CN117379540A

CN117379540A - Application of Yersinia pestis EV 76-delta sORF17 in preparation of pestis vaccine

Info

Publication number: CN117379540A
Application number: CN202210808482.8A
Authority: CN
Inventors: 杜宗敏; 郭晓; 杨瑞馥; 曹诗洋; 颜焱峰
Original assignee: Academy of Military Medical Sciences AMMS of PLA
Current assignee: Academy of Military Medical Sciences AMMS of PLA
Priority date: 2022-07-11
Filing date: 2022-07-11
Publication date: 2024-01-12

Abstract

The invention discloses an application of Yersinia pestis EV 76-delta sORF17 in preparation of a plague vaccine. The Yersinia pestis EV 76-delta sORF17 is an sORF17 protein or EV76 strain with a coding gene function deletion. The invention also discloses a product for preventing and/or treating plague, and the active ingredient of the product is sORF17 protein or EV76 strain with encoding gene function deletion. Compared with the EV76 vaccine strain, the yersinia pestis EV 76-delta sORF17 obtained by knocking out the sORF17 gene in the EV76 vaccine strain has lower toxicity and higher safety, can stimulate organisms to generate stronger humoral immunity, has no obvious difference with the protection rate of the EV76 vaccine strain after toxicity attack, and has good application prospect.

Description

Application of Yersinia pestis EV 76-delta sORF17 in preparation of pestis vaccine

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of yersinia pestis EV 76-delta sORF17 in preparation of a plague vaccine.

Background

Plague is a natural epidemic zoonotic disease caused by Yersinia pestis, the main host is rodents, the plague can be transmitted to people through fleas, and can be transmitted among people through aerosol routes, and the plague has strong infectivity and extremely high death rate, and is one of the most threatening biological warfare agents and bioterrorism agents.

Vaccination is the most effective and economical method for preventing plague, wherein, the live attenuated plague vaccine has been used for over 70 years, and has a certain protection. EV76 vaccine strain is used in high risk group in some countries and regions, is attenuated strain based on pgm locus deletion on chromosome, can induce humoral immunity and cellular immune response of organism, and can protect plague and pulmonary plague.

However, pestis EV76 attenuated live vaccines can cause varying degrees of side effects. In addition, there are other individual reports that infection with attenuated strain lacking pgm locus resulted in death of the experimenter. Therefore, the preparation of the pestis attenuated live vaccine with better safety is very necessary.

Disclosure of Invention

The technical problem to be solved by the invention is how to reduce the toxicity of the EV76 vaccine strain so as to improve the safety of the EV76 vaccine strain.

In order to solve the technical problems, the invention firstly provides a product for preventing and/or treating plague.

The active ingredient of the product for preventing and/or treating plague provided by the invention is sORF17 protein or EV76 strain with encoding gene function deletion.

In order to solve the technical problems, the invention also provides a recombinant yersinia pestis.

The recombinant Yersinia pestis provided by the invention is an EV76 strain with sORF17 protein or encoding gene function deletion.

In the above-mentioned product or recombinant Yersinia pestis, the sORF17 protein may be a protein as shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;

a2 A protein with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1;

a3 A protein having 90% identity and the same function as the amino acid sequence shown in sequence 1.

The protein according to a 2) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

In the protein described in the above a 3), the "identity" includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in the sequence 1 of the present invention.

The protein of a 1), a 2) or a 3) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.

In the above-mentioned product or recombinant Yersinia pestis, the sORF17 protein-encoding gene may be a gene as shown in b 1) or b 2) or b 3) as follows:

b1 A DNA molecule represented by SEQ ID No. 2;

b2 A DNA molecule which has 75% or more identity to the nucleotide sequence defined in b 1) and which encodes a sORF17 protein;

b3 A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b 1) or b 2) and which codes for the sORF17 protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 1 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

The stringent conditions are hybridization in a solution of 2 XSSC, 0.1% SDS at 68℃and washing the membrane 2 times for 5min each; alternatively, hybridization and washing the membrane in 0.5 XSSC, 0.1% SDS solution at 68℃for 15min each; alternatively, hybridization and washing of the membrane were performed at 65℃in a solution of 0.1 XSSPE (or 0.1 XSSC) and 0.1% SDS.

In the above-mentioned product or recombinant Yersinia pestis, the method of deleting the sORF17 protein or the coding gene thereof in the EV76 strain may be to inhibit the activity of the sORF17 protein in the EV76 strain or to inhibit the expression of the sORF17 protein-coding gene in the EV76 strain or to knock out the sORF17 protein-coding gene in the EV76 strain.

Further, the method for knocking out the sORF17 protein encoding gene in the EV76 strain is to introduce a substance for knocking out the sORF17 protein encoding gene into the EV76 strain.

Furthermore, the substance for knocking out the sORF17 protein encoding gene is a substance for knocking out the sORF17 gene by utilizing a lambda-Red recombination technology.

In a specific embodiment of the invention, the substance for knocking out the sORF17 gene by utilizing the lambda-Red recombination technology is a DNA molecule shown in a sequence 3 in a sequence table.

In order to solve the technical problems, the invention also provides a new application of the recombinant yersinia pestis.

The invention provides application of the recombinant yersinia pestis in preparing products for preventing and/or treating plague.

In order to solve the technical problems, the invention also provides a novel application of sORF17 protein or related biological materials.

The invention provides an application of sORF17 protein or related biological material thereof in regulating and controlling the toxicity of EV76 strain.

The biological material is a nucleic acid molecule encoding sORF17 protein, or an expression cassette, a recombinant vector and a recombinant microorganism containing the nucleic acid molecule. The nucleic acid molecule encoding sORF17 protein is a DNA molecule shown in a sequence 2.

In order to solve the technical problems, the invention also provides a novel application of the sORF17 protein or the substance with the coding gene function deleted.

The present invention provides the use of a sORF17 protein or a substance encoding a deletion of the function of the gene in any one of the following c 1) -c 3):

c1 Reduced EV76 strain virulence;

c2 Preparing sORF17 gene knockout strain;

c3 Preparing a product for preventing and/or treating plague.

In the above application, the substance that causes deletion of the function of the sORF17 protein or the gene encoding the same may be a substance that inhibits the activity of the sORF17 protein in the EV76 strain or a substance that inhibits the expression of the gene encoding the sORF17 protein in the EV76 strain or a substance that knocks out the gene encoding the sORF17 protein in the EV76 strain.

Further, the substance inhibiting the activity of sORF17 protein may be a substance which can realize the inactivation of sORF17 protein in EV76 strain in any manner, such as a protein, polypeptide or small molecule compound which inhibits the synthesis of sORF17 protein or promotes the degradation of sORF17 protein or inhibits the function of sORF17 protein. The small molecule compound may specifically be an inhibitor of sORF17 protein activity.

The substance that inhibits expression of the sORF17 protein-encoding gene may be a substance that does not allow expression of the sORF17 gene in the EV76 strain in any manner, specifically by removing or altering regulatory components (such as promoter editing) so that the sORF17 gene sequence is not transcribed, preventing translation by binding to mRNA, or the like. Further, the substance that inhibits expression of the sORF17 protein-encoding gene may be a silencing sORF17 gene or miRNA, siRNA, dsRNA or shRNA that interferes with expression of the sORF17 gene.

The substance for knocking out the sORF17 protein encoding gene may be a substance which does not produce a functional protein product of the sORF17 gene by the EV76 strain in any way, specifically by removing all or part of the sORF17 gene sequence, introducing deletion mutations and/or insertion mutations and/or base substitutions in the sORF17 gene, and the like. Typically, the knockout is performed at the genomic DNA level such that the progeny of the cell also permanently carry the knockout. Further, the substance for knocking out the sORF17 protein encoding gene may be a substance for knocking out the sORF17 gene by using lambda-Red recombination technology. Furthermore, the substances for knocking out sORF17 genes by utilizing the lambda-Red recombination technology are DNA molecules shown in a sequence 3 in a sequence table.

In any of the above products or applications, the product is a vaccine.

In order to solve the technical problems, the invention finally provides a method for reducing the toxicity of the EV76 strain.

The method for reducing the toxicity of the EV76 strain provided by the invention comprises the following steps: deleting the sORF17 protein or the coding gene function of the EV76 strain to obtain recombinant Yersinia pestis; the virulence of the recombinant yersinia pestis strain is lower than the EV76 strain.

In the above method, the method of deleting the function of the sORF17 protein or encoding gene thereof in the EV76 strain may be to inhibit the activity of the sORF17 protein in the EV76 strain or to inhibit the expression of the sORF17 protein encoding gene in the EV76 strain or to knock out the sORF17 protein encoding gene in the EV76 strain.

The toxicity of the recombinant Yersinia pestis is lower than that of the EV76 strain, and the survival rate of mice infected with the recombinant Yersinia pestis is higher than that of mice infected with the EV76 strain.

The invention provides a sORF17 gene knockout strain (EV 76 delta sORF 17), which is a strain obtained by knocking out the sORF17 gene in an EV76 vaccine strain. Compared with EV76 vaccine strain, the sORF17 gene knockout strain (EV 76 delta sORF 17) constructed by the invention has reduced toxicity, can stimulate organisms to generate stronger humoral immunity, has no obvious difference with the protection rate of EV76 vaccine strain after toxicity attack, has better safety and has good application prospect.

Drawings

FIG. 1 shows the PCR identification results of sORF17 gene knockout strain.

FIG. 2 shows survival curves of mice infected by the subcutaneous route of EV76 vaccine strain and EV76 ΔsORF17 strain.

FIG. 3 shows survival curves of 201 strains after immunization for nasal drip and challenge.

FIG. 4 shows the survival curve of 201 strains under the skin at 42 days after immunization.

FIG. 5 shows the survival curve of 201-lux strain nasal drip challenge at day 132 post immunization.

FIG. 6 shows the survival curve of 201-lux strain under skin challenge 132 days after immunization.

FIG. 7 shows the results of in vivo imaging of mice 12 days after nasal challenge with 201-lux strain.

FIG. 8 shows the results of in vivo imaging of mice 12 days after subcutaneous challenge with the 201-lux strain.

FIG. 9 shows the titers of different immune groups F1-IgG antibody (A) and LcrV-IgG antibody (B) 40 days after priming.

FIG. 10 shows the IgG subtype of specific anti-pestis F1 antibody 40 days after priming.

FIG. 11 shows the time course of the F1-IgG antibody.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The EV76 vaccine strain in the following examples is described in the literature "comparative genomics study of Yersinia pestis live vaccine strain, zhou Dongsheng et al, J.Legionella journal of medicine, vol.4, vol.29, no. 29, no. 4, med J Chin PLA April,2004, vol.29, no. 4, 310-314" (corresponding to strain EV76 in the literature).

The strain 201 of pestis in the following examples is described in the literature "Yersinia pestis biovar Microtus strain 201,an avirulent strain to humans,provides protection against bubonic plague in rhesus macaques,Qingwen Zhang,Qiong Wang,Guang Tian,et al[J ]. Hum Vaccin Immunother,2014,10 (2): 368-77" (corresponding to strain Yersinia pestis biovar Microtus strain 201 in the literature).

The strain of Yersinia pestis 201-lux in the examples below is described in the literature "construction of Yersinia pestis bioluminescence plasmid deletion strain and in vivo imaging studies of infected mice, zhou Jiyuan, shuoshi paper, 2014" (corresponding to strain 201-lux in the literature).

The pKD4 plasmid in the examples described below is described in the literature "One-step inactivation of chromosomal genes in Escherichia coli K-12using PCR products,Kirill A.Datsenko and Barry L.Wanner,Proc Natl Acad Sci U S A,2000, 97 (12), 6640-5".

The pKD46 plasmid in the examples described below is described in "Yersinia pestis type III secretory system effector protein Yopk in the pathogenesis, tan Yafang, doctor's treatise, 2011".

Animals in the following examples: SPF-grade BALB/c female mice of 6-8 weeks old are products of Beijing Vitre Lihua laboratory animal technologies Co.

The HRP-labeled goat anti-mouse IgG antibody in the examples below is a product of ThermoFisher corporation.

EXAMPLE 1 construction and identification of sORF17 Gene knockout Strain EV76- ΔsORF17

1. Construction of sORF17 Gene knockout Strain EV76- ΔsORF17

And (3) knocking out sORF17 genes in the EV76 vaccine strain by using a lambda-Red one-step mutation method, and constructing a sORF17 gene knocked-out strain. The method comprises the following specific steps:

1. and (3) taking the pKD4 plasmid as a template, carrying out PCR amplification by adopting a homologous region mutation cassette primer sORF17-P1/P2 to obtain a PCR product (a kana resistance mutation cassette amplification product, the nucleotide sequence of which is shown as a sequence 3 in a sequence table), and recovering the PCR product. The PCR amplification primer sequences were as follows:

sORF17-P1：TCAGAAAATAGACAGTGTTGACACGCGCTCACACTATACCTATCATAATGATGTGTAG GCTGGAGCTGCTTC；

sORF17-P2：CTGGTTTTTGATGCGACCACACTGGTCGACCGCTTGCCTGATTTGCGTGGCATGGTGCTCCGGCATATGAATATCCTCCTTA。

the PCR amplification procedure was as follows: pre-denaturation 94 ℃/5min; denaturation 94 ℃/40s; annealing for 54 ℃/40s; extending for 72 ℃/2min for 30s; and then extending for 72 ℃/5min.

2. The pKD46 plasmid is electrotransferred into a plague EV76 vaccine strain to obtain the EV76 vaccine strain containing the pKD46 plasmid. The EV76 vaccine strain containing the pKD46 plasmid is subjected to L-arabinose induction expression of recombinant protein, and competent cells are prepared. After the EV76 vaccine strain containing the pKD46 plasmid is induced by L-arabinose, the recombinant protein of lambda phage is expressed, and host bacteria have the capacity of homologous recombination.

3. Transferring 1.5 mug of the amplification product of the kana resistance mutation box prepared in the step 1 into competent cells prepared in the step 2, adding 1mL of LB culture medium for resuscitation for 2 hours, collecting bacteria, then coating the bacteria on a double-antibody LB plate (ampicillin 100 mug/mL and kanamycin 50 mug/mL) for 2 days, picking up single colonies, streaking and increasing bacteria on the double-antibody plate, carrying out PCR identification on sORF17-F/R primers, and sequencing to verify that cloning is correct. The primer sequences identified by PCR were as follows:

sORF17-F：CTATAGCCGTTTTCTGCGGC；

sORF17-R：CCTTTGGAACAAATGGCGGC。

the PCR amplification procedure was as follows: pre-denaturation 95 ℃/5min; denaturation 95 ℃/40s; annealing for 56 ℃/40s; extending for 72 ℃/2min for 30s; and then extending for 72 ℃/5min.

4. Clones with correct sequencing verification were cultured in a constant temperature incubator at 37℃for 1 day, 100. Mu.L of bacterial liquid was diluted 1000-fold and then plated on LB plates, single colonies were picked up for PCR identification using pKD46-JD-F/R primers, and pKD46 plasmid-eliminating clones were selected. The primer sequences identified by PCR were as follows:

pKD46-JD-F：TTCCTACCTACGTAACGGAC；

pKD46-JD-R：GCGTGAAGGCCTGCATTATG。

the PCR amplification procedure was as follows: pre-denaturation 95 ℃/5min; denaturation 95 ℃/40s; annealing for 56 ℃/40s; extending for 72 ℃/1min; and then extending for 72 ℃/5min.

5. The pCP20 helper plasmid was electrotransferred into the pKD 46-eliminating plasmid strain obtained in step 4, the plasmid-introduced monoclonal was cultured at 37℃for 1 day, 100. Mu.L of the bacterial liquid was diluted 1000-fold and then plated on LB plates, single colonies were picked up and subjected to PCR identification using sORF17-F/R primers to confirm resistance gene elimination, and correct clones were screened by sequencing. And the clone with correct sequencing is named as EV76 delta sORF17, namely the sORF17 gene knockout strain of the invention. EV76 ΔsORF17 is a strain obtained by knocking out sORF17 gene in the genome of EV76 vaccine strain.

2. Identification of sORF17 Gene knockout Strain EV76- ΔsORF17

Colony PCR amplification (the sizes of the theoretical PCR products of the knocked-out strain and the wild strain are 282bp and 381bp respectively) is carried out on the sORF17 gene knocked-out strain EV 76-delta sORF17 and the wild strain (plague fungus EV76 vaccine strain) by adopting a primer pair sORF17-F/R, and the amplified products are detected and verified by 1.5% agarose gel electrophoresis.

The result of gel electrophoresis is shown in FIG. 1, and the sequencing result is in line with the expectation, which shows that the EV76 delta sORF17 is successfully constructed.

Example 2 comparison of the immune Effect of pestis EV76 vaccine Strain with sORF17 Gene knockout Strain EV 76. Delta. SORF17 prepared according to the invention

1. Experimental method

1. Bacterial culture

Inoculating the plague bacillus EV76 vaccine strain and sORF17 gene knockout strain EV76 delta sORF17 into 5mL LB culture medium, and culturing at 26 ℃ for 200r/min overnight to obtain bacterial solutions; then the bacterial solutions are respectively processed according to the following steps of 1:50 in 5mL of culture medium, and culturing to OD _620nm About 1.0; OD is then added again _620nm Bacterial liquid of about 1.0 was prepared according to 1:50 is inoculated in 5mL LB culture medium and cultured until OD _620nm About 1.0, and a final culture broth was obtained.The final culture broth was transferred to 37 ℃ for incubation for 1h before nasal drip challenge.

2. Survival curve observation of mice after infection of EV76 and EV76 ΔsORF17 by subcutaneous route

20 female BALB/c mice of 6-8 weeks of age were randomly divided into two groups of 10, EV 76-infected and EV76- ΔsORF 17-infected groups, respectively. Sterile PBS (pH 7.4, the components and their concentrations are as follows: naCl 9000mg/L, na) ₂ HPO ₄ 268mg/L、KH ₂ PO ₄ 144 mg/L) the final culture solution of the plague fungus EV76 vaccine strain and the EV76 delta sORF17 knockout strain obtained in the step 1 is prepared into a concentration of 2 multiplied by 10 ⁸ CFU/mL bacterial liquid, taking 100 mu L bacterial liquid to infect mice by subcutaneous route, counting by dropping plate and determining the actual infection amount. Mice were observed and recorded 2 times daily for morbidity and mortality, and the mice were observed continuously for 2 weeks to draw survival curves.

3. Animal immunity and detoxication

1) Immunization of animals

70 female mice of SPF grade BALB/c from 6 to 8 weeks of age were randomly divided into three groups:

EV76 immune group (30): 100. Mu.L of EV76 bacterial liquid (containing 2X 10) ⁵ CFU), the same dose was boosted after 21 days.

EV 76-. DELTA.sORF 17 immunized group (30): 100. Mu.L of EV 76-. DELTA.sORF 17 bacterial liquid (containing 2X 10) ⁵ CFU), the same dose was boosted after 21 days.

PBS control group (10): the same dose was boosted 21 days after injection of 100 μl PBS solution.

2) Attack toxin

2-1) 42 days after the first immunization, 5 mice in each group were subjected to subcutaneous or nasal drip challenge with 201 strains of pestis, the dosage of the toxicity attack theory is 1 multiplied by 10 respectively ³ CFU/only (300 LD 50) or 1×10 ⁵ CFU/4 (40 LD 50). After the toxicity attack, the incidence and death of the mice are observed and recorded for 2 times every day, and the protection rate is calculated by continuously observing for 2 weeks. The protection rate calculation formula is as follows: protection = (number of surviving mice +.number of mice before challenge) ×100%.

2-2) 132 days after the first immunization, 10 mice per group were challenged subcutaneously or nasally with the 201-lux strain of pestis,the toxicity attack theory dose is 5000 CFU/or 1.5X10 respectively ⁶ CFU. After the toxicity attack, the incidence and death of the mice are observed and recorded for 2 times every day, and the protection rate is calculated by continuously observing for 2 weeks. At 12 days after challenge with 201-lux broth, the mice were anesthetized with isopentobarbitune, 1.4 mg/mouse, imaged using a mouse live imaging system, and observed for bacterial clearance.

4. ELISA for detecting serum antibody level

1) Specific F1 IgG antibody detection

Each group of immunized mice contains 5 mice, the orbital vein is collected for 40 days after the initial immunization, and serum is separated for standby. ELISA for detecting serum specific F1 IgG antibody level comprises the following specific steps: 2. Mu.g/mL purified F1 antigen protein 100. Mu.L/well, ELISA plates were coated overnight at 4℃and blocked with blocking solution at 37℃for 2h, serum from 1:200 to 1:409600 100 μl of different dilutions of serum was added to the detection wells and incubated at 37deg.C for 30 min, and the plates were washed 5 times with PBST wash; HRP-sheep anti-mouse IgG antibody, HRP-sheep anti-mouse IgG1 antibody, HRP-sheep anti-mouse IgG2a antibody, HRP-sheep anti-mouse IgG2b antibody are added into the detection hole, and the detection hole is incubated for 20 minutes at 37 ℃, and the PBST washing solution is washed for 5 times; TMB is added into the detection hole, and the detection hole is incubated for 10 minutes at 37 ℃ in a dark place; adding a stop solution, and detecting the OD value at 450nm by an enzyme-labeled instrument. OD values greater than 2.1 times negative control were considered positive.

2) Specific low calcium response factor V (LcrV) IgG antibody detection

Each group of immunized mice contains 5 mice, the orbital vein is collected for 40 days after the initial immunization, and serum is separated for standby. ELISA detects serum-specific low calcium response factor V (LcrV) IgG antibody levels, and the specific steps are as follows: 1 μg/mL purified LcrV antigen protein 100 μl/well, ELISA plates were coated overnight at 4deg.C, and blocking solution was blocked at 37deg.C for 2h. Serum collected on day 40 from 1:20 to 1:2560 100 μl of different dilutions of serum was added to the detection wells and incubated at 37deg.C for 30 min, and the plates were washed 5 times with PBST wash; HRP-sheep anti-mouse IgG antibody is added into the detection hole, the detection hole is incubated for 20 minutes at 37 ℃, and the PBST washing liquid is washed for 5 times; adding TMB into the detection hole, and incubating for 10 minutes at 37 ℃ in a dark place; adding a stop solution, and detecting the OD value at 450nm by an enzyme-labeled instrument. OD values greater than 2.1 times negative control were considered positive.

3) Variation of specific F1 antibody level at different immunization times

Each group of 5 immunized mice was collected from orbital veins of 20d, 40d, 67d, 82d, 115d after priming, and serum was isolated for use. The anti-F1 IgG antibody level in serum was detected according to the method in step 1).

2. Experimental results

1. Comparison of survival curves of mice after infection of EV76 and EV76 ΔsORF17 by subcutaneous route

The EV76 vaccine strain and the EV76 delta sORF17 strain are immunized with BALB/c mice by subcutaneous route, and the drop plate counting result shows that the actual infection dose of the EV76 vaccine strain is 2.5x10 ⁷ CFU/strain, EV 76. DELTA.sORF 17 strain, actual infection dose was 3.3X10% ⁷ CFU/CFU. The survival curves were plotted as shown in figure 2, after 14 days of inoculation. The results show that: the survival rate of the EV 76-infected group was 70%, while the survival rate of the EV76- ΔsORF 17-infected group was 100%. Log-Rank (Mantel-Cox) test shows that P is less than 0.05, and the actual challenge agent amount is higher than EV76 strain in EV76 ΔsORF17, and the EV76 ΔsORF17 is seen to have further reduced virulence than the parent strain (EV 76 vaccine strain).

2. Evaluation of protective Effect of attenuated strains on subcutaneous, nasal drip and toxicity attack after subcutaneous immunization

After 42 days of the first dose immunization, the immunization groups and PBS groups were challenged by the subcutaneous and nasal drip routes, respectively, using strain 201 of pestis, and the survival curves were drawn and the protection rates were calculated for 14 days, as shown in FIGS. 3 and 4 (the dose in the figure is the actual infection dose). The results show that: in subcutaneous route challenge, both the EV76 Δsorf17 immunized group and the EV76 immunized group animals survived 100%; in the nasal drip route toxicity attack, the protection rates of the EV76 delta sORF17 immune group and the EV76 immune group are respectively 80% and 40%, and the three groups have no obvious difference in Log-Rank (Mantel-Cox) test.

The immune and PBS groups were challenged by the subcutaneous and nasal drip route using the plague 201-lux strain, respectively, 132 days after the first dose immunization, and the survival curves were plotted and the protection rates were calculated for 14 days, as shown in fig. 5 and 6 (the dose in the figure is the actual infection dose). The results show that: in the subcutaneous route toxicity attack, 100% of EV76 delta sORF17 immunized animals survive, and the EV76 immunized animals survive at 90%; in the nasal drip route of toxicity attack, the protection rate of the EV76 delta sORF17 immune group and the EV76 immune group is 50 percent. Three groups were examined for no significant differences by Log-Rank (Mantel-Cox).

Bacterial clearance was observed in vivo in mice 12 days after challenge with pestis 201-lux strain as shown in figures 7 and 8 (the dose in the figures is the actual infection dose). The results show that: 12 days after the EV 76-delta sORF17 immune group is used for nasal drip and toxin attack, the bacterial clearance is 60 percent, and 12 days after the EV76 immune group is used for nasal drip and toxin attack, the bacterial clearance is 66.6 percent; the bacterial clearance is 30% 12 days after the subcutaneous challenge of the EV 76-delta sORF17 immune group, and 66.6% 12 days after the subcutaneous challenge of the EV76 immune group.

3. Comparison of serum protective antibody titres of mice after subcutaneous immunization

The capsular antigen F1 and virulence antigen LcrV of pestis are two important protective antigens of pestis, and 40 days after the mice are primed, blood is collected through the orbital veins and serum is separated, and the corresponding antibody titer is detected by ELISA method. Among them, EV76 immune group and EV76 ΔsORF17 immune group can stimulate the organism to produce higher titres of anti-F1-IgG, the average titre of anti-F1-IgG of EV76 ΔsORF17 immune group is 225280, the average titre of anti-F1-IgG of EV76 immune group is 149760, and the titre of anti-F1-IgG of EV76 ΔsORF17 immune group is higher than that of EV76 immune group (FIG. 9A). No anti-LcrV-IgG was detected in both EV76 immunized and PBS groups, but lower titers of LcrV-lgG were detected in the ev7Δsorf17 immunized group (fig. 9B). IgG subtype detection of specific F1 antibodies resulted in IgG1, igG2a, and IgG2b antibodies in both the EV 76. DELTA.sORF 17 immune group and the EV76 immune group, with IgG1 antibodies having higher titers than IgG2a and IgG2b antibodies (FIG. 10). The time course of the F1-IgG antibody is shown in FIG. 11, which shows that: antibody titers reached a peak on day 42, and then began to decline, with higher titers remaining at day 115.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

1. A product for preventing and/or treating plague comprises active ingredient of sORF17 protein or EV76 strain with coding gene function deletion;

the sORF17 protein is a protein shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;

2. The product according to claim 1, characterized in that: the sORF17 protein coding gene is a gene shown in the following b 1) or b 2) or b 3):

b1 A DNA molecule represented by SEQ ID No. 2;

3. A recombinant yersinia pestis, which is an EV76 strain with a deletion of the sORF17 protein or its encoding gene function;

the sORF17 protein is a protein shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;

4. Use of the recombinant yersinia pestis of claim 3 for the preparation of a product for the prevention and/or treatment of plague.

Application of sORF17 protein in regulating and controlling toxicity of EV76 strain;

the sORF17 protein is a protein shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;

6. The application of biological materials related to sORF17 protein in regulating and controlling the toxicity of EV76 strain;

the sORF17 protein is a protein shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;

7. The use according to claim 6, characterized in that: the biological material related to the sORF17 protein is a nucleic acid molecule encoding the sORF17 protein, or an expression cassette, a recombinant vector and a recombinant microorganism containing the nucleic acid molecule.

8. The use according to claim 7, characterized in that: the nucleic acid molecule encoding sORF17 protein is a gene as shown in b 1) or b 2) or b 3) as follows:

b1 A DNA molecule represented by SEQ ID No. 2;

9. Use of a sORF17 protein or a substance encoding a loss of gene function in any one of the following c 1) -c 3):

c1 Reduced EV76 strain virulence;

c2 Preparing sORF17 gene knockout strain;

c3 Preparing a product for preventing and/or treating plague.

10. A method of reducing virulence of an EV76 strain comprising the steps of: deleting the sORF17 protein or the coding gene function of the EV76 strain to obtain recombinant Yersinia pestis; the virulence of the recombinant yersinia pestis is lower than the EV76 strain;

the sORF17 protein is a protein shown in the following a 1) or a 2) or a 3):

a1 Amino acid sequence is a protein shown in sequence 1;