CN117343971A

CN117343971A - Method for efficiently synthesizing omega-amino fatty acid and alpha, omega-diamine

Info

Publication number: CN117343971A
Application number: CN202311197881.6A
Authority: CN
Inventors: 郁惠蕾; 李举谋; 石焜; 张志钧
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2023-09-15
Filing date: 2023-09-15
Publication date: 2024-01-05

Abstract

The invention provides a method for efficiently synthesizing alpha, omega-diamine, which comprises the following steps: (1) Using alpha, omega-dicarboxylic acid as a substrate, and using a catalyst containing a first carboxylic acid reductase mutant to catalyze and synthesize omega-amino fatty acid; (2) Using alpha, omega-dicarboxylic acid and omega-amino fatty acid as substrates, and using a catalyst containing a second carboxylic acid reductase mutant to catalyze and synthesize alpha, omega-diamine; wherein the first carboxylic acid reductase mutant has increased catalytic activity towards the substrate alpha, omega-dicarboxylic acid and decreased catalytic activity towards omega-amino fatty acids; and/or wherein the second carboxylic acid reductase mutant has enhanced catalytic activity on both the substrates alpha, omega-dicarboxylic acid and omega-amino fatty acid. The invention also provides a method for efficiently synthesizing omega-amino fatty acid. At the same time, the invention also discloses a series of carboxylic acid reductase mutants and application thereof in synthesizing omega-amino fatty acid and alpha, omega-diamine.

Description

Method for efficiently synthesizing omega-amino fatty acid and alpha, omega-diamine

Technical Field

The invention belongs to the technical field of bioengineering, and more particularly relates to a method for efficiently synthesizing omega-amino fatty acid and alpha, omega-diamine.

Background

Omega-amino fatty acids are important monomers of nylon and 6-aminocaproic acid (6-ACA) is a monomer of nylon 6. Currently, the commercial production of 6-ACA relies mainly on chemical catalysis starting from benzene (via cyclohexane) and caprolactam. Similarly, α, ω -diamines are widely used as nylon monomers, such as hexamethylenediamine as one of the two monomers of nylon 66. The current industrial production of hexamethylenediamine is mainly an energy intensive multistage chemical reaction with butadiene as starting material developed by dupont, which, although large-scale, uses highly toxic hydrogen cyanide. In response to the "green bio-manufacturing" call, more and more experts in recent years have attempted to synthesize omega-amino fatty acids and alpha, omega-diamines using renewable dibasic acids as substrates.

In 2020, yakunin, canada, reported for the first time that 6-aminocaproic acid was synthesized from adipic acid by carboxylic acid reductive amination using a carboxylic acid reductase and a transaminase, followed by continued carboxylic acid reductive amination of 6-aminocaproic acid to hexamethylenediamine, the main catalyst form being pure enzyme, but the final product 6-aminocaproic acid had a titer of only 9.5mM and hexamethylenediamine titer of only 3mM (j.am.chem.soc., 2020,142,1038-1048). In 2023, team Deng Yu from Jiangnan university constructed a redirected carboxyreductase cascade for biocatalytic adipic acid synthesis of hexamethylenediamine in E.coli, although the titer of hexamethylenediamine was 567-fold increased relative to the initial strain, only 2.1mM was reached (ACS Sustainable chem.Eng.,2023,11 (15): 6011-6020). Meanwhile, a laboratory team successfully screens a plurality of Carboxylic Acid Reductases (CARs) with high substrate specificity and high catalytic efficiency through a virtual screening method, and then the carboxylic acid reductases and aminotransferase are cascaded to catalyze adipic acid to synthesize 6-aminocaproic acid, the conversion rate is close to 90%, but the substrate loading amount is only 5mM, and the yield of hexamethylenediamine is only 14% (Biotechnol Bioeng,2023,120,1773-1783). In order to further increase the substrate loading and yield, it is highly desirable to modify the CAR to further increase its catalytic efficiency on adipic acid while reducing its enzymatic activity on the product 6-aminocaproic acid to ensure high yields of 6-aminocaproic acid, and then expand the substrate spectrum to other chain length alpha, omega-dicarboxylic acids (C3-C12) to synthesize omega-amino fatty acids. In 2020, levi Kramer et al, U.S. Pat. No. University of Nebraska, improved the catalytic efficiency of CAR on AA by a factor of 17, but the end product was hexanediol and the catalytic efficiency and substrate specificity for 6-aminocaproic acid were not considered (ACS Synth. Biol.,2020,9,1632-1637). Meanwhile, in order to synthesize alpha, omega-diamine efficiently, CAR needs to be further modified to improve the catalytic activity of the CAR on omega-amino fatty acid, only Yakunin and the like improve the catalytic efficiency of the CAR on 6-ACA by 9.1 times by analyzing the crystal structure of the CAR from Mycobacterium abscessus at present, but the final substrate loading is only 10mM (J.Am.chem.Soc., 2020,142,1038-1048).

There are also several patents at home and abroad which report the catalytic synthesis of various omega-amino fatty acids such as 5-aminopentanoic acid (CN 106011191 a), 6-aminocaproic acid, etc. (CN 113430119a, US20070254341A1, TW1627153B, US20190271014 A1), but the substrates of these routes (lysine, 6-amino-2-hydroxycaproic acid, alpha-ketopimelic acid, 6-hydroxycaproic acid) are all of non-bio-based origin, and the product is single, with poor broad-spectrum of the enzyme element. Biological synthesis of α, ω -diamines of different chain lengths has also been reported, such as 1, 4-butanediamine (CN 116355824 a), pentanediamine (CN 116376789 a), hexamethylenediamine (US 20190271014A1, US9,580,732B2), 1, 8-octanediamine and 1, 10-decanediamine (US9,580,732B2), the substrates of these routes being mainly L-glutamic acid, lysine, 6-hydroxycaproic acid and α, ω -diol, etc. In 2021, the recombinant plasmid composition was transferred into E.coli BL21 by Chongqing university Wang Dan to obtain two genetically engineered bacteria, and lysine (5 g/L) was used as a fermentation substrate to culture with the genetically engineered bacteria LRAD to obtain 2.18-6.65 g/L hexamethylenediamine (CN 113755419A).

There are also patent reports on simultaneous synthesis of nylon monomers such as 6-aminocaproic acid and hexamethylenediamine by designing cascade routes. In 2015, botels et al, a limited responsibility company of swiss, inflight, describe biochemical pathways for the production of 2-aminopimelic acid from 2, 6-diaminopimelic acid and for the conversion of 2-aminopimelic acid to 6-aminocaproic acid, hexamethylenediamine, etc., but the specific product titers are not described in detail (CN 106574283 a). The production of amines and diamines from carboxylic or dicarboxylic acids or monoesters thereof has been proposed by sand et al, incorporated by the Windfei, germany, but in particular examples only methyl aminoundecanoate (CN 104937104A) is present. Subsequently, yakunin, university of Toronto, synthesizes 6-aminocaproic acid and hexamethylenediamine using 20mM adipic acid as a substrate, but the maximum conversion efficiency of 6-aminocaproic acid reaches only 21.3.+ -. 0.8%, and the hexamethylenediamine yield is not explicitly indicated in the patent (CN 116064690A).

Therefore, there is a need in the art to solve the problems of low catalytic activity, poor substrate specificity, etc. of the rate-limiting enzyme Carboxylic Acid Reductase (CAR) in the multienzyme cascade catalysis of α, ω -dicarboxylic acid (C3-C12) to ω -amino fatty acids and α, ω -diamine systems to the mode substrates Adipic Acid (AA) and 6-aminocaproic acid (6-ACA).

Disclosure of Invention

The invention aims to provide a method for efficiently synthesizing alpha, omega-diamine, which comprises the following steps: (1) Using alpha, omega-dicarboxylic acid as a substrate, and using a catalyst containing a first carboxylic acid reductase mutant to catalyze and synthesize omega-amino fatty acid; (2) Using alpha, omega-dicarboxylic acid and omega-amino fatty acid as substrates, and using a catalyst containing a second carboxylic acid reductase mutant to catalyze and synthesize alpha, omega-diamine; wherein the first carboxylic acid reductase mutant has increased catalytic activity towards the substrate alpha, omega-dicarboxylic acid and decreased catalytic activity towards omega-amino fatty acids; and/or wherein the second carboxylic acid reductase mutant has enhanced catalytic activity on both the substrates alpha, omega-dicarboxylic acid and omega-amino fatty acid. The invention also provides a method for efficiently synthesizing omega-amino fatty acid. At the same time, the invention also discloses a series of carboxylic acid reductase mutants and application thereof in synthesizing omega-amino fatty acid and alpha, omega-diamine.

In a first aspect of the present invention, there is provided a method for efficiently synthesizing an α, ω -diamine, comprising the steps of:

(1) Using alpha, omega-dicarboxylic acid as a substrate, and using a catalyst containing a first carboxylic acid reductase mutant to catalyze and synthesize omega-amino fatty acid;

(2) Using alpha, omega-dicarboxylic acid and omega-amino fatty acid as substrates, and using a catalyst containing a second carboxylic acid reductase mutant to catalyze and synthesize alpha, omega-diamine;

wherein the first carboxylic acid reductase mutant has increased catalytic activity towards the substrate alpha, omega-dicarboxylic acid and decreased catalytic activity towards omega-amino fatty acids; and/or the number of the groups of groups,

wherein the second carboxylic acid reductase mutant has enhanced catalytic activity for both the substrate alpha, omega-dicarboxylic acid and omega-amino fatty acid.

In one or more embodiments, the first carboxylate reductase mutant is:

(a1) A protein with an amino acid sequence corresponding to one or more amino acids in SEQ ID No.2, position 303, position 306, position 342, position 344, position 395, position 418 and position 426;

(b1) A protein derived from (a 1) and having the function of the protein (a 1) and formed by substitution, deletion or addition of one or more amino acid residues in the amino acid sequence of the protein (a 1), wherein the amino acid sequence corresponds to one or more amino acids at positions 303, 306, 342, 344, 395, 418 and 426 of SEQ ID No.2, which are identical to amino acids after mutation at the corresponding positions of the protein (a 1);

(c1) A protein derived from (a 1) having 80% or more homology (for example, 85% or more, 88% or more, 90% or more, 92% or more, 95% or more, 98% or more, or 99% or more homology) to the amino acid sequence of the protein of (a 1) and having the function of the protein of (a 1), but one or more amino acids corresponding to positions 303, 306, 342, 344, 395, 418, 426 of SEQ ID No.2 are the same as those after the mutation of the corresponding positions of the protein of (a);

(d1) An active fragment of the protein of (a 1) comprising a structure in the spatial structure of a carboxylate reductase that interacts with a carboxylate substrate and wherein one or more of the amino acids at positions 303, 306, 342, 344, 395, 418, 426 corresponding to SEQ ID No.2 are identical to the amino acids after mutation at the corresponding positions of the protein of (a 1).

In one or more embodiments, the first carboxylate reductase mutant is selected from the group consisting of:

(1) Alanine (Ala) at position 303 to lysine (Lys);

(2) Leucine (Leu) at position 306 is mutated to lysine (Lys) or arginine (Arg);

(3) Leucine (Leu) at position 342 to lysine (Lys) or arginine (Arg);

(4) Valine (Val) at position 344 to lysine (Lys);

(5) A glycine (Gly) mutation at position 395 to lysine (Lys);

(6) Glycine (Gly) at position 418 is mutated to histidine (His), lysine (Lys), asparagine (Asn) or serine (Ser);

(7) Glycine (Gly) at position 426 was mutated to histidine (His).

In one or more embodiments, the second carboxylate reductase mutant is:

(a2) A protein with an amino acid sequence corresponding to one or more amino acids in SEQ ID No.2, 284, 303, 306, 342, 393, 395, 418 and 426;

(b2) A protein derived from (a 2) and having the function of (a 2) and formed by substitution, deletion or addition of one or more amino acid residues in the amino acid sequence of the protein (a 2), wherein one or more amino acids corresponding to 284, 303, 306, 342, 393, 395, 418 and 426 of SEQ ID No.2 are the same as those obtained by mutating the corresponding positions of the protein (a 2);

(c2) A protein derived from (a 2) having 80% or more homology (for example, 85% or more, 88% or more, 90% or more, 92% or more, 95% or more, 98% or more, or 99% or more homology) to the amino acid sequence of the protein of (a 2) and having the function of the protein of (a 2), but one or more amino acids corresponding to positions 284, 303, 306, 342, 393, 395, 418, 426 of SEQ ID No.2 are the same as those obtained by the mutation of the corresponding positions of the protein of (a);

(d2) An active fragment of the protein of (a 2) comprising a structure in the spatial structure of a carboxylate reductase that interacts with a carboxylate substrate and wherein one or more of the amino acids at positions 284, 303, 306, 342, 393, 395, 418, 426 corresponding to SEQ ID No.2 are identical to the amino acids after mutation at the corresponding positions of the protein of (a 2).

In one or more embodiments, the second carboxylate reductase mutant is selected from one or a combination of two or more of the following:

(8) Leucine (Leu) at position 284 is mutated to aspartic acid (Asp), glutamic acid (Glu), glycine (Gly), asparagine (Asn), threonine (Thr), valine (Val) or tryptophan (Trp);

(9) Alanine (Ala) at position 303 is mutated to glutamic acid (Glu), methionine (Met) or valine (Val);

(10) Leucine (Leu) at position 306 is mutated to methionine (Met) or valine (Val);

(11) Leucine (Leu) at position 342 is mutated to aspartic acid (Asp), glutamic acid (Glu), lysine (Lys), methionine (Met), asparagine (Asn), glutamine (Gln), valine (Val) or tryptophan (Trp);

(12) Glycine (Gly) at position 393 is mutated to aspartic acid (Asp) or glutamic acid (Glu);

(13) Glycine (Gly) at position 395 to glutamic acid (Glu);

(14) Glycine (Gly) at position 418 to aspartic acid (Asp) or glutamic acid (Glu);

(15) Glycine (Gly) at position 426 was mutated to serine (Ser).

In one or more embodiments, the second carboxylate reductase mutant is selected from the group consisting of:

(16) Leucine (Leu) 284 to aspartic acid (Asp), alanine (Ala) 303 to methionine (Met), leucine (Leu) 306 to isoleucine (Ile), leucine (Leu) 342 to glutamic acid (Glu), and glycine (Gly) 393 to alanine (Ala);

(17) Leucine (Leu) 284 to aspartic acid (Asp), leucine (Leu) 306 to methionine (Met), and leucine (Leu) 342 to glutamic acid (Glu);

(18) Leucine (Leu) 284 to aspartic acid (Asp), alanine (Ala) 303 to isoleucine (Ile), leucine (Leu) 306 to isoleucine (Ile), leucine (Leu) 342 to glutamic acid (Glu), and glycine (Gly) 418 to aspartic acid (Asp);

(19) Leucine 284 (Leu) to isoleucine (Ile), leucine 306 (Leu) to methionine (Met), leucine 342 (Leu) to glutamic acid (Glu), and glycine 393 (Gly) to glutamic acid (Glu);

(20) Leucine (Leu) at position 284 into aspartic acid (Asp), leucine (Leu) at position 306 into methionine (Met), leucine (Leu) at position 342 into glutamic acid (Glu), glycine (Gly) at position 393 into alanine (Ala), and glycine (Gly) at position 418 into glutamic acid (Glu);

(21) Leucine (Leu) 284 to aspartic acid (Asp), leucine (Leu) 306 to methionine (Met), leucine (Leu) 342 to glutamic acid (Glu), and glycine (Gly) 393 to glutamic acid (Glu);

(22) Leucine (Leu) at position 284 into glutamic acid (Glu), leucine (Leu) at position 306 into methionine (Met), leucine (Leu) at position 342 into glutamic acid (Glu), glycine (Gly) at position 393 into alanine (Ala), and glycine (Gly) at position 426 into serine (Ser);

(23) Leucine 284 (Leu) to phenylalanine (Phe), leucine 306 (Leu) to isoleucine (Ile), leucine 342 (Leu) to aspartic acid (Asp), and glycine 393 (Gly) to glutamic acid (Glu);

(24) Leucine 284 (Leu) to phenylalanine Phe, leucine 306 (Leu) to methionine (Met), leucine 342 (Leu) to aspartic acid (Asp), and glycine 393 (Gly) to glutamic acid (Glu);

(25) Alanine (Ala) at position 303 to methionine (Met), leucine (Leu) at position 306 to isoleucine (Ile), leucine (Leu) at position 342 to aspartic acid (Asp), and glycine (Gly) at position 393 to glutamic acid (Glu);

(26) Alanine (Ala) at position 303 to methionine (Met), leucine (Leu) at position 306 to methionine (Met), leucine (Leu) at position 342 to aspartic acid (Asp), and glycine (Gly) at position 393 to glutamine (gin);

(27) Leucine (Leu) 284 to aspartic acid (Asp), leucine (Leu) 306 to methionine (Met), leucine (Leu) 342 to aspartic acid (Asp), and glycine (Gly) 393 to glutamic acid (Glu);

(28) Leucine (Leu) at position 306 to isoleucine (Ile), leucine (Leu) at position 342 to aspartic acid (Asp), and glycine (Gly) at position 418 to aspartic acid (Asp);

(29) Leucine 284 (Leu) to glutamic acid (Glu), alanine 303 (Ala) to isoleucine (Ile), leucine 306 (Leu) to isoleucine (Ile), leucine 342 (Leu) to glutamic acid (Glu), and glycine 393 (Gly) to glutamic acid (Glu);

(30) Leucine (Leu) 284 to aspartic acid (Asp), alanine (Ala) 303 to methionine (Met), leucine (Leu) 306 to isoleucine (Ile), leucine (Leu) 342 to glutamic acid (Glu), glycine (Gly) 393 to alanine (Ala), and glycine (Gly) 418 to aspartic acid (Asp);

(31) Leucine (Leu) at position 284 into glutamine (gin), leucine (Leu) at position 306 into methionine (Met), leucine (Leu) at position 342 into glutamic acid (Glu), glycine (Gly) at position 418 into glutamic acid (Glu), and glycine (Gly) at position 426 into serine (Ser);

(32) Leucine (Leu) 284 to aspartic acid (Asp), alanine (Ala) 303 to isoleucine (Ile), leucine (Leu) 306 to isoleucine (Ile), leucine (Leu) 342 to aspartic acid (Asp), glycine (Gly) 393 to glutamic acid (Glu), and glycine (Gly) 418 to glutamic acid (Glu);

(33) Leucine 284 (Leu) to phenylalanine (Phe), leucine 306 (Leu) to isoleucine (Ile), leucine 342 (Leu) to glutamic acid (Glu), and glycine 393 (Gly) to glutamine (gin).

In one or more embodiments, the α, ω -dicarboxylic acid comprises: malonic acid (C3), succinic acid (C4), glutaric acid (C5), adipic acid (C6), pimelic acid (C7), suberic acid (C8), azelaic acid (C9), sebacic acid (C10), undecanedioic acid (C11) and dodecanedioic acid (C12).

In one or more embodiments, the omega-amino fatty acid is 3-aminopropionic acid (C3), 4-aminobutyric acid (C4), 5-aminovaleric acid (C5), 6-aminocaproic acid (C6), 7-aminoheptanoic acid (C7), 8-aminocaprylic acid (C8), 9-aminononanoic acid (C9), 10-aminodecanoic acid (C10), 11-aminoundecanoic acid (C11), 12-aminododecanoic acid (C12), or derivatives thereof.

In one or more embodiments, the α, ω -diamine is a short chain α, ω -diamine, a medium chain α, ω -diamine, or a long chain α, ω -diamine.

In one or more embodiments, the short chain refers to a carbon chain of 5C or less (e.g., 3C-5C) length, the medium chain refers to a carbon chain of 6C-9C length (6C as nylon monomer, maximum ratio), the medium chain refers to a carbon chain of 10C-12C length, and the long chain refers to a carbon chain of 13C or more.

In one or more embodiments, the terms "above" or "below" are intended to include the present number.

In one or more embodiments, the 3C-5C, 6C-9C, 10C-12C are all intended to include the endpoints.

In one or more embodiments, the α, ω -diamine comprises: 1, 3-propanediamine (C3), 1, 4-butanediamine (C4), 1, 5-pentanediamine (C5), 1, 6-hexanediamine (C6), 1, 7-heptanediamine (C7), 1, 8-octanediamine (C8), 1, 9-nonanediamine (C9), 1, 10-decanediamine (C10), 1, 11-undecanediamine (C11), 1, 12-dodecanediamine (C12) or derivatives thereof.

In one or more embodiments, the catalyst further comprises: one or more of transaminase, glucose dehydrogenase and polyphosphate kinase.

In one or more embodiments, the transaminase has an organic amine as an amino donor.

In one or more embodiments, the amino donor includes: aliphatic amine donors (e.g., isopropylamine, alanine, glutamic acid, etc.), aromatic amino donors (e.g., benzylamine, etc.).

In one or more embodiments, the glucose dehydrogenase is a glucose and NADP ⁺ As a substrate, catalyzes glucose oxidation with NADP ⁺ Reduced to NADPH.

In one or more embodiments, the glucose dehydrogenase is glucose dehydrogenase BmGDH.

In one or more embodiments, the polyphosphate kinase catalyzes the production of ATP from AMP using sodium hexametaphosphate as a substrate.

In one or more embodiments, the polyphosphate kinase is polyphosphate kinase PPK12.

In a second aspect of the present invention, there is provided a method for efficiently synthesizing omega-amino fatty acids, comprising: using alpha, omega-dicarboxylic acid as a substrate, using a first carboxylic acid reductase mutant as a catalyst, and catalyzing and synthesizing omega-amino fatty acid; wherein the first carboxylic acid reductase mutant has increased catalytic activity towards the substrate alpha, omega-dicarboxylic acid and decreased catalytic activity towards omega-amino fatty acids.

In one or more embodiments, the first carboxylate reductase mutant is:

In one or more embodiments, wherein the first carboxylate reductase mutant is selected from the group consisting of:

(1) Alanine (Ala) at position 303 to lysine (Lys);

(2) Leucine (Leu) at position 306 is mutated to lysine (Lys) or arginine (Arg);

(3) Leucine (Leu) at position 342 to lysine (Lys) or arginine (Arg);

(4) Valine (Val) at position 344 to lysine (Lys);

(5) A glycine (Gly) mutation at position 395 to lysine (Lys);

(7) Glycine (Gly) at position 426 was mutated to histidine (His).

In a third aspect of the invention, there is provided a carboxylic acid reductase mutant having an altered catalytic activity on a substrate relative to a wild-type carboxylic acid reductase.

In one or more embodiments, when the substrate is an α, ω -dicarboxylic acid, the carboxylic acid reductase mutant has increased catalytic activity for the substrate α, ω -dicarboxylic acid and decreased catalytic activity for ω -amino fatty acids; preferably, the carboxylic acid reductase mutant is a first carboxylic acid reductase mutant as defined in any one of the embodiments of the invention.

In one or more embodiments, when the substrate is an α, ω -dicarboxylic acid and ω -amino fatty acid, the carboxylic acid reductase mutant has enhanced catalytic activity on both the substrate α, ω -dicarboxylic acid and ω -amino fatty acid; preferably, the carboxylic acid reductase mutant is a second carboxylic acid reductase mutant as defined in any one of the embodiments of the invention.

In a fourth aspect of the invention, there is provided an isolated polynucleotide encoding a carboxylic acid reductase mutant of the invention, or encoding a first carboxylic acid reductase mutant or a second carboxylic acid reductase mutant as defined in any one of the embodiments of the invention.

In a fifth aspect of the invention, there is provided a vector comprising a polynucleotide of the invention; preferably, the vector is an expression vector or an expression transformant; more preferably, the expression transformant comprises an expression vector.

In a sixth aspect of the invention there is provided a genetically engineered host cell comprising a vector of the invention, or having integrated into its genome a polynucleotide of the invention.

In a seventh aspect of the invention. Providing an application selected from the group consisting of:

(a) The invention relates to a carboxylic acid reductase mutant, or the application of a first carboxylic acid reductase mutant or a second carboxylic acid reductase mutant defined in any embodiment of the invention in the catalytic synthesis of alpha, omega-diamine;

(b) The first carboxylic acid reductase mutant disclosed by the invention or the application of the first carboxylic acid reductase mutant defined in any one embodiment of the invention in catalytic synthesis of omega-amino fatty acid;

(c) The use of a carboxylic acid reductase mutant according to the invention, or a first carboxylic acid reductase mutant or a second carboxylic acid reductase mutant as defined in any one of the embodiments of the invention, for the preparation of a catalyst for the catalytic synthesis of omega-amino fatty acids and/or alpha, omega-diamines.

In one or more embodiments, the first carboxylic acid reductase mutants described herein, or as defined in any one of the embodiments, can be used to prepare catalysts for the catalytic synthesis of omega-amino fatty acids, as well as catalysts for the catalytic synthesis of alpha, omega-diamines.

In one or more embodiments, the second carboxylic acid reductase mutants described herein, or as defined in any one of the embodiments of the invention, can be used to prepare catalysts for the catalytic synthesis of α, ω -diamines.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, reaction scheme for the synthesis of BOC protected omega-amino fatty acids.

FIG. 2, schematic diagram of a multi-enzyme cascade catalytic synthesis of omega-amino fatty acids and alpha, omega-diamines of different chain lengths.

Detailed Description

Aiming at the problems of low catalytic activity, poor substrate specificity and the like of a speed-limiting enzyme Carboxylic Acid Reductase (CAR) in a multienzyme cascade catalytic alpha, omega-dicarboxylic acid (C3-C12) system for synthesizing omega-amino fatty acid and alpha, omega-diamine on a mode substrate Adipic Acid (AA) and 6-aminocaproic acid (6-ACA), the inventor provides a method for efficiently synthesizing omega-amino fatty acid and alpha, omega-diamine through intensive research, and the catalytic efficiency of the carboxylic acid reductase on AA and 6-ACA is accurately regulated and controlled through site-directed mutagenesis of the carboxylic acid reductase so as to efficiently synthesize omega-amino fatty acid and alpha, omega-diamine.

When omega-amino fatty acid is synthesized efficiently, compared with wild type carboxylic acid reductase, the carboxylic acid reductase mutant provided by the invention has higher catalytic efficiency on alpha, omega-dicarboxylic acid, and the catalytic efficiency on the product omega-amino fatty acid is reduced, so that the catalytic efficiency on a substrate is reducedThe loading is further increased and the yield of omega-amino fatty acids is higher. When the alpha, omega-diamine is synthesized efficiently, compared with wild-type carboxylic acid reductase, the carboxylic acid reductase mutant provided by the invention has improved catalytic efficiency on alpha, omega-dicarboxylic acid and omega-amino fatty acid, especially on omega-amino fatty acid _cat /K _m Greatly improves (101 times) the synthesis efficiency of alpha, omega-diamine. The invention also extends the substrate spectrum to other alpha, omega-dicarboxylic acids (C3-C12) for the synthesis of omega-amino fatty acids and alpha, omega-diamines. The invention also provides a protein and a gene of the carboxylic acid reductase mutant, a recombinant expression vector and a recombinant expression transformant containing the gene, a preparation method of a recombinant transformant culture capable of expressing the carboxylic acid reductase mutant, an application of the carboxylic acid reductase mutant or the recombinant transformant culture and aminotransferase omega-TA, glucose dehydrogenase GDH/formate dehydrogenase FDH and polyphosphatase PPK12 in cascade catalysis of alpha, omega-dicarboxylic acid to synthesize omega-amino fatty acid and alpha, omega-diamine, and the like.

As used herein, unless otherwise indicated, the terms "carboxyreductase mutant", "recombinant carboxyreductase mutant" and "recombinant carboxyreductase mutant" are used interchangeably to refer to polypeptides that correspond to wild-type carboxyreductase having a mutation in the vicinity of a binding pocket for its substrate or to polypeptides that have altered catalytic activity, preferably to polypeptides that have a mutation in one or more of positions 284, 303, 306, 342, 344, 393, 395, 418, 426 of their sequence.

As used herein, "first" and "second" are merely for the purpose of distinguishing between the mutants of a carboxylic acid reductase that are used in different steps and do not represent a sequential or chronological order.

If desired, the wild-type carboxylate reductase may be a protein having the amino acid sequence shown in SEQ ID No.2, or may be a homofunctional variant or active fragment of the protein. Preferably, the wild-type carboxylate reductase is derived from Mycobacteroides abscessus; however, it is to be understood that other homologues of the carboxylic acid reductase which are homologous thereto and functionally equivalent are also contemplated by the present invention. If desired, the polynucleotide representing the wild-type carboxylate reductase may be a polynucleotide comprising a sequence encoding the protein, e.g., a polynucleotide having a nucleotide sequence as set forth in SEQ ID No.1, or may be a polynucleotide comprising additional coding and/or non-coding sequences.

As used herein, an "isolated carboxyreductase mutant" refers to a carboxyreductase mutant that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. The skilled artisan can purify the carboxylic acid reductase mutants using standard protein purification techniques. Substantially pure proteins can produce a single main band on a non-reducing polyacrylamide gel.

As used herein, a "substrate binding pocket" refers to a position in the spatial structure of a carboxylate reductase mutant where interaction (binding) with a substrate occurs.

The protein of the present invention may be a recombinant protein, a natural protein, a synthetic protein, preferably a recombinant protein. The proteins of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacterial, yeast, higher plant, insect, and mammalian cells) using recombinant techniques.

The invention also includes fragments, derivatives and analogues of the carboxylic acid reductase mutants. As used herein, the terms "fragment," "derivative" and "analog" refer to proteins that retain substantially the same biological function or activity of the native carboxylate reductase mutants of the present invention. The protein fragments, derivatives or analogues of the invention may be (i) proteins having one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, substituted, which may or may not be encoded by the genetic code, or (ii) proteins having a substituent in one or more amino acid residues, or (iii) proteins in which an additional amino acid sequence is fused to the protein sequence (such as a leader or secretory sequence or a sequence used to purify the protein or a proprotein sequence, or fusion proteins). Such fragments, derivatives and analogs are within the purview of one skilled in the art and would be well known to those skilled in the art in view of the definitions herein. However, the above-described mutations of the present invention must be present in the amino acid sequences of the carboxylic acid reductase mutants and fragments, derivatives and analogues thereof; preferably, the mutation is a mutation corresponding to one or more amino acids 284, 303, 306, 342, 344, 393, 395, 418, 426 of SEQ ID NO. 2.

In the present invention, the term "carboxylic acid reductase mutant" also includes (but is not limited to): deletion, insertion, substitution and/or substitution of several (usually 1 to 20, more preferably 1 to 10, still more preferably 1 to 8, 1 to 5, 1 to 3 or 1 to 2) amino acids, and addition or deletion of one or several (usually 20 or less, preferably 10 or less, more preferably 5 or less) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein. As another example, the addition or deletion of one or more amino acids at the C-terminus and/or N-terminus generally does not alter the function of the protein. The term also includes active fragments and active derivatives of the carboxylic acid reductase mutants. However, in these variants, the mutations described above according to the invention must be present; preferably, the mutation is a mutation corresponding to one or more amino acids 284, 303, 306, 342, 344, 393, 395, 418, 426 of SEQ ID NO. 2.

In the present invention, the term "carboxylic acid reductase mutant" also includes (but is not limited to): derived proteins having 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, such as 98% or more, 99% or more sequence identity to the amino acid sequence of the carboxylate reductase mutant, which retain their protein activity. Likewise, in these derived proteins, the mutations described in the present invention must be present; preferably, the mutation is a mutation corresponding to one or more amino acids 284, 303, 306, 342, 344, 393, 395, 418, 426 of SEQ ID NO. 2.

As used herein, "adipic acid" and "AA" are used interchangeably and "α, ω -dicarboxylic acid" includes "adipic acid". In this context, generally, "α, ω -dicarboxylic acid" refers to "adipic acid".

As used herein, "omega-amino fatty acid" and "6-amino fatty acid" are used interchangeably, and "omega-amino fatty acid" includes "6-aminocaproic acid". In this context, generally, "omega-amino fatty acid" refers to "6-aminocaproic acid". The "6-aminocaproic acid", "6-ACA" and "ACA" are used interchangeably.

As used herein, "1, 6-hexamethylenediamine" and "hexamethylenediamine" are used interchangeably and "a, ω -diamine" includes "1, 6-hexamethylenediamine". In this context, generally, "α, ω -diamine" refers to "1, 6-hexamethylenediamine".

As used herein, "catalytic reaction," "enzyme-linked reaction," and "enzymatic reaction" are used interchangeably and refer to reactions that proceed under the catalysis of an enzyme. As used herein, the terms "multiple enzyme-linked reaction", "multiple enzyme-linked reaction" and "multistage enzyme-linked reaction" are used interchangeably and include at least two enzyme-linked reactions. In a specific embodiment, the multienzyme cascade for synthesizing an α, ω -diamine comprises: the multienzyme cascade for synthesizing omega-amino fatty acids (i.e., module I) is catalyzed using the first carboxylate reductase mutant as a catalyst, and the multienzyme cascade for synthesizing alpha, omega-diamines (i.e., module II) is catalyzed using the second carboxylate reductase mutant as a catalyst. The conditions for the multienzyme cascade are known to the person skilled in the art and can be carried out, for example, at normal temperature (e.g.20-40℃) under normal pressure and at pH 6.0-7.5.

As used herein, "catalytic efficiency" and "catalytic activity" may be used interchangeably.

Method for efficiently synthesizing omega-amino fatty acid

The invention provides a method for efficiently synthesizing omega-amino fatty acid, which comprises the step of using a first carboxylic acid reductase mutant as a catalyst. The first carboxylic acid reductase mutant has high catalytic efficiency on alpha, omega-dicarboxylic acid and low catalytic efficiency on omega-amino fatty acid, so that the substrate loading capacity is further improved, and the yield of omega-amino fatty acid is higher.

As used herein, the term "catalytic efficiency" generally refers to the catalytic activity of an enzyme on a substrate. In some embodiments, the catalytic efficiency of the enzyme is expressed in terms of a specific activity value.

In one or more embodiments, the "catalytic efficiency" increase refers to a 5%, 10%, 15%, 20%, 30% or greater increase in catalytic efficiency over a "wild-type" or "control.

In one or more embodiments, the "reduced catalytic efficiency" refers to a reduction in catalytic efficiency of 5%, 10%, 15%, 20%, 30% or less compared to a "wild-type" or "control. As used herein, a "first carboxylic acid reductase mutant" corresponds to a wild-type carboxylic acid reductase and has an altered catalytic efficiency for alpha, omega-dicarboxylic acids and omega-amino fatty acids. For example, it has an increased catalytic efficiency for α, ω -dicarboxylic acids and a decreased catalytic efficiency for ω -amino fatty acids, corresponding to wild-type carboxylic acid reductases. Since the alpha, omega-dicarboxylic acid is the substrate and the omega-amino fatty acid is the product, it can also be said that the substrate specificity and/or substrate specificity of the "first carboxylic acid reductase mutant" is changed, i.e. the specificity and/or specificity for the substrate alpha, omega-dicarboxylic acid is enhanced. In one or more embodiments, the first carboxyreductase mutant has a mutation at one or more of amino acids 303, 306, 342, 344, 395, 418, 426 corresponding to the amino acid sequence shown in SEQ ID No.2, corresponding to the wild-type carboxyreductase.

In one or more embodiments, the first carboxylate reductase mutant mutates one or more amino acids from alanine (Ala), leucine (Leu) at position 303, leucine (Leu) at position 306, leucine (Leu) at position 342, valine (Val) at position 344, glycine (Gly) at position 395, glycine (Gly) at position 418, glycine (Gly) at position 426, corresponding to the amino acid sequence shown in SEQ ID No. 2. In one or more preferred embodiments, the first carboxylate reductase mutant is mutated at one or more of the amino acid positions corresponding to the amino acid sequence set forth in SEQ ID No. 2:

(1) Alanine (Ala) at position 303 to lysine (Lys);

(2) Leucine (Leu) at position 306 is mutated to lysine (Lys) or arginine (Arg);

(3) Leucine (Leu) at position 342 to lysine (Lys) or arginine (Arg);

(4) Valine (Val) at position 344 to lysine (Lys);

(5) A glycine (Gly) mutation at position 395 to lysine (Lys);

(7) Glycine (Gly) at position 426 was mutated to histidine (His).

In one or more embodiments, the method of efficiently synthesizing omega-amino fatty acids comprises: the first carboxylic acid reductase mutant takes alpha, omega-dicarboxylic acid as a substrate, and the omega-amino fatty acid is synthesized by catalyzing multi-enzyme cascade reaction under the condition of providing an amino donor.

Method for efficiently synthesizing alpha, omega-diamine

The invention provides a method for efficiently synthesizing alpha, omega-diamine, which comprises the steps of using a second carboxylic acid reductase mutant as a catalyst to catalyze and synthesize the alpha, omega-diamine. The second carboxylic acid reductase mutant has high catalytic efficiency on alpha, omega-dicarboxylic acid and omega-amino fatty acid, so that the alpha, omega-diamine is synthesized efficiently.

In one or more embodiments, the method for efficiently synthesizing an α, ω -diamine includes a step (block I) of efficiently synthesizing an ω -amino fatty acid using the first carboxylic acid reductase mutant as a catalyst, in addition to the step (block II) of catalytically synthesizing an α, ω -diamine using the second carboxylic acid reductase mutant as a catalyst.

In one or more embodiments, the "catalytic efficiency" increase refers to a 5%, 10%, 15%, 20%, 30% or greater increase in catalytic efficiency over a "wild-type" or "control. As used herein, a "second carboxylic acid reductase mutant" corresponds to a wild-type carboxylic acid reductase and has an altered catalytic efficiency for alpha, omega-dicarboxylic acids and omega-amino fatty acids. For example, corresponding to wild-type carboxylic acid reductase, the catalytic efficiency for alpha, omega-dicarboxylic acids is increased, as is the catalytic efficiency for omega-amino fatty acids. Since the α, ω -dicarboxylic acid is the substrate and the ω -amino fatty acid is the intermediate during the synthesis of the α, ω -diamine, it can also be said that the substrate and intermediate specificity of the "second carboxylic acid reductase mutant" are changed, i.e., the substrate α, ω -dicarboxylic acid and intermediate ω -amino fatty acid specificity is enhanced. In one or more embodiments, the second carboxylate reductase mutant is mutated at one or more amino acids corresponding to positions 284, 303, 306, 342, 393, 395, 418, 426 of the amino acid sequence shown in SEQ ID No.2, corresponding to the wild-type carboxylate reductase.

In one or more embodiments, the second carboxylate reductase mutant mutates one or more amino acids of leucine 284 (Leu), alanine 303 (Ala), leucine 306 (Leu), leucine 342 (Leu), glycine 393 (Gly), glycine 395 (Gly), glycine 418 (Gly), glycine 426 (Gly) corresponding to the amino acid sequence shown in SEQ ID No. 2.

In one or more preferred embodiments, the second carboxylate reductase mutant is mutated at one or more of the amino acid positions corresponding to the amino acid sequence set forth in SEQ ID No. 2:

(13) Glycine (Gly) at position 395 to glutamic acid (Glu);

(14) Glycine (Gly) at position 418 to aspartic acid (Asp) or glutamic acid (Glu); (15) Glycine (Gly) at position 426 was mutated to serine (Ser).

In one or more embodiments, the second carboxylate reductase mutant is mutated at a plurality of amino acids corresponding to the amino acid sequence set forth in SEQ ID No.2, the mutated amino acid selected from any one of the following:

284 th, 303 th, 306 th, 342 th and 393 th bits; or (b)

284 th, 306 th and 342 th bits; or (b)

284 th bit, 303 th bit, 306 th bit, 342 th bit and 418 th bit; or (b)

284 th, 306 th, 342 th and 393 th bits; or (b)

284 th, 306 th, 342 th, 393 th and 418 th bits; or (b)

284 th bit, 306 th bit; 342 nd and 393 th bits; or (b)

284 th, 306 th, 342 th, 393 th and 426 th bits; or (b)

284 th, 306 th, 342 th and 393 th bits; or (b)

Bits 303, 306, 342 and 393; or (b)

284 th, 306 th, 342 th and 393 th bits; or (b)

306 th, 342 th and 418 th bits; or (b)

284 th, 303 th, 306 th, 342 th and 393 th bits; or (b)

284 th, 303 th, 306 th, 342 th, 393 th and 418 th bits; or (b)

284 th bit, 306 th bit, 342 th bit, 418 th bit and 426 th bit; or (b)

284 th, 303 th, 306 th, 342 th, 393 th and 418 th bits; or 284 th, 306 th, 342 th and 393 th bits.

leucine 284 (Leu), alanine 303 (Ala), leucine 306 (Leu), leucine 342 (Leu) and glycine 393 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), and leucine 342 (Leu); or (b)

Leucine 284 (Leu), alanine 303 (Ala), leucine 306 (Leu), leucine 342 (Leu), and glycine 418 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), leucine 342 (Leu) and glycine 393 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), leucine 342 (Leu), glycine 393 (Gly) and glycine 418 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), leucine 342 (Leu), glycine 393 (Gly) and glycine 426 (Gly); or (b)

Alanine (Ala) at position 303, leucine (Leu) at position 306, leucine (Leu) at position 342, and glycine (Gly) at position 393; or (b)

Leucine 306 (Leu), leucine 342 (Leu) and glycine 418 (Gly); or (b)

Leucine 284 (Leu), alanine 303 (Ala), leucine 306 (Leu), leucine 342 (Leu), glycine 393 (Gly), and glycine 418 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), leucine 342 (Leu), glycine 418 (Gly) and glycine 426 (Gly); or (b)

Leucine 284 (Leu), leucine 306 (Leu), leucine 342 (Leu) and glycine 393 (Gly).

In one or more preferred embodiments, corresponding to the amino acid sequence shown in SEQ ID No.2, the second carboxylate reductase mutant is selected from the group consisting of:

In one or more embodiments, the method for efficiently synthesizing an α, ω -diamine uses an α, ω -dicarboxylic acid as a substrate, including but not limited to: malonic acid (C3), succinic acid (C4), glutaric acid (C5), adipic acid (C6), pimelic acid (C7), suberic acid (C8), azelaic acid (C9), sebacic acid (C10), undecanedioic acid (C11) and dodecanedioic acid (C12).

In one or more embodiments, the method for efficiently synthesizing an α, ω -diamine uses organic ammonia as an amino donor, the amino donor comprising: aliphatic amine donors such as isopropylamine, alanine and glutamic acid, or aromatic amino donors such as benzylamine. Those skilled in the art will appreciate that all amino donors that can be used in the synthesis of omega-amino fatty acids and/or alpha, omega-diamines are applicable in the present invention.

In one or more embodiments, the catalyst includes (but is not limited to) in addition to the carboxylate reductase mutant: transaminase, glucose dehydrogenase and polyphosphate kinase.

In one or more embodiments, the catalytic form of the catalyst is any one of whole cells, crude cell extracts (crude enzyme solutions), or pure enzymes. The crude cell extract may be crude enzyme solution containing the carboxylic acid reductase mutant obtained by disrupting host cells transformed with the transformant of the present invention, or lyophilized enzyme powder obtained by lyophilizing the crude enzyme solution. The pure enzyme may be a pure enzyme obtained by purifying the crude enzyme solution.

In some embodiments, the carboxylic acid reductase mutants of the present invention may also increase product concentration when used in combination with other catalysts. For example, when the carboxylic acid reductase mutant disclosed by the invention is used and isopropylamine is used as an amino donor, the catalytic efficiency of the carboxylic acid reductase mutant disclosed by the invention is high, so that an intermediate product omega-amino fatty acid can be efficiently and further catalyzed, the balance movement of the aminotransferase in the last step is facilitated, and the alpha, omega-diamine with higher concentration is obtained.

In one or more embodiments, the glucose dehydrogenase is a glucose and NADP ⁺ As a substrate, catalyzes glucose oxidation with NADP ⁺ Reduced to NADPH. In one or more specific embodiments, the glucose dehydrogenase is the glucose dehydrogenase BmGDH (NCBI Reference Sequence:1GCO_A) derived from Bacillus megaterium IWG, which is useful for NADPH regeneration.

In one or more embodiments, the polyphosphate kinase catalyzes the production of ATP from AMP using sodium hexametaphosphate as a substrate. In one or more specific embodiments, the polyphosphate kinase is polyphosphate kinase PPK12 (NCBI Reference Sequence: HCY 06753.1) derived from Erysipelotrichaceae bacterium, useful for ATP regeneration.

In one or more embodiments, the α, ω -diamine can be a short chain α, ω -diamine, a medium chain α, ω -diamine, or a long chain α, ω -diamine.

In one or more embodiments, the short chain refers to a carbon chain of less than 5C in length, such as a carbon chain of 3C-5C length. The medium chain refers to a carbon chain with the length of 6C-9C. The medium-long chain refers to a carbon chain with the length of 10C-12C. The long chain refers to a carbon chain with a length of more than 13C.

In one or more embodiments, the α, ω -diamine is 1, 3-propanediamine (C3), 1, 4-butanediamine (C4), 1, 5-pentanediamine (C5), 1, 6-hexanediamine (C6), 1, 7-heptanediamine (C7), 1, 8-octanediamine (C8), 1, 9-nonanediamine (C9), 1, 10-decanediamine (C10), 1, 11-undecanediamine (C11), 1, 12-dodecanediamine (C12), or derivatives thereof.

Those skilled in the art will recognize that in synthesizing α, ω -diamines of different lengths, it is necessary to select an appropriate length of α, ω -dicarboxylic acid and/or ω -amino fatty acid as a substrate depending on the length of the chain of the desired α, ω -diamine product.

Methods for synthesizing alpha, omega-diamines using a multi-enzyme cascade are known in the art, and the conditions of the enzymatic reaction system, reaction temperature, reaction time, etc. used in the methods are known to those skilled in the art or can be obtained by routine experimentation, for example, reference may be made to Biotechnol Bioeng,2023,120,1773-1783. It is understood that all methods capable of synthesizing omega-amino fatty acids and/or alpha, omega-diamines using the carboxylic acid reductase mutants of the present invention are included within the scope of the present invention after the carboxylic acid reductase mutants of the present invention are known.

Methods for determining omega-amino fatty acids and/or alpha, omega-diamines are also known in the art, including but not limited to: high performance liquid chromatography, gas chromatography, liquid chromatography-mass spectrometry, and gas chromatography-mass spectrometry.

Nucleic acid, recombinant expression vector, recombinant expression transformant

The invention also provides polynucleotide sequences encoding the carboxylic acid reductase mutants of the invention or conservative variant proteins thereof.

The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

Polynucleotides encoding the mature proteins of the mutants include: a coding sequence encoding only the mature protein; coding sequences for mature proteins and various additional coding sequences; the coding sequence (and optionally additional coding sequences) of the mature protein, and non-coding sequences.

The "polynucleotide encoding a protein" may include a polynucleotide encoding the protein, or may include additional coding and/or non-coding sequences.

The invention also relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered with the vectors or the coding sequences of the carboxylic acid reductase mutants of the invention, and methods for producing the proteins of the invention by recombinant techniques.

The polynucleotide sequences of the invention may be used to express or produce recombinant carboxylic acid reductase mutants by conventional recombinant DNA techniques. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a carboxylic acid reductase mutant of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) Host cells cultured in a suitable medium;

(3) Isolating and purifying the protein from the culture medium or the cells.

In the present invention, the carboxylic acid reductase mutant polynucleotide sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In general, any plasmid or vector can be used as long as it replicates and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements.

In one or more embodiments, other polynucleotide sequences (e.g., polynucleotide sequences encoding other catalysts) in addition to the carboxylate reductase mutants may also be inserted into the recombinant expression vector. Other polynucleotide sequences may be inserted into the same recombinant expression vector as the carboxylate reductase mutant polynucleotide sequence, or may be inserted into a different recombinant expression vector.

Accordingly, the present invention also provides a recombinant expression transformant comprising the recombinant expression vector of the present invention into which the polynucleotide sequence of the carboxylic acid reductase mutant is inserted. The recombinant expression transformant can be prepared by simultaneously transforming and introducing two or more recombinant expression vectors (e.g., a recombinant expression vector in which a carboxylic acid reductase mutant polynucleotide sequence is inserted and a recombinant expression vector in which other catalyst polynucleotide sequences are inserted) of the present invention into a host cell by a conventional method in the art.

In one or more specific embodiments, the nucleic acid sequence encoding the carboxylate reductase mutant of the invention may be ligated to the pET30b plasmid, the aminotransferase encoding nucleic acid sequence is ligated to the pETDuet-1 plasmid (e.g., the second multiple cloning site MCS II), the glucose dehydrogenase encoding nucleic acid sequence is ligated to the pET-28a plasmid, and the polyphosphate kinase encoding nucleic acid sequence is ligated to the pET-28a plasmid, by methods conventional in the art. In a preferred embodiment, for successful expression and catalytic activity of the carboxylate reductase mutant, a nucleic acid sequence encoding the phosphopantylethynyl modification enzyme Bssfp (NCBI Reference Sequence:WP_ 003234549.1) from Bacillus sublis may be ligated to the pCDFDuet plasmid (e.g., at the first multiple cloning site MCS I).

Methods well known to those skilled in the art can be used to construct expression vectors containing a carboxylic acid reductase mutant encoding DNA sequence and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. The expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

In the present invention, the host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Representative examples of host cells are: coli (e.coli), bacillus subtilis (Bacillus subtilis), corynebacterium glutamicum (Corynebacterium glutamicum), saccharomyces cerevisiae (Saccharomyces cerevisiae), streptomycete, agrobacterium, and the like. In a specific embodiment of the invention E.coli BL21 (DE 3) is used as host cell.

It will be clear to a person of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Compared with the prior art, the invention has the excellent technical effects:

1. compared with other enzyme catalysts for synthesizing omega-amino fatty acid and alpha, omega-diamine, the carboxylic acid reductase mutant provided by the invention has the advantages of high catalytic activity, strong substrate specificity, wide catalytic substrate range and the like, and the substrate loading capacity and space-time yield reach the highest level of the current reported biological method synthesis, thereby providing a new reference and thinking for synthesizing nylon monomers in the biological method industry.

2. Since the carboxylic acid reductase catalytic process requires expensive cofactors NADPH and ATP, the cost of the required cofactors increases further with increasing substrate loading and expanding reaction system. The present invention provides a glucose dehydrogenase BmGDH (NCBI Reference Sequence:1GCO_A) derived from Bacillus megaterium IWG3 for NADPH regeneration and a polyphosphate kinase PPK12 (NCBI Reference Sequence:HCY 06753.1) derived from Erysipelotrichaceae bacterium for ATP regeneration. The two enzymes can efficiently regenerate cofactors NADPH and ATP, which is beneficial to saving the cost of cofactors in the catalytic process of the carboxylic acid reductase, and the industrialized expansion production is possible.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer.

Materials and methods

1. Synthesis of omega-amino fatty acids and alpha, omega-diamines by multienzyme cascade catalysis of alpha, omega-dicarboxylic acids

The schematic of omega-amino fatty acids and alpha, omega-diamines of different chain lengths in the synthesis of alpha, omega-dicarboxylic acids catalyzed by a multi-enzyme cascade is shown in FIG. 2.

The enzymatic reaction is carried out in Hepes-Na buffer with pH of 6.5 at 30 ℃ to synthesize omega-The amino fatty acid module 1 reaction system comprises alpha, omega-dicarboxylic acid (C3-C12), 1mM NADP (H), 10mM ATP, 120mM MgCl with a final concentration of 100mM ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and appropriate amounts of recombinant carboxylic acid reductase mutants, transaminases, glucose dehydrogenases and polyphosphate kinases.

The Module 1 and Module 2 reaction systems for the synthesis of alpha, omega-diamines include alpha, omega-dicarboxylic acid (C3-C12), 2mM NADP (H), 10mM ATP, 240mM MgCl at a final concentration of 100mM ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and appropriate amounts of recombinant carboxylic acid reductase mutants, transaminases, glucose dehydrogenases and polyphosphate kinases.

The reaction is carried out in an EP tube of a shaking reactor (1000 rpm) or in a reaction flask (8 mL or 200 mL) fed with 2M NaOH at pH Stat for controlling the pH of the reaction solution to be constant, the reaction time being based on complete conversion of the substrate or no further increase in the product concentration. During the reaction, 100. Mu.L of the reaction mixture was sampled and the reaction was terminated by adding 5. Mu.L of 6M HCl.

2. Detection of product omega-amino fatty acids by High Performance Liquid Chromatography (HPLC)

The sample treatment method is as follows: adding 20 mu L of acetonitrile into 20 mu L of sample, uniformly mixing, placing in a refrigerator at-20 ℃ for freezing for more than half an hour, centrifuging at 10000rpm for 1min, taking 20 mu L of supernatant, adding 20 mu L of 28mM Marfey and 100 mu L of DMSO, uniformly mixing, standing at 40 ℃ for derivatization for 1h, finally adding 40 mu L of 1M HCl for quenching, and filtering by an organic nylon membrane after uniformly mixing.

The specific analysis conditions were as follows:

the chromatographic column is illite C18, the mobile phase is methanol to water (0.1% trifluoroacetic acid) =50:50 (v/v), and the flow rate is 1mL/min; the column temperature was 35℃and the UV detection wavelength was 340nm.

3. Detection of product alpha, omega-diamine by High Performance Liquid Chromatography (HPLC)

The sample treatment method is as follows: mu.L of a sample was taken, 250. Mu.L of dansyl chloride (5 mg/mL) and 208. Mu.L of Hepes-Na buffer (0.1M, pH 6.5) were added, mixed well and left to stand for 10min, and finally 500. Mu.L of methanol was added, and after mixing well, the mixture was filtered through an organic nylon membrane.

The specific analysis conditions were as follows:

the chromatographic column is illite C18, the mobile phase is methanol to water (0.1% trifluoroacetic acid) =83:17 (v/v), and the flow rate is 1mL/min; the column temperature was 35℃and the UV detection wavelength was 254nm.

4. Detection of substrate alpha, omega-dicarboxylic acids by Gas Chromatography (GC)

30. Mu.L of the sample was taken, 300. Mu.L of ethyl acetate (containing an internal standard) was added, followed by sufficient shaking for 5-10min, followed by centrifugation at 12000rpm for 1min, 150. Mu.L of the organic phase was taken, dried by shaking for 1h or more with anhydrous sodium sulfate, centrifugation at 12000rpm for 1min, 50. Mu.L of the organic phase was taken and added to a memory tube, and 10. Mu.L of trimethylsilylated diazomethane and 50. Mu.L of methanol-diethyl ether (v/v=1:1) were added.

The specific analysis conditions were as follows:

the column was SH-Rxi-5Sil MS column (30 m. Times.0.25 mm. Times.0.25 μm) using nitrogen as carrier gas at a flow rate of 3mL/min. The temperatures of the injector and detector were 250 ℃ and 280 ℃, respectively, and the specific GC detection procedure was 85 ℃ for 3 minutes, with a 5 ℃/min rise to 100 ℃, then 10 ℃/min rise to 160 ℃, and finally 20 ℃/min rise to 280 ℃, and at 280 ℃ for 2 minutes.

5. Process for preparing omega-amino fatty acids

A1000 mL three-necked flask was used as a reactor, and a 200 mL-scale reaction was carried out in accordance with the above-mentioned reaction system. After the reaction was completed, the reaction solution was centrifuged at 12000rpm for 40min to remove cells, and the reaction solution was acidified to pH3.0 by adding 6M HCl solution, and the precipitated protein was removed again by centrifugation. The reaction solution was concentrated, the reaction volume was reduced, the product concentration was increased, extraction was performed with ethyl acetate (3X 20 mL), unreacted substrate or intermediate was removed, and the remaining aqueous phase mainly contained the product and salts in the buffer. After the aqueous phase was neutralized by careful addition of 6M NaOH, an equal volume of t-butanol, 1.1equiv. NaOH and 2.0equiv. Di-tert-butyl dicarbonate (Boc-anhydride) was added and the reaction mixture was stirred at room temperature for 16h (see FIG. 1 for equation). After the reaction, 2M HCl was slowly added to the mixture in an ice-water bath to neutralize the mixture, followed by extraction with ethyl acetate (1X 50 mL+2X 20 mL), and then the ethyl acetate phases were combined, washed with a saturated NaCl solution, dried over anhydrous sodium sulfate Vacuum concentration is carried out by a rotary evaporator, and a crude product is obtained. Further column purification by silica gel column chromatography, the mobile phase using ethyl acetate: petroleum ether: acetic acid=75:200:1, the purer mobile phase was collected, concentrated in vacuo by rotary evaporator to give purer product, using GC-MS or H ¹ The NMR spectrum further characterizes the structure.

Example 1: preparation of Carboxylic acid reductase MabCAR3 mutant

In this example, a gene encoding a carboxylic acid reductase (NCBI Reference Sequence:WP_ 052537360.1) derived from Mycobacteroides abscessus was obtained by gene mining, and a recombinant expression vector pET30b and a recombinant expression transformant E.coli BL21 (DE 3) containing the gene were obtained. Site-directed mutagenesis or multi-point combination mutagenesis is carried out on the 284 th Leu, the 303 rd Ala, the 306 th Leu, the 342 th Leu, the 344 th Val, the 393 th Gly, the 395 th Gly, the 418 th Gly and the 426 th Gly in the amino acid sequence shown in SEQ ID No. 2. Site-directed mutagenesis was performed using the protocol described by IISite-Directed Mutegenesis Kit (Stratagenem Catalog #200502). Firstly, designing a mutation primer containing a mutation point, wherein the mutation primer containing the mutation point is a primer commonly used in the field, only the amino acid residue in SEQ ID No.2 is required to be mutated into the amino acid residue required by the invention through a common genetic engineering technology, and the specific mutation code of the nucleic acid is not limited. The 284 th, 303 th, 306 th, 342 nd, 344 th, 393 th, 395 th, 418 th and 426 th introduced mutations in the sequence are all site-directed mutagenesis primers.

PCR reaction System (10. Mu.L): template 20-50 ng, a pair of mutation primers each 0.5. Mu.L (10. Mu.M), 5. Mu.L PrimeStarmix, sterilized double distilled water make-up system to 10. Mu.L. Wherein the template is a carboxylate reductase (MabCAR 3, WP_198151610.1,SEQ ID No.2).

PCR reaction procedure: (1) denaturation at 95℃for 3min; (2) denaturation at 98℃for 10s; (3) annealing at 55 ℃ for 5s; (4) extending at 72 ℃ for 9min; steps (2) - (4) were extended for 25 cycles altogether, and finally extended for 10min at 72 ℃ and the product was preserved at 4 ℃.

For multipoint combination mutation, in order to further improve mutation efficiency, a short gene fragment containing a plurality of combination mutation sites is designed, and the gene fragment corresponding to the wild-type carboxylic acid reductase is replaced by a one-step cloning mode.

The PCR product obtained was digested with restriction enzyme Dpn I at 37℃for 0.5-2 hours and transformed into E.coli BL21 (DE 3) competent cells, and uniformly spread on an agar plate of LB medium (peptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, agar powder: 20 g/L) containing 50. Mu.g/mL kanamycin. After culturing for 10-16h at 37 ℃, selecting a monoclonal to obtain an E.coli BL21 (DE 3) strain containing mutant expression plasmids, and sending the E.coli BL21 strain to Shanghai qinghao biological science and technology Co., ltd for sequencing analysis. The sequencing results were aligned with the wild-type carboxylate reductase gene sequence using snapge software to confirm the differences in the gene sequences before and after mutation and the corresponding amino acid sequences.

The gene sequences of other biological enzyme catalysts such as aminotransferase, glucose dehydrogenase, polyphosphatase and the like required in the multienzyme cascade reaction are synthesized by Shanghai qing biological science and technology Co-Ltd after codon optimization based on an escherichia coli expression system, and are introduced into corresponding carrier plasmids, and finally are transformed into escherichia coli E.coli BL21 (DE 3).

Example 2: co-expression of carboxylic acid reductase MabCAR3 mutant gene and phosphopantetheinyl transferase sfp gene

Plasmids were extracted from E.coli BL21 (DE 3) strains containing mutant plasmids using the Qiagen miniprep plasmid extraction kit, while plasmid pCDFDuet expressing sfp was extracted in bulk from transformants containing sfp. The obtained double plasmids are simultaneously and chemically transformed into E.coli BL21 (DE 3) competent cells, and uniformly coated on LB culture medium agar plates (peptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, agar powder: 20 g/L) containing 50 mug/mL kanamycin and streptomycin dual resistance, cultured for 12-18h at 37 ℃, and monoclonal bodies are picked up to obtain expression strains for expressing different carboxylic acid reductase mutants, and the strains simultaneously co-express sfp, and have the function of modifying the tail ends of the carboxylic acid reductase so as to ensure the catalytic efficiency.

Example 3: preparation of MabCAR3 and mutant, transaminase, glucose dehydrogenase/formate dehydrogenase and polyphosphatase biological enzyme catalyst thereof

Preparation of crude enzyme: the monoclonal colonies obtained in example 1 and example 2 were picked up to 4mL of LB medium (containing streptomycin and kanamycin) and shake-cultured at 37℃with 180rpm for 12-16 hours, followed by shaking-culturing with shaking at 180rpm at 37℃with 100mL of LB medium (containing streptomycin, kanamycin or ampicillin) inoculated at 1% (v/v) of inoculum size. When the OD of the culture solution reaches 0.6-0.8, isopropyl-beta-D-thiogalactoside (IPTG) with the final concentration of 0.2mM is added as an inducer to induce for 16-24 h at 16 ℃. The culture broth was centrifuged at 10000rpm for 3min, and the pellet was washed twice with physiological saline to obtain recombinant expression transformant cells. Suspending the obtained recombinant cells in 10mL Buffer A Buffer solution, carrying out ultrasonic crushing, centrifuging and collecting supernatant to obtain crude enzyme solutions of the recombinant carboxylic acid reductase mutant, the transaminase, the glucose dehydrogenase and the polyphosphate kinase, concentrating the obtained crude enzyme solutions by using a 100kDa or 10kDa ultrafiltration tube for 10-20 times, and then redissolving the crude enzyme solutions in a refrigerator at the temperature of minus 80 ℃ for freezing and preserving.

Preparation of pure enzyme: the obtained recombinant carboxylic acid reductase mutant, transaminase, glucose dehydrogenase and polyphosphate kinase crude enzyme solution are further purified. The following is a protein purification buffer formulation: buffer a:25mM Hepes-Na, pH 7.5, 500mM NaCl,20mM imidazole; buffer B:25mM Hepes-Na, pH 7.5, 500mM NaCl,500mM imidazole; buffer C:25mM Hepes-Na, pH 7.5, 150mM NaCl,1mM DTT,5% glycerol. Loading the crude enzyme solution of the carboxylic acid reductase obtained by crushing onto a nickel column balanced by the solution A, eluting the impurity protein in the column by using the solution B of 10 percent after loading, eluting the target protein by using the solution B of 50 percent, verifying whether the target protein is contained by using SDS-PAGE, collecting the eluent containing the target protein, ultrafiltering and concentrating by using a ultrafilter tube (10 kDa or 30 kDa), replacing twice by using the solution C to remove imidazole in the protein solution, quick-freezing by using liquid nitrogen, and storing at the temperature of-80 ℃ for later use.

Preparing freeze-dried enzyme powder: after the above wet cells were collected by centrifugation, the cells (150-200 g/L) were resuspended in sodium phosphate buffer (100 mM, pH 7.5), followed by sieving, and cell disruption was performed three times by high pressure homogenizer (700-800 MPa), and the disrupted solution was centrifuged at 8000rpm at 4℃for 40min to collect the supernatant, which was frozen at-80℃overnight. Freeze-drying the frozen enzyme liquid by adopting a freeze dryer, collecting the obtained freeze-dried enzyme powder, and placing the freeze-dried enzyme powder at 4 ℃ for sealing and preserving.

Example 4: determination of specific Activity of MabCAR3 and its mutants on the model substrates adipic acid and 6-aminocaproic acid

Since the reaction of the substrate adipic acid of the MabCAR3 catalytic mode requires consumption of the cofactor NADPH, the NADPH has a higher absorption value at 340nm, and the corresponding product NADP ⁺ There is no absorbance, so DeltaOD is detected by a spectrophotometer ₃₄₀ The decrease in time of 1min was used to calculate the specific activity of mabar 3.

The specific activity measuring system of MabCAR3 and the mutant thereof on adipic acid and 6-aminocaproic acid is as follows: the total reaction system was 1mL, and the reaction was carried out at 30℃in 100mM Hepes-Na buffer (pH 7.5) comprising adipic acid or 6-aminocaproic acid, 0.15mM NADPH, 1mM ATP and 10mM MgCl at a final concentration of 10mM ₂ And an appropriate amount of recombinant carboxylic acid reductase mutant pure enzyme catalyst to ensure Δod ₃₄₀ Between 0.05 and 0.2, so that the measurement data of the enzyme activity is more accurate.

Firstly, performing site-directed saturation mutation on some key amino acid sites based on Rosetta energy score and NAC frequency, virtually screening about 8000 mutants in total, selecting a small part of mutants for wet experiment verification, selecting dominant single-point mutants after experiment verification for virtual screening calculation of combined mutation, and finally selecting dominant multi-point combined mutants after virtual screening for wet experiment verification.

When 6-aminocaproic acid is synthesized, the optimal carboxylic acid reductase mutant has improved specific activity on substrate adipic acid, and reduced or even absent specific activity on product 6-aminocaproic acid. The result shows that the specific activity of the wild type MabCAR3 pure enzyme to the substrate adipic acid is 0.20U/mg, and a series of single-point or multi-point dominant mutants with improved specific activity are obtained. The mutant sequences of these mutants and the changes in the catalytic activity of these mutants on adipic acid are shown in Table 1. In the list of table 1, the sequence numbers refer to the corresponding series of sequences following table 1, respectively; in the multiple of the improvement of the specific activity of the mutant, a plus sign "+" indicates that the specific activity of the mutant protein to adipic acid is improved by 0.1-1.5 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the two plus signs "++" indicate that the specific activity of the mutant protein to adipic acid is improved by 1.6-3.0 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the three plus signs "++ + +" indicate that the specific activity of the mutant protein to adipic acid is improved 3.1-5.0 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2. Four plus signs "++ + +." indicates mutant specific activity ratio of protein to adipic acid the protein composed of the amino acid sequence shown in SEQ ID No.2 is improved by more than 5.0 times.

The specific activity of the wild type MabCAR3 pure enzyme to the product 6-aminocaproic acid is 0.017U/mg, and a series of single-point dominant mutants with reduced specific activity are obtained. The mutant sequences of these mutants and the changes in the catalytic activity of these mutants on 6-aminocaproic acid are shown in Table 1. In the list of table 1, the sequence numbers refer to the corresponding series of sequences following table 1, respectively; in the reduction multiple of the specific activity of the mutant, a plus sign "+" indicates that the specific activity of the mutant protein to 6-aminocaproic acid is reduced by more than 40% compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the two plus signs "++" indicate that the specific activity of the mutant protein to 6-aminocaproic acid is reduced by 20% -40% compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the three plus signs "++ + +" indicate that the specific activity of the mutant protein to 6-aminocaproic acid is reduced by 10% -20% compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2. Four plus signs "+++". Representing mutant proteins specific activity ratio to 6-aminocaproic acid the protein with the amino acid sequence shown in SEQ ID No.2 is reduced to less than 10% of the original protein.

TABLE 1MaCAR3 and the ratio of the increase in specific activity of the mutant thereof to the substrate Adipic Acid (AA) and the decrease in specific activity of the product 6-aminocaproic acid (6-ACA)

In order to further synthesize hexamethylenediamine with high efficiency, dominant mutants with improved catalytic efficiency on 6-aminocaproic acid are required to be screened, and first, the specific activity of the single-point mutants after virtual screening is tried to be measured. The result shows that the specific activity of the wild type MabCAR3 pure enzyme to 6-aminocaproic acid is 0.017U/mg. The mutant sequences of these mutants and the fold increase in the catalytic activity of these mutants on 6-aminocaproic acid are shown in Table 2. In the list of table 2, the sequence numbers refer to the corresponding series of sequences following table 2, respectively; in the multiple of the improvement of the specific activity of the mutant, a plus sign "+" indicates that the specific activity of the mutant protein to 6-aminocaproic acid is improved by 0.1-1.5 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the two plus signs "++" indicate that the specific activity of the mutant protein to 6-aminocaproic acid is improved by 1.6-3.0 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the three plus signs "++ + +" indicate that the specific activity of the mutant protein to 6-aminocaproic acid is improved 3.1-5.0 times compared to the protein consisting of the amino acid sequence shown in SEQ ID No. 2. Four plus signs "+++". Representing mutant proteins specific activity ratio to 6-aminocaproic acid the protein composed of the amino acid sequence shown in SEQ ID No.2 is improved by more than 5.0 times.

TABLE 2 specific Activity of MaCAR3 and mutants thereof on 6-aminocaproic acid (6-ACA) fold improvement

/>

The single point mutation obtains better results, and the mutants with obviously improved specific activity to 6-ACA are successfully obtained, so that the combined calculation is continuously carried out on 6 dominant mutation points L284/L306/L342/G393/G418/A303, 8000 mutants are accumulated, 18 combined mutants shown in the table 3 are finally selected to determine the specific activity to adipic acid and 6-aminocaproic acid, the improvement times of the mutants in the table 3 are shown in the table 1, and the difference is that the "+" is used for indicating the improvement times of the 6-ACA instead of the reduction times of the 6-ACA in the table 3. As shown in Table 3, the specific activities of a plurality of multi-point combined mutants on adipic acid and 6-aminocaproic acid are obviously improved, the specific activities can be improved by more than 5 times, the highest activity on 6-aminocaproic acid is improved by more than 65 times, and the dominant mutants combined with mutation can be used for efficiently synthesizing alpha, omega-diamine in the subsequent examples.

TABLE 3 specific Activity of MaCAR3 and its mutants on substrate Adipic Acid (AA) and product 6-aminocaproic acid (6-ACA) fold increase

Example 6: wild type carboxylic acid reductase MabCAR3 _WT Application in synthesizing 6-aminocaproic acid

The present invention is not limited to the conversion of alpha, omega-dicarboxylic acids to omega-amino fatty acids and alpha, omega-diamines, but is equally applicable to the conversion of other similar alpha, omega-dicarboxylic acids to omega-amino fatty acids and alpha, omega-diamines.

In this example, NADPH is regenerated by glucose dehydrogenase GDH, ATP is regenerated by polyphosphate kinase PPK, 6-aminocaproic acid is synthesized by CAR and TA cascade catalysis of adipic acid, 8mL of the reaction system is reacted in Hepes-Na buffer with pH of 6.5 at 30 ℃ (temperature control by water circulation) and 800rpm, and the pH of the reaction solution is controlled to be constant by pH Stat fed-batch of 2M NaOH due to the large amount of acid generated in the cascade reaction. The reaction system comprises 100mM AA, 1mM NADP (H), 10mM ATP and 120mM MgCl ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and 50mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _WT Crude cell extracts, 9U of aminotransferase SpTA,50U of glucose dehydrogenase BmGDH and 10U of polyphosphate kinase PPK12 were sampled by reaction for 18 h.

The amount of 6-aminocaproic acid produced was measured by HPLC, and GC measured the consumption of adipic acid as a substrate and the yield of 6-aminocaproic acid as possible by-products, 6-hydroxycaproic acid and hexanediol, etc., as high as 24.8% (titer: 24.8 mM), and no by-products, 6-hydroxycaproic acid and hexanediol, etc., were detected. At the same time, a small amount ofHexamethylenediamine, illustrating the wild-type carboxylic acid reductase MabCAR3 _WT Has catalytic activity on 6-aminocaproic acid, has poor substrate specificity and needs to be further improved.

Example 7: carboxylic acid reductase mutant MabCAR3 _M9 Application in synthesizing 6-aminocaproic acid

In this example, NADPH is regenerated by glucose dehydrogenase GDH, ATP is regenerated by polyphosphate kinase PPK, 6-aminocaproic acid is synthesized by CAR and TA cascade catalysis of adipic acid, 8mL of the reaction system is reacted in Hepes-Na buffer with pH of 6.5 at 30 ℃ (temperature control by water circulation) and 800rpm, and the pH of the reaction solution is controlled to be constant by pH Stat fed-batch of 2M NaOH due to the large amount of acid generated in the cascade reaction. The reaction system comprises 100mM AA, 1mM NADP (H), 10mM ATP and 120mM MgCl ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and 50mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M9 Crude cell extracts, 9U of aminotransferase SpTA,50U of glucose dehydrogenase BmGDH and 10U of polyphosphate kinase PPK12 were sampled by reaction for 18 h.

The amount of 6-aminocaproic acid produced was measured by HPLC, and GC measured the consumption of adipic acid as a substrate and the possible byproducts 6-hydroxycaproic acid and hexanediol, etc., and the yield of 6-aminocaproic acid reached 65.1% (titer: 65.1 mM), and no byproduct 6-hydroxycaproic acid and hexanediol, etc., were detected. Meanwhile, no hexamethylenediamine was detected, indicating that the carboxylic acid reductase mutant MabCAR3 _M9 The mutant has no catalytic activity on 6-aminocaproic acid and strong substrate specificity, and the catalytic efficiency of the mutant to 6-ACA is successfully reduced while the catalytic efficiency of AA is improved.

Example 8: carboxylic acid reductase mutant MabCAR3 _M9 And formate dehydrogenase cascade in the synthesis of 6-aminocaproic acid

In this example, NADPH was regenerated by formate dehydrogenase FDH, ATP was regenerated by polyphosphate kinase PPK, 6-aminocaproic acid was synthesized by CAR and TA cascades, 8mL of the reaction system was reacted in Hepes-Na buffer of pH 6.5 at 30℃under 800rpm, and since a large amount of acid was produced during the cascade reaction, the pH of the reaction solution was controlled to be constant by pH Stat fed with 2M NaOH.The reaction system comprises 100mM AA, 1mM NADP (H), 10mM ATP and 120mM MgCl ₂ 1mM PLP, 120mM sodium formate, 100mM Poly P6 and 200mM isopropylamine, and 50mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M9 Crude cell extracts, 9U of aminotransferase SpTA,50U of formate dehydrogenase BstFDH and 10U of polyphosphate kinase PPK12 were sampled by reaction for 18 h.

The amount of 6-aminocaproic acid produced was measured by HPLC, and GC measured the consumption of adipic acid as a substrate and the yields of 6-aminocaproic acid and hexanediol, etc. as possible by-products, up to 62.4% (titer: 62.4 mM), and no by-products, 6-hydroxycaproic acid and hexanediol, etc., were detected, and the product titer of 6-aminocaproic acid in this example was almost the same as in example 7 when NADPH was regenerated using glucose dehydrogenase GDH.

Example 9: application of carboxylic acid reductase MabCAR3 mutant in synthesis of short-chain omega-amino fatty acid (C3-C5)

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, CAR and TA cascades to catalyze the synthesis of alpha, omega-dicarboxylic acids (C3-C5) to omega-amino fatty acids (C3-C5), and other bio-enzyme catalysts used in this route to regenerate NADPH and ATP are also protected by this patent. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6.5 at 30℃and 800rpm, and the pH of the reaction solution was controlled to be constant by feeding 2M NaOH through pH Stat since a large amount of acid was generated during the cascade reaction. The reaction system comprises final concentration of 50mM malonic acid/succinic acid/glutaric acid, 0.5mM NADP (H), 5mM ATP and 60mM MgCl ₂ 1mM PLP, 60mM glucose, 50mM Poly P6 and 100mM isopropylamine, and 25mg _{wet cell} The recombinant carboxylic acid reductase MabCAR3 mutant crude cell extract, 4.5U of aminotransferase SpTA,25U of glucose dehydrogenase BmGDH and 5U of polyphosphatase PPK12 freeze-dried enzyme powder are reacted for 18 hours for sampling.

The amount of 3-aminopropionic acid/4-aminobutyric acid/5-aminopentanoic acid produced is detected by HPLC, and GC detects the consumption of malonic acid/succinic acid/glutaric acid as substrate and 3-hydroxypropionic acid/4-hydroxybutyric acid/5-hydroxypentanoic acid and propylene glycol/butanediol/pentanediol as possible byproducts. As shown in Table 4, the product titer of 5-aminopentanoic acid was 20.3mM, which was significantly reduced compared to 6-aminocaproic acid, mainly because the number of carbon atoms was reduced to short-chain carbon, the CAR specific activity was significantly reduced, and the product titers also showed a gradual decrease trend with the reduction of the number of carbon atoms, and the product titers of 3-aminopropionic acid and 4-aminobutyric acid were 11.6mM and 15.8mM, respectively.

TABLE 4 MabCAR3 mutant and transaminase cascade catalytic short chain alpha, omega-dicarboxylic acids (C3-C5) synthesis of omega-amino fatty acids

Example 10: application of carboxylic acid reductase MabCAR3 mutant in synthesis of medium-chain omega-amino fatty acid (C7-C9)

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, and CAR and TA cascades to catalyze the synthesis of alpha, omega-dicarboxylic acids (C7-C9) to omega-amino fatty acids (C7-C9), and other bio-enzyme catalysts used in this route to regenerate NADPH and ATP are also protected by this patent. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6.5 at 30℃and 1000rpm, and the pH of the reaction solution was controlled to be constant by feeding 2M NaOH through pH Stat since a large amount of acid was generated during the cascade reaction. The reaction system comprises 100mM pimelic acid/suberic acid/azelaic acid, 1mM NADP (H), 10mM ATP and 120mM MgCl ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and 50mg _{wet cell} The crude cell extract of the recombinant carboxylic acid reductase MabCAR3 mutant, 9U of aminotransferase SpTA,50U of glucose dehydrogenase BmGDH and 10U of polyphosphate kinase PPK12 were reacted for 18 hours for sampling.

The amount of the product 7-aminoheptanoic acid/8-aminocaprylic acid/9-aminononanoic acid produced was measured by HPLC, and the GC measured the consumption of the substrate pimelic acid/suberic acid/azelaic acid and the possible byproducts 7-hydroxyheptanoic acid/8-hydroxyoctanoic acid/9-hydroxynonanoic acid and heptanediol/octanediol/nonanediol, etc. As shown in Table 5, the yield of 7-aminoheptanoic acid was higher than that of 6-aminocaproic acid, reaching 74.3% (74.3 mM titer), and the 8-aminocaprylic acid and 9-aminononanoic acid titers were further improved, 82.5mM and 90.3mM, respectively, without detecting any by-products.

TABLE 5 MabCAR3 mutant and transaminase cascade catalytic Medium chain alpha, omega-dicarboxylic acids (C7-C9) Synthesis of omega-amino fatty acids

Example 11: application of carboxylic acid reductase MabCAR3 mutant in synthesis of medium-long chain omega-amino fatty acid (C10-C12)

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, and CAR and TA cascades to catalyze the synthesis of alpha, omega-dicarboxylic acids (C10-C12) to omega-amino fatty acids (C10-C12), and other bio-enzyme catalysts used in this route to regenerate NADPH and ATP are also protected by this patent. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6.5 at 30℃and 1000rpm, and the pH of the reaction solution was controlled to be constant by feeding 3M NaOH through pH Stat since a large amount of acid was generated during the cascade reaction. The reaction system comprises final concentration of 200mM sebacic acid/undecanedioic acid/dodecanedioic acid, 1mM NADP (H), 15mM ATP, 240mM MgCl ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and 100mg _{wet cell} The crude cell extract of the recombinant carboxylic acid reductase MabCAR3 mutant/mL, 18U of aminotransferase SpTA,100U of glucose dehydrogenase BmGDH and 20U of polyphosphate kinase PPK12 were reacted for 18 hours for sampling.

The amount of the product 10-aminodecanoic acid/11-aminoundecanoic acid/12-aminododecanoic acid produced was checked by HPLC, and the GC checked the consumption of the substrate sebacic acid/undecanedioic acid/dodecanedioic acid and the possible byproducts 10-hydroxydecanoic acid/11-hydroxyundecanoic acid/12-hydroxydodecanoic acid and decanediol/undecanediol/dodecanediol, etc. As the carbon chain increased, the CAR specific activity tended to increase further to 200mM, resulting in a titre of 10-aminodecanoic acid of 110.4mM, and the product 11-aminoundecanoic acid (122.3 mM titres) and 12-aminododecanoic acid (103.9 mM titres) titres were comparable to 10-aminodecanoic acid, with no by-products detected, as shown in table 6.

TABLE 6 MabCAR3 mutant and transaminase Cascade catalysis of Medium-Long chain alpha, omega-dicarboxylic acids (C10-C12) Synthesis of omega-amino fatty acids

Example 12: carboxylic acid reductase mutant MabCAR3 _M9 Amplification of synthetic 6-aminocaproic acid system and preparation of products

The reaction system was further scaled up to 300mL of a system using glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, CAR and TA cascades to catalyze adipic acid to synthesize 6-aminocaproic acid as a monomer of nylon 6 in a Hepes-Na buffer solution of pH 6.5 under conditions of 30 ℃ (temperature control by water circulation) and 800rpm, and since a large amount of acid is generated during the cascade reaction, the pH of the reaction solution was controlled to be constant by pH Stat fed with 2M NaOH. The reaction system comprises 100mM AA and 1mM NADP ⁺ 、10mM ATP、120mM MgCl ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and 50mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M9 Crude cell extracts, 225U of the aminotransferase SpTA,500U of the glucose dehydrogenase BmGDH and 250U of the polyphosphate kinase PPK12 were sampled by reaction for 18 h. Because the reaction system is large and the consumption of the freeze-dried enzyme powder is large, the four element enzymes are directly crushed and centrifuged by a high-pressure homogenizer (the preparation method is described in the embodiment 3), and the high-pressure homogenizer can crush high-concentration thalli, which is equivalent to the crushed and concentrated crude enzyme liquid by an ultrasonic crusher.

The amount of 6-aminocaproic acid produced was measured by HPLC, and GC measured the consumption of adipic acid as a substrate and the yield of 6-aminocaproic acid as possible by-products, 6-hydroxycaproic acid and hexanediol, etc., as high as 55.1% (55.1 mM), and no by-products, 6-hydroxycaproic acid and hexanediol, etc., were detected. Finally, separating and preparing 6-aminocaproic acid from the reaction mixed solution according to the omega-amino fatty acid preparation method, verifying through GC-MS, and successfully realizing gram-grade preparation of nylon monomers, wherein the separation yield reaches 42.1%.

Example 13: wild type carboxylic acid reductase MabCAR3 _WT Application in synthesizing 1, 6-hexamethylenediamine

In this example, glucose dehydrogenase GDH was used to regenerate NADPH, polyphosphate kinase PPK was used to regenerate ATP, CAR and TA cascades catalyzed adipic acid to synthesize 6-aminocaproic acid first, and CAR and TA cascades catalyzed 6-aminocaproic acid to synthesize 1, 6-hexamethylenediamine. Other biological enzyme catalysts that regenerate NADPH and ATP can also be used in this route. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6 at 30℃and 800rpm (temperature control by water circulation), and the pH of the reaction solution was controlled to be constant by pH Stat fed-batch of 2M NaOH since a large amount of acid was produced during the cascade reaction. The reaction system comprises 100mM AA, 2mM NADP (H), 10mM ATP and 240mM MgCl ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and 100mg _wet _cell /mL recombinant carboxylic acid reductase MabCAR3 _WT Crude cell extract, 18U of aminotransferase SpTA,50U of glucose dehydrogenase BmGDH and 20U of polyphosphatase PPK12 freeze-dried enzyme powder, and sampling after 18 h.

The formation concentrations of the product 1, 6-hexamethylenediamine and the intermediate product 6-aminocaproic acid were detected by HPLC, the consumption of the substrate adipic acid and the possible byproducts 6-hydroxycaproic acid and hexanediol, etc., were detected by GC, the concentration of the product 1, 6-hexamethylenediamine was 1.4mM, most of which accumulated in the intermediate product 6-aminocaproic acid, and any byproducts 6-hydroxycaproic acid and hexanediol, etc., were not detected. This result indicates that the wild-type carboxylate reductase MabCAR3 _WT Too low catalytic activity on 6-aminocaproic acid results in a considerable accumulation of intermediate 6-aminocaproic acid, whereas the final 1, 6-hexamethylenediamine concentration is too low.

Example 14: carboxylic acid reductase mutant MabCAR3 _M39 And MabCAR3 _M42 Application in synthesizing 1, 6-hexamethylenediamine

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, mabCAR3 _M39 And TA cascade catalysis of adipic acid to synthesize 6-aminocaproic acid first and then MabCAR3 _M42 And TA cascade catalysis of 6-aminocaproic acid to synthesize 1, 6-hexamethylenediamine, 8mL of the reaction system is carried out in Hepes-Na buffer solution with pH of 6.5 at 30 ℃ (temperature control by water circulation) and 800rpm due to the stage The co-reaction process produced a large amount of acid, so the pH of the reaction solution was controlled to be constant by pH Stat fed-batch with 2M NaOH. The reaction system comprises 100mM AA, 1mM NADP (H), 10mM ATP and 240mM MgCl ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and 8.3mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M39 Crude cell extract, 91.7mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M42 Crude cell extracts, 18U aminotransferase SpTA,50U glucose dehydrogenase BmGDH and 20U polyphosphate kinase PPK12 were sampled by reaction for 18 h. Of particular note is mutant MabCAR3 _M39 Has higher catalytic efficiency on AA, and mutants MabCAR3 _M42 The catalytic efficiency to 6-ACA is higher, the specific activity to 6-ACA is controlled to be slightly higher than that of AA by adjusting the proportion of the two carboxylic acid reductase mutants in the cascade reaction, and the cascade reaction is carried out before the cascade reaction is promoted by the cascade reaction, so that the yield of the final product 1, 6-hexamethylenediamine is improved.

The formation concentrations of the product 1, 6-hexamethylenediamine and the intermediate 6-aminocaproic acid were detected by HPLC, the consumption of the substrate adipic acid and possible by-products 6-hydroxycaproic acid and hexanediol, etc., the concentration of the product 1, 6-hexamethylenediamine was increased to 49.5mM, the remaining amount accumulated in the intermediate 6-aminocaproic acid (25.1 mM) and the substrate adipic acid (15.3 mM) was not consumed completely, and any by-products 6-hydroxycaproic acid and hexanediol, etc. were not detected. The results show that: compared with wild type carboxylic acid reductase MabCAR3 _WT Mutant MabCAR3 _M39 、MabCAR3 _M42 The catalytic activity of adipic acid and 6-aminocaproic acid is obviously improved, the final product 1, 6-hexamethylenediamine is improved by 35 times, the accumulation of the intermediate product 6-aminocaproic acid is greatly reduced, and the substrate adipic acid is almost consumed completely.

Example 15: application of carboxylic acid reductase MabCAR3 mutant in synthesis of short-chain alpha, omega-diamine (C3-C5)

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, CAR and TA cascade continuous carboxylic acid reductive amination to catalyze the synthesis of alpha, omega-diamine (C3-C5) from alpha, omega-dicarboxylic acid (C3-C5), as are other biological enzyme catalysts used in this route to regenerate NADPH and ATPProtected by this patent. The reaction was carried out in 8mL of Hepes-Na buffer at pH 6.5 (temperature control by water circulation) at 25℃and 800rpm, and the pH of the reaction solution was controlled to be constant by pH Stat fed-batch of 2M NaOH because a large amount of acid was produced during the cascade reaction. The reaction system comprises final concentration of 50mM malonic acid/succinic acid/glutaric acid, 0.5mM NADP (H), 5mM ATP and 120mM MgCl ₂ 1mM PLP, 120mM glucose, 100mM Poly P6 and 200mM isopropylamine, and 4.2mg _{wet cell} Recombinant carboxylic acid reductase/mLCrude cell extract, 45.8mg _{wet cell} Recombinant Carboxylic acid reductase/mL->Crude cell extract, 9U of aminotransferase SpTA,25U of glucose dehydrogenase BmGDH and 10U of polyphosphate kinase PPK12 freeze-dried enzyme powder, and sampling after 18 h.

The concentration of the products 1, 3-propanediamine/1, 4-butanediamine/1, 5-pentanediamine and the intermediates 3-aminopropionic acid/4-aminobutyric acid/5-aminopentanoic acid were measured by HPLC, and the consumption of the substrates malonic acid/succinic acid/glutaric acid and possible by-products omega-hydroxy fatty acid and alpha, omega-diol, etc. were measured by GC. As a result, as shown in Table 7, the concentrations of 1, 3-propanediamine, 1, 4-butanediamine and 1, 5-pentanediamine were 16.2mM,26.1mM and 31.3mM, respectively, and no by-products were detected, and a small amount of the intermediate omega-amino fatty acid was accumulated.

TABLE 7 synthesis of alpha, omega-diamines by cascade catalysis of short-chain alpha, omega-dicarboxylic acids (C3-C5) by MabCAR3 mutants and aminotransferase

Example 16: application of carboxylic acid reductase MabCAR3 mutant in synthesis of medium-chain alpha, omega-diamine (C7-C9)

The present embodiment uses grapesSugar dehydrogenase GDH regenerates NADPH, polyphosphate kinase PPK regenerates ATP, CAR and TA cascade continuous carboxylic acid reductive amination of alpha, omega-dicarboxylic acid (C7-C9) to alpha, omega-diamine (C7-C9), and other bio-enzyme catalysts used in this route to regenerate NADPH and ATP are also protected by this patent. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6.5 at 30℃and 1000rpm, and the pH of the reaction solution was controlled to be constant by feeding 2M NaOH through pH Stat since a large amount of acid was generated during the cascade reaction. The reaction system comprises 100mM pimelic acid/suberic acid/azelaic acid, 1mM NADP (H), 10mM ATP and 240mM MgCl ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and 8.4mg _{wet cell} Recombinant carboxylic acid reductase/mLCrude cell extract, 91.6mg _{wet cell} Recombinant Carboxylic acid reductase/mL->Crude cell extracts, 18U aminotransferase SpTA,50U glucose dehydrogenase BmGDH and 20U polyphosphate kinase PPK12 were sampled by reaction for 18 h.

The formation concentrations of the products 1, 7-heptanediamine/1, 8-octanediamine/1, 9-nonanediamine and the intermediate 7-aminoheptanoic acid/8-aminocaprylic acid/9-aminononanoic acid were checked by HPLC, and the consumption of the substrates pimelic acid/suberic acid/azelaic acid and the possible byproducts 7-hydroxyheptanoic acid/8-hydroxyoctanoic acid/9-hydroxynonanoic acid and heptanediol/octanediol/nonanediol were checked by GC. As a result, as shown in Table 8, the yield of 1, 7-heptanediamine was 60.2% (60.2 mM), and no by-product was detected. The yields were higher than the 1, 6-hexamethylenediamine concentration in example 14, and the alpha, omega-diamine product titres increased slightly with increasing carbon chain length, with 1, 8-octanediamine and 1, 9-nonanediamine titres of 71.8mM and 80.2mM, respectively.

TABLE 8 MabCAR3 mutant and transaminase Cascade catalytic Medium chain alpha, omega-dicarboxylic acid (C7-C9) Synthesis of alpha, omega-diamine

Example 17: application of carboxylic acid reductase MabCAR3 mutant in synthesis of medium-long chain alpha, omega-diamine (C10-C12)

This example uses glucose dehydrogenase GDH to regenerate NADPH, polyphosphate kinase PPK to regenerate ATP, CAR and TA cascade continuous carboxylic acid reductive amination of alpha, omega-dicarboxylic acids (C10-C12) to synthesize alpha, omega-diamines (C10-C12), and other bio-enzyme catalysts used in this route to regenerate NADPH and ATP are also protected by this patent. The reaction system was carried out in 8mL of Hepes-Na buffer at pH 6.5 at 25℃and 1000rpm, and the pH of the reaction solution was controlled to be constant by feeding 3M NaOH through pH Stat since a large amount of acid was generated during the cascade reaction. The reaction system comprises final concentration of 200mM sebacic acid/undecanedioic acid/dodecanedioic acid, 2mM NADP (H), 15mM ATP, 480mM MgCl ₂ 1mM PLP, 480mM glucose, 400mM Poly P6 and 800mM isopropylamine, and 16.8mg _{wet cell} Recombinant carboxylic acid reductase/mLCrude cell extract, 183.2mg _{wet cell} Recombinant Carboxylic acid reductase/mL->Crude cell extracts, 36U of aminotransferase SpTA,100U of glucose dehydrogenase BmGDH and 40U of polyphosphate kinase PPK12 were sampled by reaction for 18 h.

The formation concentrations of the products 1, 10-decanediamine/1, 11-undecanediamine/1, 12-dodecanediamine and the intermediate products 10-aminodecanoic acid/11-aminoundecanoic acid/12-aminododecanoic acid were checked by HPLC, and the consumption of the substrates sebacic acid/undecanedioic acid/dodecanedioic acid and the possible byproducts 10-hydroxydecanoic acid/11-hydroxyundecanoic acid/12-hydroxydodecanoic acid and decanediol/undecanediol/dodecanediol were checked by GC. As the chain length was further increased, the CAR specific activity tended to increase as well to a substrate loading of 200mM, resulting in a product titer of 105.3mM for 1, 10-decamethylene diamine as shown in table 9, with no by-products detected. In this example, bio-based α, ω -dicarboxylic acid is used as substrate, and the titer of α, ω -diamine product is highest in all documents and patent reports at present, especially for medium-long chain substrate (C10-C12), the steric hindrance of the substrate is generally larger, which further reflects the innovation and advancement of the carboxylic acid reductase mutant in this example.

TABLE 9 synthesis of alpha, omega-diamines by MabCAR3 mutant and transaminase Cascade catalysis of Medium-Long chain alpha, omega-dicarboxylic acids (C10-C12)

Example 18: amplification of carboxylic acid reductase MabCAR3 mutant synthesized 1,6 hexamethylenediamine system and preparation of product

1, 6-hexamethylenediamine was used as one of two monomers of nylon 66, the reaction system was further enlarged to 300mL system in this example, NADPH was regenerated by glucose dehydrogenase GDH, ATP was regenerated by polyphosphate kinase PPK, and the cascade of CAR and TA catalyzed adipic acid to synthesize 1, 6-hexamethylenediamine, which was carried out in Hepes-Na buffer at pH 6.5 at 30℃under 1000rpm (temperature control by water circulation), and since a large amount of acid was produced during the cascade reaction, the pH of the reaction solution was controlled to be constant by pH Stat fed 3M NaOH. The reaction system comprises 100mM AA and 1mM NADP ⁺ 、10mM ATP、240mM MgCl ₂ 1mM PLP, 240mM glucose, 200mM Poly P6 and 400mM isopropylamine, and 8.3mg _{wet cell} /mL recombinant carboxylic acid reductase MabCAR3 _M39 Crude cell extract, 91.7mg _wet _cell /mL recombinant carboxylic acid reductase MabCAR3 _M42 Crude cell extracts, 450U of aminotransferase SpTA,1000U of glucose dehydrogenase BmGDH and 500U of polyphosphate kinase PPK12 were sampled by reaction for 18 h. The five element enzymes are directly used for crushing the centrifuged crude enzyme solution (the preparation method is described in the embodiment 3), and the high-pressure homogenizer can crush the high-concentration bacterial cells, which is equivalent to the crushing and concentrating of the crude enzyme solution by an ultrasonic crusher.

The amount of 1, 6-hexamethylenediamine produced and the concentration of intermediate 6-aminocaproic acid were detected by HPLC, and GC detected the consumption of adipic acid as a substrate and the possible byproducts 6-hydroxycaproic acid and hexanediol, etc., the yield of 1, 6-hexamethylenediamine reached 42.1%, and no byproduct 6-hydroxycaproic acid and hexanediol, etc., were detected. Finally, the 1, 6-hexamethylenediamine can be extracted from the reaction mixed solution by utilizing n-butanol, then powder is obtained by spin-steaming and drying through a spin-steaming instrument, verification is carried out through GC-MS, the separation yield reaches 31.2%, and gram-grade preparation of the 1, 6-hexamethylenediamine is successfully realized.

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims. All documents referred to in this application are incorporated by reference herein as if each was individually incorporated by reference.

Sequence listing

SEQ ID No.1

/>

SEQ ID No.2

SEQ ID No.3

atgcatcatcatcatcatcatgcaaccattaccaaccacatgccgaccgcagaactgcaggcactggatgcggcgcaccacctgcacccgttcagcgcaaacaacgc

cctgggtgaagaaggcacccgcgttattacccgtgcacgcggcgtctggctgaatgacagtgaaggtgaagaaattctggatgcaatggcaggtctgtggtgtgttaat

attgggtatggtcgtgatgaactggcagaagttgcagcgcgtcagatgcgtgagctgccgtactataatacgttttttaaaacaacccacgtgccggcaattgcactggct

cagaaactggcagaactggcaccgggagatctgaatcatgttttttttgcaggaggtggtagcgaagcgaacgacaccaatattcgtatggttcgcacctattggcaga

ataaaggtcaaccggaaaaaaccgttattattagccgtaaaaatgcatatcatggtagcaccgttgcaagcagcgcactgggtggtatggcaggtatgcatgcacagag

cggtctgattccggatgttcatcatattaatcagccgaattggtgggcagaaggtggtgatatggaccctgaagaatttggtctggcacgtgcacgtgaactggaagaag

caattctggaactgggtgaaaatcgtgttgcagcatttattgcagaaccggttcagggtgcaggtggtgttattgttgcaccggatagctattggccggaaattcagcgtat

ttgtgataaatatgatattctgctgattgcagatgaagttatttgtggttttggtcgtaccggtaattggtttggtacacagacaatgggtattcgtccgcatattatgaccattg

caaaaggtctgagcagcggttatgcaccgattggtggtagcattgtttgtgatgaagttgcacatgttattggtaaagatgaatttaatcatggttatacctatagcggtcatc

cggttgcagcagcagttgcactggaaaatctgcgtattctggaagaagaaaatattctggatcatgttcgtaatgttgcagcaccgtatctgaaagaaaaatgggaagca

ctgaccgatcatccgctggttggtgaagcaaaaattgttggtatgatggcaagcattgcactgaccccgaataaagcaagccgtgcaaaatttgcaagcgaaccgggta

caattggttatatttgtcgtgaacgttgttttgcaaataatctgattatgcgtcatgttggtgatcgtatgattattagcccgccgctggttattaccccggcagaaattgatgaaatgtttgttcgtattcgtaaaagcctggatgaagcacaggcagaaattgaaaaacagggtctgatgaaaagcgcataa*

SEQ ID No.4

atgtataaagatttagaaggaaaagtagtggtcataacaggttcatctacaggtttgggaaaatcaatggcgattcgttttgcgacagaaaaagctaaagtagttgtgaatt

atcgttctaaggaagacgaagctaacagcgttttagaagaaattaaaagagttggcggagaggctattgccgttaaaggtgacgtaacagttgagtctgatgtaatcaatt

tagttcaatctgcaattaaagaatttggaaagctagacgttatgattaacaacgcaggactagaaaatccggtttcatctcatgaaatgtctttaagcgattggaataaagta

attgatacgaacttaacgggagctttcttaggtagtcgtgaagcgattaaatattttgttgaaaatgatattaagggaacagttattaacatgtcgagtgttcacgagaaaatt

ccttggccattatttgttcattatgcagcaagtaaaggcggtatgaagcttatgactgaaacactggcattagaatacgctccaaaaggtattcgtgtaaataacattggacc

gggagcgattaatacaccgattaacgctgagaaatttgctgatcctgagcagcgtgcagatgtagaaagcatgattccaatgggatacatcggagagccggaagaaat

tgcagcagttgctgcatggctagcttcttcagaggcgagttatgtaacaggaattacgctctttgctgacggcggtatgacactgtacccatcattccaagcaggacgcggataa*

SEQ ID No.5

atgatcaacatctataaaatcgataaactgaacaactttaacctgaacaaccataaaaccgatgattatagcctgtgtaaagataaagataccgcactggaact

gacccagaaaaacatccagaaaatttatgattatcagcagaaactgtatgccgaaaaaaaagaaggtctgattattgcatttcaggcaatggatgcagcaggtaaagatg

gtaccattcgtgaagttctgaaagcactggcaccgcagggtgttcatgaaaaaccgtttaaaagcccgagcagcaccgaactggcacatgattatctgtggcgtgttcat

aatgcagttccggaaaaaggtgaaattaccatttttaatcgtagccattatgaagatgttctgattggtaaagttaaagaactgtataaatttcagaataaagcagatcgtatt

gatgaaaataccgttgttgataatcgttatgaagatattcgtaattttgaaaaatatctgtataataatagcgttcgtattattaaaatttttctgaatgttagcaaaaaagaacag

gcagaacgttttctgagccgtattgaagaaccggaaaaaaattggaaatttagcgatagcgattttgaagaacgtgtttattgggataaatatcagcaggcatttgaagatg

caattaatgcaaccagcaccaaagattgtccgtggtatgttgttccggcagatcgtaaatggtatatgcgttatgttgttagcgaaattgttgttaaaaccctggaagaaatg

aatccgaaatatccgaccgttaccaaagaaaccctggaacgttttgaaggttatcgtaccaaactgctggaagaatataattatgatctggataccattcgtccgattgaaaaa*

Claims

1. A method for efficiently synthesizing alpha, omega-diamine, comprising the steps of:

2. The method of claim 1, wherein the first carboxylate reductase mutant is:

(c1) A protein derived from (a 1) having 80% or more homology to the amino acid sequence of the protein (a 1) and having the function of the protein (a 1), but corresponding to one or more of amino acids 303, 306, 342, 344, 395, 418 and 426 of SEQ ID No.2, which are identical to amino acids after mutation at the corresponding positions of the protein (a);

(d1) An active fragment of the protein of (a 1) comprising a structure in the spatial structure of a carboxylate reductase that interacts with a carboxylate substrate and wherein one or more of the amino acids at positions 303, 306, 342, 344, 395, 418, 426 corresponding to SEQ ID No.2 are identical to the amino acids after mutation at the corresponding positions of the protein of (a 1);

preferably, wherein the first carboxylate reductase mutant is selected from the group consisting of:

(1) Alanine (Ala) at position 303 to lysine (Lys);

(2) Leucine (Leu) at position 306 is mutated to lysine (Lys) or arginine (Arg);

(3) Leucine (Leu) at position 342 to lysine (Lys) or arginine (Arg);

(4) Valine (Val) at position 344 to lysine (Lys);

(5) A glycine (Gly) mutation at position 395 to lysine (Lys);

(7) Glycine (Gly) at position 426 was mutated to histidine (His).

3. The method of claim 1, wherein the second carboxylate reductase mutant is:

(c2) A protein derived from (a 2) having 80% or more homology to the amino acid sequence of the protein (a 2) and having the function of the protein (a 2), but corresponding to one or more of amino acids 284, 303, 306, 342, 393, 395, 418, 426 of SEQ ID No.2, which are identical to amino acids after mutation at the corresponding positions of the protein (a);

(d2) An active fragment of the protein of (a 2) comprising a structure in the spatial structure of a carboxylate reductase that interacts with a carboxylate substrate and wherein one or more of the amino acids at positions 284, 303, 306, 342, 393, 395, 418, 426 corresponding to SEQ ID No.2 are identical to the amino acids after mutation at the corresponding positions of the protein of (a 2);

preferably, the second carboxylate reductase mutant is selected from one or a combination of two or more of the following:

(13) Glycine (Gly) at position 395 to glutamic acid (Glu);

(15) Glycine (Gly) at position 426 to serine (Ser);

more preferably, the second carboxylate reductase mutant is selected from the group consisting of:

4. The method of claim 1, wherein,

the alpha, omega-dicarboxylic acid comprises: malonic acid (C3), succinic acid (C4), glutaric acid (C5), adipic acid (C6), pimelic acid (C7), suberic acid (C8), azelaic acid (C9), sebacic acid (C10), undecanedioic acid (C11) and dodecanedioic acid (C12); or,

the omega-amino fatty acids include: 3-aminopropionic acid (C3), 4-aminobutyric acid (C4), 5-aminopentanoic acid (C5), 6-aminocaproic acid (C6), 7-aminoheptanoic acid (C7), 8-aminocaprylic acid (C8), 9-aminononanoic acid (C9), 10-aminodecanoic acid (C10), 11-aminoundecanoic acid (C11), 12-aminododecanoic acid (C12) or derivatives thereof; or,

the alpha, omega-diamine is a short chain alpha, omega-diamine, a medium chain alpha, omega-diamine or a long chain alpha, omega-diamine; preferably, the short chain refers to a carbon chain with the length of below 5C, the medium chain refers to a carbon chain with the length of 6C-9C, the medium long chain refers to a carbon chain with the length of 10C-12C, and the long chain refers to a carbon chain with the length of above 13C; more preferably, the α, ω -diamine comprises: 1, 3-propanediamine (C3), 1, 4-butanediamine (C4), 1, 5-pentanediamine (C5), 1, 6-hexanediamine (C6), 1, 7-heptanediamine (C7), 1, 8-octanediamine (C8), 1, 9-nonanediamine (C9), 1, 10-decanediamine (C10), 1, 11-undecanediamine (C11), 1, 12-dodecanediamine (C12), or derivatives thereof; or,

The catalyst further comprises: one or more of transaminase, glucose dehydrogenase and polyphosphate kinase; preferably, the transaminase has organic ammonia as an amino donor; more preferably, the amino donor comprises: aliphatic amine donors, aromatic amino donors; preferably, the glucose dehydrogenase is a glucose and NADP ⁺ As a substrate, catalyzes glucose oxidation with NADP ⁺ Reduction to NADPH; more preferably, the glucose dehydrogenase is glucose dehydrogenase BmGDH; preferably, the polyphosphate kinase takes sodium hexametaphosphate as a substrate to catalyze AMP to generate ATP; more preferably, the polyphosphate kinase is polyphosphate kinase PPK12.

5. A method for efficiently synthesizing omega-amino fatty acids, comprising: using alpha, omega-dicarboxylic acid as a substrate, using a first carboxylic acid reductase mutant as a catalyst, and catalyzing and synthesizing omega-amino fatty acid; wherein the first carboxylic acid reductase mutant has increased catalytic activity towards the substrate alpha, omega-dicarboxylic acid and decreased catalytic activity towards omega-amino fatty acids;

preferably, the first carboxylate reductase mutant is:

more preferably, wherein the first carboxylate reductase mutant is selected from the group consisting of:

(1) Alanine (Ala) at position 303 to lysine (Lys);

(2) Leucine (Leu) at position 306 is mutated to lysine (Lys) or arginine (Arg);

(3) Leucine (Leu) at position 342 to lysine (Lys) or arginine (Arg);

(4) Valine (Val) at position 344 to lysine (Lys);

(5) A glycine (Gly) mutation at position 395 to lysine (Lys);

(7) Glycine (Gly) at position 426 was mutated to histidine (His).

6. A carboxylic acid reductase mutant having an altered catalytic activity on a substrate relative to a wild-type carboxylic acid reductase;

preferably, when the substrate is an alpha, omega-dicarboxylic acid,

the carboxylic acid reductase mutant has the advantages that the catalytic activity of the carboxylic acid reductase mutant on a substrate alpha, omega-dicarboxylic acid is enhanced, and the catalytic activity of the carboxylic acid reductase mutant on omega-amino fatty acid is reduced; more preferably, the carboxylate reductase mutant is as defined in claim 2;

preferably, when the substrate is an α, ω -dicarboxylic acid and ω -amino fatty acid, the carboxylic acid reductase mutant has enhanced catalytic activity on both the substrate α, ω -dicarboxylic acid and ω -amino fatty acid; more preferably, the carboxylate reductase mutant is as defined in claim 3.

7. An isolated polynucleotide, wherein said nucleic acid encodes a carboxylic acid reductase mutant according to claim 6, or wherein said nucleic acid encodes a carboxylic acid reductase mutant as defined in claim 2 or 3.

8. A vector comprising the polynucleotide of claim 7; preferably, the vector is an expression vector or an expression transformant; more preferably, the expression transformant comprises an expression vector.

9. A genetically engineered host cell comprising the vector of claim 8, or having integrated into its genome the polynucleotide of claim 7.

10. Selected from the following applications:

(a) Use of a carboxylic acid reductase mutant according to claim 6, or as defined in claim 2 or 3, for the catalytic synthesis of an α, ω -diamine;

(b) Use of a carboxylic acid reductase mutant as defined in claim 6, or a carboxylic acid reductase mutant as defined in claim 2, for the catalytic synthesis of omega-amino fatty acids;

(c) Use of a carboxylic acid reductase mutant according to claim 6, or as defined in claim 2 or 3, for the preparation of a catalyst for the catalytic synthesis of omega-amino fatty acids and/or alpha, omega-diamines.