CN117305358A - Reversible gene knockout system and application thereof - Google Patents

Abstract

The invention discloses a reversible gene knockout system and application thereof. The reversible gene knockout system comprises a transcription regulation element, wherein the transcription regulation element sequentially comprises a 5' cutting site, a Flpo recombinase homodromous recognition site FRT, a Cre recombinase reverse recognition site loxP2272, a Cre recombinase reverse recognition site loxP, an inverted transcription termination sequence, an inverted fluorescent protein gene, an inverted 3' cutting site, a Cre recombinase reverse recognition site loxP2272, a drug screening marker gene, a Cre recombinase reverse recognition site loxP, a Flpo recombinase homodromous recognition site FRT and a 3' cutting site from the 5' end to the 3' end. The gene knockout system realizes gene knockout through Cre recombinase mediated transcription termination, realizes gene recovery through Flp recombinase mediated transcription termination signal deletion, has reversibility, and can realize chemical induction regulation.

Description

Reversible gene knockout system and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a reversible gene knockout system and application thereof.

Background

Studies of gene function and reverse genetics have relied primarily on Loss-of-function (LOF) analysis, which can be accomplished in a variety of ways, such as induction of mutagenesis, nuclease-mediated gene knockout, RNA interference (RNAi) -mediated gene knockdown, and the like. Gene inactivation is the most powerful tool for studying gene function and in yeast, nematodes and Drosophila, many mutants were generated by forward genetic screening to reveal gene function and regulate developmental pathways, and likewise, by forward genetic screening of zebra fish, many mutants were generated for studying vertebrate development.

The direct gene knockout method is not suitable for studying genes affecting embryo development or cell survival, and when genes essential for embryo development are mutated, it causes embryonic lethality, thus preventing the analysis of the subsequent gene functions, and in order to effectively solve this problem, conditional gene inactivation strategies have been developed. In organisms with efficient forward genetics, researchers have developed temperature-sensitive alleles that generally produce typical missense mutations that do not mutate at the allowable temperatures, expressed proteins that function normally, but missense mutations that do not function at defined temperatures, and therefore conditional gene mutation can be achieved by regulating the temperature. In mammals, the Cre/loxP system is most commonly used for realizing conditional gene inactivation, DNA recombinase Cre promotes strand exchange between two recombinase recognition sites loxP at both ends of a target sequence, and target sequence deletion (in the same direction) or inversion (in the opposite direction) is mediated according to the direction of the loxP sites, so that conditional gene knockout can realize target gene deletion containing the same-direction loxP sites at both ends by means of relying on recombinase Cre.

The presently reported conditional gene knockout system and the principle of action thereof are as follows:

1. site-specific DNA recombinase system

The most commonly used DNA recombinase systems at present are the Cre/loxP system, wherein the Cre recombinase is derived from phage and the Flp recombinase is derived from Saccharomyces cerevisiae, and the Flp/FRT system. These two recombinase systems conditionally regulate gene expression by site-specific DNA recombination. The Cre and Flp recombinases catalyze a strand exchange between two 34bp recognition sites, and in 34bp loxP and FRT sites, two 13bp inverted repeat sequences are contained, and an 8bp core sequence is arranged between the two inverted repeat sequences, wherein the core sequence determines the direction of the recognition sites.

Problems and disadvantages: (1) Two loxP sites with the same direction are required to be introduced at two ends of a target gene, so that the difficulty of transgene is increased; (2) gene knockout is irreversible.

2. TetR-based conditional gene knockout system

The most widely used binary trans-transcriptional activation system is the tetracycline-dependent regulatory system developed by Manfred Gossen and Hermann Bujar. The effector protein in this system is a tetracycline regulatory transactivation element (tTA) consisting of transactivator VP16 (Virus protein 16) and a tetracycline repressor (TetR) protein. The TetR protein is capable of specifically binding to tetracycline and the 19bp operon sequence (tetO) of the tet operon in the target gene.

Problems and disadvantages: (1) Two binary systems are needed to exist in the space-time specificity regulation system, so that the difficulty of transgenosis is greatly increased; (2) gene knockout is irreversible.

In summary, the limitations of current methods of gene inactivation are mainly the lack of temporal or tissue specificity of the mutated alleles, and furthermore, these methods are not reversible and the function of the gene cannot be restored after inactivation. This limitation is a major obstacle in the study of essential and pleiotropic genes, for example, direct knockout of genes that cause embryonic developmental lethality can prevent analysis of later LOFs. At present, a widely used solution in mice and Drosophila is to further realize mutation at specific developmental stages and specific tissue types by controlling the expression of the recombinase in time and space by using Cre/loxP and Flp/FRT inducible recombinase systems, respectively. However, in most cases, these inducible systems are irreversible, and after the loss of gene function, the gene whose function is lost is usually recovered by using an exogenous gene overexpression system, which cannot completely mimic the expression level of the gene before the loss of gene function in view of uncertainty in copy number and expression amount. Therefore, how to provide a genetic tool capable of mediating conditional gene function deficiency and in situ regulating gene restoration after gene function deficiency is one of the urgent problems in the field of genetic engineering.

Disclosure of Invention

Aiming at the defects and actual demands of the prior art, the invention provides a reversible gene knockout system and application thereof, which can respectively realize the knockout and recovery of target genes through the induction of small molecular compounds, provides a high-efficiency, rapid and flexible bidirectional regulation switch for gene functions, and provides an important tool for the research of gene functions and reverse genetics.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a reversible gene knockout system comprising a transcriptional regulatory element;

the transcription regulating element sequentially comprises a 5' cutting site, a Flpo recombinase homodromous recognition site FRT, a Cre recombinase reverse recognition site loxP2272, a Cre recombinase reverse recognition site loxP, an inverted transcription termination sequence, an inverted fluorescent protein gene, an inverted 3' cutting site, a Cre recombinase reverse recognition site loxP2272, a drug screening marker gene, a Cre recombinase reverse recognition site loxP, a Flpo recombinase homodromous recognition site FRT and a 3' cutting site from the 5' end to the 3' end.

In the invention, a transcription regulation element comprises a 5 'cutting site (5' ss), a 3 'cutting site (3' ss), two pairs of reverse recognition sites loxP and loxP2272 of Cre recombinase, a pair of homodromous recognition sites FRT of Flpo recombinase, an inverted fluorescent protein gene for marking gene knockout and a drug screening marker, and is inserted into a target gene, and the outermost side of the element is provided with the 5'ss and the 3' ss, so that the element is similar to an artificial intron, can be cut off by an RNA cutting complex in the transcription process of the target gene, and the expression and the function of the target gene are not influenced; when Cre recombinase exists, elements between the loxP and loxP2272 are inverted, and finally the directions of the fluorescent protein genes and transcription termination sequences are right, drug screening marks are deleted, at this time, in the transcription process of the target genes, 5'ss and 3' ss which are closer to each other are sheared, the left part of the target genes and the fluorescent protein genes-transcription termination sequences are spliced together, the fluorescent proteins are expressed, the right part of the target genes cannot be transcribed, and the functions of the target genes are affected; when Flp recombinase is present, the fluorescent protein gene and transcription termination sequence between the homodromous FRTs are deleted and the target gene is re-expressed.

In summary, the invention constructs a reversible gene knockout system capable of achieving conditional gene knockout and recovery, gene knockout is achieved through Cre recombinase-mediated transcription termination, gene recovery is achieved through Flp recombinase-mediated transcription termination signal deletion, and the system can be directly inserted into exons of target genes to regulate expression of the target genes through recombinases.

In the present invention, gene knockout refers to the disabling of a target gene, and does not refer to the deletion of a target gene sequence from the genome in a narrow sense.

Preferably, the nucleic acid sequence of the 5' cleavage site comprises the sequence shown in SEQ ID NO. 1.

Preferably, the nucleic acid sequence of the Flpo recombinase homodromous recognition site FRT comprises the sequence shown in SEQ ID No. 2.

Preferably, the nucleic acid sequence of the Cre recombinase reverse recognition site loxP2272 comprises a sequence shown in SEQ ID NO. 3.

Preferably, the nucleic acid sequence of the Cre recombinase reverse recognition site loxP comprises a sequence shown in SEQ ID NO. 4.

Preferably, the nucleic acid sequence of the transcription termination sequence comprises the sequence shown in SEQ ID NO. 5.

Preferably, the fluorescent protein gene comprises EGFP.

Preferably, the nucleic acid sequence of EGFP comprises the sequence shown in SEQ ID NO. 6.

Preferably, the drug screening marker gene comprises Puro.

Preferably, the nucleic acid sequence of Puro comprises the sequence shown in SEQ ID NO. 7.

Preferably, the nucleic acid sequence of the 3' cleavage site comprises the sequence shown in SEQ ID NO. 8.

Preferably, the nucleic acid sequence of the transcription control element comprises the sequence shown in SEQ ID NO. 9.

SEQ ID NO.1：gtgagtttggggacccttgattgttctttctttttcgctattgtaaa。

SEQ ID NO.2：gaagtacctattccgaagttcctattctctagaaagtataggaacttc。

SEQ ID NO.3：ataacttcgtataggatactttatacgaagttat。

SEQ ID NO.4：ataacttcgtatagcatacattatacgaagttat。

SEQ ID NO.5：

gaaaaatctggctagtaaaacatgtaaggaaaattttagggatgttaaagaaaaaaataacacaaaacaaaatataaaaaaaatctaacctcaagtcaaggcttttctatggaataaggaatggacagcagggggctgtttcatatactgatgacctctttatagccacctttgttcatggcagccagcatatggcatatgttgccaaactctaaaccaaatactcattctgatgttttaaatgatttgccctcccatatgtccttccgagtgagagacacaaaaaattccaacacactattgcaatgaaaataaatttcctttattagccagaagtcagatgctcaaggggcttcatgatgtccccataatttttggcagagggaaaaagatctcagtggtatttgtgagccagggcattggccacaccagccaccaccttctgataggcagcctgcacctgagg。

SEQ ID NO.6：

ttacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccat。

SEQ ID NO.7：

atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgccgtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga。

SEQ ID NO.8：cgggcccctctgctaaccatgttcatgccttcttctctttcctacag。

SEQ ID NO.9：

gtgagtttggggacccttgattgttctttctttttcgctattgtaaaattcttaatttctaggaagtacctattccgaagttcctattctctagaaagtataggaacttcgtcgactatagcataacttcgtatagcatacattatacgaagttatcctgcatcgacctagactagctagaactagtataacttcgtataggatactttatacgaagttatgaaaaatctggctagtaaaacatgtaaggaaaattttagggatgttaaagaaaaaaataacacaaaacaaaatataaaaaaaatctaacctcaagtcaaggcttttctatggaataaggaatggacagcagggggctgtttcatatactgatgacctctttatagccacctttgttcatggcagccagcatatggcatatgttgccaaactctaaaccaaatactcattctgatgttttaaatgatttgccctcccatatgtccttccgagtgagagacacaaaaaattccaacacactattgcaatgaaaataaatttcctttattagccagaagtcagatgctcaaggggcttcatgatgtccccataatttttggcagagggaaaaagatctcagtggtatttgtgagccagggcattggccacaccagccaccaccttctgataggcagcctgcacctgaggttacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcagggcggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatgggggtgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggacttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgtaggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaacttgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagctcctcgcccttgctcaccatctgtaggaaagagaagaaggcatgaacatggttagcagaggggcccggttgggtcgtttgttcggatctagactagaataacttcgtataatgtatgctatacgaagttatggggatcggcaataaaaaggaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacctgcaggtcctcgccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgccgtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggacagaataaaacgcacgggtataacttcgtataaagtatcctatacgaagttatcagatcctagagctgaagtacctattccgaagttcctattctctagaaagtataggaacttcagctcgctgatcagcctcgacgggcccctctgctaaccatgttcatgccttcttctctttcctacag。

Preferably, the reversible gene knockout system further comprises an rtTA expression element comprising an rtTA gene and a recombinase expression element comprising a TRE3G promoter, a Cre recombinase gene and a Flpo recombinase gene.

Preferably, the rtTA expression element further comprises a resistance gene.

Preferably, the resistance gene comprises a NEO gene.

Preferably, the nucleic acid sequence of the rtTA expression element comprises the sequence shown in SEQ ID NO. 10.

Preferably, the nucleic acid sequence of the recombinase expression element comprises the sequence shown in SEQ ID NO. 11.

Further, in the invention, a Tet-On system is utilized to induce Cre recombinase and Flp-ERT2 fusion protein to express, a chemically induced reversible gene knockout system (Chemical-induced reversible gene knockout system, CIRKO) is constructed, in the absence of doxycycline (DoxCyline, dox), rtTA is difficult or not substantially bound to a TRE3G promoter, recombinase is not expressed, rtTA and Dox are bound to the TRE3G promoter when doxycycline Dox is present, thereby activating the TRE3G promoter to start Cre recombinase gene and Flpo recombinase gene expression, cre recombinase expression mediates target gene transcriptional inactivation, and Flpo recombinase cannot enter the cell nucleus alone; when Dox and tamoxifen exist simultaneously, flp recombinase can be combined with tamoxifen and incorporated into a core so as to mediate that a transcription termination sequence is deleted, a target gene is recovered to be expressed, a CIRKO system bypasses a barrier for transferring the recombinase through viruses and is expected to be widely applied to primary cells and animal bodies, and the system provides an efficient, rapid and flexible bidirectional regulation switch for gene functions and provides an important tool for researching gene functions and reverse genetics.

SEQ ID NO.10：

atgtctagactggacaagagcaaagtcataaactctgctctggaattactcaatggagtcggtatcgaaggcctgacgacaaggaaactcgctcaaaagctgggagttgagcagcctaccctgtactggcacgtgaagaacaagcgggccctgctcgatgccctgccaatcgagatgctggacaggcatcatacccactcctgccccctggaaggcgagtcatggcaagactttctgcggaacaacgccaagtcataccgctgtgctctcctctcacatcgcgacggggctaaagtgcatctcggcacccgcccaacagagaaacagtacgaaaccctggaaaatcagctcgcgttcctgtgtcagcaaggcttctccctggagaacgcactgtacgctctgtccgccgtgggccactttacactgggctgcgtattggaggaacaggagcatcaagtagcaaaagaggaaagagagacacctaccaccgattctatgcccccacttctgaaacaagcaattgagctgttcgaccggcagggagccgaacctgccttccttttcggcctggaactaatcatatgtggcctggagaaacagctaaagtgcgaaagcggcgggccgaccgacgcccttgacgattttgacttagacatgctcccagccgatgcccttgacgactttgaccttgatatgctgcctgctgacgctcttgacgattttgaccttgacatgctccccgggtaa。

SEQ ID NO.11：

atggccaatctcctgaccgtccaccagaacttgcctgccctccccgtcgacgcaacctccgacgaggtgcgcaagaacctgatggacatgttcagggatcgccaggccttctctgagcacacctggaagatgcttctgtccgtgtgccggtcctgggccgcatggtgcaagttgaacaaccggaagtggtttcccgccgagcctgaagacgtgcgcgattaccttctctatcttcaggcccgcggactggccgtcaagacaatccagcagcacttgggccagctcaacatgcttcacaggcggtccgggctgccaagaccaagcgacagcaatgctgtgtccctggtgatgcggcggatcagaaaggagaacgtggacgcaggcgaaagggcaaagcaggctctcgccttcgaacgcacagacttcgaccaggtgaggtctctcatggagaatagcgaccgctgccaggatatcaggaatctggccttcctggggattgcttacaacaccctgctcaggatcgccgagattgccaggatcagggtgaaagacatctccaggacagacggcgggagaatgctcatccacattggcagaaccaagaccctggtgagcaccgccggcgtggagaaggcccttagcctgggggtgactaaactggtcgagagatggatttccgtctctggcgtggctgacgatcccaataactacctgttttgccgggtcagaaaaaatggcgtggccgcaccatctgccaccagccagctctccacacgcgccctggaagggatttttgaagcaacacacagattgatttacggcgctaaggacgactctggccagagatacctggcctggtctggacacagcgccagggtcggagccgcaagagacatggcccgcgctggagtgtccatccccgagatcatgcaggctggcggctggaccaatgtgaatattgtcatgaactatatcaggaacctggacagcgagacaggggcaatggtgcgcctgctggaagatggcgatgagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctatggctatgagccagttcgacatcctgtgcaagaccccccccaaggtgctggtgcggcagttcgtggagagattcgagaggcccagcggcgagaagatcgccagctgtgccgccgagctgacctacctgtgctggatgatcacccacaacggcaccgccatcaagagggccaccttcatgagctacaacaccatcatcagcaacagcctgagcttcgacatcgtgaacaagagcctgcagttcaagtacaagacccagaaggccaccatcctggaggccagcctgaagaagctgatccccgcctgggagttcaccatcatcccttacaacggccagaagcaccagagcgacatcaccgacatcgtgtccagcctgcagctgcagttcgagagcagcgaggaggccgacaagggcaacagccacagcaagaagatgctgaaggccctgctgtccgagggcgagagcatctgggagatcaccgagaagatcctgaacagcttcgagtacaccagcaggttcaccaagaccaagaccctgtaccagttcctgttcctggccacattcatcaactgcggcaggttcagcgacatcaagaacgtggaccccaagagcttcaagctggtgcagaacaagtacctgggcgtgatcattcagtgcctggtgaccgagaccaagacaagcgtgtccaggcacatctactttttcagcgccagaggcaggatcgaccccctggtgtacctggacgagttcctgaggaacagcgagcccgtgctgaagagagtgaacaggaccggcaacagcagcagcaacaagcaggagtaccagctgctgaaggacaacctggtgcgcagctacaacaaggccctgaagaagaacgccccctaccccatcttcgctatcaagaacggccctaagagccacatcggcaggcacctgatgaccagctttctgagcatgaagggcctgaccgagctgacaaacgtggtgggcaactggagcgacaagagggcctccgccgtggccaggaccacctacacccaccagatcaccgccatccccgaccactacttcgccctggtgtccaggtactacgcctacgaccccatcagcaaggagatgatcgccctgaaggacgagaccaaccccatcgaggagtggcagcacatcgagcagctgaagggcagcgccgagggcagcatcagataccccgcctggaacggcatcatcagccaggaggtgctggactacctgagcagctacatcaacaggcggatctgcgtacgcggatcctctgctggagacatgagagctgccaacctttggccaagcccgctcatgatcaaacgctctaagaagaacagcctggccttgtccctgacggccgaccagatggtcagtgccttgttggatgctgagccccccatactctattccgagtatgatcctaccagacccttcagtgaagcttcgatgatgggcttacttaccaacctggcagacagggagctggttcacatgatcaactgggcgaagagggtgccaggctttgtggatttgaccctccatgatcaggtccaccttctagaatgtgcctggctagagatcctgatgattggtctcgtctggcgctccatggagcacccagtgaagctactgtttgctcctaacttgctcttggacaggaaccagggaaaatgtgtagagggcatggtggagatcttcgacatgctgctggctacatcatctcggttccgcatgatgaatctgcagggagaggagtttgtgtgcctcaaatctattattttgcttaattctggagtgtacacatttctgtccagcaccctgaagtctctggaagagaaggaccatatccaccgagtcctggacaagatcacagacactttgatccacctgatggccaaggcaggcctgaccctgcagcagcagcaccagcggctggcccagctcctcctcatcctctcccacatcaggcacatgagtaacaaaggcatggagcatctgtacagcatgaagtgcaagaacgtggtgcccctctatgacctgctgctggaggcggcggacgcccaccgcctacatgcgcccactagccgtggaggggcatccgtggaggagacggaccaaagccacttggccactgcgggctctacttcatcgcattccttgcaaaagtattacatcacgggggaggcagagggtttccctgccacagcttag。

Preferably, the reversible gene knockout system comprises a transcription control element, a rtTA expression element and a recombinase expression element, wherein the nucleic acid sequence of the transcription control element comprises a sequence shown in SEQ ID NO.9, the nucleic acid sequence of the rtTA expression element comprises a sequence shown in SEQ ID NO.10, and the nucleic acid sequence of the recombinase expression element comprises a sequence shown in SEQ ID NO. 11.

In a second aspect, the present invention provides the use of a reversible gene knockout system as described in the first aspect for the preparation of a gene knockout product.

In a third aspect, the invention provides a pharmaceutical composition comprising a reversible gene knockout system according to the first aspect.

Preferably, the pharmaceutical composition further comprises an adjuvant.

Preferably, the auxiliary materials comprise any one or a combination of at least two of pharmaceutically acceptable carriers, diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, bacteriostats or buffers.

In a fourth aspect, the present invention provides the use of a reversible gene knockout system as described in the first aspect in gene knockout.

In a fifth aspect, the present invention provides a gene knockout method comprising:

introducing the reversible gene knockout system of the first aspect into a cell, and performing gene knockout.

Preferably, the gene knockout method comprises:

inserting a transcription regulatory element of the reversible gene knockout system into a target gene sequence, and performing target gene knockout and recovery by Cre recombinase gene and Flpo recombinase.

Compared with the prior art, the invention has the following beneficial effects:

(1) The reversible gene knockout system realizes gene knockout through Cre recombinase mediated transcription termination, realizes gene recovery through Flp recombinase mediated transcription termination signal deletion, has reversibility, can realize visualization after conditional gene knockout, is convenient for subsequent tracing of target cells, has universality, and can study the function of any gene;

(2) The rtTA expression original and the recombinase expression original are designed based On a Tet-On system, and the expression and the function of the recombinase are flexibly and rapidly regulated and controlled through the Dox and the tamoxifen, so that the knockout and the recovery of genes can be realized in a chemical induction mode, and the transfer problem of the recombinase is solved.

Drawings

FIG. 1 is a schematic diagram of the gene knockout system in example 1 of the present invention;

FIG. 2 is a schematic diagram of the gene knockout system in example 2 of the present invention;

FIG. 3 is a schematic diagram of the insertion of a Recin element into the mCherry gene;

FIG. 4 is a fluorescent image of a Recin element transfected HEK293 cells;

FIG. 5 is a flow chart for treating porcine fibroblasts;

FIG. 6 is a graph showing the results of flow analysis of corresponding cells on day 6;

FIG. 7A is a graph showing the results of flow assays for cells of the corresponding control group on day 9;

FIG. 7B is a graph showing the results of flow analysis of cells from the corresponding experimental group on day 9;

FIG. 8 is a histogram of percent EGFP-positive cells on days 6 and 9;

FIG. 9 is a diagram of PCR analysis of P53 locus in corresponding swine fibroblast cells;

FIG. 10 is a graph showing immunocytochemistry detection of EGFP and P53 expression in corresponding PFF cells.

Detailed Description

The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Example 1

The embodiment provides a reversible gene knockout system, the nucleic acid sequence of a transcription regulatory element in the reversible gene knockout system is shown as SEQ ID NO.9, the knockout principle is shown as shown in figure 1, and the outermost side of an element is provided with 5'ss and 3' ss, so that the element is similar to an artificial intron, and can be sheared off by an RNA shearing compound in the gene transcription process, so that the expression and the function of the gene are not affected; when Cre recombinase exists (+cre), elements between inverse loxP and loxP2272 are inverted, and finally the directions of EGFP and transcription termination sequence polyA (rβglpA) are positive, the screening marker Puro is deleted, at the moment, during gene transcription, 5'ss and 3' ss which are closer are sheared off, the left part (EXON-L) of a target gene and EGFP-rβglpA are spliced together, EGFP is expressed, the right part (EXON-R) of the target gene cannot be transcribed, and gene functions are affected; when Flp recombinase is present (+Flp), EGFP and rβ glpA between the homodromous FRTs are deleted and the target gene is re-expressed.

Example 2

The embodiment provides a chemically induced reversible gene knockout system, which comprises a transcription regulation element, a rtTA expression element and a recombinase expression element, wherein the nucleic acid sequence of the transcription regulation element is shown as SEQ ID NO.9, the nucleic acid sequence of the rtTA expression element is shown as SEQ ID NO.10, the nucleic acid sequence of the recombinase expression element is shown as SEQ ID NO.11, the knockout principle is shown as figure 2, the expression of the recombinase Cre and the FlpoERT2 is induced by utilizing Dox (when Dox is not present, cre and FlpoERT2 are expressed when Dox is present, flpoERT2 cannot enter the nucleus, the recombinase Cre mediates the transcription termination signal direction to mediate the transcription termination of the target gene, and when Dox and 4-hydroxy tamoxifen (4-OHT) are simultaneously present, flERT 2 is combined with 4-OHT and then enters the nucleus, and the recombinase Flpo mediates the transcription termination sequence to be deleted, so that the target gene is restored to be expressed.

Example 3

This example uses the gene knockout systems of examples 1 and 2 to perform gene knockout.

To verify the effectiveness of example 1, the entire code of this element was inserted into the reporter gene mCherry, and the pCMV-mCherryL-ReCOIN-mCherryR vector was constructed. Theoretically, as shown in FIG. 3, when Cre recombinase is present, the 3' ss, EGFP and polyA sequences are orthotopic and the target gene is inactivated; when Flpo recombinase is present, the 3' ss, EGFP and polyA sequences are deleted and the target gene resumes expression. The pCMV-mCherryL-Recin-mCherryR vector alone or separately with Cre or Flpo was transfected into HEK293 cells and detected under a fluorescence microscope after 72h of transfection. As shown in FIG. 4, the pCMV-mCherryL-RECOIN-mCherryR vector (CoCo) alone was electroed, the reporter gene mCherry was expressed normally, and the Cre-set (+cre), the target gene mCherry was not expressed, EGFP was expressed, and the Flpo-set (+Flpo), the target gene mCherry was expressed, and EGFP was not expressed (FIG. 4, scale size 200 μm). The above results indicate that the Recin element can flexibly respond to the recombinase system, thereby regulating the expression of the target gene.

To verify the effectiveness of the gene knockout system of example 2, positive clones (DDCC-P53, dual drug-induced conditional conversion-P53) were treated with small molecule compounds, and cells were analyzed on day 6 before 4OHT and day 9 after 4OHT, with unmodified porcine fetal fibroblasts as controls (Ctrl), and with Dox for 6 days, followed by Dox and 4OHT for 3 days, as shown in FIG. 5. DDCC-P53 positive clones were observed by flow analysis, and on day 6 after Dox treatment, it was found from FIG. 6 that EGFP positive cell fraction reached about 50%, whereas EGFP was hardly expressed in the control group. From fig. 7A and 7B, it can be seen that the EGFP-positive cell proportion reached about 70% at day 9 after the Dox treatment, whereas the EGFP-positive cell proportion was reduced to about 20% on average after 3 days of simultaneous Dox and 4OHT treatment (fig. 7A), whereas EGFP was hardly expressed in the control group (fig. 7B). FIG. 8 is a statistical plot of the proportion of EGFP-positive cells after small molecule treatment of the cells, where "-" indicates no addition of the corresponding substance and "+" indicates addition of the corresponding substance. In order to detect the sequence of the Recin element at the genomic level in P53 after induction with small molecule compounds, primers were designed at both ends of the P53 gene where the Recin element was inserted and PCR detection was performed, as shown in FIG. 9, all bands detected were of the expected size, while it was observed that no 2747bp band was produced without Dox, demonstrating that Cre was not expressed in leakage; in the absence of 4OHT, no 1342 bp-sized band was generated, demonstrating that 4OHT tightly controls Flp nuclear entry. Next, it was verified at the protein level whether the chemical induction could achieve knockout and recovery of the P53 gene, and the immunofluorescence staining results are shown in fig. 10, in the DDCC-P53 experimental group, the EGFP was not expressed by cells that did not undergo any drug treatment, and the P53 protein expression level was similar to Ctrl control group; the independent Dox treatment group expresses EGFP, and the expression level of the P53 protein is lower than that of a Ctrl control group; EGFP expression levels were lower in the Dox and 4OHT simultaneous treatment groups than in the Dox alone treatment group, while P53 protein expression levels were higher in the Dox alone treatment group (FIG. 10, scale size 100 μm). The above results indicate that EGFP expression level was down-regulated after addition of 4OHT, while P53 expression level was up-regulated, demonstrating that expression was restored after P53 gene knockout. The CIRKO system can flexibly regulate gene knockout and restoration through drug induction.

In summary, the invention utilizes the conserved cleavage site to combine with Cre/loxP and Flp/FRT recombinase systems to construct a genetic tool capable of realizing conditional gene knockout and recovery, realizes gene knockout through Cre recombinase-mediated transcription termination, realizes gene recovery through Flp recombinase-mediated transcription termination signal deletion, and further utilizes a Tet-On system to induce Cre recombinase and Flp-ERT2 fusion protein expression, further constructs a chemically-induced reversible gene knockout system, and when Dox exists, cre recombinase expression is utilized to mediate target gene transcription inactivation; when Dox and tamoxifen coexist, flp recombinase enters the nucleus to mediate that transcription termination signals are deleted, and the target genes resume expression, bypass the barrier of transferring the recombinase through viruses, and are expected to be widely applied to primary cells and animal bodies.

The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Sequence listing

<110> Guangzhou biomedical and health institute of China academy of sciences

<120> a reversible gene knockout system and use thereof

<130> 2022-06-20

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 47

<212> DNA

<213> artificial sequence

<400> 1

gtgagtttgg ggacccttga ttgttctttc tttttcgcta ttgtaaa 47

<210> 2

<211> 48

<212> DNA

<213> artificial sequence

<400> 2

gaagtaccta ttccgaagtt cctattctct agaaagtata ggaacttc 48

<210> 3

<211> 34

<212> DNA

<213> artificial sequence

<400> 3

ataacttcgt ataggatact ttatacgaag ttat 34

<210> 4

<211> 34

<212> DNA

<213> artificial sequence

<400> 4

ataacttcgt atagcataca ttatacgaag ttat 34

<210> 5

<211> 466

<212> DNA

<213> artificial sequence

<400> 5

gaaaaatctg gctagtaaaa catgtaagga aaattttagg gatgttaaag aaaaaaataa 60

cacaaaacaa aatataaaaa aaatctaacc tcaagtcaag gcttttctat ggaataagga 120

atggacagca gggggctgtt tcatatactg atgacctctt tatagccacc tttgttcatg 180

gcagccagca tatggcatat gttgccaaac tctaaaccaa atactcattc tgatgtttta 240

aatgatttgc cctcccatat gtccttccga gtgagagaca caaaaaattc caacacacta 300

ttgcaatgaa aataaatttc ctttattagc cagaagtcag atgctcaagg ggcttcatga 360

tgtccccata atttttggca gagggaaaaa gatctcagtg gtatttgtga gccagggcat 420

tggccacacc agccaccacc ttctgatagg cagcctgcac ctgagg 466

<210> 6

<211> 720

<212> DNA

<213> artificial sequence

<400> 6

ttacttgtac agctcgtcca tgccgagagt gatcccggcg gcggtcacga actccagcag 60

gaccatgtga tcgcgcttct cgttggggtc tttgctcagg gcggactggg tgctcaggta 120

gtggttgtcg ggcagcagca cggggccgtc gccgatgggg gtgttctgct ggtagtggtc 180

ggcgagctgc acgctgccgt cctcgatgtt gtggcggatc ttgaagttca ccttgatgcc 240

gttcttctgc ttgtcggcca tgatatagac gttgtggctg ttgtagttgt actccagctt 300

gtgccccagg atgttgccgt cctccttgaa gtcgatgccc ttcagctcga tgcggttcac 360

cagggtgtcg ccctcgaact tcacctcggc gcgggtcttg tagttgccgt cgtccttgaa 420

gaagatggtg cgctcctgga cgtagccttc gggcatggcg gacttgaaga agtcgtgctg 480

cttcatgtgg tcggggtagc ggctgaagca ctgcacgccg taggtcaggg tggtcacgag 540

ggtgggccag ggcacgggca gcttgccggt ggtgcagatg aacttcaggg tcagcttgcc 600

gtaggtggca tcgccctcgc cctcgccgga cacgctgaac ttgtggccgt ttacgtcgcc 660

gtccagctcg accaggatgg gcaccacccc ggtgaacagc tcctcgccct tgctcaccat 720

<210> 7

<211> 600

<212> DNA

<213> artificial sequence

<400> 7

atgaccgagt acaagcccac ggtgcgcctc gccacccgcg acgacgtccc cagggccgta 60

cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc gccacaccgt cgatccggac 120

cgccacatcg agcgggtcac cgagctgcaa gaactcttcc tcacgcgcgt cgggctcgac 180

atcggcaagg tgtgggtcgc ggacgacggc gccgccgtgg cggtctggac cacgccggag 240

agcgtcgaag cgggggcggt gttcgccgag atcggcccgc gcatggccga gttgagcggt 300

tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg gcccaaggag 360

cccgcgtggt tcctggccac cgtcggagtc tcgcccgacc accagggcaa gggtctgggc 420

agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg ccggggtgcc cgccttcctg 480

gagacctccg cgccccgcaa cctccccttc tacgagcggc tcggcttcac cgtcaccgcc 540

gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga cccgcaagcc cggtgcctga 600

<210> 8

<211> 47

<212> DNA

<213> artificial sequence

<400> 8

cgggcccctc tgctaaccat gttcatgcct tcttctcttt cctacag 47

<210> 9

<211> 3072

<212> DNA

<213> artificial sequence

<400> 9

gtgagtttgg ggacccttga ttgttctttc tttttcgcta ttgtaaaatt cttaatttct 60

aggaagtacc tattccgaag ttcctattct ctagaaagta taggaacttc gtcgactata 120

gcataacttc gtatagcata cattatacga agttatcctg catcgaccta gactagctag 180

aactagtata acttcgtata ggatacttta tacgaagtta tgaaaaatct ggctagtaaa 240

acatgtaagg aaaattttag ggatgttaaa gaaaaaaata acacaaaaca aaatataaaa 300

aaaatctaac ctcaagtcaa ggcttttcta tggaataagg aatggacagc agggggctgt 360

ttcatatact gatgacctct ttatagccac ctttgttcat ggcagccagc atatggcata 420

tgttgccaaa ctctaaacca aatactcatt ctgatgtttt aaatgatttg ccctcccata 480

tgtccttccg agtgagagac acaaaaaatt ccaacacact attgcaatga aaataaattt 540

cctttattag ccagaagtca gatgctcaag gggcttcatg atgtccccat aatttttggc 600

agagggaaaa agatctcagt ggtatttgtg agccagggca ttggccacac cagccaccac 660

cttctgatag gcagcctgca cctgaggtta cttgtacagc tcgtccatgc cgagagtgat 720

cccggcggcg gtcacgaact ccagcaggac catgtgatcg cgcttctcgt tggggtcttt 780

gctcagggcg gactgggtgc tcaggtagtg gttgtcgggc agcagcacgg ggccgtcgcc 840

gatgggggtg ttctgctggt agtggtcggc gagctgcacg ctgccgtcct cgatgttgtg 900

gcggatcttg aagttcacct tgatgccgtt cttctgcttg tcggccatga tatagacgtt 960

gtggctgttg tagttgtact ccagcttgtg ccccaggatg ttgccgtcct ccttgaagtc 1020

gatgcccttc agctcgatgc ggttcaccag ggtgtcgccc tcgaacttca cctcggcgcg 1080

ggtcttgtag ttgccgtcgt ccttgaagaa gatggtgcgc tcctggacgt agccttcggg 1140

catggcggac ttgaagaagt cgtgctgctt catgtggtcg gggtagcggc tgaagcactg 1200

cacgccgtag gtcagggtgg tcacgagggt gggccagggc acgggcagct tgccggtggt 1260

gcagatgaac ttcagggtca gcttgccgta ggtggcatcg ccctcgccct cgccggacac 1320

gctgaacttg tggccgttta cgtcgccgtc cagctcgacc aggatgggca ccaccccggt 1380

gaacagctcc tcgcccttgc tcaccatctg taggaaagag aagaaggcat gaacatggtt 1440

agcagagggg cccggttggg tcgtttgttc ggatctagac tagaataact tcgtataatg 1500

tatgctatac gaagttatgg ggatcggcaa taaaaaggaa ttctaccggg taggggaggc 1560

gcttttccca aggcagtctg gagcatgcgc tttagcagcc ccgctgggca cttggcgcta 1620

cacaagtggc ctctggcctc gcacacattc cacatccacc ggtaggcgcc aaccggctcc 1680

gttctttggt ggccccttcg cgccaccttc tactcctccc ctagtcagga agttcccccc 1740

cgccccgcag ctcgcgtcgt gcaggacgtg acaaatggaa gtagcacgtc tcactagtct 1800

cgtgcagatg gacagcaccg ctgagcaatg gaagcgggta ggcctttggg gcagcggcca 1860

atagcagctt tgctccttcg ctttctgggc tcagaggctg ggaaggggtg ggtccggggg 1920

cgggctcagg ggcgggctca ggggcggggc gggcgcccga aggtcctccg gaggcccggc 1980

attctgcacg cttcaaaagc gcacgtctgc cgcgctgttc tcctcttcct catctccggg 2040

cctttcgacc tgcaggtcct cgccatgacc gagtacaagc ccacggtgcg cctcgccacc 2100

cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg cgttcgccga ctaccccgcc 2160

acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg tcaccgagct gcaagaactc 2220

ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg tcgcggacga cggcgccgcc 2280

gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg cggtgttcgc cgagatcggc 2340

ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc agcaacagat ggaaggcctc 2400

ctggcgccgc accggcccaa ggagcccgcg tggttcctgg ccaccgtcgg agtctcgccc 2460

gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc ccggagtgga ggcggccgag 2520

cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc gcaacctccc cttctacgag 2580

cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg aaggaccgcg cacctggtgc 2640

atgacccgca agcccggtgc ctgactgtgc cttctagttg ccagccatct gttgtttgcc 2700

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 2760

atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 2820

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg gatgcggtgg 2880

gctctatgga cagaataaaa cgcacgggta taacttcgta taaagtatcc tatacgaagt 2940

tatcagatcc tagagctgaa gtacctattc cgaagttcct attctctaga aagtatagga 3000

acttcagctc gctgatcagc ctcgacgggc ccctctgcta accatgttca tgccttcttc 3060

tctttcctac ag 3072

<210> 10

<211> 747

<212> DNA

<213> artificial sequence

<400> 10

atgtctagac tggacaagag caaagtcata aactctgctc tggaattact caatggagtc 60

ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120

ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctgccaat cgagatgctg 180

gacaggcatc atacccactc ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240

aacaacgcca agtcataccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300

ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360

tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420

acactgggct gcgtattgga ggaacaggag catcaagtag caaaagagga aagagagaca 480

cctaccaccg attctatgcc cccacttctg aaacaagcaa ttgagctgtt cgaccggcag 540

ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600

ctaaagtgcg aaagcggcgg gccgaccgac gcccttgacg attttgactt agacatgctc 660

ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720

tttgaccttg acatgctccc cgggtaa 747

<210> 11

<211> 3318

<212> DNA

<213> artificial sequence

<400> 11

atggccaatc tcctgaccgt ccaccagaac ttgcctgccc tccccgtcga cgcaacctcc 60

gacgaggtgc gcaagaacct gatggacatg ttcagggatc gccaggcctt ctctgagcac 120

acctggaaga tgcttctgtc cgtgtgccgg tcctgggccg catggtgcaa gttgaacaac 180

cggaagtggt ttcccgccga gcctgaagac gtgcgcgatt accttctcta tcttcaggcc 240

cgcggactgg ccgtcaagac aatccagcag cacttgggcc agctcaacat gcttcacagg 300

cggtccgggc tgccaagacc aagcgacagc aatgctgtgt ccctggtgat gcggcggatc 360

agaaaggaga acgtggacgc aggcgaaagg gcaaagcagg ctctcgcctt cgaacgcaca 420

gacttcgacc aggtgaggtc tctcatggag aatagcgacc gctgccagga tatcaggaat 480

ctggccttcc tggggattgc ttacaacacc ctgctcagga tcgccgagat tgccaggatc 540

agggtgaaag acatctccag gacagacggc gggagaatgc tcatccacat tggcagaacc 600

aagaccctgg tgagcaccgc cggcgtggag aaggccctta gcctgggggt gactaaactg 660

gtcgagagat ggatttccgt ctctggcgtg gctgacgatc ccaataacta cctgttttgc 720

cgggtcagaa aaaatggcgt ggccgcacca tctgccacca gccagctctc cacacgcgcc 780

ctggaaggga tttttgaagc aacacacaga ttgatttacg gcgctaagga cgactctggc 840

cagagatacc tggcctggtc tggacacagc gccagggtcg gagccgcaag agacatggcc 900

cgcgctggag tgtccatccc cgagatcatg caggctggcg gctggaccaa tgtgaatatt 960

gtcatgaact atatcaggaa cctggacagc gagacagggg caatggtgcg cctgctggaa 1020

gatggcgatg agggcagagg aagtcttcta acatgcggtg acgtggagga gaatcccggc 1080

cctatggcta tgagccagtt cgacatcctg tgcaagaccc cccccaaggt gctggtgcgg 1140

cagttcgtgg agagattcga gaggcccagc ggcgagaaga tcgccagctg tgccgccgag 1200

ctgacctacc tgtgctggat gatcacccac aacggcaccg ccatcaagag ggccaccttc 1260

atgagctaca acaccatcat cagcaacagc ctgagcttcg acatcgtgaa caagagcctg 1320

cagttcaagt acaagaccca gaaggccacc atcctggagg ccagcctgaa gaagctgatc 1380

cccgcctggg agttcaccat catcccttac aacggccaga agcaccagag cgacatcacc 1440

gacatcgtgt ccagcctgca gctgcagttc gagagcagcg aggaggccga caagggcaac 1500

agccacagca agaagatgct gaaggccctg ctgtccgagg gcgagagcat ctgggagatc 1560

accgagaaga tcctgaacag cttcgagtac accagcaggt tcaccaagac caagaccctg 1620

taccagttcc tgttcctggc cacattcatc aactgcggca ggttcagcga catcaagaac 1680

gtggacccca agagcttcaa gctggtgcag aacaagtacc tgggcgtgat cattcagtgc 1740

ctggtgaccg agaccaagac aagcgtgtcc aggcacatct actttttcag cgccagaggc 1800

aggatcgacc ccctggtgta cctggacgag ttcctgagga acagcgagcc cgtgctgaag 1860

agagtgaaca ggaccggcaa cagcagcagc aacaagcagg agtaccagct gctgaaggac 1920

aacctggtgc gcagctacaa caaggccctg aagaagaacg ccccctaccc catcttcgct 1980

atcaagaacg gccctaagag ccacatcggc aggcacctga tgaccagctt tctgagcatg 2040

aagggcctga ccgagctgac aaacgtggtg ggcaactgga gcgacaagag ggcctccgcc 2100

gtggccagga ccacctacac ccaccagatc accgccatcc ccgaccacta cttcgccctg 2160

gtgtccaggt actacgccta cgaccccatc agcaaggaga tgatcgccct gaaggacgag 2220

accaacccca tcgaggagtg gcagcacatc gagcagctga agggcagcgc cgagggcagc 2280

atcagatacc ccgcctggaa cggcatcatc agccaggagg tgctggacta cctgagcagc 2340

tacatcaaca ggcggatctg cgtacgcgga tcctctgctg gagacatgag agctgccaac 2400

ctttggccaa gcccgctcat gatcaaacgc tctaagaaga acagcctggc cttgtccctg 2460

acggccgacc agatggtcag tgccttgttg gatgctgagc cccccatact ctattccgag 2520

tatgatccta ccagaccctt cagtgaagct tcgatgatgg gcttacttac caacctggca 2580

gacagggagc tggttcacat gatcaactgg gcgaagaggg tgccaggctt tgtggatttg 2640

accctccatg atcaggtcca ccttctagaa tgtgcctggc tagagatcct gatgattggt 2700

ctcgtctggc gctccatgga gcacccagtg aagctactgt ttgctcctaa cttgctcttg 2760

gacaggaacc agggaaaatg tgtagagggc atggtggaga tcttcgacat gctgctggct 2820

acatcatctc ggttccgcat gatgaatctg cagggagagg agtttgtgtg cctcaaatct 2880

attattttgc ttaattctgg agtgtacaca tttctgtcca gcaccctgaa gtctctggaa 2940

gagaaggacc atatccaccg agtcctggac aagatcacag acactttgat ccacctgatg 3000

gccaaggcag gcctgaccct gcagcagcag caccagcggc tggcccagct cctcctcatc 3060

ctctcccaca tcaggcacat gagtaacaaa ggcatggagc atctgtacag catgaagtgc 3120

aagaacgtgg tgcccctcta tgacctgctg ctggaggcgg cggacgccca ccgcctacat 3180

gcgcccacta gccgtggagg ggcatccgtg gaggagacgg accaaagcca cttggccact 3240

gcgggctcta cttcatcgca ttccttgcaa aagtattaca tcacggggga ggcagagggt 3300

ttccctgcca cagcttag 3318

Claims (10)

1. A reversible gene knockout system, wherein the reversible gene knockout system comprises a transcriptional regulatory element;

the transcription regulating element sequentially comprises a 5' cutting site, a Flpo recombinase homodromous recognition site FRT, a Cre recombinase reverse recognition site loxP2272, a Cre recombinase reverse recognition site loxP, an inverted transcription termination sequence, an inverted fluorescent protein gene, an inverted 3' cutting site, a Cre recombinase reverse recognition site loxP2272, a drug screening marker gene, a Cre recombinase reverse recognition site loxP, a Flpo recombinase homodromous recognition site FRT and a 3' cutting site from the 5' end to the 3' end.

2. The reversible gene knockout system of claim 1, wherein the nucleic acid sequence of the 5' cleavage site comprises the sequence shown in SEQ ID No. 1;

preferably, the nucleic acid sequence of the Flpo recombinase homodromous recognition site FRT comprises the sequence shown in SEQ ID No. 2;

preferably, the nucleic acid sequence of the Cre recombinase reverse recognition site loxP2272 comprises a sequence shown in SEQ ID NO. 3;

preferably, the nucleic acid sequence of the Cre recombinase reverse recognition site loxP comprises a sequence shown in SEQ ID NO. 4;

preferably, the nucleic acid sequence of the transcription termination sequence comprises the sequence shown in SEQ ID NO. 5;

preferably, the fluorescent protein gene comprises EGFP;

preferably, the nucleic acid sequence of EGFP comprises the sequence shown in SEQ ID NO. 6;

preferably, the drug screening marker gene comprises Puro;

preferably, the nucleic acid sequence of Puro comprises the sequence shown in SEQ ID No. 7;

preferably, the nucleic acid sequence of the 3' cleavage site comprises the sequence shown in SEQ ID NO. 8.

3. The reversible gene knockout system according to claim 1 or 2, characterized in that the nucleic acid sequence of the transcription regulatory element comprises the sequence shown in SEQ ID No. 9.

4. The reversible gene knockout system of any one of claims 1-3, wherein the reversible gene knockout system further comprises rtTA expression elements and recombinase expression elements;

the rtTA expression element contains an rtTA gene;

the recombinase expression element comprises a TRE3G promoter, a Cre recombinase gene and a Flpo recombinase gene.

5. The reversible gene knockout system according to claim 4, wherein the rtTA expression element further comprises a resistance gene;

preferably, the resistance gene comprises a NEO gene;

preferably, the nucleic acid sequence of the rtTA expression element comprises the sequence shown in SEQ ID No. 10;

preferably, the nucleic acid sequence of the recombinase expression element comprises the sequence shown in SEQ ID NO. 11.

6. A reversible gene knockout system according to any one of claims 1-3, characterized in that the reversible gene knockout system comprises a transcriptional regulatory element, a rtTA expression element and a recombinase expression element, the nucleic acid sequence of the transcriptional regulatory element comprising the sequence shown in SEQ ID No.9, the nucleic acid sequence of the rtTA expression element comprising the sequence shown in SEQ ID No.10 and the nucleic acid sequence of the recombinase expression element comprising the sequence shown in SEQ ID No. 11.

7. Use of a reversible gene knockout system according to any one of claims 1-6 for the preparation of a gene knockout product.

8. A pharmaceutical composition comprising the reversible gene knockout system of any one of claims 1-6;

preferably, the pharmaceutical composition further comprises an adjuvant;

preferably, the auxiliary materials comprise any one or a combination of at least two of pharmaceutically acceptable carriers, diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, bacteriostats or buffers.

9. Use of a reversible gene knockout system according to any one of claims 1-6 in gene knockout.

10. A method of gene knockout, the method comprising:

introducing the reversible gene knockout system of any one of claims 1 to 6 into a cell for gene knockout.