned cell, tissue or organ, or the above-mentioned tumor tissue, characterized in that the application comprises:

A) Use in product development involving TL 1A-associated immune processes of human cells;

b) Use in model systems related to TL1A as pharmacological, immunological, microbiological and medical studies;

c) To the use of animal experimental disease models for the production and use in etiology studies associated with TL1A and/or for the development of diagnostic strategies and/or for the development of therapeutic strategies;

d) Application in screening, drug effect detection, efficacy evaluation, verification or evaluation of in vivo researcher TL1A signal path regulator; or,

e) Study TL1A gene function, study medicine and medicine effect aiming at target sites of human TL1A, study immune related disease medicine related to TL1A and application of antineoplastic medicine.

The use may be for diagnostic or therapeutic purposes of the disease or for diagnostic or therapeutic purposes of the non-disease, as desired in particular embodiments.

In a twenty-eighth aspect of the present invention, there is provided the use of a non-human animal or progeny thereof derived from the above, a non-human animal or progeny thereof obtained by the above construction method, or an animal model as described above, for screening a modulator specific for human TL 1A.

In a twenty-ninth aspect of the present invention, there is provided a screening method of a human TL 1A-specific modulator, said screening method comprising applying the modulator to an individual implanted with tumor cells, and detecting inhibition of tumor, wherein said individual is selected from the group consisting of the above-mentioned non-human animal or progeny thereof, the non-human animal or progeny thereof obtained by the above-mentioned construction method, or the above-mentioned animal model.

Preferably, the modulator is selected from CAR-T, a drug. Further preferably, the drug comprises a targeting drug, more preferably, the targeting drug is an antigen binding protein, and the antigen binding protein is an antibody.

Preferably, the regulator is monoclonal antibody or bispecific antibody or the combination of two or more drugs.

Preferably, the detection comprises determining the size and/or proliferation rate of the tumour.

Preferably, the method of detection comprises vernier caliper measurement, flow cytometry detection and/or animal live imaging detection.

Preferably, the detecting comprises assessing an individual's weight, fat mass, activation pathway, neuroprotective activity, or metabolic change, including a change in food consumption or water consumption.

Preferably, the tumor cells are derived from a human or non-human animal.

Preferably, the method of screening for modulators specific for human TL1A may be for therapeutic or non-therapeutic purposes. The method is used for screening or evaluating medicines, detecting and comparing the medicine effects of candidate medicines to determine which candidate medicines can be taken as medicines and which can not be taken as medicines, or comparing the medicine effect sensitivity degree of different medicines, namely that the treatment effect is not necessarily the same, but is only one possibility.

In a thirty-first aspect of the present invention, there is provided a method of screening a human drug, or a method of evaluating an intervention program, the method comprising administering a candidate drug to an individual after implantation of tumor cells, or applying an intervention program, and detecting and/or comparing the efficacy of the drug to the individual after administration of the candidate drug, or detecting and evaluating the tumor suppression effect; wherein the individual is selected from the non-human animals or their offspring, the non-human animals or their offspring obtained by the above construction method or the animal model.

Preferably, the intervention regimen is selected from the group consisting of CAR-T, drug therapy. Further preferably, the drug comprises a targeting drug, more preferably, the targeting drug is an antigen binding protein, and the antigen binding protein is an antibody.

Preferably, the tumor cells are derived from a human or non-human animal.

Preferably, the candidate drug is a monoclonal antibody or a bispecific antibody or a combination of two or more drugs.

Preferably, the screening method of the human drug may be for therapeutic or non-therapeutic purposes. The method is used for screening or evaluating medicines, detecting and comparing the medicine effects of candidate medicines to determine which candidate medicines can be taken as medicines and which can not be taken as medicines, or comparing the medicine effect sensitivity degree of different medicines, namely that the treatment effect is not necessarily the same, but is only one possibility. Likewise, the method of evaluation of an intervention program may also be for therapeutic or non-therapeutic purposes, which is simply the detection and evaluation of an intervention program to determine whether the intervention program has a therapeutic effect, i.e. the therapeutic effect is not necessarily the only possibility.

In a thirty-first aspect of the present invention, there is provided the use of a non-human animal or progeny thereof derived from the above described non-human animal or progeny thereof obtained by the above described construction method or an animal model as described above for the preparation of a human TL1A specific modulator.

In a thirty-second aspect, the present invention provides a use of a non-human animal or its progeny derived from the above, a non-human animal or its progeny obtained by the above construction method, or the above animal model in the manufacture of a medicament for treating a tumor or an inflammation.

"inflammation" as used herein includes acute inflammation as well as chronic inflammation. In particular, including but not limited to, allergic inflammation, exudative inflammation (serositis, cellulitis, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, specific inflammation (tuberculosis, syphilis, jatropha, lymphogranuloma, etc.), preferably, the inflammation includes inflammatory bowel diseases, preferably, the inflammatory bowel diseases include colitis (e.g., ulcerative colitis), crohn's disease, etc.

The "tumor" as described herein includes, but is not limited to, lymphoma, non-small cell lung cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, renal cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein the leukemia is selected from acute lymphoblastic (lymphoblastic) leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia; the lymphoma is selected from hodgkin's lymphoma and non-hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and waldenstrom's macroglobulinemia; the sarcoma is selected from osteosarcoma, ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma.

The TL1A gene humanized non-human animal can normally express human or humanized TL1A protein in vivo, can be used for drug screening aiming at a target site of human TL1A, drug effect evaluation or inflammation or tumor treatment, can accelerate the research and development process of new drugs, saves time and cost, and provides effective guarantee for researching TL1A protein functions and screening related diseases.

The invention relates to all or part of the whole, the whole is the whole, the part is the part of the whole or the whole individual.

The "humanized TL1A proteins" described herein comprise portions derived from human TL1A proteins and portions from non-human animals. For example, the "human TL1A protein" is identical to all of the human TL1A proteins, i.e. its amino acid sequence corresponds to the full-length amino acid sequence of the human TL1A protein. The "portion of human TL1A protein" is a contiguous or spaced 5-251 amino acid sequence which corresponds to the amino acid sequence of human TL1A protein, preferably a contiguous or spaced 10-195 or 10-191, such as contiguous 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 191, 192, 193, 194, 195, 200, 210, 220, 230, 240, 250 or 251 amino acid sequence which corresponds to the amino acid sequence of human TL1A protein. The "portion of the non-human animal" is preferably a portion of the TL1A protein endogenous to the non-human animal.

The "part of the TL1A protein endogenous to the non-human animal" according to the present invention is a sequence of 1 to 252 amino acids or a sequence of 1 to 60 amino acids or a sequence of 1 to 65 amino acids or a sequence of 1 to 60 amino acids or a sequence of 1 to 252 amino acids or a sequence of 1 to 60 amino acids endogenous to the non-human animal, such as 1, 5, 10, 20, 30, 40, 50, 60, 65, 70, 74, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250 or 252 amino acids or a sequence of 1A protein of the non-human animal.

The "humanized TL1A gene" of the invention includes a portion derived from a human TL1A gene and a portion of a non-human animal, for example, the "human TL1A gene" is identical to the whole human TL1A gene, i.e., its nucleotide sequence is identical to the full-length nucleotide sequence of the human TL1A gene. The "part of the human TL1A gene" is a continuous or intermittent 20-21405bp nucleotide sequence which is consistent with the nucleotide sequence of the human TL1A gene, preferably 50-15378bp or 50-6583bp or 50-573bp, such as 20, 50, 100, 200, 300, 400, 500, 550, 573, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 6500, 6583, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 15378, 16000, 17000, 18000, 19000, 20000, 21000 or 21405bp nucleotide sequence which is consistent with the nucleotide sequence of the human TL1A gene. The term "portion of a non-human animal" includes a portion of the non-human animal's endogenous TL1A gene.

The "portion of the non-human animal endogenous TL1A gene" according to the present invention comprises a portion of the non-human animal endogenous TL1A gene exon 1 and/or a portion of the exon 4, preferably the portion of the non-human animal endogenous TL1A gene exon 1 comprises at least 5-251bp, preferably 20-224bp, e.g. consecutive 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 224, 230, 240, 250 or 251bp, which corresponds to the non-human animal endogenous TL1A gene exon 1. Preferably, the portion of exon 4 of the endogenous TL1A gene of the non-human animal comprises at least the nucleotide sequence of the non-coding region.

The "locus" as used herein refers broadly to the location of a gene on a chromosome, and in a narrow sense to a DNA fragment on a gene, either a gene or a portion of a gene. For example, the "TL1A locus" refers to a DNA fragment of an optional stretch on exons 1 to 4 of the TL1A gene. In one embodiment of the invention, the replaced non-human animal endogenous TL1A locus may be a DNA fragment of the non-human animal endogenous TL1A gene, optionally one of exons 1 to 4.

"part of an exon" as used herein means that consecutive or spaced several, tens or hundreds of nucleotide sequences are identical to all exon nucleotide sequences, e.g. part of exon 1 of the human TL1A gene, comprising consecutive or spaced 5-237 bp, preferably 5-30bp, e.g. 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 237bp nucleotide sequences are identical to exon 1 of the human TL1A gene.

"xx to xxx exons" or "all of xx to xxx exons" as described herein include exons and nucleotide sequences of introns between exons, e.g., "all of exons 2 to 3" includes all of the nucleotide sequences of exons 2, introns 2-3 and exons 3.

The "x-xx intron" as used herein means an intron between the x-exon and the xx exon, for example, "1-2 intron" means an intron between the 1-exon and the 2-exon.

The "two or more" as used herein includes, but is not limited to, two, three, four, five, six, seven or eight or more, etc.

"treatment" as used herein means slowing, interrupting, arresting, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease, but does not necessarily refer to the complete elimination of all disease-related signs, symptoms, conditions, or disorders, and refers to therapeutic intervention to ameliorate the signs, symptoms, etc. of a disease or pathological condition after the disease has begun to develop.

The "cells" described herein may be fertilized egg cells or somatic cells, which preferably include, but are not limited to, umbilical vein endothelial cells (HUVECs), monocytes, macrophages, dendritic Cells (DCs), T cells, chondrocytes, synovial fibroblasts, and the like. Thus, depending on the source of the cell, a portion of the cell described herein may develop into an individual animal and a portion may not develop into an individual animal.

The terms "comprises" and "comprising" as used herein are intended to be inclusive and open-ended as described above, and to exclude the presence of any other specified elements or steps. However, when used to describe a sequence of a protein or nucleic acid, the protein or nucleic acid may consist of the sequence or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, yet still have the activity described herein.

"homology" as used herein means that a person skilled in the art, while using an amino acid sequence or a nucleotide sequence, can adjust the sequence according to actual working needs on the premise of ensuring a structure or function similar to that of a known sequence, and the sequence used has (including but not limited to) 1%,2%,3%,4%,5%,6%,7%,8%,9%,10%,11%,12%,13%,14%,15%,16%,17%,18%,19%,20%,21%,22%,23%,24%,25%,26%,27%,28%,29%,30%,31%,32%,33%,34%,35%,36%,37%,38%,39%,40%,41%,42%,43%,44%,45%,46%,47%,48%,49%,50%,51%,52%,53%,54%,55%,56%,57%,58%,59%,60%,70%,80%,81%,82%,83%,84%,85%,86%,87%,88%,89%,90%,91%,92%,93%,94%, 96%,97%, 99.99.99.99%, 99.99.99% and 99.99% as compared with the sequence obtained in the prior art.

One skilled in the art can determine and compare sequence elements or degrees of identity to distinguish additional mouse and human sequences.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following documents. For example: molecular Cloning A Laboratory Manual,2ndEd., ed. By Sambrook, fritschechnandManiatis (Cold Spring Harbor Laboratory Press:1989); DNA Cloning, volumes I and II (D.N.Glcovered., 1985); oligonucleotide Synthesis (m.j. Gaited., 1984); mullisial U.S. Pat. No.4,683,195; nucleic Acid Hybridization (B.D.Hames & S.J.Higginseds.1984); transcription And Translation (B.D.Hames & S.J.Higginseds.1984); culture Of Animal Cells (R.I.Freshney, alanR.Liss, inc., 1987); immobilized Cells And Enzymes (IRL Press, 1986); perbal, A Practical Guide To Molecular Cloning (1984); the services, methods In ENZYMOLOGY (j. Abelson and m.simon, eds. -in-coef, academic Press, inc., new York), special, vol.154 and 155 (wuetal. Eds.) and vol.185, "Gene Expression Technology" (d.goeddel, ed.); gene Transfer Vectors For Mammalian Cells (j.h.miller and M.P.Caloseds.,1987,Cold Spring Harbor Laboratory); immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., academic Press, london, 1987); handbook Of Experimental Immunology, volumes V (d.m. weir and c.c. blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, cold Spring Harbor, n.y., 1986).

In one aspect, the non-human animal is a mammal. Preferably, the non-human animal is a small mammal, e.g. a murine. In one embodiment, the non-human animal is a rodent. In one embodiment, the rodent is selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from a murine family. In one embodiment, the genetically modified animal is from a family selected from the group consisting of the hamsidae (e.g., hamster-like), hamsidae (e.g., hamster, new world rats and mice, voles), murine superfamily (true mice and rats, gerbils, spiny rats, coronary rats), equine island murine (mountain climbing mice, rock mice, tailed rats, motor gas rats and mice), spiny murine (e.g., spiny sleeping rats) and mole murine (e.g., mole rats, bamboo rats and zokors). In a particular embodiment, the genetically modified rodent is selected from the group consisting of a true mouse or rat (murine superfamily), a gerbil, a spiny mouse, and a coronary rat. In one embodiment, the genetically modified mouse is from a member of the murine family. In one embodiment, the animal is a rodent. In a particular embodiment, the rodent is selected from a mouse and a rat. In one embodiment, the non-human animal is a mouse.

In a specific embodiment, the non-human animal is a rodent selected from the group consisting of BALB/C, A/He, A/J, A/WySN, AKR, AKR/A, AKR/J, AKR/N, TA1, TA2, RF, SWR, C3H, C BR, SJL, C57L, DBA/2, KM, NIH, ICR, CFW, FACA, C BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6J, C BL/6ByJ, C57BL/6NJ, C57BL/10ScSn, C57BL/10Cr and C57BL/Ola, C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, mice of the CBA/H strain and NOD, NOD/SCID, NOD-Prkdc ^scid IL-2rg ^null Background smallnessAnd (3) mice.

The beneficial technical effects of the invention are as follows:

by using gene editing technology, the homologous genes of animal genome are replaced by human normal or mutant genes, and a gene humanized animal model which is closer to human physiological or disease characteristics is established, so that human protein is expressed in vivo, and the gene humanized animal model is used as a target point of a medicine which can only recognize human protein sequences, thereby providing possibility for screening anti-human antibodies and other medicines at animal level.

The pharmacological efficacy evaluation of the antihuman antibody medicine can be carried out by utilizing the gene humanized animal model to establish various disease models.

The foregoing is merely illustrative of some aspects of the present invention and is not, nor should it be construed as limiting the invention in any respect.

All patents and publications mentioned in this specification are incorporated herein by reference in their entirety. It will be appreciated by those skilled in the art that certain changes may be made thereto without departing from the spirit or scope of the invention. The following examples further illustrate the invention in detail and are not to be construed as limiting the scope of the invention or the particular methods described herein.

Drawings

Embodiments of the present invention are described in detail below with reference to the attached drawing figures, wherein:

fig. 1: schematic representation of the comparison of the mouse TL1A locus and the human TL1A locus (not to scale);

fig. 2: schematic representation of humanization of the mouse TL1A locus (not to scale);

fig. 3: TL1A gene targeting strategy and targeting vector V1 design schematic (not to scale);

fig. 4: TL1A gene humanized mouse FRT recombination process schematic (not to scale);

fig. 5: TL1A gene targeting strategy and targeting vector V2 design schematic (not to scale);

fig. 6: PCR detection result of F1 generation mouse, wherein WT is wild type contrast, M is Marker, H ₂ O is water control;

fig. 7: southern blot detection results of F1 mice, wherein WT is a wild-type control;

fig. 8: TL1A gene humanized homozygote mouse bone marrow dendritic cell soluble TL1A detection result, wherein +/+ is wild type mouse and H/H is TL1A gene humanized homozygote mouse.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

In each of the following examples, the devices and materials were obtained from several companies as indicated below:

c57BL/6 mice were purchased from national rodent laboratory animal seed center of China food and drug verification institute;

AseI, bamHI enzymes were purchased from NEB under the respective accession numbers: R0526S and R3136S;

purified anti-mouse CD16/32 anti-body is available from bioleged under the trade designation: 101302;

zombie NIR ™ Fixable Viability Kit was purchased from Biolegend under the trade designation: 423106;

BV480 Rat Anti-Mouse CD31 Anti-body was purchased from Biolegend under the trade designation: 565629;

TL1A Monoclonal Antibody (Tandys 1 a), perCP-eFluor 710, eBioscience ™, available from Invitrogen under the designation: 46-7911-82;

Polyclonal Rabbit anti-Human TNFSF15/TL1A/VEGI Antibody (PE, aa148-175, IF, WB) LS-C241951 available from LSBio under the designation: LS-C241951-200;

mouse IgG1 kappa Isotype Control (P3.6.2.8.1), perCP-eFluor 710, eBioscience ™ available from Invitrogen under the trade designation: 46-4714-80;

polyclonal Rabbit IgG Isotype Control Antibody (RPE) LS-C149377 available from LSBio under the designation: LS-C149377;

the Human TL1A/TNFSF15 DuoSet ELISA was purchased from R & D under the trade designation: DY1319-05.

EXAMPLE 1 TL1A Gene humanized mice

The alignment of the mouse TL1A Gene (NCBI Gene ID:326623,Primary source:MGI:2180140,UniProt ID:Q5UBV8 at positions 63642837 to 63663296 of chromosome 4 NC-000070.7 based on transcript NM-177371.4 and its encoded protein NP-796345.4 (SEQ ID NO: 1)) and the human TL1A Gene (NCBI Gene ID:9966,Primary source:HGNC: 11931,UniProt ID:O95150 at positions 114784635 to 114806039 of chromosome 9 NC-000009.12 based on transcript NM-005118.4 and its encoded protein NP-005109.2 (SEQ ID NO: 2)) is shown in FIG. 1.

For the purposes of the present invention, a nucleotide sequence encoding a human TL1A protein may be introduced at the endogenous TL1A locus of a mouse, such that the mouse expresses a human or humanized TL1A protein. Specifically, under the control of regulatory elements of the mouse TL1A gene, the humanized TL1A gene locus is obtained by replacing the partial sequence of mouse exon 1 to the partial sequence of exon 4 by about 15.4kb containing the partial sequence of exon 1 to the partial sequence of exon 4 with about 15.2kb containing the partial sequence of exon 1 to the partial sequence of exon 4 of the human TL1A gene by using the gene editing technology, and the schematic diagram of the humanized TL1A gene locus is shown in FIG. 2, thereby realizing the humanized modification of the mouse TL1A gene.

The targeting strategy shown in FIG. 3 was further designed according to FIG. 2, which shows that the V1 targeting vector contains homologous arm sequences upstream and downstream of the mouse TL1A gene, and an A fragment containing the human TL1A gene. Wherein the upstream 5 'homology arm sequence (SEQ ID NO: 3) is identical to the 63663073 to 63667349 nucleotide sequence of NCBI accession No. NC_000070.7 and the downstream 3' homology arm sequence (SEQ ID NO: 4) is identical to the 63643878 to 63647828 nucleotide sequence of NCBI accession No. NC_ 000070.7. The nucleotide sequence of the human TL1A fragment (SEQ ID NO: 7) is identical to the 114790455 to 114805832 nucleotide sequence of NCBI accession NC_ 000009.12; the ligation of the human TL1A fragment sequence upstream to the mouse was designed as: 5' -TCCCATCCTCGCAGGACTTAGCACCCTCCTAATGGCTGGCCAGCTCCGGGCCCAGGGAGAGGCCTGTGTGCAGTTCCAGGTAAGCCACATGGCACTCTGACCT-3' (SEQ ID NO: 10) in which the sequence "TCCGGThe last "G" of the "sequences" is the last nucleotide of the mouse "GCCCA"G" in "is the first nucleotide of a human sequence. The sequence downstream of the human TL1A fragment was designed to be linked to the mouse: 5' -ATCTCTTTGGTGGATTACACAAAAGAAGATAAAACCTTCTTTGGAGCCTTCTTACTATAAGGAGGAGAAAACCATCATTCCAAGGGGCTCCCCTGCCTCCTACTTTCCA-3' (SEQ ID NO: 11), wherein the sequence " TACTAThe last "A" of the "sequences" is the last nucleotide of a human "TAAGG"T" in "is the first nucleotide of the mouse sequence.

The targeting vector also comprises a resistance gene for positive clone screening, namely neomycin phosphotransferase coding sequence Neo, and two site-specific recombination systems Frt recombination sites which are arranged in the same direction are arranged on two sides of the resistance gene to form a Neo box (neocassette). Wherein the connection between the 5' end of the Neo box and the human gene is designed as follows: 5' -TCCATACTATCACCAGTTGGCCAACTTTCCAAGTCTAGTGCAGAAATCCAAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGGTCTGAAGAGGAG-3' (SEQ ID NO: 12) in which the sequence "TCCAAThe last "A" of the "sequences" is the last nucleotide of a human "GAAGTThe first "G" in "is the first nucleotide of the Neo cassette; the connection between the 3' end of Neo box and human gene is designed as follows: 5' -TTGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGGCACCTCACACCTAGAGTTCCTATACCTCTGAGACTCCAGAGGAAAGAACAAGACAGTGCAGAAG-3' (SEQ ID NO: 13) in which the sequence "ACTTCThe last "C" of the "is the last nucleotide of the Neo cassette, sequence"GGCACThe first "G" in "is the first nucleotide in humans. The mRNA sequence transcribed by the modified humanized TL1A gene is shown as SEQ ID NO:8, the amino acid sequence of the expressed humanized TL1A protein is shown as SEQ ID NO: shown at 9.

Targeting vector construction can be performed by conventional methods, such as enzyme digestion ligation, and the like. After the constructed targeting vector is subjected to primary verification through enzyme digestion, the targeting vector is sent to a sequencing company for sequencing verification. And (3) electroporation transfection of the targeting vector with correct sequencing verification into embryonic stem cells of a C57BL/6 mouse, and screening the obtained cells by using a positive clone screening marker gene to obtain correct positive clone cells. The correctly positive cloned cells (black mice) are introduced into the isolated blasts (white mice) according to the known technique in the art, and the obtained chimeric blasts are transferred to a culture solution for short culture and then transplanted into oviducts of recipient mice (white mice), so that F0 generation chimeric mice (black-white interphase) can be produced. And backcrossing the F0 generation chimeric mice and the wild mice to obtain F1 generation mice, and then mating the F1 generation heterozygous mice to obtain F2 generation homozygous mice. Positive mice and Flp tool mice can also be mated to remove positive clone screening marker genes (the process is schematically shown in figure 4), and then the humanized homozygous mice of the TL1A genes can be obtained through the mating.

In addition, gene editing can be performed by using a CRISPR/Cas9 system, a targeting strategy shown in figure 5 is further designed, homologous arm sequences on the targeting vector V2, which are upstream and downstream of the mouse TL1A gene, and a human TL1A fragment are shown, and a schematic diagram of the humanized TL1A locus after construction is shown in figure 2. Wherein the upstream 5 'homology arm sequence (SEQ ID NO: 5) is identical to nucleotide sequence 63663073 to 63664140 of NCBI accession No. NC_000070.7 and the downstream 3' homology arm sequence (SEQ ID NO: 6) is identical to nucleotide sequence 63645928 to 63647828 of NCBI accession No. NC_ 000070.7. The nucleotide sequence of the human TL1A fragment (SEQ ID NO: 7) is identical to the 114790455 to 114805832 nucleotide sequence of NCBI accession NC_ 000009.12. The mRNA sequence transcribed by the modified humanized TL1A gene is shown as SEQ ID NO:8, the amino acid sequence of the expressed humanized TL1A protein is shown as SEQ ID NO: shown at 9.

The targeting vector construction can be carried out by conventional methods, such as enzyme digestion, ligation, direct synthesis and the like. After the constructed targeting vector is subjected to primary verification through enzyme digestion, the targeting vector is sent to a sequencing company for sequencing verification. The targeting vector with correct sequencing verification was used for subsequent experiments.

The target sequence determines the targeting specificity of the sgrnas and the efficiency of inducing Cas9 cleavage of the gene of interest. Therefore, efficient and specific target sequence selection and design are a prerequisite for construction of sgRNA expression vectors. The sgrnas sequence that recognizes the target site were designed and synthesized, and the target sequence of an exemplary sgRNA on the TL1A gene is as follows:

sgRNA1 target site (SEQ ID NO: 14): 5'-ACAAAGCAAATACAGACCGGGGG-3';

sgRNA2 target site (SEQ ID NO: 15): 5'-AGCCTGCCCGCCTACTAACAGGG-3';

the UCA kit is used for detecting the activity of sgRNA, after determining that the efficiency of high-efficiency cleavage can be mediated, enzyme cleavage sites are respectively added on the 5' end and the complementary strand of the sgRNA to obtain forward oligonucleotide and reverse oligonucleotide sequences as shown in table 1, annealing products are connected to pT7-sgRNA plasmid (the plasmid is linearized by BbsI first), and expression vectors pT7-TL1A-1 and pT7-TL1A-2 are obtained.

TABLE 1 sgRNA1 and sgRNA2 sequence Listing

pT7-sgRNA vector A fragment DNA (SEQ ID NO: 24) containing the T7 promoter and sgRNA scaffold was synthesized by plasmid synthesis company and ligated to a backbone vector (source Takara, cat. No. 3299) by cleavage (EcoRI and BamHI) in sequence, and the results were verified by sequencing by a professional sequencing company, and the result showed that the objective plasmid was obtained. The mouse prokaryotic fertilized eggs, such as C57BL/6 mice, are taken, and the in vitro transcription products of pT7-TL1A-1 and pT7-TL1A-2 plasmids (transcribed by using an Ambion in vitro transcription kit according to the specification method), a targeting vector and Cas9 mRNA are premixed by a microinjection instrument and injected into the cytoplasm or nucleus of the mouse fertilized eggs. Microinjection of fertilized eggs was performed according to the method of the "mouse embryo handling laboratory Manual (third edition)" (andelas, nagel, chemical industry Press, 2006), the fertilized eggs after injection were transferred into a culture medium for short-term culture, then transplanted into oviducts of recipient mice for development, and the obtained mice (F0 generation) were subjected to hybridization and selfing to expand population numbers and establish stable TL1A gene humanized mouse strains.

TABLE 2 F1 Generation genotyping PCR detection primer sequences and recombinant fragment sizes

The PCR technique can be used to screen F1 positive mice, and the primers shown in Table 2 can be used to detect, and exemplary results are shown in FIG. 6, with 4 mice numbered F1-01 to F1-04 being positive mice. The humanized TL1A gene mice identified as positive for F1 were subjected to Southern blot detection (digestion of cellular DNA with AseI or BamHI, respectively, and hybridization using 2 probes, probe and fragment lengths of interest shown in Table 3) to confirm the presence of random insertions. Exemplary results are shown in FIG. 7, where 3 mice numbered F1-01 to F1-03 were randomly inserted in combination with PCR and sequencing results. This shows that the method can be used for constructing the TL1A gene humanized mice which can be stably passaged and have no random insertion.

TABLE 3 lengths of specific probes and fragments of interest

5’ Probe-F（SEQ ID NO：29）：5’-CATAATTCAAATGCCCTTCAGTGGG-3’，

5’Probe-R（SEQ ID NO：30）：5’-CTGACTTGGCTTGGCTCTTTCTGTC-3’；

A Probe -F（SEQ ID NO：31）：5’-TTCAGCTCTGTCAATATCAAGG-3’，

A Probe -R（SEQ ID NO：32）：5’-GGCCAACAGCTTGCACAACAGC-3’；

The expression of mRNA in a TL1A gene humanized mouse can be detected by RT-PCR, specifically, 1 female C57BL/6 mice (+/+) of 7 weeks old and 7 female TL1A gene humanized homozygotes (H/H) prepared by the implementation are respectively selected, lung tissues are taken after neck-removing euthanasia, RT-PCR detection is carried out by using a primer sequence shown in the following table 4, and the detection result shows that only mouse TL1A mRNA is detected in a wild C57BL/6 mouse and human TL1A mRNA is not detected; only human TL1A mRNA was detected in mice homozygous for the TL1A gene humanized.

TABLE 4 RT PCR primer sequences and fragment sizes of interest

The expression of the humanized TL1A protein (chiTL 1A) in mice was confirmed by flow cytometry. Specifically, 1 male wild type C57BL/6 mice (+/+) at 7 weeks of age and humanized homozygous mice (H/H) for the male TL1A gene at 7 weeks of age were selected, and lung tissue was harvested after cervical euthanasia. Detection was performed using Purified Anti-Mouse CD16/32 Anti-body, zombie NIR ™ Fixable Viability Kit, BV480 Rat Anti-Mouse CD31 Anti-body, mouse IgG1 kappa Isotype Control (P3.6.2.8.1), perCP-eFluor 710, eBioscience ™, polyclonal Rabbit IgG Isotype Control Antibody (RPE) and Human murine cross Antibody Polyclonal Rabbit Anti-Human TNFSF15/TL1A/VEGI Anti-body (PE, aa148-175, IF, WB) LS-C241951 and TL1A Monoclonal Antibody (Tandys 1A), perCP-eFluor 710, eBioscience ™, confirming that TL1A protein expression was detected in both C57BL/6 mice and TL1A gene humanized homozygous mice (results not shown). By combining the RT-PCR results, the humanized homozygous mice of the TL1A gene after transformation can normally express the humanized TL1A protein.

In addition, to further determine the expression of soluble TL1A in mice homozygous for the humanized TL1A gene. 3 mice (+/+) of 6-week-old male wild type C57BL/6 mice and 6-week-old male TL1A gene humanized homozygous mice (H/H), respectively, were selected, bone marrow was taken, bone marrow-derived dendritic cells were isolated, LPS was added at 1. Mu.g/mL to stimulate for 24 hours, and supernatants were collected and levels of soluble TL1A were detected using a specific Human TL1A ELISA kit, human TL1A/TNFSF15 DuoSet ELISA. The detection result (see FIG. 8) shows that the soluble human TL1A is only detected in the TL1A gene humanized homozygous mice, and the modified TL1A gene humanized homozygous mice are proved to function normally in vivo.

Example 2 efficacy model

TL1A humanized mice made using the method described in example 1 can be used to evaluate the efficacy of modulators targeting human TL 1A. For example, TL1A humanized homozygous mice were randomly divided into a blank group, a control group, or a treatment group, 100ml of 2% -3% dextran sulfate (DSS) was administered to the control group and the treatment group for colitis modeling, and an equal volume of drinking water was administered to the blank group. After successful modeling, the treatment group randomly selected the drug targeting human TL1A, and the control group injected an equal volume of physiological saline. The body weight and the stool hardness of the mice are measured regularly, and the in-vivo safety and in-vivo efficacy of the compounds can be effectively evaluated by comparing the body weight, the stool hardness, the stool blood condition and the colon HE pathological score of the mice.

EXAMPLE 3 preparation of double-or Multi-Gene humanized mice

The TL1A gene humanized mice prepared by the method can also be used for preparing a multi-humanized mouse model. For example, in example 1, embryonic stem cells used for microinjection may be selected from mice containing IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3, LAG3 and other genetic modifications, or alternatively, based on humanized TL1A mice, a double-or multiple-humanized mouse model may be obtained by using isolated mouse ES embryonic stem cells and genetic recombination targeting techniques. The method can also be used for obtaining the homozygote or the heterozygote of the TL1A mouse and other genetically modified mice, screening offspring thereof, obtaining the humanized TL1A gene and other genetically modified polygenic mice with a certain probability according to the Mendelian genetic rule, and then mutually mating the heterozygotes to obtain the polygenic or polygenic modified homozygote.

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details of the above embodiments, and various simple modifications can be made to the technical solution of the present invention within the scope of the technical concept of the present invention, and all the simple modifications belong to the protection scope of the present invention.

In addition, the specific features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations are not described further.

Moreover, any combination of the various embodiments of the invention can be made without departing from the spirit of the invention, which should also be considered as disclosed herein.

Claims

1. The method for constructing the humanized non-human animal model of the TL1A gene is characterized in that humanized TL1A protein is expressed in the non-human animal model, and/or the genome of the non-human animal model contains the humanized TL1A gene; the humanized TL1A gene encodes the humanized TL1A protein;

the humanized TL1A protein comprises a part of an extracellular region of a human TL1A protein and a part of a non-human animal endogenous TL1A protein, and/or the humanized TL1A gene comprises a part of a human TL1A gene and a part of a non-human animal endogenous TL1A gene;

The construction method comprises the steps of introducing partial nucleotide sequences of extracellular regions of the human TL1A protein in the human TL1A gene into endogenous TL1A gene loci of non-human animals;

the amino acid sequence of the humanized TL1A protein is shown in SEQ ID NO: shown as 9;

the non-human animal model is a mouse;

the non-human animal model has reduced or absent expression of endogenous TL1A proteins.

2. The method according to claim 1, wherein the portion of the introduced human TL1A gene comprises a portion of exon 1, all of exons 2 to 3 and a portion of exon 4 of the human TL1A gene, wherein the portion of exon 1 of the human TL1A gene comprises at least exon 1 of the human TL1A gene of 5bp and the portion of exon 4 of the human TL1A gene comprises at least exon 4 of the human TL1A gene of 50 bp.

3. The method of construction according to claim 1, wherein the portion of the introduced human TL1A gene comprises the amino acid sequence of SEQ ID NO: 7.

4. The method of claim 1, wherein said introducing comprises inserting or replacing.

5. The method according to claim 1, further comprising mating the TL1A humanized non-human animal model with other genetically modified non-human animal models, in vitro fertilization, or direct gene editing, and screening to obtain a polygenic modified non-human animal model;

Wherein the other genes comprise at least one of IL23A, IL12B, TNFA, TNFR1, TNFR2, PD-1, PD-L1, CTLA4, 4-1BB, CD3 or LAG 3.

6. The method of claim 1, wherein the method of constructing comprises constructing a non-human animal model humanized for TL1A gene using a targeting vector.

7. The method of claim 6, wherein the targeting vector further comprises a 5 'arm and/or a 3' arm;

wherein the 5' arm comprises the amino acid sequence as set forth in SEQ ID NO:3 or 5, and a nucleotide sequence as set forth in seq id no;

the 3' arm comprises the amino acid sequence as shown in SEQ ID NO:4 or 6.

8. The method of claim 1, wherein the mRNA transcribed from the humanized TL1A gene is as set forth in SEQ ID NO: shown at 8.

9. A humanized TL1A protein, wherein said humanized TL1A protein comprises a portion of an extracellular domain of a human TL1A protein and a portion of a TL1A protein endogenous to a non-human animal;

the non-human animal is a mouse.

10. A humanized TL1A gene, wherein said humanized TL1A gene encodes a humanized TL1A protein of claim 9.

11. The humanized TL1A gene of claim 10, wherein the mRNA transcribed from said humanized TL1A gene is as set forth in SEQ ID NO: shown at 8.

12. A cell, tissue or organ expressing the humanized TL1A protein of claim 9 or comprising the humanized TL1A gene of claim 10 or 11 in its genome or derived from a non-human animal model obtained by the construction method of any one of claims 1 to 8;

the cells are unable to develop into animal individuals.

13. Use of a non-human animal model obtained by the construction method according to any one of claims 1-8, characterized in that the use comprises:

a) Use in the development of products involving the immune process of human cells;

b) As model systems for pharmacological, immunological, microbiological and medical research applications;

c) Relates to the etiology research of producing and utilizing animal experimental disease models, and the application is for the diagnosis and treatment of non-diseases.