CN117304335A - Application of recombinant expression protein in preventing and/or treating respiratory diseases - Google Patents

Application of recombinant expression protein in preventing and/or treating respiratory diseases Download PDF

Info

Publication number
CN117304335A
CN117304335A CN202310601537.2A CN202310601537A CN117304335A CN 117304335 A CN117304335 A CN 117304335A CN 202310601537 A CN202310601537 A CN 202310601537A CN 117304335 A CN117304335 A CN 117304335A
Authority
CN
China
Prior art keywords
influenza
virus
coronavirus
omicron
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310601537.2A
Other languages
Chinese (zh)
Inventor
陆路
姜世勃
曹娜静
黄鑫
王欣玲
蔡艳星
王茜
杨霞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi Jinbo Bio Pharmaceutical Co ltd
Fudan University
Original Assignee
Shanxi Jinbo Bio Pharmaceutical Co ltd
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi Jinbo Bio Pharmaceutical Co ltd, Fudan University filed Critical Shanxi Jinbo Bio Pharmaceutical Co ltd
Priority to CN202310601537.2A priority Critical patent/CN117304335A/en
Publication of CN117304335A publication Critical patent/CN117304335A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/168—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0043—Nose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/42—Lectins, e.g. concanavalin, phytohaemagglutinin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Pulmonology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Otolaryngology (AREA)
  • Immunology (AREA)

Abstract

The invention relates to the use of recombinant expressed proteins for the prevention and/or treatment of respiratory diseases. Provides the application of two recombinant proteins in preparing medicaments for preventing and/or treating respiratory diseases, wherein the respiratory diseases are caused by influenza A virus infection or combined infection of influenza A virus and novel coronavirus, GRFT has an amino acid sequence shown as SEQ ID NO.1, and GL25E has an amino acid sequence shown as SEQ ID NO. 2. The invention provides a recombinant protein GRFT and fusion protein GL25E capable of efficiently inhibiting influenza A virus infection, wherein GL25E is coupled with EK1 polypeptide on the basis of GRFT, has good inhibitory activity on influenza A virus, has good inhibitory activity on influenza virus combined with novel coronavirus infection, and can be used for preparing medicaments for preventing and/or treating influenza virus and respiratory diseases caused by combined infection of influenza virus and coronavirus.

Description

Application of recombinant expression protein in preventing and/or treating respiratory diseases
Technical Field
The invention relates to the field of protein medicines, in particular to application of two recombinant expression proteins GRFT and GL25E in medicines for preventing and/or treating respiratory diseases.
Background
Influenza viruses are single-stranded negative-strand RNA viruses with envelope proteins, belonging to the Orthomyxoviridae family, influenza a viruses (Influenza A virus, IAV) contain 8 negative-sense single-stranded viral RNA (vRNA) gene segments, including viral polymerase basic protein 1 (PB 1), polymerase basic protein 2 (PB 2) and polymerase acidic protein (polymerase acidic, PA), nucleoprotein (NP), matrix protein (M) and nonstructural protein (nonstructural protein, NS).
Influenza Virus (IV) is divided into four subtypes, type a (a), type B (B), type C (C) and type D (D) according to the antigenicity of the viral nucleoprotein (Viral nucleoprotein, NP) and the matrix protein M1. Most influenza epidemics are caused by one or two influenza viruses, influenza a virus (Influenza A Virus, IAV) being the most common influenza virus in the influenza season. Respiratory disease symptoms caused by influenza virus include fever, sore throat, runny nose, dry cough, headache, sore throat, runny nose, muscle or body pain or gastrointestinal symptoms (vomiting and diarrhea), and the like. Influenza a viruses can be classified into 18 HA (H1-H18) subtypes and 11 NA (N1-N11) subtypes according to the antigenicity and genetic characteristics of the surface antigens Hemagglutinin (HA) and Neuraminidase (NA), wherein influenza viruses of different subtypes (e.g., H1N1, H7N9, H3N 2), H17N10 and H18N11 are isolated from bat.
HA is initially translated into HA0 precursor, which upon proteolysis and glycosylation forms a trimer consisting of three HA1 and three HA2 subunits. Precursor HA0 does not cause membrane fusion and must be cleaved by proteases to the HA1/HA2 complex before it can fuse with the membrane. Human HA0 protein and low pathogenic avian influenza virus are cleaved and activated extracellular by trypsin-like proteases or other soluble proteases. The mature HA1/HA2 complex comprises a membrane proximal handle domain comprising the N-and C-termini of HA1 and the entire HA2, and a membrane distal receptor binding domain comprising the receptor binding and residual esterase subdomains. After viral budding and HA0 lysis, influenza virus is able to infect new host cells. To this end, the HA protein binds to sialic acid containing receptors, and the virion is then internalized by endocytosis (clathrin-mediated or clathrin-independent) or macrophagia. During endocytosis, influenza virions are sequentially exposed to lower pH in early endosomes (pH 6.0-6.5), late endosomes (pH 5.0-5.5), and lysosomes (pH 4.6-5.0). Cleaved HA1/HA2 is trapped in a high energy (metastable) conformation and triggered by low pH organisms, an irreversible conformational change occurs, leading to membrane fusion. If the virion is exposed to a sufficiently low pH outside the host or host cell, the HA protein may be prematurely activated to irreversibly refold, thereby inactivating the virion.
The transmission of influenza viruses in humans occurs mainly by respiratory droplets, direct contact, aerosol from susceptible individuals to infected individuals, or respiratory mites. Unlike human influenza viruses, avian influenza viruses are transmitted primarily through the fecal-fecal, fecal-oral or fecal respiratory tract during migration of wild birds. HAs of human influenza viruses have a high affinity for the alpha-2, 6 sialic acid receptor, whereas HAs of most avian influenza viruses bind to alpha-2, 3 sialic acid. The human upper respiratory tract has only alpha-2, 6 sialic acid receptors present, and alpha-2, 3 sialic acid receptors are located in the human lower respiratory tract, at the respiratory bronchoalveolar and interstitial cell wall sites, whereas alpha-2, 3 sialic acid receptors are predominantly distributed in avian intestinal epithelial cells.
Epidemic conditions caused by influenza viruses are generally classified into seasonal influenza and pandemics. Seasonal influenza occurs almost every year. During the last 20 years, cross-species transmission of highly pathogenic H5N1 and H7N9 strains occurred occasionally, bringing a great threat to public health, and thus there is a need to develop efficient and broad-spectrum anti-influenza a virus drugs.
Recent studies have found that the possibility exists that infection with a novel coronavirus in combination with influenza results in exacerbation of the disease. Therefore, in the context of a global new coronavirus infection pandemic, there is a need to develop broad-spectrum inhibitors that are both resistant to influenza and new coronavirus infection, and that have prophylactic and therapeutic effects on combined infections.
Disclosure of Invention
In one aspect, the invention provides a fusion protein comprising a first polypeptide comprising the amino acid sequence shown in SEQ ID No.1 or a variant amino acid sequence thereof having one or more amino acid mutations and a second polypeptide comprising the amino acid sequence shown in SEQ ID No.3 or a variant amino acid sequence thereof having one or more amino acid mutations, and the first polypeptide and the second polypeptide are linked directly or through a linker.
In one embodiment, the first polypeptide has anti-influenza activity. In one embodiment, the second polypeptide has anti-coronavirus activity.
In one embodiment, the first polypeptide is at the N-terminus or the C-terminus of the second polypeptide.
In one embodiment, the joint is a flexible joint.
In one embodiment, the linker is (GS) n, (GGS) n, (GGGS) n, or (GGGGS) n, n being an integer from 1 to 20, 2 to 15, 3 to 10, or 4 to 8.
In one embodiment, the linker is (GGGGS) 5 。
In one embodiment, the fusion protein comprises the amino acid sequence shown in SEQ ID NO. 2.
In one embodiment, the mutation is a substitution, insertion, deletion and/or addition, preferably a conservative amino acid substitution.
In one aspect, the invention provides a nucleic acid encoding a fusion polypeptide according to the description herein.
In one aspect, the invention provides a vector comprising a nucleic acid according to the description herein,
in one embodiment, the vector comprises nucleotides encoding a purification tag, nucleotides encoding a precursor, and/or regulatory elements.
In one embodiment, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag, or a NusA tag.
In one embodiment, the regulatory element is selected from a promoter, a terminator and/or an enhancer.
In one aspect, the invention provides a host cell comprising a nucleic acid according to the disclosure or a vector according to the disclosure.
In one embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.
In one embodiment, the eukaryotic cell is a yeast cell, an animal cell, and/or an insect cell, and/or the prokaryotic cell is an E.coli cell.
In one aspect, the invention provides a pharmaceutical composition comprising a fusion polypeptide according to the present disclosure, a nucleic acid according to the present disclosure, and/or a vector according to the present disclosure, and further comprising a pharmaceutically acceptable carrier.
In one embodiment, the composition comprises an additional anti-influenza drug and/or an anti-coronavirus drug.
In one embodiment, the anti-influenza drug is an anti-influenza a virus drug, e.g., selected from oseltamivir, arbidol, marbalo Sha Wei, peramivir, and zanamivir.
In one embodiment, the anti-coronavirus drug is selected from Mo Nuola, nemutavir, ritonavir, albevudine, an Bawei mab, romidepuweimab, sotrovimab, imdevimab, casirivimab, tixagevimab, cilgavimab, bamlanivimab, etesevimab, amubarvimab, and romidepusevimab.
In one embodiment, the composition is in the form of a tablet, capsule, drop pill, aerosol, pill, powder, solution, suspension, emulsion, granule, liposome, transdermal agent, or lyophilized powder.
In one aspect, the invention provides an in vitro method of inhibiting proliferation of influenza virus and/or coronavirus comprising contacting a cell with a fusion protein described herein and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No. 1; wherein the influenza virus is influenza A virus and the coronavirus is SARS-CoV-2.
In one embodiment, the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1, and H7N9.
In one embodiment, SARS-CoV-2 is selected from a mutant strain having a mutation in wild-type SARS-CoV-2 and S protein, e.g., selected from D614G, omicron BA.1, omicron BA.2, omicron BA.3, omicron BA.5, omicron BF.7, omicron BQ.1 and Omicron XBB.
In one aspect, the invention provides the use of a fusion protein, nucleic acid, pharmaceutical composition and/or GRFT protein comprising the amino acid sequence shown in SEQ ID No.1 as described herein in the manufacture of a medicament for the prevention and/or treatment of a respiratory disease caused by an influenza a virus and/or a novel coronavirus infection, preferably by an influenza a virus infection or by an influenza a virus combined with a novel coronavirus. For example, the disease is influenza or influenza combined with a novel coronavirus infection.
In one embodiment, the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1, and H7N9; and/or severe acute respiratory syndrome coronavirus 2 is selected from wild-type SARS-CoV-2 and mutant strains mutated in S protein, e.g. from D614G, omicron ba.1, omicron ba.2, omicron ba.3, omicron ba.5, omicron bf.7, omicron bq.1 and Omicron XBB.
In one embodiment, the drug is a nasal drug.
In one embodiment, the drug is a prophylactic drug.
In one embodiment, the drug is a drug administered 3 hours prior to coronavirus infection to 3 hours after coronavirus infection, 2 hours prior to coronavirus infection to 2 hours after coronavirus infection, 1 hour prior to coronavirus infection to 1 hour after coronavirus infection, or 0.5 hours prior to coronavirus infection to 0.5 hours after coronavirus infection.
In one embodiment, the medicament is used for preventing and/or treating respiratory diseases by inhibiting the influenza a virus surface protein hemagglutinin-mediated endocytosis.
In one aspect, the invention provides a method of increasing anti-coronavirus activity of an anti-coronavirus polypeptide, a method of increasing anti-influenza virus activity of an anti-influenza virus and/or a method of adding anti-influenza virus activity in the event of increasing anti-coronavirus activity of an anti-coronavirus polypeptide, comprising fusing an anti-influenza polypeptide to an anti-coronavirus polypeptide, wherein the anti-coronavirus polypeptide comprises the amino acid sequence shown in SEQ ID No.3 or a variant amino acid sequence thereof having one or more amino acid mutations, the anti-influenza polypeptide comprises the amino acid sequence shown in SEQ ID No.1 or a variant amino acid sequence thereof having one or more amino acid mutations, by directly ligating the anti-influenza polypeptide to the anti-coronavirus polypeptide or by ligation through a linker; wherein the coronavirus is SARS-CoV-2; the influenza virus is influenza a virus.
In one embodiment, the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1, and H7N9.
In one embodiment, SARS-CoV-2 is selected from a mutant strain having a mutation in wild-type SARS-CoV-2 and S protein, e.g., selected from D614G, omicron BA.1, omicron BA.2, omicron BA.3, omicron BA.5, omicron BF.7, omicron BQ.1 and Omicron XBB.
In one embodiment, the anti-coronavirus polypeptide is at the N-terminus or the C-terminus of the anti-influenza polypeptide.
In one embodiment, the joint is a flexible joint.
In one embodiment, the linker is (GS) n, (GGS) n, (GGGS) n, or (GGGGS) n, n being an integer from 1 to 20, 2 to 15, 3 to 10, or 4 to 8.
In one embodiment, the linker is (GGGGS) 5 。
In one embodiment, the fusion protein comprises the amino acid sequence shown in SEQ ID NO. 2.
In one embodiment, the mutation is a substitution, insertion, deletion and/or addition, preferably a conservative amino acid substitution.
The invention provides a medicament for preventing and/or treating respiratory diseases, which comprises GRFT and GL25E.
The respiratory disease may be caused by an influenza a infection or by an influenza a virus combined with a novel coronavirus, the GRFT having a nucleotide sequence as shown in SEQ ID No.1 and the GL25E having a nucleotide sequence as shown in SEQ ID No. 2.
In one embodiment, the influenza virus comprises H1N1, H3N2, H5N1, H7N9, the novel coronavirus is Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
In one embodiment, the novel coronaviruses include wild-type coronaviruses and mutants mutated in the S protein comprising one or more of D614G, omicron ba.1, omicron ba.2, omicron ba.3, omicron ba.5, omicron bf.7, omicron bq.1, omicron XBB.
In one embodiment, the respiratory disease comprises influenza or influenza combined with a novel coronavirus infection.
In one embodiment, the medicament for preventing and/or treating respiratory diseases is administered nasally.
In one embodiment, nasal administration is performed 0.5 hours prior to coronavirus infection or 0.5 hours after coronavirus infection.
In one embodiment, GL25E is administered at a dose of not less than 0.4mg/kg.
In one embodiment, the CC50 of GRFT and GL25E is greater than 10000nM.
In one embodiment, GRFT and GL25EG prevent and/or treat respiratory disease by inhibiting influenza a virus surface protein Hemagglutinin (HA) -mediated endocytosis.
The advantages of the invention include:
1. the invention provides a recombinant expression protein GRFT (griffithsin) and a recombinant fusion expression protein GL25E (griffithiin-L25-EK 1) capable of efficiently inhibiting influenza A virus infection, which have good inhibitory activity on influenza A virus and can be used for preparing medicaments for preventing and/or treating respiratory diseases caused by influenza A virus or influenza A virus combined with novel coronavirus infection.
2. The anti-influenza polypeptides of the invention can increase the anti-coronavirus activity of the anti-coronavirus polypeptides herein.
3. The anti-coronavirus polypeptides of the invention may increase the anti-influenza activity of the anti-influenza polypeptides herein.
4. The invention provides a polypeptide medicine, in particular a preventive medicine, which can be used for novel coronavirus and influenza combined infection. The invention is particularly useful for preventing infection of a patient with influenza A virus or influenza A patient with SARS-CoV-2 or a disease caused by SARS-CoV-2 (e.g., a novel coronavirus infection).
5. The polypeptide of the invention is particularly suitable for preparing drugs for nasal administration, and has good patient compliance.
Drawings
FIG. 1 is an SDS-PAGE (FIG. a) and Western blot (FIG. b) identification chart of two recombinant expression proteins GRFT and GL25E provided by the invention;
FIG. 2 is a graph showing the results of detection of pseudo-viral infection of GRFT and GL25E proteins provided by the invention on MDCK cells by inhibiting H7N9 (panel a), H5N1/Thailand (panel b) and H5N1/QH (panel c);
FIG. 3 is a graph (a-d) showing the detection results of inhibiting influenza A live virus infection on MDCK cells by two proteins GRFT and GL25E provided by the invention;
FIG. 4 is a diagram (b) showing the results of purification and identification of the influenza A virus surface protein HA1 (a diagram) and detection of the binding of two proteins GRFT and GL25E to HA 1;
FIG. 5 is a graph showing the results of detection of binding of two proteins GRFT (panel a) and GL25E (panel b) provided by the invention to HA protein in the presence of mannose;
FIG. 6 is a graph showing the detection results of inhibiting influenza A virus A/Puerto Rico/8/1934 (H1N 1) infected mice by pre-challenge administration (a, c, E) and post-challenge administration (b, d, f) of two proteins GRFT and GL25E provided by the invention;
FIG. 7 is a graph showing the results of in vitro safety tests of GRFT and GL25E proteins provided by the invention;
FIG. 8 is a graph showing the results of in vivo safety tests of GRFT and GL25E proteins provided by the invention;
FIG. 9 is a graph showing the results of the detection of the inhibitory activity of two proteins GRFT and GL25E provided by the invention on novel coronavirus Omicron mutant pseudoviruses;
FIG. 10 is a graph showing the detection of the inhibitory activity of two proteins GRFT and GL25E provided by the invention on novel coronavirus live virus Omicron BA.2.2;
FIG. 11 is a graph showing the detection of the inhibitory activity of two proteins GRFT and GL25E provided by the invention on simultaneous infection of two target cells and one target cell by combining novel coronavirus pseudoviruses of influenza A viruses;
FIG. 12 is a graph showing the effect of two proteins GRFT and GL25E provided by the invention on inhibiting novel coronavirus pseudovirus infection of target cells by preventing influenza A virus.
Detailed Description
For a further understanding of the present invention, preferred embodiments of the invention are described below, but it is to be understood that these descriptions are merely intended to further illustrate the features and advantages of the invention and are not limiting of the invention claims. Those skilled in the art can, with the benefit of this disclosure, suitably modify the process parameters to achieve this. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included within the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this invention, without departing from the spirit or scope of the invention. While the following terms are believed to be well understood by those of ordinary skill in the art, the following definitions are set forth to aid in the description of the presently disclosed subject matter.
As used herein, griffithin, used interchangeably with GRFT polypeptide, is a seaweed-derived lectin, one of the most potent viral entry inhibitors discovered so far. It is currently being developed as a microbiocide, having a broad spectrum of activity against several enveloped viruses. GRFT can inhibit Human Immunodeficiency Virus (HIV) infection at picomolar concentrations, exceeding the capacity of most anti-HIV drugs. In this context, griffithin may have the amino acid sequence shown in SEQ ID NO.1 or a variant amino acid sequence thereof having one or more amino acid mutations.
As used herein, "influenza a virus" is the most common influenza virus in the influenza season. Respiratory disease symptoms caused by influenza virus include fever, sore throat, runny nose, dry cough, headache, sore throat, runny nose, muscle or body pain or gastrointestinal symptoms (vomiting and diarrhea), and the like. Influenza a viruses can be classified into 18 HA (H1-H18) subtypes and 11 NA (N1-N11) subtypes according to the antigenicity and genetic characteristics of the surface antigens Hemagglutinin (HA) and Neuraminidase (NA), wherein influenza viruses of different subtypes (e.g., H1N1, H7N9, H3N 2), H17N10 and H18N11 are isolated from bat. Herein, influenza a virus may be selected from H1N1, H3N2, H5N1 and H7N9.
As used herein, "SARS-CoV-2" refers to severe acute respiratory syndrome coronavirus 2, sometimes also referred to as a novel coronavirus or a novel coronavirus. In this context, the term may include mutant strains in which wild-type coronaviruses and S proteins are mutated, such as one or more of D614G, omicron ba.1, omacron ba.2, omacron ba.3, omacron ba.5, omacron bf.7, omacron bq.1, omacron XBB.
As used herein, "respiratory disease" refers to a disease or condition of the respiratory system, which may include upper respiratory tract infection, pneumonia, and the like. In this context, respiratory diseases refer in particular to respiratory diseases caused by viral infections, such as influenza and/or viral pneumonia, respiratory diseases caused by influenza a virus and/or SARS-CoV-2 or complications thereof.
As used herein, a peptide or polypeptide refers to a plurality of amino acid residues joined by peptide bonds.
As used herein, mutation refers to addition, deletion, substitution, and/or insertion of an amino acid sequence. In this context, a mutation is a conservative amino acid substitution. Any of the amino acid sequences herein, e.g., any of SEQ ID nos. 1-3, may be suitably modified to retain the desired activity (e.g., anti-influenza virus activity and/or anti-novel coronavirus activity).
As used herein, "linker" refers to one or more amino acid residues that connect multiple functional polypeptide moieties. For example, the linker is (GS) n, (GGS) n, (GGGS) n, or (GGGGS) n, n being an integer of 1 to 20, 2 to 15, 3 to 10, or 4 to 8. For example, n may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
As used herein, "nucleic acid" refers to a plurality of nucleotides connected by internucleotides. The internucleotide linkage may be, for example, a phosphodiester linkage. The nucleic acids herein may comprise polynucleotides encoding the polypeptides of the invention. To facilitate subsequent processing of the polypeptide, the nucleic acids of the invention may also comprise nucleotides encoding a purification tag, such as a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag, and, if desired, a nucleotide sequence encoding a leader sequence.
As used herein, the term "vector" is a nucleic acid vehicle into which a polynucleotide may be inserted. When a vector enables expression of a protein encoded by an inserted polynucleotide, the vector is referred to as an expression vector. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes, such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC), or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. The vector may contain a variety of elements that control expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain a replication origin. The vector may comprise a nucleic acid of the invention for ease of introduction into a cell for expression. The vector may comprise an expression control element, such as a promoter, terminator and/or enhancer, operably linked to the nucleic acid.
As used herein, the term "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biological techniques. These techniques include transfection of viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA by electroporation, lipofection, and particle gun. The host cell may be a eukaryotic cell or a prokaryotic cell. For example, eukaryotic cells are yeast cells, animal cells, and/or insect cells. The prokaryotic cell may be an E.coli cell.
As used herein, the degree of relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For the purposes of the present invention, a software application such as the software application described in the embos package (embos: the sequence identity between two amino acid sequences is determined by the Nidel-crafts algorithm (Needleman and Wunsch,1970, J.mol.biol. [ J.Mol.48:443-453) implemented by the Nidel program of European molecular biology open software suite, rice et al 2000,Trends Genet [ genetics trend ]16:276-277, preferably version 5.0 or newer). The parameters used are gap opening penalty of 10, gap extension penalty of 0.5, and EBLOSUM62 (the emoss version of BLOSUM 62) substitution matrix. The output of the nitel labeled "longest identity" (obtained using the non-simplified option) was used as the percent identity and calculated as follows:
(identical residue. Times.100)/(alignment Length-total number of gaps in the alignment)
For the purposes of the present invention, the sequence identity between two deoxynucleotide sequences is determined using the Nidelman-Wen application algorithm (Needleman and Wunsch,1970, supra) as implemented in the Nidel program of the EMBOSS software package (EMBOSS: european molecular biology open software suite, rice et al, 2000, supra), preferably version 5.0.0 or newer. The parameters used are gap opening penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBI NUC 4.4) substitution matrix. The output of the nitel labeled "longest identity" (obtained using the non-simplified option) was used as the percent identity and calculated as follows:
(identical deoxyribonucleotides x 100)/(alignment Length-total number of gaps in the alignment)
In the context of the present invention, conservative amino acid substitutions or conservative substitutions may be defined by substitutions within the class of amino acids reflected in one or more of the following tables:
table 1: amino acid residues of conserved class:
acidic residues D and E
Basic residues K. R, and H
Hydrophilic uncharged residues S, T, N and Q
Aliphatic uncharged residues G. A, V, L and I
Nonpolar uncharged residues C. M and P
Aromatic residues F. Y and W
Table 2: physical and functional classification of alternative amino acid residues:
residues containing alcohol groups S and T
Aliphatic residues I. L, V and M
Cycloalkenyl-related residues F. H, W and Y
Hydrophobic residues A. C, F, G, H, I, L, M, R, T, V, W and Y
Negatively charged residues D and E
Polar residues C. D, E, H, K, N, Q, R, S and T
Positively charged residues H. K and R
Small residues A. C, D, G, N, P, S, T and V
Minimal residues A. G and S
Residues involved in corner formation A. C, D, E, G, H, K, N, Q, R, S, P and T
Flexible residues Q, T, K, S, G, P, D, E and R
Polypeptides
The present invention provides the following polypeptide sequences.
Table 3: polypeptides of the invention
The GRFT polypeptide may comprise SEQ ID No.1 or a variant sequence thereof, provided that the variant sequence retains the antiviral activity, particularly anti-influenza virus (e.g., anti-influenza a virus) activity, of the GRFT polypeptide. The EK1 polypeptide may comprise SEQ ID NO.3 or a variant sequence thereof, provided that the variant sequence retains the antiviral activity, in particular the anti-SARS-CoV-2 activity, of the EK1 polypeptide. anti-SARS-CoV-2 activity of EK1 polypeptides has been previously described in a number of papers and patent applications published by the inventors. The fusion protein prepared according to the invention may comprise the amino acid sequence of SEQ ID NO.2 or a variant thereof.
Unexpectedly, the inventors have discovered that GRFT polypeptides, when fused to an EK1 polypeptide, can increase anti-SARS-CoV-2 activity of the EK1 polypeptide and that the fusion protein also possesses additional antiviral activity, such as anti-influenza and/or anti-HIV activity, due to the antiviral properties of the GRFT polypeptide itself. Furthermore, the inventors have unexpectedly found that EK1 polypeptides also increase the antiviral activity of GRFT polypeptides against pseudotyped influenza viruses and certain influenza a strains.
Method
The present invention provides a method of inhibiting the proliferation of influenza and/or coronaviruses comprising contacting a cell with a fusion protein herein and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No. 1. The methods described herein may be in vitro methods or in vivo methods.
The present invention provides methods for preventing infection of a cell by a coronavirus with an influenza virus comprising contacting the cell with a fusion protein herein and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No. 1. The methods described herein may be in vitro methods or in vivo methods.
The present invention provides methods of treating and/or preventing influenza virus and/or coronavirus infection, and/or a disease caused by influenza virus and/or coronavirus infection, comprising administering to a subject a fusion protein herein and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No.1, and/or a composition comprising the fusion protein and/or the GRFT protein.
The present invention provides methods of preventing an influenza a virus infected person or influenza a patient from being infected with SARS-CoV-2 or suffering from a disease caused by SARS-CoV-2 (e.g., a novel coronavirus infection) comprising administering to the influenza a virus infected person or influenza a patient a fusion protein herein and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No.1, and/or a composition comprising the fusion protein and/or the GRFT protein.
The composition may comprise additional anti-influenza drugs and/or anti-coronavirus drugs to increase the therapeutic effect. For example, the anti-influenza drug is an anti-influenza a virus drug, e.g., selected from oseltamivir, arbidol, marbalo Sha Wei, peramivir, and zanamivir. The anti-coronavirus drug may be selected from Mo Nuola, nemrotevir, ritonavir, albevudine, an Bawei mab, romidepuweimab, sotrovimab, imdevimab, casirivimab, tixagevimab, cilgavimab, bamlanivimab, etesevimab, amubarvimab and romidepvimab. The compositions herein may be in the form of tablets, capsules, drops, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, or lyophilized powders. Preferably, the fusion polypeptide, GRFT protein or composition thereof of the invention is prepared as a dosage form for nasal administration. The method of the invention is particularly suitable for use in the prevention of viral infections or related diseases. Prevention does not necessarily mean before infection. Herein, prevention may be administered from 3-10 hours before coronavirus infection to 3-10 hours after coronavirus infection, from 2-6 hours before coronavirus infection to 2-6 hours after coronavirus infection, from 1-4 hours before coronavirus infection to 1-4 hours after coronavirus infection, or from 0.5-2 hours before coronavirus infection to 0.5-2 hours after coronavirus infection.
Herein, the influenza virus may be an influenza a virus. The coronavirus may be SARS-CoV-2. For example, influenza a virus is selected from H1N1, H3N2, H5N1, and H7N9.SARS-CoV-2 can be selected from mutants mutated in wild-type SARS-CoV-2 and S proteins, e.g. from D614G, omicron BA.1, omicron BA.2, omicron BA.3, omicron BA.5, omicron BF.7, omicron BQ.1 and Omicron XBB.
Pseudovirus preparation
Pseudoviruses may be prepared herein using methods known in the art. For example, as previously described (L.Lu, Q.Liu, Y.Zhu, K. -H.Chan, L.Qin, Y.Li, Q.Wang, J.F. -W.Chan, L.Du, F.Yu, C.Ma, S.Ye, K. -Y.Yuen, R.Zhang, S.Jiang, structure-based discovery of Middle East respiratory syndrome coronavirus fusion inhibitor. Nat. Commun.5,3067 (2014)), 293T cells were transfected with plasmids including HIV backbone plasmid pNL4-3.Luc. R - .E - And S protein expression plasmids of different SARS-CoV-2 mutant strains. The amino acid sequences of the S proteins of the different SARS-CoV-2 mutants are known. A variety of SARS-CoV-2 variant S protein expression plasmids are provided in Table 4. The amino acid sequences of one or more SARS-CoV-2 mutant S proteins listed in Table 4 can be used herein.
Table 4:
use of the same
The invention provides the use of the fusion protein, nucleic acid, pharmaceutical composition and/or GRFT protein comprising the amino acid sequence shown in SEQ ID NO.1 as described herein in the preparation of a medicament. The medicament may be used for the prevention and/or treatment of respiratory diseases caused by influenza a virus and/or novel coronavirus infection, preferably influenza a virus infection or influenza a virus combined with novel coronavirus. Alternatively, the medicament may be used to prevent infection of SARS-CoV-2 by influenza A virus infected persons or influenza A patients or to suffer from a novel coronavirus infection.
The present invention provides fusion proteins, nucleic acids, pharmaceutical compositions and/or GRFT proteins comprising the amino acid sequence shown in SEQ ID No.1 as described herein for use in the prevention and/or treatment of respiratory diseases caused by influenza a virus and/or novel coronavirus infection, preferably by influenza a virus infection or by influenza a virus in combination with novel coronaviruses. For example, the disease is influenza or influenza combined with a novel coronavirus infection.
The fusion proteins, nucleic acids, pharmaceutical compositions and/or GRFT proteins comprising the amino acid sequence shown in SEQ ID No.1 described herein can also be used to prevent infection of a person with influenza a or a patient with influenza a with SARS-CoV-2 or with a novel coronavirus infection.
Influenza a viruses herein may be selected from the group consisting of H1N1, H3N2, H5N1, and H7N9; and/or severe acute respiratory syndrome coronavirus 2 is selected from wild-type SARS-CoV-2 and mutant strains mutated in S protein, e.g. from D614G, omicron ba.1, omicron ba.2, omicron ba.3, omicron ba.5, omicron bf.7, omicron bq.1 and Omicron XBB. The medicament may be a medicament for nasal administration. The medicament may be particularly a prophylactic medicament. As mentioned above, prevention does not necessarily mean to be performed prior to infection. The fusion polypeptides, polypeptides or medicaments herein prevent and/or treat respiratory diseases by inhibiting the influenza a virus surface protein hemagglutinin-mediated endocytosis.
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described in the following in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Examples
Example 1 expression, purification and characterization of two proteins GRFT and GL25E
1. The gene sequences of the GRFT and GL25E proteins are subjected to codon optimization, and then are subjected to double digestion by NdeI and XhoI to construct an escherichia coli expression vector pET28a (+) to obtain a recombinant plasmid, and the recombinant plasmid is transformed into escherichia coli BL21 (DE 3) and then coated on an LB plate containing 50 mug/mL kanamycin.
TABLE 5
2. Single positive clones were selected and inoculated into 5mL of LB medium (containing 50. Mu.g/mL kanamycin) and pre-cultured overnight at 37℃and 220 rpm; the preculture solution was then mixed at 1:200 were inoculated into 1L of LB medium (containing 50. Mu.g/mL kanamycin) and cultured at 37℃and 220rpm until the OD600 value of the bacterial solution reached about 0.5; the bacterial solution was allowed to stand at 4℃for half an hour, 1mM IPTG was added thereto, and the culture was continued at 16℃and 180rpm for 20 hours.
3. The culture broth after the end of the incubation was centrifuged at 8000rpm for 3 minutes, the bacterial broth was collected and resuspended in 100mL of PBS. The resuspended bacterial liquid was sonicated, centrifuged at 10000rpm at 4℃for 30 minutes, and the supernatant was filtered with a 0.45 μm filter. 1mL of nickel column equilibrated with binding buffer (10 mM imidazole, 20mM Na2HPO4, 0.5M NaCl, pH 7.4) was added to the culture supernatant and bound for 2 hours at room temperature. 4. The liquid from step 3 was passed through a purification column and washed with 50 volumes of wash buffer (20 mM imidazole, 20mM Na2HPO4, 0.5M NaCl, pH 7.4). Finally, elution was performed with 5 volumes of elution buffer (500 mM imidazole, 20mM Na2HPO4, 0.5M NaCl, pH 7.4). Ultrafiltering the eluted protein for 5-6 times, and replacing the buffer solution with PBS to obtain purified fusion protein. 5. And (3) carrying out SDS-PAGE (SDS-PAGE) protein electrophoresis on the purified protein, and respectively carrying out coomassie brilliant blue staining and Western blotting for identification after the electrophoresis is finished. The results are shown in FIG. 1, wherein a is an SDS-PAGE identification map of two proteins GRFT and GL25E in FIG. 1, and b is a Western blot identification map of two fusion proteins GRFT and GL 25E. As shown in FIG. 1, both GRFT and GL25E proteins migrate to a position consistent with the expected band size (GRFT: 16kDa; GL25E:21 kDa). The polypeptides described above may also be prepared synthetically by commercial companies.
Example 2 pseudo-viral infection experiments inhibiting influenza A viruses H7N9 and H5N1In this example, the activity of GRFT and GL25E in inhibiting pseudovirus infection was tested on MDCK cells using H7N9 and H5N1 pseudovirus systems as tools, and the specific steps were as follows:
(1) packaging and preparation of pseudovirus a (H7N 9) and pseudovirus a (H5N 1):
the plasmids used for packaging influenza A pseudovirus (H7N 9) were: HA plasmids of A (H7N 9) pVKD-HA (GenBank: KC 853228), NA plasmids of A (H7N 9) pVKD-NA (GenBank: KC 853231) and HIV backbone plasmid pNL4-3. Luc.R-E-containing luciferase reporter gene, wherein the HA and NA genes encoded by the pVKD-NA plasmids are obtained from influenza A/Shanggai/4664T/2013 (H7N 9) by RT-PCR. The plasmids used for packaging influenza A pseudovirus (H5N 1) are plasmids containing H5N1 (A/QH/59/05) HA (GenBank: ABE 68921) or plasmids containing H5N1 (A/Thailand/Kan 353/2004) HA (GenBank: EF 541411.1), NA plasmids containing H5N1 (A/Thailand/Kan 353/2004) N1-type and the HIV backbone plasmid pNL4-3.Luc.R-E- (all available from the New York blood center of the United states or directly available).
The pseudovirus preparation process is as follows:
1. HEK 293T cells are cultivated in DMEM culture solution containing 10% fetal bovine serum, a 10cm petri dish is placed in a 37 ℃ and 5% CO2 incubator for cultivation, and transfection is carried out when the cell grows to 50% -70% confluency;
2. HA plasmid, NA plasmid and HIV-1 skeleton plasmid for packaging influenza A pseudovirus (H7N 9) are respectively 10 mug, 10 mug and 20 mug, and are mixed together in 1mL of 0.9% NaCl solution, and the mixture is stood for 5 minutes at room temperature;
3. mu.L of Vigofect transfection reagent (Wiggares Biotechnology (Beijing) Co., ltd., used in a ratio of 1:1000 with the culture medium) was added to another 1mL of 0.9% NaCl solution, and left to stand at room temperature for 5 minutes;
4. dropwise adding the Vigofect diluent into the plasmid mixed solution, standing at room temperature for 15 minutes, and dropwise adding the plasmid mixed solution into HEK 293T cells cultured in a T75 culture bottle;
5. replacement with fresh DMEM medium containing 10% fetal bovine serum after 6 hours of transfection;
6. after 48 hours of cell exchange, the cell culture supernatant was collected, centrifuged at 3000rpm for 20 minutes, and the supernatant was passed through a 0.22 μm filter membrane and stored in aliquots at-80 ℃.
7. The packaging and collection procedure for influenza A pseudovirus (H5N 1) was consistent with that described above for influenza A pseudovirus (H7N 9).
(2) Pseudoviral infection assay procedure for inhibition of influenza a viruses H7N9 and H5N 1: 1. GRFT, GL25E and EK1 were diluted in a gradient in 96-well round bottom plate using serum-free DMEM medium at a total of 8 concentrations (as shown in FIG. 2), with a dosing volume of 100. Mu.L per well, 3 replicates per gradient, GRFT and EK1 as positive controls, EK1 having the amino acid sequence shown as SEQ ID NO:3, synthesized by Gill Biochemical company, GRFT having the amino acid sequence shown as SEQ ID NO: 1; 2. adding 100 mu L of pseudo-virus liquid (RLU: 20000-100000) into the 96-well plate (drug-added and virus-well marked as drug-well) in the step (1) of the embodiment, and simultaneously setting a positive control group (with or without virus drug, i.e. virus-well) and a negative control group (without virus and drug, i.e. without drug-well), and incubating the virus and drug for 1 hour at 37 ℃;
3. 200. Mu.L of the mixture in step (2) of this example was added to a 96-well plate in which MDCK cells (which were purchased from a cell bank of the department of Chinese sciences, catalog number: GNO 23) were spread. Culturing at 37deg.C under 5% CO2 for 12 hr, and changing culture medium to DMEM medium containing 10% FBS;
4. after further culturing for 48 hours, the culture supernatant was discarded and the cells were washed once with PBS, and 50. Mu.L of a cell lysate (available from Promega Corp., cat. No. 0000389797) was added thereto for lysis at room temperature for 1 hour. After 40. Mu.L of the lysate was pipetted into a 96-well assay plate and 40. Mu.L of substrate (available from Promega Corp., cat. 0000369690) was added, the fluorescence value was immediately detected;
5. the inhibition rate of the pseudovirus infection is calculated, and the calculation formula is as follows: inhibition = (viral pore-drug pore)/(viral pore-drug free pore) ×100%.
FIG. 2 shows the effect of GRFT and GL25E proteins provided by the invention on MDCK cells. As shown in fig. 2, GRFT and GL25E were able to efficiently inhibit H7N9 and H5N1 pseudovirus infection, with half inhibitory concentrations (IC 50) of H7N9 on MDCK cells of 63.11nM, 49.43nM, respectively; IC50 for H5N1/QH were 250.9nM and 234.3nM, respectively; IC50 for H5N1/Thailand were 556.0nM and 527.8nM, respectively; control EK1 had no inhibitory activity. For these influenza pseudoviruses, GL25E has improved IC50 compared to GRFT.
EXAMPLE 3 GRFT and GL25E inhibition of A/Puerto Rico/8/1934/(H1N 1), A/Guizhou/54/89 (H3N 2), A/California/7/09 (H1N 1) and A/WSN/1933 (H1N 1) live virus infection experiments
After in vitro inhibition experiments with the pseudoviruses described above, plaque reduction experiments were performed on MDCK cells using A/Puerto Rico/8/1934/(H1N 1), A/Guizhou/54/89 (H3N 2), A/California/7/09 (H1N 1) and A/WSN/1933 (H1N 1) live viruses, as follows:
1. MDCK cells were plated in 24-well plates 12 hours in advance, DMEM medium (10% fetal bovine serum), density1.5x 10 5 Holes;
2. cell culture at 37℃with 5% CO 2 The incubator can carry out plaque experiments when the cells are converged to more than 80%;
3. respectively diluting GRFT and GL25E with DMEM culture medium according to a 3-fold gradient;
4. influenza virus was subjected to 10-fold gradient dilution with DMEM medium containing 1. Mu.g/mL TPCK-trypsin;
4. firstly sucking out culture solution supernatant of MDCK cells, washing once by PBS, adding virus and polypeptide mixture into the MDCK cells, setting two compound holes (experimental group) at each concentration of 200 mu L, taking one group of cell holes with DMEM culture medium as blank control (infection negative control group), adding one group with the same virus number into the cell holes as infection positive control group, infecting for 2 hours at 37 ℃, and shaking and uniformly mixing every 15 minutes;
5. Heating pre-prepared and sterilized 3% low melting point agar with a microwave oven, cooling to 37deg.C, and mixing with preheated DMEM containing 2 μg/mL TPCK-trypsin at 37deg.C to obtain agar with final concentration of 1%;
6. sucking the supernatant of MDCK cells, adding 1% low-melting-point agar at 37 ℃ into the cells, standing at room temperature for half an hour, and then pouring the cells into a 37 ℃ and 5% CO2 incubator for continuous culture;
7. after 48 hours of incubation, the clear milky spots in the 24-well plate were observed, and then fixed and stained with a solution containing 4% paraformaldehyde solution and 0.5% crystal violet, and left at room temperature for 4 hours;
8. gently flushing the agar with tap water, and airing at room temperature;
9. the number of uncolored spots in the 24-well plate was counted and the inhibition ratio was calculated. Virus entry inhibition ratio (%) =100× [ (average of the number of spots in the infection positive control group-average of the number of spots in each hole in the experimental group)/(average of the number of spots in the infection positive control group-average of the number of spots in the infection negative control group) ]
10. Counting the number of virus spots in each well by using Excel software, and plotting by using GraphPad Prism 8.0 software;
GRFT and GL25E anti-influenza virus entry inhibition rate was plotted against concentration and half inhibition concentration (IC 50) was calculated.
The results are shown in FIG. 3, wherein a is a graph of the detection result of GRFT and GL25E inhibiting A/Puerto Rico/8/1934/(H1N 1) live virus infection, b is a graph of the detection result of GRFT and GL25E inhibiting A/California/7/09 (H1N 1) live virus infection, c is a graph of the detection result of GRFT and GL25E inhibiting A/Guizhou/54/89 (H3N 2) live virus infection, and d is a graph of the detection result of GRFT and GL25E inhibiting A/WSN/1933 (H1N 1) live virus infection.
As shown in FIG. 3, GRFT and GL25E can inhibit infection of a plurality of influenza A viruses more effectively, the IC50 of the GRFT and GL25E are respectively in the range of 263-683 nM and 152-519 nM, GL25E shows higher trend of inhibiting activity on influenza viruses than GRFT, and it is presumed that fusion protein GL25E coupled with EK1 increases solubility of GRFT (discovered in the preparation process of recombinant protein), which possibly promotes binding of polypeptide and virus. Control EK1 had no inhibitory activity on influenza virus.
Example 4 detection of binding of GRFT and GL25E to influenza Virus HA1
(1) Construction and amplification of HA1 protein plasmid:
1. the plasmid construction process comprises the steps of constructing a gene capable of expressing H5N1 (A/QH/59/05) HA1 protein (Genbank: ABE 68921) on a pF-Fc vector (invogen) in a PCR mode (taking HA of H5N1 (A/QH/59/05) as a template, wherein the primer sequence is shown in table 6, the PCR reaction conditions are 95 ℃,5 minutes, 95 ℃ for 30 seconds, 56 ℃,30 seconds, 72 ℃,90 seconds, 36 cycles and finally 72 ℃ for 5 minutes), and constructing the gene on a pF-Fc vector (invogen) in a enzyme digestion (EcoRV and NcoI double enzyme digestion) and enzyme ligation (T4 DNA ligase) mode, wherein the PCR reaction conditions are 95 ℃, and the pF-HA 1 (H5N 1/QH) -Fc plasmid is named;
Table 6 primers and sequences
Primer name Primer sequence 5'-3'
HA1-F GATCGATATCGATGGAGAAAATAGTGCTTCTTCTT
HA1-R CATGCCATGGCTCTTCTCTCTCCTTGAGGGCTA
2. 2 mu L of recombinant plasmid successfully identified by sequencing is sucked and transformed into TOP10 competent cells, and the mixture is placed on ice for 30 minutes and at 42 ℃ for 90 seconds; the culture was again carried out on ice for 3 to 5 minutes, 1mL of LB medium was added, the culture was continued at 220rpm and 37℃for 45 to 60 minutes, and then centrifugation was carried out at 3000rpm for 2 minutes. The supernatant was discarded, and the pellet was plated on a bleomycin (YEASEN, CAT:60216ES60,1:2000 dilution use) resistant LB plate and incubated at 37℃for 12 hours in an incubator;
3. selecting positive monoclonal and immediately inoculating to 5mL of LB culture solution (containing bleomycin and the same as before), then inoculating to 200mL of LB culture solution (containing bleomycin and the same as before) at a ratio of 1:100, and shaking at 37 ℃ for 12 hours;
4. bacterial liquid was collected, plasmids were extracted according to the method described in the plasmid large extraction kit (endotoxin free large extraction kit, magen), and the concentration was determined by Nanodrop and frozen at-20 ℃.
(2) HA1-Fc protein expression:
1. taking out the Expi293 cells from the liquid nitrogen tank, rapidly putting the Expi293 cells into a water bath kettle at 37 ℃, centrifuging for 3 minutes at 800g after the frozen cells are melted, and absorbing and discarding frozen solution;
2. adding 1mL of SMM293-TII culture medium, gently sucking and blowing the uniformly mixed cells, transferring to a 500mL flat-bottom triangular shake flask, supplementing 200mL of culture medium, placing in a 5% CO2 incubator at 37 ℃ and shaking and culturing at 120 rpm;
3. The day prior to transfection, cells were counted and passaged into new cell culture flasks to a cell number of 1.5x10 in the new cell culture flask 6 Cell viability was greater than 95% (trypan blue staining assay);
4. mu.g of pFUE-HA 1 (H5N 1/QH) -Fc plasmid and 720 mu.L of EZtrans (Shanghai Li Biotechnology Co., ltd., lot: LFC 23039) were diluted to 10mL with 10mL of SMM293-TII medium, respectively, then the diluted solution containing EZtrans was added to the diluted solution containing the plasmid, mixed uniformly, left standing at room temperature for 10 minutes, then the prepared transfection system was added dropwise to cells (200 mL of Expi293 cells), and the cells were gently shaken while being noted, and the mixture was kept in a 5% CO2 incubator at 37℃with shaking at 120 rpm;
5. 10mL of SMM293-TII medium was added the next and fifth days after transfection, centrifuged at 3,000rpm for 10 minutes at 7 days after transfection, and the cell supernatant was collected and filtered with a 0.45 μm filter, followed by protein purification;
(3) HA1-Fc protein affinity chromatography purification:
1. 2mL of Protein A resin (Genescript, cat. No.: L00210-200) was pipetted into the bottom of the affinity chromatography column, 1mL of binding/equilibration buffer (PBS, pH 7.4) was added in advance, and the resin was allowed to precipitate and the buffer flowed out of the column. Adding ultrapure water with the volume of 10 times of the column volume to clean the column material, and balancing the column material by using balancing buffer solution with the volume of 20 times of the column volume;
2. Adding the well-balanced column material into the filtered cell supernatant containing the target protein, and shaking and combining at 200rpm under the condition of 4 ℃ for overnight;
3. after the combination is completed, adding the mixed solution of the cell supernatant and the column material into an affinity chromatography column material, and collecting effluent liquid;
4. washing the column material by using an equilibrium buffer solution with the volume of 30 times of the column volume to remove the impurity protein;
5. adding 50 mu L of neutralization buffer (1M Tris-HCl, pH 8.5) into a collecting pipe in advance, washing the column material by using elution buffer (0.1M glycine, pH 3.0) with 10 times of column volume, and collecting the eluent, namely purified protein; the purified protein HA1-Fc is verified by SDS-PAGE;
6. a10 kDa ultrafiltration tube was selected according to the molecular weight of the HA1-Fc protein (about 64 kDa), the buffer was replaced with PBS having a pH of 7.4, the protein concentration was determined by Nanodrop, and the product was dispensed and stored at-80 ℃.
(4) Binding experiments of GRFT and GL25E with HA1-Fc
1. GRFT, GL25E and BSA at 5. Mu.g/mL were added to a 96-well ELISA plate (Corning Co.) at 50. Mu.L per well, and the ELISA plate was coated at 37℃for 2 hours;
2. washing with PBST for 1-2 times, each time for 5 minutes, adding 150 mu L of blocking solution (PBST containing 2% gelatin), and blocking at 37 ℃ for 2 hours;
3. washing with PBST for 2 times, each for 5 minutes, adding HA1-Fc (initial concentration 5 μg/mL) diluted in 5-fold gradient, and reacting at 37 ℃ for 1 hour at 50 μl per well;
4. PBST is used for washing 3-4 times for 5 minutes each time. 50. Mu.L of HRP-labeled goat anti-human IgG antibody, which is capable of binding specifically to the Fc tag, (1:10000, abacam, ab97225), was added and reacted at 37℃for 1h;
5. wash with PBST 4 times for 5 minutes each. After 50. Mu.L of TMB developing solution was added, 50. Mu.L of stop solution (2% H) was used after developing 2 SO 4 ) The reaction was terminated and absorbance values were measured for each well at the microplate reader OD 450.
The results are shown in FIG. 4, wherein a in FIG. 4 is an identification pattern of HA1-Fc protein by SDS-PAGE, and b in FIG. 4 is a binding pattern of GRFT and GL25E and HA1 protein, and the results show that HA1 protein can bind GRFT and GL25E in a concentration-dependent manner, but the unrelated protein BSA cannot bind thereto.
EXAMPLE 5 mannose inhibits the binding of GRFT and GL25E to the HA1 subunit
1. 50 μl of HA1 protein (prepared as in example 4) (5 μg/ml) was added to an ELISA plate (Corning) and left to stand at 37deg.C for 2h;
2. wash with PBST 2 times for 5 minutes each. Adding PBST containing 2% gelatin, and reacting at 37deg.C for 2 hr;
3. mannose was added to GL25E of 5. Mu.g/ml 1 hour in advance, the final concentration of mannose was 0, 50, 100, 200mM, respectively, GRFT and GL25E added with equal volumes of PBS were used as control groups, and reacted at 37℃for 1 hour;
4. The elisa plate was washed 2 times with 5 minutes each with PBST. Adding 50 mu L of the mixture obtained in the step 3 into the coated holes, and reacting for 1 hour at 37 ℃;
5. wash 3 times with PBST for 5 minutes each. 50 μl of HRP-labeled goat anti-human IgG antibody (1:10000, abacam, ab97225) was added and reacted at 37deg.C for 1 hour;
6. wash with PBST 4 times for 5 minutes each. After 50. Mu.L of TMB was added, after development, 50. Mu.L of stop solution (2% H) 2 SO 4 ) The reaction was terminated and absorbance values were measured for each well at the microplate reader OD 450.
The results are shown in FIG. 5, wherein a is a graph of the detection result of binding of mannose-inhibited GRFT to HA1 protein, and b is a graph of the detection result of binding of mannose-inhibited GL25E to HA1, and as shown in the graph, mannose is capable of inhibiting binding of GRFT and GL25E to HA1 subunit, and as the concentration of mannose increases, the binding of GRFT and GL25E to HA1 subunit gradually decreases, indicating that GRFT and GL25E bind to HA1 subunit in a glycosyl-dependent manner.
Example 6 Detection of GRFT and GL25E in vivo inhibition of A/PuertoRico/8/1934 (H1N 1) live-infected mice Measuring
1. Preventive protection experiment: c57BL/6 females with the age of 6-8 weeks are selected, mice are divided into 5 groups, and 6 mice in each group are selected; the groups were Mock (untreated blank), PBS (virus control), EK1 (drug control), GRFT and GL25E (drug treated). The medicine is administrated by nasal drops through nasal cavities 0.5 hour in advance, and the administration dosage is 10 mg/kg/dose. Nasal challenge A/Puerto Rico/8/1934 (H1N 1) (hereinafter PR 8) was given as live 10 times LD50 at half an hour after administration. (pre-experiments, 6-8 week old C57BL/6J female mice were divided into 4 groups, 4 animals per group were randomly assigned, and the stored PR8 live viruses were diluted to 4 gradients according to 10-fold gradient, and each group was given nasal challenge, respectively; the virus dose (dilution) used to achieve half the number of deaths was determined as half the lethal dose, LD 50).
2. Therapeutic experiments: c57BL/6J females of 6-8 weeks of age were also selected, mice were divided into 5 groups of 6 mice each, and into Mock (untreated blank), PBS (virus control), EK1 (drug control), GRFT and GL25E (drug treated). Half an hour in advance, a 10-fold LD50 (lethal dose) of A/Puerto Rico/8/1934 (H1N 1) was given. After half an hour of toxin expelling, GL25E 10mg/kg is administrated by nasal drops, and the administration dosage is 10 mg/kg/dose.
3. Mice were continuously monitored for body weight and survival, and recording was stopped after 15 days.
The results are shown in FIG. 6, wherein a is the weight change result of PR8 infected mice before the challenge of GRFT and GL25E, b is the survival rate test result of PR8 infected mice after the challenge of GRFT and GL25E, C is the weight change result of PR8 infected mice before the challenge of GRFT and GL25E, d is the survival rate test result of PR8 infected mice after the challenge of GRFT and GL25E, and E and f are the effects of C57BL/6 mice lung tissue virus load of challenge A/Puerto Rico/8/1934 (H1N 1) by the pre-challenge and post-challenge administration, respectively. As shown in fig. 6, when GRFT and GL25E were administered nasally 0.5 hours before infection with a/(H1N 1)/PR 8 virus, weight loss and mortality due to infection with a/(H1N 1)/PR 8 could be effectively prevented, and the protection rate reached 100%; the nasal administration of GRFT and GL25E 0.5 hours after A/Puerto Rico/8/1934 (H1N 1) virus infection has a protection rate of 50%, which suggests that the in vivo prophylactic effect of GRFT and GL25E is better than therapeutic effect, and can be used for drug development for preventing influenza virus (IAV) infection.
Example 7 in vitro safety assay for GRFT and GL25E
1. Gradient dilutions of GRFT and GL25E were performed in 96-well round bottom plates using DMEM medium containing 10% FBS for a total of 8 concentrations, with a dosing volume of 120 μl per well, with 3 replicates per gradient set; DMEM medium (containing 10% FBS) with an equal volume of PBS was used as a cell control well.
2. 100. Mu.L of the mixture in step (1) of this example was added to a culture well plated with MDCK cells, A549 cells, calu3 cells, huh-7 cells, caco2 cells and vero cells (the above cells were purchased from the cell bank of China academy of sciences). The cells were cultured at 37℃under 5% CO2 for 48 hours.
3. The culture supernatant was discarded, CCK-8 (available from MCE Co., under the trade designation HY-K0301) diluted 20-fold with serum-free DMEM was added thereto, and after further culturing for 1 to 2 hours, the absorbance of OD450 was measured.
4. Cell viability was calculated as: cell viability= [ (drug well-blank well)/(control well-blank well) ]x100%.
As a result, as shown in FIG. 7, at a concentration of 10000nM, both GRFT and GL25E and the treated cells had viability values of 70% or more, showing that the half-cell cytotoxicity concentration (CC 50) was more than 10000nM.
Example 8 in vivo safety detection of GRFT and GL25E
C57BL/6J female mice of 6-8 weeks of age were also selected and divided into two groups of 6 GL25E (10 mg/kg) were given by nasal drip, while PBS group was set as a control. After GL25E administration, we monitored the mice for weight change every two days and observed for 14 days. As shown in figure 8, panel a, mice in the GL 25E-treated group did not show weight loss, and there was no significant difference between the weight of the GL 25E-treated group and the weight of the PBS-treated group. To further verify the in vivo safety of GL25E, we collected serum from mice at days 0, 1, 3, 5, 7 and 9 post-dose for detection of levels of glutamic pyruvic transaminase and creatinine (see glutamic pyruvic transaminase detection kit and creatinine detection kit instructions, institute of biotechnology, south-jing). As shown in panel b of fig. 8, there was no significant increase in glutamic pyruvic transaminase and creatinine in the GL25E treated group, and no significant difference from the PBS treated group. These results indicate that nasal administration of GL25E does not cause damage to the liver and kidneys of mice.
EXAMPLE 9 inhibition effect detection of GRFT and GL25E against pseudotoxicity of SARS-CoV-2Omicron mutant strain
The application constructs pseudo viruses of SARS-CoV-2omicron mutant strains B.1.1.529, BA.2, BA.2.12.1, BA.2.2, BA.2.9, BA.3, BA.5, BF.7, XBB and BQ.1.1, and detects the inhibition effect of GRFT and GL25E on SARS-CoV-2 mutant strains, and the specific steps are as follows:
(1) Packaging and preparation of SARS-CoV-2omicron mutant pseudovirus:
the backbone plasmid (pNL 4-3. Luc.R-E-) and the corresponding envelope protein plasmid (pcDNA3.1-B.1.1.529-S, BA.2-S, BA.2.12.1-S, BA.2.2-S, BA.2.9.1-S, BA.3-S, BA.4/5-S, BF.7-S, XBB-S, BQ.1.1-S, corresponding Genbank or GISAID No. see methods, pseudovirus preparation, table 4) were packaged in a ratio of pcDNA3.1-B.1.529-S, BA.2.2-S, BA.2.9.1-S, 7. Mu.g of envelope plasmid was used as a backbone plasmid, and the pseudovirus preparation procedure was as described in example 2.
(2) Inhibition effect detection of GRFT and GL25E against SARS-CoV-2Omicron mutant pseudovirus:
1. GRFT, GL25E and EK1 were diluted in a gradient in 96-well round bottom plate using serum-free DMEM medium for a total of 8 concentrations (as shown in fig. 9), dosing volume of 60 μl per well, 3 replicates per gradient set;
2. adding 60 mu L of pseudo virus liquid (RLU: 20000-100000) into the 96-well plate (drug-added and virus-well marked as drug-well) in the step (1) of the embodiment, and simultaneously setting a positive control group (with virus or without drug, i.e. virus-well) and a negative control group (without virus or drug, i.e. without drug-well) of virus infection, and incubating the viruses and the drugs for 1 hour at 37 ℃;
3. 100. Mu.L of the mixture in step (2) of this example was added to a 96-well plate plated with Caco2 cells. Culturing at 37deg.C under 5% CO2 for 12 hr, and changing culture medium to DMEM medium containing 10% FBS;
4. after further culturing for 48 hours, the culture supernatant was discarded and the cells were washed once with PBS, and 50. Mu.L of a cell lysate (available from Promega Corp., cat. No. 0000389797) was added thereto for lysis at room temperature for 1 hour. After 40. Mu.L of the lysate was pipetted into a 96-well assay plate and 40. Mu.L of substrate (available from Promega Corp., cat. 0000369690) was added, the fluorescence value was immediately detected;
5. the inhibition rate of the pseudovirus infection is calculated, and the calculation formula is as follows: inhibition = (viral pore-drug pore)/(viral pore-drug free pore) ×100%.
The results are shown in FIG. 9, which shows that GL25E significantly better inhibited mutant infection than EK1 and GRFT. This suggests that GRFT can improve the anti-SARS-CoV-2 activity of EK 1.
Example 10 inhibition effect of GRFT and GL25E against Omicron mutant BA.2.2 live virus was examined
The inhibition effect of GRFT and GL25E on SARS-CoV-2 Omicron BA.2.2 live virus (virus infection and lysis experiments are completed in BSL-3 class laboratory) is determined by adopting a real-time fluorescence quantitative PCR method, and the specific steps are as follows:
(1) Virus infection experiments
1. GRFT, GL25E and EK1 were diluted in a gradient in 96-well round bottom plate using serum-free DMEM medium for a total of 6 concentrations, with a dosing volume of 60 μl per well, with 3 replicates per gradient set;
2. adding 60 mu L of diluted BA.2.2 live virus liquid (MOI=0.01) into the 96-well plate (drug adding and virus hole are marked as drug holes) in the step (1) of the embodiment, and simultaneously setting a positive control group (with virus or without drug, namely the virus hole) and a negative control group (without virus or drug, namely the drug hole), and incubating the virus and the drug for 1 hour at 37 ℃;
3. 100. Mu.L of the mixture in step (2) of this example was added with Caco spread 2 Cells in 96-well plates. 37 ℃ and 5% CO 2 Culturing for 1 hr under the condition, and changing the culture medium to DMEM culture medium containing 2% FBS; culturing in an incubator at 37 ℃ for 48 hours;
4. after 48 hours, 50. Mu.l of the cell supernatant was pipetted into a 1.5ml screw tube and 3 volumes of Buffer RZ (TIANGEN, lot#X1221) were added to lyse the virus.
(2) RNA extraction
RNA was extracted according to the protocol of RNAsimple Total RNA Kit Total RNA extraction kit (Lot#X11117), comprising the following steps:
1. the RZ of 3 times of the volume of the sample is used for cracking the virus-containing supernatant, and the repeated blowing and sucking are carried out for several times, so that the cracking uniformity is ensured.
2. The nucleoprotein complex was allowed to stand at room temperature for 5 minutes to completely dissociate.
3. 0.12mL of chloroform was added to 0.45mL of RZ lysate, and the mixture was mixed by shaking.
4. The mixture was left at room temperature for 2-3 minutes, and after separation of the organic phase from the aqueous phase, the mixture was centrifuged at 12,000g for 15 minutes at 4 ℃.
5. After centrifugation, RNA was present in the upper aqueous phase, carefully pipetting the upper aqueous phase into the new EP tube, taking care not to aspirate the middle DNA layer and the lower organic phase.
6. Slowly adding 0.5 times of absolute ethyl alcohol, and uniformly mixing. The resulting solution was transferred to an adsorption column CR3 together with the precipitate, centrifuged at 12,000rpm at 4℃for 30 seconds, and the waste liquid in the collection tube was discarded.
7. To the adsorption column CR3, 500. Mu.L of deproteinized liquid RD (ethanol added), 4℃and 12,000rpm were added, and the waste liquid was discarded, and CR3 was placed in a collection tube.
8. To the adsorption column CR3, 500. Mu.L of a rinse solution RW (ethanol added) was added, and the mixture was allowed to stand at room temperature for 2 minutes, centrifuged at 12,000rpm at 4℃for 30 seconds, and the waste liquid was discarded.
9. The operation 8 is repeated.
10. The column was placed in a 2mL collection tube and centrifuged at 12,000rpm at 4℃for 2 minutes to remove residual liquid.
11. Transfer column CR3 into a new 1.5mL centrifuge tube and add 100ul of Rnase-Free ddH 2 O, left at room temperature for 2 minutes, 4℃and centrifuged at 12,000rpm for 2 minutes.
(3) Detection of viral copy number by q-PCR
The detection is carried out by using a Bio-Rad CFX96 fluorescence quantitative PCR instrument, and primers and probes are synthesized by Huada genes, and the sequences are as follows:
TABLE 7 primer and probe sequences
Primer name Primer sequence 5'-3'
SARS-CoV-2-N-F GGGGAACTTCTCCTGCTAGAAT
SARS-CoV-2-N-R CAGACATTTTGCTCTCAAGCTG
SARS-CoV-2-N-probe 5’-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3’
Three wells per sample were configured as follows, and tested using the HiScript II One Step qRT-PCR Probe Kit (Vazyme):
TABLE 8 HiScript II One Step qRT PCR Probe Kit (Vazyme) reaction system
The reaction conditions are as follows: 42 ℃,5 minutes, 95 ℃ for 10 seconds; 95℃for 5 seconds, 50℃for 30 seconds, 72℃for 30 seconds, 40 cycles.
As shown in FIG. 10, GL25E and GRFT proteins were effective in inhibiting SARS-CoV-2 live virus infection of Caco2 cells compared to EK1 polypeptide, with IC50 of 6.88nM and 82.20nM, respectively, 64-fold and 5-fold higher than EK polypeptide (IC50= 438.90 nM), respectively. This suggests that GRFT can improve the anti-SARS-CoV-2 activity of EK 1.
Example 11 inhibition of GRFT and GL25E anti-influenza Virus combined with novel coronavirus infection
This example establishes an in vitro model of the combined infection of two SASR-CoV-2 and IAV.
(1) Model one uses SASR-CoV-2-S D614G and H5N1/Thailand two pseudovirus systems (SASR-CoV-2-S D G pseudoviruses take pNL4-3. Luc.R-E-as skeleton plasmids, corresponding envelope protein plasmids PcDNA3.1SARS-CoV-2-S D G (GISAID: EPI_ISL_ 412912), pseudovirus packaging is carried out according to a mass ratio of 4:1, H5N1/Thailand pseudovirus packaging is referred to example 2, the preparation process of the pseudoviruses is referred to example 2) to simulate in vivo simultaneous infection of novel coronaviruses and influenza A viruses, and the effect of GRFT and GL25E on Caco-2 cells and A549 cells or on separate Calu3 cells to inhibit simultaneous infection of host cells is detected as follows:
1. GRFT, GL25E and EK1 were diluted in a gradient in 96-well round bottom plate using serum-free DMEM medium for a total of 8 concentrations, with a dosing volume of 60 μl per well, 3 replicates per gradient, EK1 as a negative control;
2. adding 60 mu L of two pseudo-virus mixed solutions (RLU: 20000-100000) containing SARS-CoV-2 and IAV into the 96-well plate (drug-added and virus-hole is marked as drug hole) in the step (1) of the embodiment, and setting a positive control group (with or without virus drug, i.e. virus hole) and a blank control group (without virus and drug, i.e. no drug hole) for virus and drug incubation for 1 hour at 37 ℃;
3. 100. Mu.L of the mixture in step (2) of this example was added to a 96-well plate in which both Caco2 and A549 cells were plated. 37 ℃ and 5% CO 2 Culturing for 12 hours under the condition, and changing the culture medium to DMEM culture medium containing 10% FBS;
4. after further culturing for 48 hours, the culture supernatant was discarded and the cells were washed once with PBS, and 50. Mu.L of a cell lysate (available from Promega Corp., cat. No. 0000389797) was added thereto for lysis at room temperature for 1 hour. After 40. Mu.L of the lysate was pipetted into a 96-well assay plate and 40. Mu.L of substrate (available from Promega Corp., cat. 0000369690) was added, the fluorescence value was immediately detected;
5. The inhibition rate of the pseudovirus infection is calculated, and the calculation formula is as follows: inhibition = (viral pore-drug pore)/(viral pore-drug free pore) ×100%.
The results are shown in FIG. 11. FIG. 11 a shows the inhibition effect of GRFT, GL25E and EK1 on Caco2 and A549 cells, and b shows the inhibition effect of GRFT, GL25E and EK1 on Calu3 cells alone, wherein GL25E can inhibit SARS-CoV-2 and IAV pseudoviruses from infecting Caco2 and A549 cells simultaneously with higher efficiency than GRFT and EK1 alone, and GL25E can inhibit SARS-CoV-2 and IAV pseudoviruses from infecting Calu3 cells simultaneously with higher efficiency than GRFT and EK1 alone.
(2) The second model is a model for simulating IAV infection to promote SARS-CoV-2 infection by using IAV living virus and SARS-CoV-2-S (WT) pseudovirus system (VSV-DeltaG rLuc is used as a framework, SARS-CoV-2-S-Delta18 is used as S envelope protein packaging pseudovirus with 18 amino acids deleted at the tail end of SARS-CoV-2-S protein) as a tool, and GRFT and GL25E are detected on MDCK, A549 and Calu3 cells respectively, and the effect of reducing the combined infection of novel coronaviruses by inhibiting influenza viruses is achieved by the following specific steps:
preparation of SARS-CoV-2-S (WT) (VSV-. DELTA.G rLuc backbone) pseudovirus:
1. 24 hours prior to transfection, 293T cells were plated in 10cm tissue culture dishes, incubated at 5% CO2, 37℃and the next day of cell confluency to 60%.
2. Mu.g of SARS-CoV-2-S (WT) - Δ18 envelope plasmid was transfected into 293T cells using a Vigofect transfection reagent.
3. After 6 hours of incubation at 37℃with 5% CO2, VSV- ΔG rLuc backbone (VSV-G pseudovirus particles framed by VSV- ΔG rLuc, stored in the laboratory) was added.
4. After 2 hours of infection, 293T cell supernatants were discarded and DMEM medium containing 10% FBS was added.
5. After further culturing for 72 hours, the supernatant containing VSV- ΔG rLuc pseudovirus particles supplemented with VSV-G was collected, and at 3000rpm for 10 minutes, cell debris was removed, filtered through a 0.45 μm sterile filter, sub-packaged and stored at-80℃for use.
In this example, MDCK, A549 and Calu3 cells were infected with A/WSN/1933 (H1N 1) live virus, respectively, as follows:
1. MDCK cells (24 hours in advance), A549 cells (24 hours in advance) and Calu3 cells (48 hours in advance) were plated in 96-well culture plates, and cultured in DMEM medium (10% fetal bovine serum) at a density of 1X 10, respectively 4 Holes, 2x 10 4 Holes and 3x 10 4 Holes;
2. culturing the cells in a DMEM culture medium containing 15% FBS, culturing the cells in a 5% CO2 incubator at 37 ℃ until the cells are converged to more than 80%, and performing experiments;
3. Virus a/WSN/1933 (H1N 1) was mixed with GRFT, GL25E or EK1 (negative control) while positive control wells (IAV virus-free drug wells) and blank control wells Mock (IAV virus-free drug wells) were set and incubated at 37 ℃ for 1 hour;
4. respectively adding the virus and inhibitor mixture into MDCK cells, A549 cells and Calu3 cells, and changing the liquid into fresh DMEM medium with 2% FBS after the virus is infected for 6-8 hours;
5. after IAV infection for 12 hours, the cell culture supernatant was discarded, and SARS-CoV-2 pseudovirus (VSV-. DELTA.G rLuc scaffold) (RLU: 200000) was added thereto, and the culture was continued for 24 hours.
6. Cell surface residual medium was gently washed off at room temperature with 1 XPBS, and 30. Mu.L of room temperature equilibrated cell lysate (Renilla Luciferase Assay lysis buffer, promega, E291A-C) was added to each well. At room temperature, the shaker was shaken for 30 minutes until the cells were completely lysed, and 15. Mu.L of the cell lysate was transferred to a 96 well white plate.
7. 40 μ L Renilla Luciferase (Promega, E2820) chromogenic substrate was added to each well and the relative luciferase activity (relative luciferase unit, RLU) was detected.
As shown in FIG. 12, pre-infection A/A/WSN/1933 (H1N 1) groups on MDCK, A549 and Calu3 cells significantly promoted infection by SARS-CoV-2 pseudovirus compared with Mock (no pre-infection IAV group), thereby establishing an in vitro IAV combined infection model of SARS-CoV-2; in this model, GL25E and GRFT were reacted with IAV first and then infected with SARS-CoV-2 pseudovirus, and the results show that GRFT and GL25E further reduced the combined infection of SARS-CoV-2 by inhibiting IAV infection compared to EK1 as shown in FIG. 12.

Claims (10)

1. A fusion protein comprising a first polypeptide comprising the amino acid sequence shown in SEQ ID No.1 or a variant amino acid sequence thereof having one or more amino acid mutations and a second polypeptide comprising the amino acid sequence shown in SEQ ID No.3 or a variant amino acid sequence thereof having one or more amino acid mutations, and wherein the first polypeptide and the second polypeptide are linked directly or through a linker;
preferably, the first polypeptide is at the N-terminus or C-terminus of the second polypeptide;
preferably, the joint is a flexible joint;
preferably, the linker is (GS) n, (GGS) n, (GGGS) n, or (GGGGS) n, n being an integer from 1 to 20, 2 to 15, 3 to 10, or 4 to 8;
preferably, the linker is (GGGGS) 5 ；
Preferably, the fusion protein comprises the amino acid sequence shown in SEQ ID NO. 2;
preferably, the mutation is a substitution, insertion, deletion and/or addition, preferably a conservative amino acid substitution;
preferably, the fusion protein consists of the amino acid sequence of SEQ ID NO. 2.
2. Nucleic acid encoding the fusion protein according to claim 1, preferably comprising the sequence shown in SEQ ID No. 5.
3. A vector comprising the nucleic acid according to claim 2,
optionally, wherein the vector comprises nucleotides encoding a purification tag, nucleotides encoding a precursor, and/or regulatory elements;
Preferably, the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag or NusA tag;
preferably, the regulatory element is selected from a promoter, a terminator and/or an enhancer.
4. A host cell comprising the nucleic acid of claim 2 or the vector of claim 3;
preferably, the host cell is a eukaryotic cell or a prokaryotic cell;
preferably, the eukaryotic cell is a yeast cell, an animal cell and/or an insect cell, and/or the prokaryotic cell is an E.coli cell.
5. A pharmaceutical composition comprising the fusion protein of claim 1, the nucleic acid of claim 2 and/or the vector of claim 3, and further comprising a pharmaceutically acceptable carrier;
preferably, the composition comprises an additional anti-influenza drug and/or an anti-coronavirus drug;
preferably, the anti-influenza drug is an anti-influenza a virus drug, e.g. selected from oseltamivir, arbidol, marbalo Sha Wei, peramivir and zanamivir;
preferably, the anti-coronavirus drug is selected from Mo Nuola, nemrotevir, ritonavir, albevudine, an Bawei mab, romidepuweimab, sotrovimab, imdevimab, casirivimab, tixagevimab, cilgavimab, bamlanivimab, etesevimab, amubarvimab and romidepusemab;
Preferably, the composition is in the form of a tablet, capsule, drop pill, aerosol, pill, powder, solution, suspension, emulsion, granule, liposome, transdermal agent, or lyophilized powder.
6. An in vitro method of inhibiting proliferation of influenza virus and/or coronavirus or preventing infection of influenza virus infected cells by coronavirus comprising contacting the cells with the fusion protein of claim 1 and/or a GRFT protein comprising the amino acid sequence shown in SEQ ID No. 1; wherein the influenza virus is influenza a virus and the coronavirus is SARS-CoV-2;
preferably, the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1 and H7N9;
preferably, SARS-CoV-2 is selected from mutants mutated in wild-type SARS-CoV-2 and S proteins, e.g.from the group consisting of D614G, omicron BA.1, omicron BA.2, omicron BA.3, omicron BA.5, omicron BF.7, omicron BQ.1 and Omicron XBB.
7. Use of the fusion protein of claim 1, the nucleic acid of claim 2, the pharmaceutical composition of claim 5 and/or the GRFT protein comprising the amino acid sequence shown in SEQ ID No.1 in the manufacture of a medicament for the prevention and/or treatment of a respiratory disease, wherein the respiratory disease is caused by an influenza a virus and/or a SARS-CoV-2 infection, preferably by an influenza a virus infection or by an influenza a virus combined with a SARS-CoV-2, such as influenza or an influenza combined with a novel coronavirus infection, or for the prevention of a disease caused by a influenza a virus infected person or an influenza a patient infected with SARS-CoV-2 or with a SARS-CoV-2, such as a novel coronavirus infection.
8. The use according to claim 7, wherein the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1 and H7N9; and/or severe acute respiratory syndrome coronavirus 2 is selected from mutant strains mutated in wild-type SARS-CoV-2 and S proteins, e.g. from D614G, omicron ba.1, omicron ba.2, omicron ba.3, omicron ba.5, omicron bf.7, omicron bq.1 and Omicron XBB;
preferably, the medicament is a nasal medicament;
preferably, the medicament is a prophylactic medicament;
preferably, the drug is a drug administered 3 hours before coronavirus infection to 3 hours after coronavirus infection, 2 hours before coronavirus infection to 2 hours after coronavirus infection, 1 hour before coronavirus infection to 1 hour after coronavirus infection, or 0.5 hour before coronavirus infection to 0.5 hour after coronavirus infection;
preferably, the medicament is used for preventing and/or treating respiratory diseases by inhibiting the hemagglutinin-mediated endocytosis of influenza a virus surface protein.
9. A method of increasing anti-coronavirus activity of an anti-coronavirus polypeptide, a method of increasing anti-influenza virus activity of an anti-influenza virus and/or a method of adding anti-influenza virus activity in the case of increasing anti-coronavirus activity of an anti-coronavirus polypeptide, comprising fusing an anti-influenza polypeptide comprising the amino acid sequence shown in SEQ ID No.3 or a variant amino acid sequence thereof having one or more amino acid mutations, with an anti-coronavirus polypeptide comprising the amino acid sequence shown in SEQ ID No.1 or a variant amino acid sequence thereof having one or more amino acid mutations, by directly linking the anti-influenza polypeptide and the anti-coronavirus polypeptide or by linker ligation; wherein the coronavirus is SARS-CoV-2; the influenza virus is influenza a virus;
Preferably, the influenza a virus is selected from the group consisting of H1N1, H3N2, H5N1 and H7N9;
preferably, SARS-CoV-2 is selected from mutants mutated in wild-type SARS-CoV-2 and S proteins, e.g.from the group consisting of D614G, omicron BA.1, omicron BA.2, omicron BA.3, omicron BA.5, omicron BF.7, omicron BQ.1 and Omicron XBB.
10. The method of claim 9, wherein the anti-coronavirus polypeptide is at the N-terminus or the C-terminus of the anti-influenza polypeptide;
preferably, the joint is a flexible joint;
preferably, the linker is (GS) n, (GGS) n, (GGGS) n, or (GGGGS) n, n being an integer from 1 to 20, 2 to 15, 3 to 10, or 4 to 8;
preferably, the linker is (GGGGS) 5 ；
Preferably, the fusion protein comprises the amino acid sequence shown in SEQ ID NO. 2;
preferably, the mutation is a substitution, insertion, deletion and/or addition, preferably a conservative amino acid substitution.
CN202310601537.2A 2023-05-25 2023-05-25 Application of recombinant expression protein in preventing and/or treating respiratory diseases Pending CN117304335A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310601537.2A CN117304335A (en) 2023-05-25 2023-05-25 Application of recombinant expression protein in preventing and/or treating respiratory diseases

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310601537.2A CN117304335A (en) 2023-05-25 2023-05-25 Application of recombinant expression protein in preventing and/or treating respiratory diseases

Publications (1)

Publication Number Publication Date
CN117304335A true CN117304335A (en) 2023-12-29

Family

ID=89285465

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310601537.2A Pending CN117304335A (en) 2023-05-25 2023-05-25 Application of recombinant expression protein in preventing and/or treating respiratory diseases

Country Status (1)

Country Link
CN (1) CN117304335A (en)

Similar Documents

Publication Publication Date Title
Zhao et al. Dual-functional peptide with defective interfering genes effectively protects mice against avian and seasonal influenza
CN107074912B (en) Influenza virus vaccine and uses thereof
EP2785372B1 (en) Influenza virus vaccines and uses thereof
CN106661091B (en) Influenza virus vaccine and uses thereof
JP6142077B2 (en) Peptide having inhibitory activity on respiratory virus infection, use thereof, and production method thereof
MX2012010406A (en) Human monoclonal antibodies derived from human b cells and having neutralizing activity against influenza a viruses.
CN116033926A (en) Binding proteins useful against ACE 2-targeted viruses
JP2023512191A (en) Polypeptides, methods for their preparation and uses thereof
CN105143251B (en) Influenza nucleoprotein vaccines
Li et al. Development of single-chain variable fragments (scFv) against influenza virus targeting hemagglutinin subunit 2 (HA2)
CN116745411A (en) Artificial eukaryotic expression system with enhanced performance
CN117304335A (en) Application of recombinant expression protein in preventing and/or treating respiratory diseases
WO2019206285A1 (en) Nucleic acid molecules and dual-functional peptides having antiviral activity and delivery activity, compositions and methods thereof
KR101921384B1 (en) Antigen composition against orthomyxoviruses comprising influenza virus surface protein hemagglutinin monomer
US9771395B2 (en) Enhanced influenza hemagglutinin binders
US20220226463A1 (en) Recombinant non-structural protein 1, recombinant influenza virus and immunological composition including the same, and method of treating or preventing disease or condition caused by or associated with influenza virus
CN113559239B (en) Application of fusion protein in preparation of medicines for preventing and/or treating respiratory diseases
KR102269257B1 (en) Antigen composition against orthomyxoviruses comprising influenza virus recombinant hemagglutinin monomeric protein multiple mutant protein
KR102546350B1 (en) Compositions containing scaffold-based fusion protein antigens for preventing or treating viral infections
Weliky Md Rokonujjaman, Abdulrazak Sahyouni, Robert Wolfe, Lihui Jia, Ujjayini Ghosh, David
Air et al. Influenza virus antiviral targets
Zhu Respiratory Syncytial Virus Fusion Protein Interaction with its Cellular Receptor, Nucleolin
Hu The role of a cholesterol consensus motif in HA and of an amphipathic helix in M2 for replication of influenza A virus
TW202306968A (en) Influenza virus-based isolated recombinant virus for inducing specific immunity to influenza virus and/or preventing influenza virus-related diseases
Colpitts Characterization of the Mechanisms of Broad-Spectrum Viral Entry Inhibitors

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination