CN117298277A

CN117298277A - DEXRAS1 inhibitors and uses thereof

Info

Publication number: CN117298277A
Application number: CN202311276694.7A
Authority: CN
Inventors: 朱丽娟; 石胡江; 朱星星; 李娜
Original assignee: Southeast University
Current assignee: Southeast University
Priority date: 2023-10-05
Filing date: 2023-10-05
Publication date: 2023-12-29

Abstract

The invention discloses a DEXRAS1 inhibitor and application thereof, and belongs to the field of biomedicine. The invention provides application of DEXRAS1 inhibitor in preparing medicines for preventing or treating nervous system diseases such as depression, cerebral apoplexy, epilepsy and the like. Specifically, the Dexras1 inhibitor may be a small molecule compound capable of inhibiting Dexras1 expression or activity, RNA or a precursor thereof that interferes with Dexras1 expression, dexras1 protein or a coding sequence thereof that reduces coupling of Dexras1 and CAPON, or a specific antibody of Dexras 1.

Description

DEXRAS1 inhibitors and uses thereof

Technical Field

The invention relates to the biomedical field, in particular to a DEXRAS1 inhibitor and a preparation method and application thereof.

Background

The high disabling and mortality rates associated with neurological diseases have become a global public health challenge. However, due to the complexity of the nervous system, understanding of the pathogenesis of various nervous system diseases is not yet thorough, and drugs for treating various nervous system diseases which are safe and rapidly effective in clinic are still lacking. The nature of the pathological process of nervous system diseases is the excitatory changes of the nervous system, i.e. the neuroplasticity changes, that occur under pathological conditions. Chronic stress stimuli such as long-term adverse environments or negative life events are important contributors to numerous neurological diseases that lead to the occurrence of neurological diseases such as anxiety, depression, stroke, epilepsy, etc., by affecting neuroplastic processes (e.g., neuronal proliferation, survival, synaptic structure and functional plasticity, etc.). In addition, chronic stress is an important research model of heart and body disorder diseases, and is also an important causative factor of diseases such as tumors, cardiovascular diseases, obesity and the like.

Currently, drugs for treating depression, such as imipramine, amitriptyline, citalopram, venlafaxine Xin Mi, etc., generally have obvious problems of slow clinical onset, often require a month or more to exert the therapeutic effect, and partial patients still have non-response phenomena. Meanwhile, the medicines have the defects of adverse reactions such as nausea, somnolence, sexual dysfunction and the like. Therefore, finding new therapeutic drugs with small side effects and fast onset of action is a problem to be solved in clinical urgent need.

Dexras1, also known as RASD1, belongs to a member of the family of small G-protein Ras, has GTPase activity, and is known to be closely related to chronic stress and neuroplasticity due to induction by the stress hormone dexamethasone. The application of Dexras1 in nervous system diseases such as depression, cerebral apoplexy and epilepsy and other diseases related to chronic stress, or the relative lack of effective therapeutic targets for the diseases are not disclosed in the prior art.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a DEXRAS1 inhibitor and application thereof.

The aim of the invention can be achieved by the following technical scheme:

in a first aspect the invention relates to the use of a DEXRAS1 inhibitor in the manufacture of a medicament for the prevention or treatment of a neurological disorder.

Optionally, the inhibitor is:

one or more of a small molecule compound capable of inhibiting the expression and/or activity of Dexras1, RNA or a precursor thereof that interferes with the expression of Dexras1, a Dexras1 protein or a coding sequence thereof that reduces the coupling of Dexras1 and CAPON, or a specific antibody for Dexras 1.

Optionally, the RNA is Dexras1-RNAi, and the sequence is:

5'-GCTCAAACAGCAGATCCTAGA-3'(SEQ ID No.1)；

5'-GCTGGTCATTTGCGGTAACAA-3'(SEQ ID No.2)；

5'-GCGTTGTGCCTACTTCGAGAT-3'(SEQ ID No.3)；

5'-GCAAGGTATCTGTGCAGTACT-3'(SEQ ID No.4)。

optionally, the Dexras1 protein sequence for reducing the coupling of Dexras1 and CAPON is the full length or part of amino acids 235-280 in the amino acid sequence selected from SEQ ID NO. 5; the coding sequence is SEQ ID NO.6.

Optionally, the small molecule compound is:

one or more of the following.

Alternatively, the specific antibody of Dexras1 is a polyclonal antibody or a monoclonal antibody.

Optionally, the neurological disease comprises depression, stroke, and epilepsy.

In a second aspect the invention relates to a medicament for the prevention or treatment of neurological diseases comprising a DEXRAS1 inhibitor.

Drawings

The invention is further described below with reference to the accompanying drawings.

Fig. 1 shows the expression of Dexras1 and the coupling of Dexras1 to CAPN in the hippocampus of mice exposed to chronic stress in example 2 of the present application. (A) Western blot experiments show that the expression of the hippocampal Dexras1 of the mice with anxiety induced by chronic Wen Heying shock (CMS) is obviously higher than that of a control group; (B) qPCR analysis showed CMS-induced depression and increased levels of hippocampal Dexras1 mRNA in anxiety mice. All data are expressed as mean ± SEM. * P <0.05, < P <0.01, < P <0.001, compared to the control group.

Fig. 2 shows that the CO-IP experiments in example 2 of the present application show that CMS induced depression, anxiety mice hippocampal Dexras1 coupled with CAPON significantly higher than the control group.

FIG. 3 is an in vitro validation of the knockdown efficiency of different Dexras1 shRNAs in example 4 of the present application. And detecting the knockout efficiency of Dexras1 by shRNA with different sequences in hippocampal tissues by using a western blotting method. The knockout efficiency is Dexras1-shRNA-2> Dexras1-shRNA-3> Dexras1-shRNA-4> Dexras1-shRNA-1.

Fig. 4 is a decoupling efficiency validation of the Dexras 1-CAPN decoupling agent in example 5 of the present application. By combining the co-immunoprecipitation with western blotting, the detection shows that the decoupling agent AAV-Dexras1-46C-GFP significantly reduces interaction of Dexras1 with CAPN in hippocampal tissues.

Fig. 5 is a graph showing that down-regulating Dexras1 expression in hippocampal neurons is effective in alleviating anxiety and depression symptoms in example 4 of the present application. (a-C) interfering with Dexras1 expression in hippocampal neurons reverses the anxiety phenotype exhibited by chronically warm-blooded stress (CMS) -induced mice in elevated plus maze experiments. (D) Interference of Dexras1 expression in hippocampal neurons reverses the depressed phenotype that CMS induced mice exhibit in forced swimming experiments.

Fig. 6 shows that blocking hippocampal Dexras1-CAPON coupling in example 6 is effective in alleviating anxiety and depression symptoms. (A-B) AAV-Dexras1-46C was infused into the hippocampal tissue of mice, blocking the coupling of hippocampal Dexras1 to the CAPON. (C-E) blocking hippocampal Dexras1-CAPON coupling reverse chronic Wen Heying shock (CMS) induced the anxiety phenotype that mice exhibited in the elevated plus maze experiment. (F) Blocking hippocampal Dexras1-CAPON coupling reverses the depressed phenotype that CMS induced mice to exhibit in forced swimming experiments.

Fig. 7 shows that the small molecule compounds of example 7 of this application inhibit the activity of Dexras1 and are effective in alleviating depression and anxiety symptoms. (A) Effect of small molecule Compounds on Dexras1 Activity. (B-D) inhibition of Dexras1 activity induced mice to exhibit an anxiolytic-like phenotype in an elevated plus maze experiment. (D) Inhibition of Dexras1 activity induces mice to exhibit an antidepressant-like phenotype in forced swimming experiments.

Fig. 8 shows that the small molecule compound of example 7 of the present application inhibits the antidepressant effect of Dexras1 against fluoxetine. (A) the anti-depression effect can be exerted by taking ZW-005 for 7 d; (B) The behavior of depression caused by CMS was reversed 28 days after fluoxetine administration.

Fig. 9 is a graph showing that the small molecule compound of example 7 of the present application inhibits the activity of Dexras1, which is effective in alleviating neurological dysfunction caused by stroke. (A) Improvement of cerebral ischemia symptoms in model mice by the small molecule compound ZW-005; (B) The small molecular compound ZW-005 significantly reduces foot defects in model mice; (C) The small molecular compound ZW-005 can significantly improve learning and memory capacity defects caused by cerebral ischemia.

Fig. 10 is a graph showing that the small molecule compound of example 7 of this application inhibits the activity of Dexras1, effectively alleviating PTZ-induced epilepsy.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1, chronic Wen Heying excitation model and behavioural test

In one example of the present disclosure, a non-human animal experimental model and an experimental method thereof are disclosed, specifically, for example, a mouse experimental model, and experimental steps are shown below.

First, adult (6-8 week old) ICR mice were taken for behavioral testing: 5/cage, 12 hours bright-dark period (7 am-7pm bright). All mice were free to ingest stable water and food and all animal experiments were approved by the animal protection and use committee of the university of eastern south.

The modeling method of the chronic Wen Heying stress model can be stress treatment including water inhibition, fasting, activity restriction, wet cage, inclined cage, day-night inversion, forced swimming and the like for 4 weeks. And after the last molding is finished, carrying out an Elevated Plus Maze (EPM) test and a forced swimming experiment (FST) test for 24 hours, taking out the sea horse tissue 24 hours after the test is finished, and carrying out expression quantity analysis.

Experimental items for the behavioral experiments for assessing depressive behavior in the present invention are, for example, but not limited to, forced swim tests.

In this example, the diameter of the mouse forced swimming cylindrical container is 12cm, and the height is 25cm. The water depth was measured to be 14cm and the water temperature was 23-24 ℃. The camera records the swimming condition of the mouse within 6min from the side. And counting the immobility time of the mice within 6min after swimming by adopting a double-blind mode, namely the floating posture of the animals or the time when the limbs are completely inactive.

All data in this example are in mean ± SEM. For all behavioural data, two-tagged Student's t-tests or one-way ANOVA followed by Tukey's post hoc test were used.

Example 2, CO-IP and Western Blotting and qPCR analysis

After the mice were anesthetized with isoflurane, the brains were removed by head breakage. Hippocampus tissue was rapidly isolated on ice and frozen at-80 ℃. The samples are in RIPA lysates, wherein the composition of the lysates is, for example, 20mM Tris-HCl [ pH 7.5], 150mM NaCl, 1mM EDTA, 1mM EGTA, 1% NP-40, 1% sodium deoxycholate (sodium deoxycholate), 1mM PMSF, 10. Mu.g/ml aprotinin (aprotinin), 1. Mu.g/ml aprotinin (pepstatin A) and 1. Mu.g/ml leupeptin (leupeptin). After completion of tissue disruption and lysis, the supernatant was centrifuged at 12000rpm for 15 min. Protein concentration was measured by BCA method, and 15-20. Mu.g of protein was loaded per well, and electrophoresis was performed on 10% SDS-PAGE gel, and transferred to a PVDF membrane for Western blotting. The primary antibody used was anti-Dexra 1 (1:4000, millipore), anti-Tubulin (1:40000, abcam), and for quantification of immunoblotting results, statistical analysis was performed using Image J software.

Then, the supernatant of hippocampal tissue protein extracted as described above was added with nNOS (BD) antibody and incubated at 4 ℃ with shaking overnight. Protein G-sepharose beads were added to the Protein supernatant the following day, and incubated at 4℃for 10h. After centrifugation at 5000rpm, the protein supernatant was aspirated and the agarose bead-protein-antibody complex was washed 5-6 times with 1 XPBS. Finally, centrifugation at 5000rpm, discarding the supernatant, resuspending the complex with 50. Mu.l of 1XPBS, adding 5 Xloading buffer for denaturation in a water bath at 100℃for 10min, and performing Western Blotting analysis.

Breaking the end of the mouse after anesthesia, rapidly taking out the sea horse on ice, placing the sea horse in an EP tube, adding 400ul of RNA-easy (Noruzhan), homogenizing in a tissue disruption instrument, adding 300ul of RNA-easy, reversing upside down, adding 300ul of DEPC water, and standing on ice for 5min; after 12000rcf centrifugation, the supernatant was aspirated into a 2ml EP tube and isopropanol was added at 1:1, gently shaken well and left to stand at-20℃for 30min before centrifugation; removing the supernatant and adding 1ml of 75% ethanol (DEPC water configuration) to resuspend the precipitate, centrifuging 8000rcf, discarding the supernatant, and repeating the washing for 1 time, discarding the powder and airing; after dissolving in 20ul of DEPC water, RNA concentration was measured. Then removing genome DNA by using a Norpran reverse transcription kit, performing reverse transcription, and performing PCR amplification on the obtained cDNA according to the following reaction system:

the primers used were:

Dexras1-Forward:TGTCGCGCTTCCTCACG

Dexras1-Reverse:CACCAGAATGAAAACGTCTCCTGTG

example 3 brain stereotactic injection

Mice were anesthetized with isoflurane and fixed on a stereotactic (RWD). Each mouse was injected with 1ul of Tat-Dexras1-46C or Dexras1-shRNA per side of the hippocampus, stereotactic coordinates (Bregma: -2.3mm (AP), + -1.4 Mm (ML), -2.1mm (DV)). Slow injection (100 nl/min) using a Ruiword microsyringe, leaving the needle 5min after injection, and then slowly removing the syringe needle within another 5min. After the drug time, a behavioural experiment and subsequent histochemical analysis experiments were performed.

EXAMPLE 4 construction of Dexras1-RNAi viral vector

In some examples of the disclosure, short hairpin RNAs (shRNA) of AAV8 virus expression of Dexras1 may be employed to down-regulate the expression level of CMS model mouse hippocampal Dexras1 protein, specifically, the following steps may be employed.

The shRNA of 4 Dexras1 interfering RNAs, SEQ ID Nos. 1-4, constructed according to the following table were cloned into the WX231-L vector:

5'-CACCGCTCAAACAGCAGATCCTAGAACATCGAATCTAGGATCTGCTGTTTGAGC-3'(SEQ ID No.1)

5'-CACCGCTGGTCATTTGCGGTAACAAACATCGAATTGTTACCGCAAATGACCAGC-3'(SEQ ID No.2)

5'-CACCGCGTTGTGCCTACTTCGAGATACATCGAAATCTCGAAGTAGGCACAACGC-3'(SEQ ID No.3)

5'-CACCGCAAGGTATCTGTGCAGTACTACATCGAAAGTACTGCACAGATACCTTGC-3'(SEQ ID No.4)

dexras1-shRNA was packaged into AAV virus and used in Dexras1 function down-regulation experiments.

Firstly, injecting packaged virus AAV-hSyn-Dexras1-shRNA-GFP (Dexras 1-shRNA-1-4) and control virus AAV-hSyn-GFP into the hippocampus of adult ICR male mice, taking the hippocampus tissues after 3 weeks of expression, and analyzing the expression quantity of the hippocampus to verify different Dexras1-shRNA interference efficiencies.

Subsequently, AAV-hSyn-Dexras1-shRNA-GFP (Dexras 1-shRNA-2) and AAV-hSyn-GFP control virus were injected into the hippocampus of adult ICR male mice and recovered for 1 week using brain stereotactic techniques, and CMS molding was performed. And (3) after the final molding is finished for 24 hours, performing a behavioural test, taking out the hippocampal tissue 24 hours after the test is finished, and performing expression analysis.

EXAMPLE 5 construction of Dexras 1-CAPN decoupling agent

In some examples of the disclosure, anxiety and depression symptoms can be effectively alleviated by blocking the coupling of Dexras1 and CAPN, for example, by designing key amino acid sequences that recognize the coupling of Dexras1 to CAPN, followed by construction of small molecule peptides or their coding sequences required for synthesis.

AAV-Dexras1-46C-GFP decoupling agent and control virus were injected into hippocampus of adult ICR male mice by brain stereotactic technique, and after 3 weeks of expression, the hippocampal tissues were taken for CO-IP to verify their decoupling efficiency.

Subsequently AAV-Dexras1-46C-GFP decoupler and control virus were injected into the hippocampus of adult ICR male mice and restored for 1 week, CMS molding was performed. And (3) after the final molding is finished for 24 hours, performing a behavioural test, taking out the hippocampal tissue 24 hours after the test is finished, and performing expression analysis.

EXAMPLE 6 construction of Small molecule Compounds that inhibit Dexras1 Activity

In some examples of the disclosure, anxiety and depression phenotypes in mice can be alleviated by constructing small molecule compounds having the structure:

specifically, the small molecular compound is continuously injected into adult ICR male mice by tail vein for 7 days, behavioral tests are carried out after 24 hours, and sea horse tissues are taken out 24 hours after the tests are finished, and expression quantity analysis and Dexras1 activity measurement are carried out; or injecting a small molecular compound for inhibiting Dexras1 activity after cerebral ischemia modeling and restoring perfusion for 2 hours, observing the improvement effect of the small molecular compound on cerebral ischemia symptoms after 24 hours, or continuously injecting the small molecular compound into the tail vein for 7 days after 2 hours of restoring perfusion, and observing the influence of the small molecular compound on nerve dysfunction caused by cerebral ischemia; or small molecule compounds inhibiting Dexras1 activity are injected 24 hours before PTZ is injected to construct an epileptic model mouse, and the improvement condition of epileptic symptoms is observed.

EXAMPLE 7 determination of Dexras1 Activity

In this example, the level of nitrosylation of Dexras1 protein was measured using the biotin conversion method to reflect Dexras1 activity. The method mainly comprises the following steps:

(1) Sample preparation: the brain tissue of the mice was rapidly removed and placed in 430. Mu.l of lysate on ice for 30min, centrifuged at 12000g for 15min, and the supernatant was aspirated at 400. Mu.l and frozen in a-80℃freezer. Lysate: 400. Mu.l HEN buffer+1% NP40+1% PMSF (mother liquor 0.1M).

(2) Closing: the purpose of this step is to allow the thiol groups in the cysteine residues of the protein to react with MMTS (methylmethanethiosulfonate) to form disulfide bonds. Mu.l of the supernatant was pipetted into a 10ml centrifuge tube and 1420. Mu.l of HEN buffer were added to bring the protein concentration to < 0.8. Mu.g/. Mu.l. 0.2ml of 25% SDS and 20. Mu.l of MMTS were added. The reaction was carried out at 50℃at 250rpm for 30min in the dark.

(3) Precipitation: 6ml of glacial acetone was added, precipitation was carried out at-20℃for 20min, centrifugation was carried out at 8000g for 5min, and the supernatant was discarded. Washing with ice acetone for 3 times, 5 ml/time.

(4) Reduction labeling: this step was mainly performed by reducing-SNO to-SH with sodium ascrobate and biotin-HPDP was labeled with biotin. Resuspended in 240. Mu.l HENS buffer and transferred to a 1.5ml EP tube. Mu.l biotin-HPDP (2.5 mg/ml) and 30. Mu.l 200mM sodium ascorbate (final concentration 20 mM) were added and reacted at 30℃at 250rpm in the absence of light for 1 hour.

(5) Precipitation: 0.9ml of glacial acetone was added, precipitation was carried out at-20℃for 20min, centrifugation was carried out for 5min at 5000g, and the supernatant was discarded. Washing with ice acetone for 4 times, 1 ml/time, centrifuging at 5000g for 5min, and discarding supernatant.

(6) Precipitation of nitrosylated proteins: first, resuspend in 250. Mu.l HENS/10buffer, then add 750. Mu. l Neutralization buffer, vortex thoroughly, then suck 30. Mu.l as Input, then add 30. Mu. lprewashed avidin-affinity resin, reverse reaction overnight at 4 ℃.5000g was centrifuged for 3min, the supernatant was discarded, 1ml of 1xPBS was added, the washing was reversed at 4℃for 5min, centrifuged, the supernatant was discarded, and the washing was performed 3 times.

(7) Eluting: 35ml Elution buffer was added and vortexed at room temperature for 5min.5000g was centrifuged for 3min, 30. Mu.l of supernatant was aspirated, and 6. Mu.l of 6x loading buffer,100 ℃water were added for 8min. Then the level of Dexras1 nitrosylation was detected using western blot.

In the sample preparation step (1), GSNO was added to 200 μm to the sample, and vortexed at room temperature for 40min as a positive reference. In the step of (4) reduction labeling, a sample of sodium ascorbate was not added as a negative reference.

Example 8 comparison of Small molecule Compound ZW-005 with Fluoxetine anti-depressant effect

Adult (6-8 week old) ICR mice were used to construct chronic mild stress models as described in example 1. While ZW-005 tail vein continuous injection 3d, 7d, 14d, 21d, 28d or abdominal cavity treatment with fluoxetine 3d, 7d, 14d, 21d, 28d was given to a part of the model mice. And (5) detecting the forced swimming behavior 24 hours after the molding is finished.

The results are shown in FIG. 8, in which the onset of the apparent reversal of the chronic stress-induced depressive behavioral phenotype was immediately after administration of ZW-005 d; whereas fluoxetine was administered for 28d before a significant antidepressant effect was seen.

Example 9 construction of cerebral ischemia model and evaluation of behaviours

Focal cerebral ischemia is caused by an intra-luminal Middle Cerebral Artery Occlusion (MCAO). Briefly, after anesthetizing the mice, a 4/0 tip rounded surgical nylon monofilament was passed through the carotid stump into the right internal carotid artery, and 20-21 mm after carotid bifurcation was advanced until slight resistance was felt. Left for 120 minutes and then removed to allow for recharging. The cerebral blood flow of the local area is measured by a laser Doppler perfusion monitor, and the reduction of the cerebral blood flow is ensured to be 85% -95%.

In this example, grid Test (Grid Test) and Morris water maze were used to evaluate the effect of the cerebral ischemia model on neurological function.

The grid test was used to evaluate neuromuscular strength and coordination in rodents. The horizontal grid device adopted by the behavior test consists of a grid with the size of 12x 12cm, and the opening of the grid is 0.5x 0.5cm. The mesh is 20 cm above the surface to prevent the animal from jumping out of the mesh. A 3 inch high wall made of a strong opaque material (plexiglas) surrounds the grid in a manner that does not affect the appearance of the subject. At the same time, the grid is allowed to rotate on both sides. The mice were placed in the center of the mesh and when they successfully gripped the mesh with all four paws, the tail was released. The grid is then inverted. The mice were allowed to freely walk on the grid for 5min. The test was repeated as necessary. The number of foot errors and the total number of steps of the mice were analyzed, and the ratio of the number of foot errors to the total number of steps was calculated.

The Morris water maze test is a circular pool of opaque water, and animals find a platform below the water surface by using the spatial memory and visual cues around the maze after training. The animals were then placed individually in the various quadrants of the pool and their arrival time and course at the concealed platform were recorded. The model has become one of the most commonly used behavioural experimental methods in cerebral ischemia research.

Example 10 construction of epileptic model and behavioral evaluation

The most classical among chemicals is Pentyltetrazine (PTZ) which is used to build animal models of acute and chronic epilepsy by blocking GABA transmission. The mice were given either saline or PTZ (50 mg/kg body weight) by intraperitoneal injection. After 30min of injection, mice were observed for development of epileptic related movements or behaviors. The degree of epilepsy was scored by the following quantification method: no abnormal movement or behavior (score 0); immobilized (1 minute); tail twitch (2 minutes); systemic tics (3 minutes); single body contraction (4 minutes); continuous body contraction (5 minutes); a series of abnormal actions (tail twitch, body tremor, or contractions), sometimes accompanied by a loss of balance for 5-10 seconds (6 minutes); tonic clonic convulsions (7 points); death (8 minutes). As shown in fig. 10, the degree of epilepsy in mice injected with the small molecule compound was significantly lower than that in the control group, indicating that the small molecule compound was effective in alleviating PTZ-induced epilepsy.

From the experiments described above, dexras1 is a critical regulator of chronic stress related diseases such as anxiety, depression, cerebral apoplexy, and epilepsy. Experiments further prove that the anxiety and depression phenotype can be relieved or eliminated or cerebral apoplexy related symptoms can be relieved through means such as inhibiting the expression or activity of Dexras1, reducing or blocking the coupling of Dexras1 and CAPON, and the like.

In the above examples, inhibiting Dexras1 expression refers to being able to reduce the mRNA and protein levels of Dexras 1. Inhibition of Dexras1 activity refers to a reduction in its nitrosylation level. The coupling of Dexras1 and CAPON means that an amino acid sequence of Dexras1 can be combined with CAPON. Proteins that uncouple Dexras1 from the CAPN can compete with normal proteins, thereby reducing the effects exerted by endogenous Dexras 1. The uncoupling protein of Dexras1-CAPON can be expressed in the target tissue or cell by administering an expressible vector (carrying the expressible uncoupling protein gene and/or its expression factor) to the target tissue or cell.

Based on the association of Dexras1 with anxiety, depression, stroke, and epilepsy, the methods described above can be used to screen or test active ingredients for the treatment of anxiety or depression or stroke or epilepsy or other chronic stress related disorders.

In addition, in the present disclosure, the active ingredient described in the above example may be a pharmaceutical ingredient or a pharmaceutical combination that has a positive effect on treatment.

The methods and medicaments of the present disclosure may be methods and medicaments that are locally effective in the hippocampus or other tissues. For drugs for nerve tissue, particularly brain nerve tissue such as the hippocampus or other specific brain regions, it is beneficial to limit the effect of the drug to the target tissue. Methods or drugs for hippocampus or specific brain regions need to consider whether the method or drug is capable of exerting the effectiveness of the drug in the specific brain region, including whether the drug is capable of reaching the specific brain region, and whether the concentration of the drug in the specific brain region is effective, etc. In some examples of the disclosure, the drug may be in a dosage form that is administered locally in a specific brain region. Limiting the effect of the drug to the target tissue may be accomplished by local administration, for example, by preparing the drug into a dosage form that is locally administered by implantation of a cannula into a specific brain region. For another example, the drug is formulated into a sustained release dosage form after implantation into tissue, and the like. The above drugs can also be formulated as tissue-specific targeted drug delivery systems. For example, a complex molecule capable of recognizing and binding cells of a specific brain region can be formed by linking a small molecule compound or bioactive molecule (nucleic acid such as DNA or mRNA encoding the corresponding protein, protein such as antibody, etc.) having the ability to promote neural plasticity with an antibody capable of specifically binding to a protein specifically expressed in a specific brain region.

In examples of the present disclosure, the treatment includes: improving, reducing, lessening or preventing the ongoing course or outcome of symptoms associated with chronic stress-related diseases; improving the ongoing course or outcome of symptoms associated with the disease; a process or outcome that normalizes body function in a disease or condition that leads to impairment of a specific body function; or an ongoing process or outcome that results in an improvement in one or more clinically measurable parameters of the disease.

In examples of the present disclosure, the therapeutic purpose is to prevent or slow down (alleviate) an undesired physiological condition, disorder or disease, or to obtain a beneficial or desired result.

The result may be, for example, medical, physiological, clinical, physical therapy, occupational therapy, healthcare-oriented or patient-oriented; or understood in the art as "quality of life" or parameters of activities of daily living. In the present disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; reducing/shrinking the extent of the condition, disorder or disease; stabilize (i.e., not worsen) the condition, disorder or disease. In some examples of the disclosure, the treatment may further include eliciting a clinically effective response without undue levels of side effects.

In examples of the present disclosure, treatment also includes extending survival compared to expected survival if not receiving treatment. Treatment may also refer to administration of a drug or the degree of medical treatment performed on a patient.

The treatment referred to in this disclosure may also be preventing (preventing), curing frailty or illness, or improving a patient's clinical condition, including reducing the course of disease or severity of disease, or subjectively improving the patient's quality of life or extending the patient's survival.

The above examples are illustrative of the present disclosure and are not to be construed as limiting the present disclosure unless otherwise indicated. Practice of the present disclosure will use conventional techniques of organic chemistry, polymer chemistry, biotechnology, and the like, it being apparent that the present disclosure may be practiced otherwise than as specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the disclosure will be apparent to those skilled in the art to which the disclosure pertains. Many modifications and variations are possible in light of the teachings of the disclosure and, thus, are within the scope of the disclosure.

In the description of the present specification, the descriptions of the terms "one embodiment," "example," "specific example," and the like, mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims.

/>

Claims

Use of a dexras1 inhibitor for the preparation of a medicament for the prevention or treatment of neurological disorders.
2. The use according to claim 1, wherein the inhibitor is:

one or more of a small molecule compound capable of inhibiting the expression and/or activity of Dexras1, RNA or a precursor thereof that interferes with the expression of Dexras1, a Dexras1 protein or a coding sequence thereof that reduces the coupling of Dexras1 and CAPON, or a specific antibody for Dexras 1.
3. The use according to claim 2, wherein the RNA is Dexras1-RNAi, having the sequence:

SEQ ID No.1；

SEQ ID No.2；

SEQ ID No.3；

SEQ ID No.4。
4. the use according to claim 2, wherein the Dexras1 protein sequence reducing the coupling of Dexras1 and CAPON is the full length or part of amino acids 235-280 of the amino acid sequence selected from the group consisting of SEQ ID NO. 5; the coding sequence is SEQ ID NO.6.
5. The use according to claim 2, wherein the small molecule compound is:

one or more of the following.
6. The use according to claim 2, wherein the specific antibody of Dexras1 is a polyclonal antibody or a monoclonal antibody.
7. The use according to claim 1, wherein the neurological disease comprises depression, stroke and epilepsy.
8. A medicament for the prevention or treatment of neurological diseases comprising a DEXRAS1 inhibitor.
9. The medicament of claim 8, wherein the DEXRAS1 inhibitor is:

one or more of a small molecule compound capable of inhibiting the expression and/or activity of Dexras1, RNA or a precursor thereof that interferes with the expression of Dexras1, dexras1 protein or a coding sequence thereof that reduces the coupling of Dexras1 to CAPON, and a specific antibody for Dexras 1.