CN117305202A

CN117305202A - Genetic engineering strain for synthesizing L-threonine by using ethanol and construction method and application thereof

Info

Publication number: CN117305202A
Application number: CN202311049947.7A
Authority: CN
Inventors: 李�灿; 王旺银; 王迎晨
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2023-08-18
Filing date: 2023-08-18
Publication date: 2023-12-29

Abstract

The application discloses a genetic engineering strain for synthesizing L-threonine by using ethanol, and a construction method and application thereof, and belongs to the technical field of genetic engineering. The genetic engineering strain provided by the invention comprises a starting strain, an initial expression vector, a promoter, an exogenous gene and an endogenous gene; the starting strain comprises escherichia coli; the exogenous genes include alcohol dehydrogenase genes and acetaldehyde dehydrogenase genes; the endogenous gene is derived from the genome of E.coli. The genetic engineering strain provided by the invention can grow and accumulate a large amount of L-threonine by using ethanol, and overcomes the defect that microorganisms cannot ferment by using ethanol in the prior art.

Description

Genetic engineering strain for synthesizing L-threonine by using ethanol and construction method and application thereof

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a genetic engineering strain for synthesizing L-threonine by using ethanol, and a construction method and application thereof.

Background

The conversion and utilization of carbon dioxide are worldwide scientific problems, the artificial light synthesis and synthesis biology are fused, and the continuous catalytic reaction is driven by utilizing renewable energy represented by solar energy, so that the conversion of carbon dioxide into solar fuel and green chemicals is realized, and a new way is opened up for solving the problems of energy shortage and environmental pollution. The fermentation of L-threonine is seriously dependent on glucose, and along with the development of the field of artificial light synthesis, an artificial light synthesis system such as photoelectrocatalysis and the like can effectively utilize renewable energy sources to realize CO ₂ The ethanol is prepared fixedly, if the recombinant microorganism strain is constructed to directionally synthesize the L-threonine by taking the ethanol as the raw material, the problem of excessive emission of carbon dioxide can be fundamentally solved, and the dependence of fermentation industry on biomass energy sources of grains such as glucose can be relieved.

Threonine is an essential amino acid for human body and has wide application in the fields of health care and antibiotic synthesis. Meanwhile, threonine has a large market demand in the feed field, and is a second limiting amino acid of pig feed and a third limiting amino acid of poultry private chat. Threonine synthesis is currently dependent on the fermentation of glucose by microorganisms. However, the theoretical conversion rate of threonine produced by glucose fermentation is only 0.81g/g due to the limitation of metabolic pathways of threonine produced by glucose, which also results in that the yield and the atomic economy of the biological fermentation of threonine are not improved all the time at present, and generally only 0.5g/g can be achieved. Compared with glucose, ethanol is used as an emerging fermentation substrate, the theoretical conversion rate of glucose synthesized by the ethanol is close to 100%, the fermentation yield can be effectively improved, and the fermentation cost is saved in industrial production. At present, there are few reports on how to construct recombinant microorganism strains for L-threonine synthesis using ethanol.

Disclosure of Invention

In order to solve the technical problems, the invention provides a genetic engineering strain for synthesizing L-threonine by using ethanol, a construction method and application thereof, wherein the genetic engineering strain can obtain L-threonine by using ethanol to grow and ferment through over-expressing exogenous ethanol dehydrogenase genes and acetaldehyde dehydrogenase genes and over-expressing endogenous genes thrA BC and rhtC from escherichia coli.

In order to achieve the above object, the present invention provides the following technical solutions:

in one aspect, the invention provides a genetically engineered strain for synthesizing L-threonine by using ethanol, wherein the genetically engineered strain comprises a starting strain, an initial expression vector, a promoter, an exogenous gene and an endogenous gene;

the starting strain comprises escherichia coli;

the exogenous genes include alcohol dehydrogenase genes and acetaldehyde dehydrogenase genes;

the endogenous genes include thrA BC gene and rhtC gene.

Optionally, the initial expression vector comprises pRSFduet-1 and/or pACYC184.

Alternatively, when the initial expression vector is pRSFduet-1, the promoter comprises Ptrc-tho, and the nucleotide sequence of Ptrc-tho is shown as SEQ ID No. 1;

when the initial expression vector is pACYC184, the promoter comprises ParaBAD, and the nucleotide sequence of the ParaBAD is shown in SEQ ID No. 2.

Optionally, the NCBI of the alcohol dehydrogenase gene has the accession number GenBank:WP_012885841;

the accession number of NCBI of the acetaldehyde dehydrogenase gene is GenBank: NP-014032;

the nucleotide sequence of the thrA BC gene is shown as SEQ ID No. 3;

the nucleotide sequence of the rhtC gene is shown as SEQ ID No. 4.

Alternatively, thrA in the thrA BC gene is a base substitution of 1034 of thrA gene in the host cell genome with base T.

Alternatively, the thrA BC gene encodes aspartokinase, homoserine dehydrogenase, homoserine kinase, and threonine synthase.

Alternatively, the rhtC gene encodes an L-threonine extracellular transporter.

In a second aspect, the invention provides a construction method of the genetic engineering strain, comprising the following steps:

step 1), connecting the exogenous gene and the endogenous gene with an initial expression vector and a promoter to obtain a recombinant over-expression vector;

and 2) transferring the recombinant over-expression vector into an original strain to obtain the genetic engineering strain.

Alternatively, step 2) transferring the recombinant over-expression vector into competent cells of the starting strain.

Optionally, step 2) after transferring the recombinant overexpression vector into the starting strain, the method further comprises a step of screening with antibiotics.

In a third aspect, the present invention provides the use of the above genetically engineered strain in the synthesis of L-threonine and its derivatives using ethanol.

In a fourth aspect, the present invention provides a method for synthesizing L-threonine using ethanol, comprising the steps of:

inoculating the genetic engineering strain into a culture medium for biological fermentation to obtain the L-threonine.

Optionally, the inoculation amount of the genetically engineered strain is 0.2-30 OD ₆₀₀ 。

Preferably, the inoculation amount of the genetically engineered strain is 2-30 OD ₆₀₀ 。

Alternatively, the inoculum size of the genetically engineered strain is independently selected from 0.2OD ₆₀₀ 、1OD ₆₀₀ 、2OD ₆₀₀ 、5OD ₆₀₀ 、10OD ₆₀₀ 、15OD ₆₀₀ 、20OD ₆₀₀ 、25OD ₆₀₀ 、30OD ₆₀₀ Any value therein or any range therebetween.

Optionally, the medium comprises ethanol;

the initial addition amount of the ethanol is 5-20 g/L.

Preferably, the initial addition amount of the ethanol is 8-12 g/L.

Alternatively, the initial addition of ethanol is independently selected from any of 5g/L, 8g/L, 10g/L, 12g/L, 14g/L, 16g/L, 18g/L, 20g/L, or a range of values therebetween.

Optionally, phosphate, magnesium salt, chelating agent and trace elements are also included in the culture medium.

Optionally, the phosphate salt comprises potassium dihydrogen phosphate and diammonium hydrogen phosphate.

Optionally, the magnesium salt comprises magnesium sulfate.

Optionally, the chelating agent comprises EDTA.

Optionally, the trace elements are selected from one or more of soluble cobalt salts, manganese salts, copper salts, molybdenum salts, zinc salts, iron salts and boric acid.

Optionally, the biological fermentation is performed under aerobic conditions.

Optionally, the temperature of the biological fermentation is 27-45 ℃.

Preferably, the temperature of the biological fermentation is 30-37 ℃.

Optionally, the time of the biological fermentation is not less than 24 hours.

Optionally, the pH of the culture medium is controlled to be 6-7.5 in the biological fermentation process.

Compared with the prior art, the invention has the following beneficial effects:

(1) The genetic engineering strain provided by the invention takes escherichia coli as an original strain, introduces exogenous ethanol dehydrogenase genes and acetaldehyde dehydrogenase genes, simultaneously overexpresses endogenous genes thrA BC and rhtC from the escherichia coli, can grow and accumulate L-threonine by utilizing ethanol, and overcomes the defect that microorganisms cannot utilize ethanol for fermentation in the prior art.

(2) The genetically engineered strain provided by the invention can produce a large amount of L-threonine outside cells, the yield of L-threonine reaches 9.6g/L, the conversion rate is 0.67g/g, and compared with the conversion rate of 0.5g/g for producing L-threonine in the current industry, the conversion rate is improved by 34%.

Drawings

FIG. 1 is a diagram showing the information of the initial plasmid and the recombinant plasmid when the ethanol pathway is used in the present invention;

FIG. 2 is a diagram showing information on the initial plasmid and the recombinant plasmid in the production of L-threonine according to the present invention;

FIG. 3 is a schematic diagram showing fermentation conditions of the genetically engineered strain BW-ethr of the present invention for synthesizing L-threonine by ethanol;

FIG. 4 is a schematic diagram showing ethanol consumption of the genetically engineered strain BW-ethr of the present invention for synthesizing L-threonine using ethanol.

Detailed Description

The present application is further illustrated below in conjunction with specific examples. The following description is given of several embodiments of the present application and is not intended to limit the present application in any way, and although the present application is disclosed in the preferred embodiments, it is not intended to limit the present application, and any person skilled in the art may make various changes or modifications using the technical contents disclosed above without departing from the scope of the technical solutions of the present application, which are equivalent to the equivalent embodiments.

Unless otherwise indicated, all starting materials in the examples of the present application were purchased commercially and used without any particular treatment.

Unless otherwise indicated, the analytical methods in the examples all employed conventional arrangements of instruments or equipment and conventional analytical methods.

The sources of the strain E.coli BW25113 used in the examples below were: https:// www.mingzhoubio.com/good-109218. Html, purchased from Ningbo biosome under the designation BMZ066594.

Example 1

Construction of a pathway for recombinant bacteria to use ethanol:

an ethanol utilization module was constructed in E.coli BW25113, expressing heterologous ethanol dehydrogenase and acetaldehyde dehydrogenase. Exogenous alcohol dehydrogenase and acetaldehyde dehydrogenase are synthesized by total gene synthesis. The ada gene (NCBI accession number is GenBank: WP_ 012885841) encoding alcohol dehydrogenase from Saccharomyces cerevisiae genome and the adh gene (NCBI accession number is GenBank: NP_ 014032) encoding acetaldehyde dehydrogenase from Rhizoctonia cerealis genome are cloned on pRSFduret-1 plasmid and controlled by Ptrc-tho promoter (nucleotide sequence is shown as SEQ ID No. 1) to obtain recombinant plasmid. The information of the initial plasmid and the recombinant plasmid is shown in FIG. 1. Transferring the obtained recombinant plasmid into the competence of wild escherichia coli BW25113, and screening correct genetic engineering bacteria by using antibiotics to obtain BW-e strain. After entering the escherichia coli, the ethanol is catalytically converted into acetyl-CoA, and the acetyl-CoA participates in the metabolic process of the microorganism.

Example 2

Construction of L-threonine pathway production by recombinant strains:

thrA BC gene and rhtC gene from the escherichia coli genome were amplified by pcr. thrA BC (nucleotide sequence shown as SEQ ID No. 3) and rhtC gene (nucleotide sequence shown as SEQ ID No. 4) were cloned into pACYC184 plasmid, and the L-arabinose inducible promoter ParaBAD, i.e., araBAD promoter (nucleotide sequence shown as SEQ ID No. 2) was selected to control the expression of the gene. The information of the initial plasmid and the recombinant plasmid is shown in FIG. 2. The specific operation is as follows:

(1) The front half thr-1 fragment of thrA BC gene cluster was amplified using the E.coli BW25113 genome as template and the primer thr-F-1/thr-R-1. The latter half thr-2 fragment of thrA BC gene cluster was amplified using primers thr-F-2/thr-R-2. And overlapping the thr-1 fragment and the thr-2 fragment into a thrA-BC fragment with single base mutation by using an overlapping PCR technology through primers thr-F-1 and thr-R-2. The plasmid fragment pACYC-1 was amplified using the nucleic acid sequence of the pACYC184 plasmid as a template and using primers pACYC-F/pACYC-R. Finally, the thrA BC fragment and the pACYC-1 fragment are connected by utilizing the homologous recombination technology to form plasmid pACYC-thrA BC.

(2) The rhtC fragment was amplified using the E.coli BW25113 genome as template and the primer rhtC-F/rhtC-R. The plasmid fragment pACYC-2 was amplified using the primer pACYC-F-2/pACYC-R-2, with the nucleic acid sequence of the pACYC-thrA BC plasmid as a template. Finally, the rhtC fragment and the pACYC-2 fragment are connected by utilizing the homologous recombination technology to form plasmid pACYC-thrA BC-rhtC. Transferring plasmid pACYC-thrA BC-rhtC into BW-e strain to obtain final genetically engineered strain BW-ethr strain.

The primer information for the amplification is as follows:

thr-F-1 is shown as SEQ ID No. 5:

GGTTATAAAAAATGCGAGTGTTGAAGTTCGGCGG；

thr-R-1 is shown as SEQ ID No. 6:

AATACGGGCGCGTGACATCGCTGCAAAGACGCG；

thr-F-2 is shown in SEQ ID No. 7:

AGCGATGTCACGCGCCCGTATTTTCGTGGTGCTG；

thr-R-2 is shown as SEQ ID No. 8:

TGATGCCTGGTTACTGATGATTCATCATCA；

pACYC-F is shown in SEQ ID No. 9:

ATCATCAGTAACCAGGCATCAAATAAAACGAAAGG；

pACYC-R is shown in SEQ ID No. 10:

CAACACTCGCATTTTTTATAACCTCCTTAGAGC；

rhtC-F is shown as SEQ ID No. 11:

CAGTAAAGAAGGAGATATACCATGTTGATGTTATTTCTCACCGTC GCC；

rhtC-R is shown as SEQ ID No. 12:

TTGATGCCTGGTCACCGCGAAATAATCAAATGAATGCC；

pACYC-F-2 is shown in SEQ ID No. 13:

TTCGCGGTGACCAGGCATCAAATAAAACGAAAGG；

pACYC-R-2 is shown in SEQ ID No. 14:

GGTATATCTCCTTCTTTACTGATGATTCATCATCAATTTACGCAACGCAGC。

example 3

Producing L-threonine by using escherichia coli genetic engineering bacteria BW-ethr fermentation:

the seed culture medium and the fermentation culture medium are prepared from the following components:

13.3g/L KH ₂ PO ₄ ，4g/L(NH ₄ ) ₂ HPO ₄ ，1.2g/L MgSO ₄ ，0.0084g/L EDTA，0.0025g/L CoCl ₂ ，0.015g/L MnCl ₂ ，0.0015g/L CuCl ₂ ，0.003g/L H ₃ BO ₃ ，0.0025g/L Na ₂ MoO ₄ ，0.008g/L Zn(CH ₃ COO) ₂ ，0.06g/L Fe(III)citrate。

the culture method comprises the following steps: at an initial OD ₆₀₀ The bacterial solution was inoculated into a seed medium at 0.3, and cultured overnight at 30℃at 200 rpm. The cultured cells were collected by centrifugation. Then re-dispersing the bacterial precipitate in 100mL fermentation medium to ensure OD ₆₀₀ 2.2. Simultaneously adding 10g/L ethanol as a fermentation substrate, and performing aerobic fermentation culture at 30 ℃ and 200 rpm.

The fermentation results are shown in FIGS. 3 and 4. After the fermentation was completed, the threonine yield was 81mM and the conversion was 0.67g/g.

Wherein, the conversion rate calculation formula: conversion rate

The foregoing description is only a few examples of the present application and is not intended to limit the present application in any way, and although the present application is disclosed in the preferred examples, it is not intended to limit the present application, and any person skilled in the art may make some changes or modifications to the disclosed technology without departing from the scope of the technical solution of the present application, and the technical solution is equivalent to the equivalent embodiments.

Claims

1. A genetically engineered strain for synthesizing L-threonine by using ethanol, which is characterized by comprising a starting strain, an initial expression vector, a promoter, an exogenous gene and an endogenous gene;

the starting strain comprises escherichia coli;

the endogenous genes include thrA BC gene and rhtC gene.

2. The genetically engineered strain for the synthesis of L-threonine using ethanol of claim 1, wherein said initial expression vector comprises prssfduet-1 and/or pACYC184.

3. The genetically engineered strain for the synthesis of L-threonine using ethanol of claim 2, wherein when said initial expression vector is prsfpdue-1, said promoter comprises Ptrc-tho, the nucleotide sequence of said Ptrc-tho is shown in SEQ ID No. 1;

4. The genetically engineered strain for the synthesis of L-threonine using ethanol of claim 1, wherein the NCBI of the alcohol dehydrogenase gene has accession No. genbank:wp_012885841;

the nucleotide sequence of the thrA BC gene is shown as SEQ ID No. 3;

the nucleotide sequence of the rhtC gene is shown as SEQ ID No. 4.

5. The method for constructing a genetically engineered strain according to any one of claims 1 to 4, comprising the steps of:

6. The method of constructing a genetically engineered strain according to claim 5, wherein step 2) the recombinant overexpression vector is transferred into competent cells of the starting strain;

preferably, step 2) further comprises the step of screening with antibiotics after transferring the recombinant overexpression vector into the starting strain.

7. The use of the genetically engineered strain according to any one of claims 1 to 4 for the synthesis of L-threonine and its derivatives using ethanol.

8. A method for synthesizing L-threonine by using ethanol, comprising the following steps:

inoculating the genetically engineered strain of any one of claims 1-4 into a culture medium for biological fermentation to obtain the L-threonine.

9. The method for synthesizing L-threonine of claim 8, wherein the genetic engineering strain is inoculated in an amount of 0.2 to 30OD ₆₀₀ ；

10. The method for synthesizing L-threonine using ethanol according to claim 8, wherein the medium comprises ethanol;

the initial addition amount of the ethanol is 5-20 g/L;

preferably, the initial addition amount of the ethanol is 8-12 g/L;

preferably, the biological fermentation is performed under aerobic conditions;

preferably, the temperature of the biological fermentation is 27-45 ℃;

preferably, the temperature of the biological fermentation is 30-37 ℃;

preferably, the time of the biological fermentation is not less than 24 hours;

preferably, the pH of the culture medium is controlled to be 6-7.5 in the biological fermentation process.