CN117363796A - Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit - Google Patents
Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit Download PDFInfo
- Publication number
- CN117363796A CN117363796A CN202311220035.1A CN202311220035A CN117363796A CN 117363796 A CN117363796 A CN 117363796A CN 202311220035 A CN202311220035 A CN 202311220035A CN 117363796 A CN117363796 A CN 117363796A
- Authority
- CN
- China
- Prior art keywords
- duck
- dadv
- ducv
- type3
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001664991 Duck circovirus Species 0.000 title claims abstract description 55
- 238000001514 detection method Methods 0.000 title claims abstract description 53
- 241000272525 Anas platyrhynchos Species 0.000 title claims abstract description 43
- 241000193096 Human adenovirus B3 Species 0.000 title claims abstract description 29
- 238000011529 RT qPCR Methods 0.000 title claims abstract description 9
- 239000000523 sample Substances 0.000 claims abstract description 41
- 238000006243 chemical reaction Methods 0.000 claims abstract description 34
- 238000003753 real-time PCR Methods 0.000 claims abstract description 29
- 238000000034 method Methods 0.000 claims abstract description 23
- 241000700605 Viruses Species 0.000 claims abstract description 16
- 238000012360 testing method Methods 0.000 claims abstract description 16
- 238000000137 annealing Methods 0.000 claims abstract description 14
- 239000013612 plasmid Substances 0.000 claims description 20
- 238000011144 upstream manufacturing Methods 0.000 claims description 18
- 230000003612 virological effect Effects 0.000 claims description 10
- 102000004190 Enzymes Human genes 0.000 claims description 9
- 108090000790 Enzymes Proteins 0.000 claims description 9
- 239000000203 mixture Substances 0.000 claims description 8
- 108020004707 nucleic acids Proteins 0.000 claims description 8
- 102000039446 nucleic acids Human genes 0.000 claims description 8
- 150000007523 nucleic acids Chemical class 0.000 claims description 8
- 238000007400 DNA extraction Methods 0.000 claims description 4
- 238000010802 RNA extraction kit Methods 0.000 claims description 4
- 230000009977 dual effect Effects 0.000 claims description 4
- 108090000623 proteins and genes Proteins 0.000 claims description 4
- 102000004169 proteins and genes Human genes 0.000 claims description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 4
- 241001465754 Metazoa Species 0.000 claims description 3
- 238000010790 dilution Methods 0.000 claims description 3
- 239000012895 dilution Substances 0.000 claims description 3
- 230000001954 sterilising effect Effects 0.000 claims description 3
- 241000894006 Bacteria Species 0.000 claims description 2
- 239000006142 Luria-Bertani Agar Substances 0.000 claims description 2
- 210000001124 body fluid Anatomy 0.000 claims description 2
- 239000010839 body fluid Substances 0.000 claims description 2
- 238000010367 cloning Methods 0.000 claims description 2
- 210000002966 serum Anatomy 0.000 claims description 2
- 238000003556 assay Methods 0.000 claims 5
- 238000003149 assay kit Methods 0.000 claims 1
- 108020004414 DNA Proteins 0.000 description 15
- 230000035945 sensitivity Effects 0.000 description 7
- 238000012408 PCR amplification Methods 0.000 description 6
- 239000007850 fluorescent dye Substances 0.000 description 4
- 241000711404 Avian avulavirus 1 Species 0.000 description 3
- 241001516406 Avian orthoreovirus Species 0.000 description 3
- 241001651352 Avihepatovirus A Species 0.000 description 3
- 241000686770 Duck Tembusu virus Species 0.000 description 3
- 241000770684 Duck adenovirus 2 Species 0.000 description 3
- 241001503699 Muscovy duck parvovirus Species 0.000 description 3
- 230000000052 comparative effect Effects 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 238000000926 separation method Methods 0.000 description 3
- 241000701161 unidentified adenovirus Species 0.000 description 3
- 241000712461 unidentified influenza virus Species 0.000 description 3
- 241000701242 Adenoviridae Species 0.000 description 2
- 241000886675 Duck atadenovirus A Species 0.000 description 2
- 241000701109 Human adenovirus 2 Species 0.000 description 2
- 108700010877 adenoviridae proteins Proteins 0.000 description 2
- 108091036078 conserved sequence Proteins 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 210000005228 liver tissue Anatomy 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 230000000405 serological effect Effects 0.000 description 2
- 238000004659 sterilization and disinfection Methods 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 241001492342 Anatid alphaherpesvirus 1 Species 0.000 description 1
- 241000272517 Anseriformes Species 0.000 description 1
- 241000534000 Berula erecta Species 0.000 description 1
- 241000272834 Cairina moschata Species 0.000 description 1
- 241000606161 Chlamydia Species 0.000 description 1
- 241001533384 Circovirus Species 0.000 description 1
- 230000004544 DNA amplification Effects 0.000 description 1
- 241000469171 Duck astrovirus Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241000710778 Pestivirus Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000000740 bleeding effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 239000003112 inhibitor Substances 0.000 description 1
- 210000004185 liver Anatomy 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 230000017074 necrotic cell death Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000011330 nucleic acid test Methods 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000008961 swelling Effects 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a double qPCR detection method and a detection kit for duck adenovirus type3 and duck circovirus, which are implemented by: extracting a virus template from a sample to be detected; preparing a reaction system, wherein the reaction system comprises 1 mu L of virus template extracted from a sample to be detected, 0.15-0.4 mu mol/L of DADV-3 and DUCV primers, 0.05-0.3 mu mol/L of probe and the annealing temperature is 56-62 ℃; fluorescent quantitative PCR was performed: the reaction is performed for 30s at 95 ℃, 5s at 95 ℃ and 50s at annealing extension for 40 cycles, fluorescence is collected in the last step of each cycle, and a fluorescence curve is obtained after the reaction is finished. The method can be used for rapid qualitative and quantitative detection, and repeated test results in and among groups show that the established method has good repeatability.
Description
Technical Field
The invention belongs to the technical field of animal virus disease diagnosis, and particularly relates to a double qPCR (quantitative polymerase chain reaction) detection method and a detection kit for duck adenovirus type3 and duck circovirus.
Background
Duckcircovirus (DuCV), which belongs to the genus Cyclovirous (Circovirus) of the family Cycloviridae, is a DNA virus which is non-envelope, icosahedral symmetric, 15 to 16nm in diameter, has a whole genome size of about 1900bp, and is currently known to be the smallest duck virus. DuCV can infect ducks of various varieties, can infect and attack all the year round, and has no obvious seasonality. Can be horizontally transmitted or vertically transmitted.
Duckadenvirype 3 (DADV-3) is a virus of the family Adenoviridae of the genus Adenoviridae, is widely distributed in China, and causes huge economic loss to the Muscovy duck breeding industry in China. DADV-3 has stronger pathogenic ability, and the mosaics which cause disease after virus infection are diseased in clinical section examination, so that the redness, swelling, bleeding and necrosis of the liver of the mosaics can be caused.
At present, the detection methods of duck circovirus and duck adenovirus type3 mainly comprise separation culture, serological detection, conventional PCR and real-time fluorescent quantitative PCR detection. The separation culture has higher requirements on culture environment, nutrition condition and separation operation, and takes longer time; the serological detection has the problems of low subjective factor, low sensitivity and specificity, easy cross reaction with other microorganisms such as chlamydia and the like in the interpretation of results. The conventional PCR detection has the problems of lack of specificity of primer combination, laboratory pollution, false negative caused by PCR inhibitors in clinical samples and the like, and the detection needs to be verified by electrophoresis sequencing after gene amplification, so that the detection is relatively time-consuming and has relatively high cost; the real-time fluorescent probe PCR method is used for distinguishing species according to the sequence specific probes, so that the specificity and sensitivity of detection are improved, two pathogens cannot be identified by the single real-time fluorescent probe PCR method through one-time detection, and in addition, the condition that 2 primer pairs and probes are mutually interfered in the double real-time fluorescent probe PCR method possibly occurs, so that the detection result is influenced. The invention can simultaneously carry out the PCR detection of the duck circovirus and the duck adenovirus type3 real-time fluorescent probe, and has sensitive and accurate reaction.
Disclosure of Invention
Aiming at the technical problems, the invention provides a double qPCR detection method for duck adenovirus type3 and duck circovirus, which comprises the following steps:
extracting a virus template from a sample to be detected;
preparing a reaction system, wherein the reaction system comprises 1 mu L of virus template extracted from a sample to be detected, 0.15-0.4 mu mol/L of DADV-3 and DUCV primer and 0.05-0.3 mu mol/L of probe, and the annealing temperature is 56-62 ℃;
the primer pair and probe used for detecting the DADV-3 comprise the following two upstream and downstream primer pairs:
DADV-3-1BF TGCCTTTATTCTAGCTGTGG
DADV-3-1BR ATGACAATCAACCAGTAGCG
DADV-3-1TF TCTGAGGACGAGGGTATTGT
DADV-3-1TR ATCCCACAAGGCGAGTAATG
DADV-3-P ROX-GTGTTTAATTGCAGATGCTTGTGACTGCT-BHQ2 was used to detect DUCV including the following two upstream and downstream primer pairs and probes:
DUCV-3BF CCCACGACTTATGTTATCT
DUCV-3BR ACTGAGTCATACCGCCTTTA
DUCV-3TF CGTGATTGGAAGACCGAAGT
DUCV-3TR TTCCCGCGTGGTTTGTAATA
DUCV-P FAM-CACCGGAAAGAGCCGTTATGCATTTG-TAMRA
the reaction system performs fluorescence quantitative PCR according to the following reaction conditions: pre-denaturing for 30s at 95 ℃, denaturing for 5s at 95 ℃ and annealing for 50s for 40 cycles, collecting fluorescence in the last step of each cycle, and obtaining a fluorescence curve after the reaction is finished;
and (3) obtaining a qualitative detection result according to the fluorescence curve, and comparing the fluorescence curve with a standard curve to obtain a quantitative detection result.
Further, the invention provides a double qPCR detection composition for duck adenovirus type3 and duck circovirus, which comprises the following components:
2 XPCR buffer 10. Mu.L; enzyme Mix 1. Mu.L, DADV-3 upstream and downstream primer (10. Mu.M) 0.5. Mu.L each and probe (10. Mu.M) 0.3. Mu.L and DUCV upstream and downstream primer (10. Mu.M) 0.6. Mu.L each and probe (10. Mu.M) 0.3. Mu.L;
furthermore, the invention provides a detection kit for realizing the detection method by using the double qPCR detection composition for duck adenovirus type3 and duck circovirus.
The detection method of the invention has the advantages that repeated test results in and among groups show that the established method has good repeatability.
Drawings
Fig. 1: a standard curve;
fig. 2: a specificity test fluorescence curve;
fig. 3: sensitivity test fluorescence curve.
Detailed Description
The materials used in the following examples and test examples include:
plasmid extraction kit was purchased from Axygen, fluorescent quantitative PremixExTaq enzyme, RNA reverse transcription kit Primescript RTkit, and Extaq enzyme was purchased from TAKARA. Viral genomic DNA and RNA were extracted using a viral genomic DNA/RNA extraction kit (tenna). DEPC water: the ultra-pure water is obtained by DEPC treatment and then high-temperature high-pressure sterilization.
Primers were designed with reference to the published duck adenovirus type3 and duck circovirus conserved gene sequences in GenBank, and synthesized by Jilin Kumei Biotechnology Co.
The following examples further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.
Example 1
The detection method comprises the following steps:
s1, preparing recombinant DADV-3 and DUCV plasmid standard products;
s2, preparing a standard curve step shown in FIG. 1;
s3, extracting a virus template from a sample to be detected and preparing a reaction system; the reaction system comprises 1 mu L of virus template extracted from a sample to be detected, 0.15-0.4 mu mol/L of DADV-3 and DUCV primer, 0.05-0.3 mu mol/L of probe, and the annealing temperature is 56-62 ℃.
S4, performing fluorescence quantitative PCR reaction on a Bio-RadIQ5 fluorescence quantitative PCR instrument, obtaining a qualitative detection result according to a fluorescence curve, and comparing the fluorescence curve with the standard curve to obtain a quantitative detection result.
In step S3, the upstream and downstream primer pairs and probes for detecting DADV-3:
DADV-3-1TF TCTGAGGACGAGGGTATTGT
DADV-3-1TR ATCCCACAAGGCGAGTAATG
DADV-3-P ROX-GTGTTTAATTGCAGATGCTTGTGACTGCT-BHQ2
in step S3, the upstream and downstream primer pairs and probes for detecting DUCV:
DUCV-3TF CGTGATTGGAAGACCGAAGT
DUCV-3TR TTCCCGCGTGGTTTGTAATA
DUCV-P FAM-CACCGGAAAGAGCCGTTATGCATTTG-TAMRA
the reaction system performs fluorescence quantitative PCR according to the following reaction conditions: the reaction is performed for 30s at 95 ℃, 5s at 95 ℃ and 50s at annealing extension for 40 cycles, fluorescence is collected in the last step of each cycle, and a fluorescence curve is obtained after the reaction is finished.
In the step S3, the step of extracting the virus template from the sample to be detected comprises the following steps:
preparing plasma, serum and cell-free body fluid from animal tissues to be tested;
the viral genomic DNA and RNA are extracted using a viral genomic DNA/RNA extraction kit.
Wherein the reaction system comprises 1 mu L of virus template extracted from a sample to be detected, 0.15-0.4 mu mol/L of DADV-3 and DUCV primer and 0.05-0.3 mu mol/L of probe, and the annealing temperature is 56-62 ℃.
In step S1, the steps for preparing the recombinant DADV-3 and DUCV plasmid standard comprise:
PCR is carried out by taking DNA of duck adenovirus type3 and duck circovirus as templates, wherein the primers are respectively 10 mu mol/LDADV-3-BF/BR and 10 mu mol/LDUCV-BF/BR;
the amplified products are purified and recovered and connected to a pMD18-T vector, and transformed into DH5 alpha competent cells, positive clones are screened by using an LB agar plate containing Amp, and positive cloning bacteria are identified by using PCR;
taking recombinant plasmid containing DADV-3 and DUCV genome as standard, measuring OD280nm and OD260nm with nucleic acid protein detector, and calculating the purity and concentration of standard.
In the step S2, the step of preparing a standard curve comprises the following steps: recombinant DADV-3 and DUCV plasmidsThe standard positive template is serially diluted by 10 times, and the plasmid concentration range is 1 multiplied by 10 8 -1×10 1 The copies/. Mu.L was repeated 3 times for each dilution and tested according to the real-time quantitative PCR protocol to give a standard curve.
Specifically, PCR (primers DADV-3-BF/BR (10. Mu. Mol/L) and DUCV-BF/BR (10. Mu. Mol/L)) was performed using duck adenovirus type3 and duck circovirus DNA as templates, respectively, and the amplified products were purified and recovered, ligated to pMD18-T vector, and transformed into DH 5. Alpha. Competent cells. The positive clone was sequenced by Kyoto Biotech, inc. Taking recombinant plasmid containing DADV-3 and DUCV genome as standard, and measuring OD with nucleic acid protein detector 280 nm and OD 260 nm, the purity and concentration of the standard were calculated. Preserving at-70 ℃ for standby. Using the copy number formula (6.02X10) 23 )×(ng/μL×10 -9 ) Plasmid copy number was calculated as/(dnalogth×660) =copies/. Mu.l.
Example 2
2.1 materials
The nucleic acid samples of duck hepatitis A virus type 1 (DHAV-1) 161/79/v strain, duck hepatitis A virus type3 (DHAV-3) JS strain and duck pestivirus strain (DPV) (CSC strain) were all stored in the laboratory, and the nucleic acid samples of duck adenovirus type3 (DADV-3), duck circovirus (DUCV), muscovy Duck Parvovirus (MDPV), avian Influenza Virus (AIV), newcastle Disease Virus (NDV), duck tembusu virus (DTMUV), avian Reovirus (ARV) and the like were all stored in the laboratory. Plasmid extraction kit was purchased from Axygen, fluorescent quantitative PremixExTaq enzyme, RNA reverse transcription kit Primescript RTkit, and Extaq enzyme was purchased from TAKARA.
Clinical samples: 35 parts of duck tissue samples suspected of being infected with duck adenovirus type3 and duck circovirus are taken from a certain duck farm in Jinan, shandong province. 35 parts of diseased duck liver tissue samples are taken from a certain duck farm in Xuzhou area of Jiangsu.
2.2 design and Synthesis of primers
Primers were designed with reference to the published duck adenovirus type3 and duck circovirus conserved gene sequences in GenBank, and synthesized by Jilin Kumei Biotechnology Co.
TABLE 1 primer information for DADV-3 and DUCV double qPCR methods
2.3 viral nucleic acid extraction
Viral genomic DNA and RNA were extracted using a viral genomic DNA/RNA extraction kit (tenna).
2.4 preparation of Standard substance
PCR (primers DADV-3-BF/BR (10. Mu. Mol/L) and DUCV-BF/BR (10. Mu. Mol/L)) was performed using DNA of duck adenovirus type3 and duck circovirus as templates, respectively, and the amplified products were purified and recovered, ligated to pMD18-T vector, and transformed into DH 5. Alpha. Competent cells. The positive clone was sequenced by Kyoto Biotech, inc. Taking recombinant plasmid containing DADV-3 and DUCV genome as standard, measuring OD280nm and OD260nm with nucleic acid protein detector, and calculating the purity and concentration of standard. Preserving at-70 ℃ for standby. Plasmid copy number was calculated using the copy number formula (6.02X103) × (ng/. Mu.L. Times.10-9)/(DNAlength. Times.660) =copies/. Mu.L.
2.5 double fluorescence quantitative PCR reaction condition optimization
The recombinant plasmid standard is used as a template, and conditions such as a primer, probe concentration, annealing temperature and the like of the real-time quantitative PCR are optimized by using a matrix method on a Bioradio Q5 fluorescent quantitative PCR instrument (Berle company). The primers in Table 1 were fuelled between 0.15-0.4. Mu. Mol/L, i.e., 0.3-0.8. Mu.L (10. Mu.M)/reaction, using the DADV-3 and DUCV plasmids as standards. The probe was searched for between 0.05 and 0.3. Mu. Mol/L final concentration, i.e.0.1 to 0.6. Mu.L (10. Mu.M)/reaction, and fluorescent quantitative PCR was performed to select the optimal concentration of primer and probe. The annealing temperature is optimized to be 56-62 ℃. The reaction system: each 1. Mu.L of the template, 10. Mu.L of the Premix enzyme, 0.3-0.8. Mu.L of the DADV-3 and DUCV primers (10. Mu.M) and 0.1-0.6. Mu.L of the probe (10. Mu.M) were combined in various ratios. DEPC water was made up to 20. Mu.L.
2.6 Standard Curve determination
The plasmid standard was serially diluted 10-fold to set the plasmid concentration range to 1X 10 8 -1×10 1 The copies/. Mu.L was run in 3 replicates per dilution and a standard curve was determined following the real-time quantitative PCR protocol.
2.7 sensitivity test for fluorescent quantitative PCR
The standard was diluted 10-fold, and fluorescent quantitative PCR was performed. Taking 1×10 8 -1×10 1 2. Mu.L of each of the cobies/. Mu.L standard plasmids was used as a mixed template for detection, the minimum detection amount was determined and a negative control was established.
With the detection method of example 2,
the double fluorescence quantitative PCR detection result of the duck adenovirus type3 shows 15 positives, wherein 14 positives are consistent with the single PCR detection result, and the positive coincidence rate is 93.3%; the double fluorescence quantitative PCR detection result shows 20 negative parts, wherein the 19 negative parts are consistent with the single PCR detection result, and the negative coincidence rate is 95%.
The double fluorescence quantitative PCR detection result of the duck circovirus shows 15 positives, wherein 15 positives are consistent with the single PCR detection result, and the positive coincidence rate is 100%; the double fluorescence quantitative PCR detection result shows 20 negative parts, wherein 20 negative parts are consistent with the single PCR detection result, and the negative coincidence rate is 100%.
Comparative example 1
The same batch of samples of example 2 was tested by the ordinary PCR method, and as a result, 0 parts of duck adenovirus type3 (positive rate 0%) and 4 parts of duck circovirus (positive rate 11.4%) were detected.
And (3) detecting 2 parts of duck adenovirus type3 (the positive rate is 5.7 percent) and 8 parts of duck circovirus (the positive rate is 22.8 percent) by using a fluorescent quantitative PCR method to detect 35 parts of duck liver tissue samples collected by a duck group in Xuzhou area of Jiangsu.
Comparative example 2
The prior art with application number CN112575122A discloses that by a double PCR primer set for rapid detection of DAdV-2 and DuCV, consisting of a primer for detection of DAdV-2 and a primer for detection of DuCV,
the nucleotide sequence of the primer for detecting DAdV-2 is:
upstream primer F1:5'-CGATGGAACGACAGTAAA-3'
Downstream primer R1:5'-AAACGAAAAAGCAAGAGC-3'
The nucleotide sequences of the primers used to detect DuCV are:
the upstream primer F2:5'-GTGGTGGGACGGTTACTCGG-3'
Downstream primer R2:5'-TTTATTGGGAACGGGAGGGT-3'
Also disclosed is a method for simultaneously detecting DAdV-2 and DuCV using the above-described double PCR primer set, the method comprising the steps of:
(1) The double PCR primer group for detecting DAdV-2 and DuCV is synthesized by a common method;
(2) Extracting total DNA of a sample to be detected, and carrying out PCR amplification reaction by adopting the double PCR primer group synthesized in the step (1) by taking the extracted total DNA as a template;
(3) And analyzing the PCR amplification product, and judging the result.
The reaction system of the PCR amplification in the step (2) is as follows: the final concentration of each of the upstream primer F1, the downstream primer R1, the upstream primer F2 and the downstream primer R2 was 0.5. Mu.L, and the final concentration of each of the primers was 0.4 pmol/. Mu.L; 12.5. Mu.L of 2 XTaqMastermix enzyme; 1 mu L of each DNA template; ddH2O was made up to 25. Mu.L after sterilization; the conditions of the PCR amplification reaction are as follows: pre-denaturation at 95 ℃ for 5min;94℃90s,94℃20s,54℃30s,72℃20s,30 cycles, the last cycle extending for 5min at 72 ℃.
Analyzing the PCR amplification product, namely performing agarose gel electrophoresis analysis on the PCR amplification product, and determining the type of the virus in the sample according to the electrophoresis result; when DAdV-2 exists in the sample, a band of about 598bp appears in the amplified product; when DuCV is present in the sample, a band of about 297bp appears in the amplified product; when the sample contains DAdV-2 and DuCV, two bands of about 598bp and 297bp appear in the amplified product.
However, in this solution, DAdV-2 is not the same virus as DAdV-3 in the present invention, and the problem of quantitative detection cannot be solved.
Comparative example 3
The prior art of patent number CN107012261A discloses a dual EvaGreen real-time fluorescence quantitative PCR detection primer and a kit for duck adenovirus A type and duck adenovirus 2 type, and establishes an EvaGreen real-time fluorescence quantitative PCR method capable of simultaneously detecting duck adenovirus A type and duck adenovirus 2 type in a duck group: duck adenovirus type A and duck adenovirus type 2 double EvaGreen real-time fluorescent quantitative PCR detection primers comprise the following steps:
for detecting duck adenovirus type A:
the upstream primer DAdVA-SYF:5'-CTAATCCTCAGGTTGGGCAAAG-3' the number of the individual pieces of the plastic,
the downstream primer DAdVA-SYR:5'-GGAAAACCAGTAACCTGACT-3' the number of the individual pieces of the plastic,
the size of the target fragment is 124bp;
for detection of duck adenovirus type 2:
the upstream primer DAdV2-SYF:5'-TGAAATAAACATTCCAGCAAT-3';
the downstream primer DAdV2-SYR:5'-ACCACCGAGCTCCAATATTT-3';
the size of the target fragment is 180bp.
The dual EvaGreen real-time fluorescence quantitative PCR reaction system is as follows:
| reagent(s) | (usage amount/. Mu.L) |
| Eva Green Mix(2×) | 10 |
| DAdVA-SYF(10μM) | 0.3 |
| DAdVA-SYR(10μM) | 0.3 |
| DAdV2-SYF(10μM) | 0.5 |
| DAdV2-SYR(10μM) | 0.5 |
| Duck adenovirus A-type nucleic acid DNA | 1.5 |
| Duck adenovirus 2 type nucleic acid DNA | 1.5 |
| Sterilized deionized water | 5.4 |
| Total volume of | 20 |
The double EvaGreen real-time fluorescence quantitative PCR method has the following reaction conditions: pre-denaturation at 95 ℃ for 60s; annealing at 95 ℃ for 10s, annealing at 58 ℃ for 10s, and extending at 72 ℃ for 20s,40 cycles; after the cycle is completed, a dissolution profile is made.
The prior art does not provide a technical scheme for efficiently, qualitatively and quantitatively detecting duck adenovirus type3 and duck circovirus.
Test example 1 specificity test
The test samples of Muscovy duck parvovirus, avian reovirus, influenza virus (H5/H7/H9), duck Tembusu virus, newcastle disease virus, duck astrovirus, duck plague virus, duck hepatitis A virus type 1 and 3 were tested according to the method of example 1, and as a result, as shown in FIG. 2, only Duck adenovirus type3 and Duck circovirus had fluorescence curves, and none of the other pathogenic nucleic acid tests had amplified fluorescence curves.
Test example 2 sensitivity test
Duck adenovirus type3 and duck circovirus (1X 10) 8 -1×10 1 copies/. Mu.L) was used as a template for amplification and the sensitivity results are shown in FIG. 3. As can be seen from the fluorescence curve in the figure, the sensitivity of the detection method to duck adenovirus type3 is l multiplied by 10 2 cobies/. Mu.L; for duck circovirus, l is multiplied by 10 1 copies/μL。
Test example 3 repeatability test
The repeated test results in the group show that the average variation coefficients of Ct values of duck adenovirus type3 and duck circovirus are 0.35% and 0.28% respectively when 3 parallel reaction tubes are carried out on the same sample.
The results of the repeated experiments among groups show that the same nucleic acid templates are repeatedly tested under the same conditions after 3d, and the average variation coefficients of Ct values of duck adenovirus type3 and duck circovirus are respectively 2.97% and 2.22%. The repeated test results in the groups and among the groups show that the established method has good repeatability.
While the invention has been described in detail in the foregoing general description, embodiments and experiments, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Claims (10)
1. The double qPCR detection method for the duck adenovirus type3 and the duck circovirus is characterized by comprising the following steps of:
extracting a virus template from a sample to be detected;
preparing a reaction system, wherein the reaction system comprises 1 mu L of virus template extracted from a sample to be detected, 0.15-0.4 mu mol/L of DADV-3 and DUCV primer and 0.05-0.3 mu mol/L of probe, and the annealing temperature is 56-62 ℃;
the primer pair and probe used for detecting the DADV-3 comprise the following two upstream and downstream primer pairs:
the primer pairs and probes used for detecting DUCV include the following two upstream and downstream primers:
the reaction system performs fluorescence quantitative PCR according to the following reaction conditions: pre-denaturing for 30s at 95 ℃, denaturing for 5s at 95 ℃ and annealing for 50s for 40 cycles, collecting fluorescence in the last step of each cycle, and obtaining a fluorescence curve after the reaction is finished;
and (3) obtaining a qualitative detection result according to the fluorescence curve, and comparing the fluorescence curve with a standard curve to obtain a quantitative detection result.
2. The assay of claim 1, further comprising the steps of preparing recombinant DADV-3 and DUCV plasmid standards and preparing said standard curve.
3. The method according to claim 1, wherein the components of the reaction system per 20. Mu.L are: 2 XPCR buffer 10. Mu.L; 1. Mu.L of Premix enzyme, 0.5. Mu.L of DADV-3 upstream and downstream primer (10. Mu.M) and 0.3. Mu.L of probe (10. Mu.M) and 0.6. Mu.L of DUCV upstream and downstream primer (10. Mu.M) and 0.3. Mu.L of probe (10. Mu.M) respectively; and sterilizing DEPC water.
4. The method of claim 1, wherein the annealing temperature is 60 ℃.
5. The assay of claim 2, wherein the step of preparing recombinant DADV-3 and DUCV plasmid standards comprises:
PCR is carried out by taking DNA of duck adenovirus type3 and duck circovirus as templates, wherein the primers are 10 mu mol/L DADV-3-BF/BR and 10 mu mol/L DUCV-BF/BR respectively;
the amplified products are purified and recovered and connected to a pMD18-T vector, and transformed into DH5 alpha competent cells, positive clones are screened by using an LB agar plate containing Amp, and positive cloning bacteria are identified by using PCR;
taking recombinant plasmid containing DADV-3 and DUCV genome as standard, measuring OD280nm and OD260nm with nucleic acid protein detector, and calculating the purity and concentration of standard.
6. The method of detecting according to claim 2, wherein the step of preparing a standard curve includes: the positive templates of recombinant DADV-3 and DUCV plasmid standard are serially diluted by 10 times, and the plasmid concentration range is 1 multiplied by 10 8 -1×10 1 The copies/. Mu.L was repeated 3 times for each dilution and tested according to the real-time quantitative PCR protocol to give a standard curve.
7. The method of claim 1, wherein the step of extracting the viral template from the sample to be tested comprises:
preparing plasma, serum and cell-free body fluid from animal tissues to be tested;
the viral genomic DNA and RNA are extracted using a viral genomic DNA/RNA extraction kit.
8. A dual qPCR assay composition for duck adenovirus type3 and duck circovirus, said assay composition comprising:
2 XPCR buffer 10. Mu.L; enzyme Mix 1. Mu.L, DADV-3 upstream and downstream primer (10. Mu.M) 0.5. Mu.L each and probe (10. Mu.M) 0.3. Mu.L and DUCV upstream and downstream primer (10. Mu.M) 0.6. Mu.L each and probe (10. Mu.M) 0.3. Mu.L.
9. The test composition of claim 8, wherein the probe and primer pairs have the following sequences:
10. a dual qPCR assay kit for duck adenovirus type3 and duck circovirus, comprising the assay composition of claim 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311220035.1A CN117363796A (en) | 2023-09-20 | 2023-09-20 | Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311220035.1A CN117363796A (en) | 2023-09-20 | 2023-09-20 | Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117363796A true CN117363796A (en) | 2024-01-09 |
Family
ID=89403117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311220035.1A Pending CN117363796A (en) | 2023-09-20 | 2023-09-20 | Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117363796A (en) |
-
2023
- 2023-09-20 CN CN202311220035.1A patent/CN117363796A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN111020062A (en) | Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN112094944B (en) | Kit for quantitatively detecting novel coronavirus copy number | |
| CN112176112A (en) | Triple fluorescent quantitative RT-PCR detection kit for avian influenza virus H5, H7 and H9 subtypes and application thereof | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| KR20110017706A (en) | Primers and its application in multiplex pcr to identify rinderpest, peste-des-petits-ruminants virus, bluetongue virus and rift valley fever | |
| CN113789413B (en) | Primer pair, probe, kit and method for simultaneously detecting five lily viruses | |
| CN115478120A (en) | Method for simultaneously detecting nodavirus and decapod iridovirus 1 of macrobrachium rosenbergii | |
| CN116875743B (en) | Fluorescent quantitative PCR kit for detecting two cat enteroviruses at one time and application thereof | |
| CN111041128B (en) | Primer probe set, kit and detection method for detecting duck astrovirus type 3 based on real-time fluorescent quantitative PCR | |
| CN112126716A (en) | Primer pair for qRT-PCR detection of tembusu virus and application thereof | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| CN117363796A (en) | Duck adenovirus type3 and duck circovirus double qPCR detection method and detection kit | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN114317817A (en) | Fluorescent quantitative PCR primer group and fluorescent quantitative PCR kit for detecting mink circovirus | |
| CN112410466A (en) | Primer, probe and detection method for porcine circovirus type 2 and porcine circovirus type 4 dual real-time fluorescent quantitative PCR detection | |
| CN111961757A (en) | Double-gene probe method real-time fluorescence quantitative PCR kit for detecting duck tembusu virus and application | |
| CN112695137A (en) | PMA-qPCR detection method of porcine pseudorabies virus | |
| CN111304364A (en) | Primer and probe combination for detecting avian influenza virus, kit and detection method | |
| CN117106982A (en) | Duck astrovirus and duck circovirus double qRT-PCR detection composition, method and kit | |
| CN115323076B (en) | Primer probe composition, kit and detection method for detecting monkey D-type retrovirus | |
| CN114480737B (en) | FAdV-4 NP strain specific primer and application thereof in recombinase-mediated isothermal nucleic acid amplification detection | |
| CN110607404B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for porcine enterovirus G and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |