CN1172856A - Active recombination amidate enzyme and its amidate modification application for polypeptide - Google Patents

Abstract

The present invention relates to the active expression of C terminated amidase gene from rat in insect cell. The oxidase structure field (PHM)cDNA of encoded rat's glycopeptide acylated monooxygenase (rPAM) is inserted into transfer expresion carrier of insect's bacillary virus and recombined virus to express active PHM in insect cell is obtained by isogeny recombination. The PHM expressed by insect cell can be directly used for amidation modification of glycopeptide.

Description

A kind of active reorganization amidating enzyme and the amidation of polypeptide modified use

The present invention relates to the genetically engineered activity expression of amidating enzyme and to the C of polypeptide end amidation processing.

The C-terminal such as hormone, neuropeptide, phallotoxins that have pharmaceutical use in a large number are amidation and modify, and this all is crucial to its biological activity and stability.Thyrocalcitonin for example, if substitute natural amidation Pro with non-amidated Pro residue, then its biological activity will descend 3,000 times.This translation post-treatment process by amidating enzyme-peptidylglycine acidylate monooxygenase (Peptidylglycine α-Amidating Monooxygenase, PAM, EC1.14.17.3) catalysis finish (Bradbury A.F., et al., 1982, Nature, 298:686).Amidating enzyme is present in batrachians widely in people's tissue, and higher homology is arranged.But in prokaryotic organism such as intestinal bacteria that genetically engineered is commonly used and the insect cell line set up, but lack this enzymic activity, the amidation after expression product is not translated is processed.

Thereby the development research of amidating enzyme just seems very necessary.PAM can separation and purification from content and active high tissue, for example serum, human thyroid, frog skin, rat marrow sample thyroid tumor tissue and cell strain, Pigs Hearts room, pig pituitary etc., the existing in the world many patent reports of this respect.But from natural tissues, extract the method for amidating enzyme, be subjected to the restriction of material source, purifying process is loaded down with trivial details, purified product often has the pollution of the proteolytic enzyme in the tissue in addition, in modification to polypeptide, cause degraded, thereby influence its further Application and Development substrate, amidated products and enzyme itself.Producing amidating enzyme with gene engineering method, is another approach.

PAM cDNA is cloned from multiple kind, and obtain activity expression in multiple mammalian cell (Eipper B.A., et al., 1991, J.Biol.Chem., 266:7827; Kato I., et al., 1990, Biochem.Biophy.Res.Commun., 172:197; Mains R.E., et al., 1991, Mol.Endocrinol. 5:187), but only limits to fundamental research.Also yet there are no the report of activity expression in intestinal bacteria, renaturation is also very difficult.Rhabdovirus expression vector is the new expression vector system that development in recent years is got up, utilize this system can be in insect cell and polypide efficiently expressing exogenous gene, output can be far above mammalian cell, and more perfect translation post-treatment system arranged, as disulfide linkage pairing, glycosylation etc., therefore in genetically engineered drug production, have more potential advantage (Karl M. than systems such as bacterium, yeast, mammalian cells, et al., 1994, Insect Cell Biotechnology, CRC press).

PAM is found first bifunctional enzyme in the polypeptide biosynthesizing, two catalyst structure domain-oxydase (PHM) and lyase (PAL) are arranged, under the physiological pH condition, the amidated two-step reaction of order catalysis: terminal for the peptide precursor of Gly at first is oxidized to peptide acyl hydroxylation glycine intermediate by PHM, be cracked into amidated products and oxoethanoic acid through PAL then.But find in the research, do not need the effect of PAL under the alkaline condition, but the intermediate spontaneous transformation be product (Eipper B.A., et al., 1991, J.Biol.Chem., 266:7827).Thereby in amidate action, PHM is more even more important than PAL.Since only PHM can satisfy the requirement of amidation processing, and in general, single PHM of expression is than expressing the PAM holoenzyme, and is easier and productive rate is high, so the activity expression of PHM is more meaningful in the genetically engineered of amidating enzyme is produced.

For this reason, the objective of the invention is PHM catalytic structure domain encoding sequence with clone's the rat that has signal peptide and leading peptide, be recombined into insect baculovirus and shift in the expression vector, realize activity expression in insect cell sf21, expressed products can be directly used in the amidation of peptidylglycine and modify.

The invention provides the PHM catalyst structure domain encoding gene of a kind of clone's the rat that has signal peptide and leading peptide.By hybridization of phage original position and PCR method, from the brain cDNA storehouse of rat, screen PAM three gene fragments (among Fig. 1 fragment P for the sieve storehouse probe, a, b and c are the PAM gene fragment that is screened), through the DNA complete sequence analysis, fragment a is 502bp, coding rPAM N end signal peptide, leading peptide and part maturation protein part; Fragment b is 422bp, the partial sequence of the oxydase structural domain PHM of coding rPAM; Fragment c is 2388bp, the sequence of comprise encoding part oxydase structural domain PHM, whole lyase PAL structural domain, stride the film region sequence, C holding cytoplasmic region and a part 3 ' end non-translated sequence.Above-mentioned three gene fragments are overlapped, and cross over the holoenzyme encoding sequence of rPAM, but their no suitable restriction enzyme sites are recombinated.By the appropriate design primer, the encoding sequence of PHM among the fragment c is gone out with pcr amplification, and recombinates by PCR with fragment a and b, obtain complete PHM encoding sequence (Fig. 2, Fig. 3);

The present invention also provides insect baculovirus transfer expression plasmid pBacPHM2 that contains the PHM gene and the recombinant virus BacPHM that is used in secreting, expressing active form PHM among insect cell sf21 or the sf9 (by Beijing China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) preservation, on March 5th, 1997, deposit number is CGMCC0295).Complete PHM encoding sequence (containing signal peptide and leading peptide) with the splicing acquisition, by restriction enzyme site EcoRI and BamHI, insert insect baculovirus and shift expression vector pBacPAK8 (CLONTECH company product, catalog number are 6145-1), be built into expression plasmid pBacPHM2 (Fig. 4); The autographa californica nuclear polyhedrosis virus BacPAK6 linearizing DNA cotransfection Spodoptera frugiperda cell sf21 of pBacPHM2 and modification obtains at the recombinant virus BacPHM that examines the PHM gene under polyhedrin gene promoter (polyhedrin promoter) control by homologous recombination.

The present invention also provides the activity expression product-single function amidating enzyme PHM after BacPHM infects the sf21 cell.Infect the sf21 cell with BacPHM, the serum-free culture supernatant detects the highest vigor of amidating enzyme (Fig. 5) behind 72h; Secrete enzyme activity to the substratum far above (Fig. 7) in the born of the same parents; Western blotting (western blot) through the specific antibody of poly-propionic acid amide gel electrophoresis (SDS-PAGE) and PAM is analyzed, the expression product molecular weight be about 41kD (Fig. 6, C and S be respectively infection BacPHM's～10 ⁵Reach the albumen in～10 μ l substratum supernatants in the individual sf21 cell born of the same parents, C0 and S0 are respectively in the sf21 cell born of the same parents that infect BacPAK6 and the albumen in the substratum supernatant.); The output of secreting to the substratum is about 1 μ g/ml substratum.Reorganization PHM can be that the polypeptide of Gly carries out amidation and modifies to C-terminal.With α-N-acetyl-Tyr-Val-Gly tripeptides is substrate, and its amidate action optimal pH is about 5.0 (Fig. 8).

The present invention also utilizes the PHM of reorganization that peptidylglycine is carried out amidation and modifies.With α-N-acetyl-Tyr-Val-Gly and D-Tyr-Val-Gly is example, and under subacidity and condition of neutral pH, PHM can transfer them respectively to α-N-acetyl-Tyr-Val-Gly (OH) and D-Tyr-Val-Gly (OH) intermediate product; And when adding 0.1M NaOH in the reaction system, the intermediate product that is generated can transfer amidated products fully in 1 minute; Substrate can separate by HPLC with product.

To sum up, advantage of the present invention is as follows: utilize baculovirus expression system at the expressed in insect cells amidating enzyme, output can also be set up suspension culture system far above mammalian cell, is beneficial to the industrialization production of this enzyme; Simultaneously in insect cell, introduced the amidating enzyme activity, be beneficial to the translation of expressed in insect cells product after amidation modify; Single PHM of expression is than expressing the PAM holoenzyme, and it is transcribed, translation efficiency wants high, and expression product will be stablized, and does not relate to two structural domains influencing each other in folding in the holoenzyme, and can satisfy the requirement of amidation processing; The PHM of clonal expression has signal peptide and leading peptide, effectively guided the outer of expression product to secrete, be beneficial to the purifying and the stability of product, avoid the degraded of intracellular protein enzyme, also the screening for recombinant virus provides convenience, only need to detect the amidating enzyme activity of emiocytosis to the serum free medium, can choose positive-virus.The active PHM of expressed in insect cells all has great importance in fundamental research and pharmaceutical developments application facet.

Description of drawings:

Fig. 1. the position and the nucleotide sequence of the complete relatively gene of the structure of P of Rats AM albumen and cDNA and the PAM gene fragment a that is screened, b, c.

The DNA splicing strategy of Fig. 2 .PHM.

The DNA Nucleotide of Fig. 3 .PHM and the aminoacid sequence of corresponding encoded.

Fig. 4. the structure of the transfer expression plasmid of the PHM of insect cell.

Fig. 5. phase when recombinant virus BacPHM infects the expression of sf21 cell.

Fig. 6. the western blot of the sf21 cell expression product that is infected by recombinant virus BacPHM analyzes.

Fig. 7. the amidating enzyme vigor that reaches in the sf21 cell born of the same parents that recombinant virus BacPHM infects in the substratum supernatant compares.

Fig. 8. the enzyme activity of the PHM of insect cell expression and the relation of pH value in reaction.

Fig. 9. reorganization PHM and two kinds of reacted HPLC of peptidylglycine analyze.A, standard D-Tyr-Val-Gly and D-Tyr-Val-NH ₂HPLC analyzes; B, the PHM reaction back HPLC of D-Tyr-Val-Gly and inactivation analyzes; C, D-Tyr-Val-Gly and active PHM reaction back HPLC analyze; D, standard α-N-acetyl-Tyr-Val-Gly and α-N-acetyl-Tyr-Val-NH ₂HPLC analyzes; E, the PHM reaction back HPLC of α-N-acetyl-Tyr-Val-Gly and inactivation analyzes; F, α-N-acetyl-Tyr-Val-Gly and active PHM reaction back HPLC analyze.

The mass spectroscopy of Figure 10 .D-Tyr-Val-Gly (A) and α-N-acetyl-Tyr-Val-Gly (B) product after the reorganization amidating enzyme is modified.

The present invention is further elaborated by following examples, but does not limit the scope of the invention.

The screening and the clone of embodiment 1. P of Rats HM cDNA gene fragments

From the rat brain cdna storehouse (Stratagene company product, #936515) in, by benton-Davis hybridization and PCR method, screening and clone PAM cDNA gene fragment.PAM dna probe (fragment P among Fig. 1) carries out isotopic labeling by random primer labelling test kit (Boehringer Mannheim company product) recommend method.The benton-Davis hybridization method is pressed cDNA storehouse specification sheets recommend method.Through the two-wheeled screening by hybridization, obtain two positive hybridization clones.Through complete sequence determination, their position such as Fig. 1 fragment c and fragment b in full gene.B, c do not cover the PHM whole coding sequence as yet.For obtaining the encoding sequence of fragment b front, the synthetic a pair of primer of design:

Primer 1:5 ' CTGCGAATTCATGGCCGGACG 3 '

Primer 1 ': 5 ' GCTTCCAGTTTCTCCTCCAAC 3 '

Wherein 5 ' end primer 1 has some codons of restriction enzyme EcoRI recognition site and coding PAM N end signal peptide, with PCR method amplification gene fragment.Add 2 μ l λ cDNA storehouses in 20 μ l redistilled waters, put 70 ℃ of water bath heat preservation 5min, put into ice then and cool off.Add 10 μ l10 * PCR damping fluid, 8 μ l2.5mmol/L dNTP, 3 μ l50mmol/L MgCl ₂, two kinds of each 100pmol of primer, Taq archaeal dna polymerase 2.5 units, making final volume is 100 μ l, in the enterprising performing PCR circulation of DNA Thermal Cycle480 amplification instrument.94 ℃ of sex change, 55 ℃ of renaturation, 72 ℃ were extended each 1 minute, after 35 circulations, extended 15min down at 72 ℃, were incubated at last at 4 ℃.Increasing from former storehouse with PCR method, (Fig. 1 fragment a), sequential analysis proves its coding P of Rats AM signal peptide, leading peptide and PHM structural domain N end parts sequence to acquisition～502bp fragment.

The whole encoding sequences that have the rPHM of signal peptide from fragment a, b, the sliceable acquisition of c.Cause does not have proper restriction site to recombinate, and then the design synthetic primer, and adopts PCR recombinant technology of new generation, and fragment is spliced.PCR reorganization splicing strategy is as Fig. 2.Primer 1 as mentioned above.Primer 2 is 5 ' CATGGAAAGGATCCTGCTCTAAT AC3 ', and wherein 3 of corresponding increase base CCT coding Pro make the joining place in rPHM and rPAL coding region make up a BamH1 point of contact.With M13 reverse primer and forward primer, amplification acquisition～640bp fragment F1 from the pBluescript SK+ plasmid that contains fragment b; F1 and the fragment a sequence that overlaps through sex change, annealing, is made a step extension.Use primer 1 and M13 forward primer again, amplify the fragment a of about 1000bp and the splicing product F2 of b.Equally, with M13 reverse primer and primer 2, from cloned sequence c, go out～the fragment F3 of 480bp through pcr amplification.3 ' the end of F2 behind the EcoRI single endonuclease digestion has with F3 that 90bp's is overlapping.With both sex change together, after the annealing, make a step extension.Add primer 1, primer 2 again, the fragment F4 of pcr amplification acquisition～1160bp.F4 proves complete rat preproPHM encoding gene (Fig. 3) through complete sequence analysis.

Embodiment 2. expression of reorganization PHM in insect baculovirus (Baculovirus) system

A. the structure gene fragment F4 of insect baculovirus transfer expression plasmid pBacPHM2 comprises P of Rats AM signal peptide, leading peptide and PHM coding region sequence, by EcoRI and BamHI restriction enzyme site, insert insect baculovirus and shift expression vector pBacPAK8, P of Rats HM gene is under nuclear polyhedrin promotor (ph promoter) control, is built into baculovirus and shifts expression plasmid pBacPHM2 (Fig. 4).

B. express the acquisition of the recombinant virus BacPHM of P of Rats HM gene

Insect baculovirus shifts the Bau36AI enzymolysis linearizing DNA of the autographa californica nuclear polyhedrosis virus BacPAK6 of expression plasmid pBacPHM2 and modification, at liposome-mediated cotransfection sf21 cell down.The cotransfection supernatant infects the go forward side by side line space spot screening of sf21 cell again.What the screening of recombinant virus was adopted is the enzyme activity determination method.After the plaque virus amplification of picking, infect 96 orifice plate cells, and change serum-free insect cell substratum SF-900II and cultivate, it is alive that the absorption substratum carries out the amidation survey after three days.With ¹²⁵The α of I mark-N-acetyl-Tyr-Val-Gly tripeptides is a substrate, detects the amidating enzyme vigor.The iodine mark adopts the IODO-GEN method.In the 40 μ l enzyme activity determination reaction systems, contain 25 μ M substrates, 1～2 μ g intracellular protein sample or 10 μ l substratum, 120mM Na (MES) pH6.0,1 μ M CuSO4, the 1mM xitix, N-ethylomaleimide (N-Ethylmaleimide, NEMI) 0.5mM and 0.25mg/ml catalase.Sample all is incubated 4h with double at 37 ℃.Reaction finishes, and adds 10 μ l 1N NaOH, the ethyl acetate extracting that 0.05% Trimethylamine 99 is saturated.Under alkaline condition, use the ethyl acetate extracting, amidated products α-N-acetyl-Tyr-Val-NH ₂Hydrophobicity is extremely strong, enters organic phase, during the unreacted substrate then is soluble in the aqueous phase.Draw upper organic phase, survey the γ counting, calculate the growing amount of product.The virus that expression activity is high carries out taking turns plaque select again, the final positive monoclonal recombinant virus BacPHM that obtains to express the high vigor of PHM.

C. the expression of P of Rats HM in Spodoptera frugiperda cell sf21

Phase when at first determining the expression of PHM.With the recombinant virus BacPHM of purifying, infect the sf21 cell, and change serum free medium SF-900II and cultivate, the infection supernatant that takes a morsel every day detects amidating enzyme activity in the substratum, after infecting 24h, can detect in the substratum significantly amidating enzyme and live.At the 3rd day, the enzyme work in the substratum reached the highest, and (Fig. 5) subsequently descends again.Expression product carries out SDS-PAGE and Western-blot analysis in the substratum to reaching in the born of the same parents respectively.Behind the virus infected cell 3 days, collect substratum, add equal-volume Laemili sample-loading buffer, preparation extracellular protein sample; Attached cell is suspended in 20mM Na (TES), in pH7.5/10mM N.F,USP MANNITOL/1%TritonX-100 solution, and freeze thawing in the liquid nitrogen, centrifugal back supernatant prepares cell intracellular protein sample.The Western-blot analytical results shows (Fig. 6), and the band obvious and reaction of PHM antiserum(antisera) is all arranged in the cell born of the same parents and in the substratum supernatant, and the molecular weight of demonstration is about 41kD, and the N end of expression product has removed signal peptide.

Measure the amidation activity that reaches expression product in the substratum supernatant in the born of the same parents respectively, measuring method for activity is the same.Enzyme liquid with ¹²⁵Behind the I-Ac-Tyr-Val-Gly substrate insulation 4h, add NaOH, make reaction intermediate be converted into amidated products, the γ counting of ethyl acetate extracting phase shows (Fig. 7), reach the PHM that expresses in the substratum in the born of the same parents tangible amidation vigor is all arranged, and secrete enzyme work in substratum far above in the born of the same parents, and control group infects the cell of BacPAK6 (virus that does not contain the PHM gene), all do not detect the amidating enzyme activity in the born of the same parents and in the substratum supernatant.

Embodiment 3. recombinant expressed amidating enzymes carry out the detection of amidation processing modification and product thereof to peptidylglycine

Concentrated 10 times the serum free medium that contains PHM 10 μ l add NaOH to final concentration 0.2M after being incubated 4h with 8nmol α-N-acetyl-Tyr-Val-Gly or D-Tyr-Val-Gly respectively, and 1min internal reaction intermediate product can transfer amidated products fully to.15, the centrifugal 10min of 000rpm, reaction solution all go up the HPLC post (KONTRON high pressure binary gradient HPLC system-DAD type, post are RP18 Spheri-5, ABI, 4.6 * 100mm).HPLC A liquid is 1mM NH ₄HCO ₃, pH9.0, B liquid are acetonitrile, 280nm detects.Acetonitrile is eluted to 50% continuously by 0% in 8min.(100 ℃, PHM reaction product 15min) in contrast with heated and inactivated.

HPLC result shows (Fig. 9), and the PHM of expression does not observe the accumulation of intermediate product in the processing to all energy amidations of two kinds of peptidylglycines.Collect the product peak, further use ESI mass spectroscopy (Figure 10).The molecular weight of theoretical calculate α-N-acetyl-Tyr-Val-Gly and D-Tyr-Val-Gly is respectively 380 and 338, and N-acetyl-Tyr-Val-NH ₂And D-Tyr-Val-NH ₂Molecular weight be respectively 322 and 281.Mass spectrometry results shows, D-Tyr-Val-Gly (Figure 10 A) and N-acetyl-Tyr-Val-Gly (Figure 10 B) measure through amidating enzyme modified outcome and all conform to theoretical calculate ( ^*Shown in number).

Claims (6)

1. the oxydase of a rat amidating enzyme (PHM) expression of gene product is that the clone of the oxidase gene by the rat amidating enzyme and expressing obtains, and it is characterized in that it being that the expression of oxidase gene in insect cell by the rat amidating enzyme obtains.

2. P of Rats HM expression of gene product as claimed in claim 1 is characterized in that the DNA Nucleotide and the amino acid sequence corresponding of described P of Rats HM gene is as follows:

10CTGCGAATTC

20 30 40 50 60 70ATG?GCC?GGA?CGC?GCC?CGC?AGC?GGT?CTG?CTA?CTG?CTG?CTG?CTG?GGG?CTG?CTC?GCC?CTG?CAGMET?Ala?Gly?Arg?Ala?Arg?Ser?Gly?Leu?Leu?Leu?Leu?Leu?Leu?Gly?Leu?Leu?Ala?Leu?Gln

80 90 100 110 120 130AGC?AGC?TGC?CTG?GCC?TTC?AGA?AGC?CCA?CTT?TCT?GTC?TTT?AAG?AGG?TTT?AAA?GAA?ACT?ACCSer?Ser?Cys?Leu?Ala?Phe?Arg?Ser?Pro?Leu?Ser?Val?Phe?Lys?Arg?Phe?Lys?Glu?Thr?Thr

140 150 160 170 180 190AGA?TCA?TTT?TCC?AAT?GAA?TGC?CTT?GGT?ACC?ATT?GGA?CCA?GTC?ACC?CCT?CTT?GAT?GCA?TCAArg?Ser?Phe?Ser?Asn?Glu?Cys?Leu?Gly?Thr?Ile?Gly?Pro?Val?Thr?Pro?Leu?Asp?Ala?Ser

200 210 220 230 240 250GAT?TTT?GCG?CTG?GAT?ATT?CGC?ATG?CCT?GGG?GTT?ACA?CCT?AAA?GAG?TCT?GAC?ACA?TAC?TTCAsp?Phe?Ala?Leu?Asp?Ile?Arg?MET?Pro?Gly?Val?Thr?Pro?Lys?Glu?Ser?Asp?Thr?Tyr?Phe

260 270 280 290 300 310TGC?ATG?TCC?ATG?CGT?CTG?CCT?GTG?GAT?GAG?GAA?GCC?TTC?GTG?ATT?GAC?TTC?AAG?CCT?CGTCys?MET?Ser?MET?Arg?Leu?Pro?Val?Asp?Glu?Glu?Ala?Phe?Val?Ile?Asp?Phe?Lys?Pro?Arg

320 330 340 350 360 370GCC?AGC?ATG?GAT?ACT?GTC?CAC?CAT?ATG?CTG?CTG?TTT?GGA?TGC?AAT?ATG?CCC?TCG?TCC?ACTAla?Ser?MET?Asp?Thr?Val?His?His?MET?Leu?Leu?Phe?Gly?Cys?Asn?MET?Pro?Ser?Ser?Thr

380 390 400 410 420 430GGA?AGT?TAC?TGG?TTT?TGT?GAT?GAA?GGA?ACC?TGT?ACA?GAT?AAA?GCC?AAT?ATT?CTA?TAT?GCCGly?Ser?Tyr?Trp?Phe?Cys?Asp?Glu?Gly?Thr?Cys?Thr?Asp?Lys?Ala?Asn?Ile?Leu?Tyr?Ala

440 450 460 470 480 490TGG?GCA?AGG?AAT?GCT?CCC?CCC?ACC?CGG?CTC?CCG?AAA?GGT?GTT?GGA?TTC?AGA?GTT?GGA?GGATrp?Ala?Arg?Asn?Ala?Pro?Pro?Thr?Arg?Leu?Pro?Lys?Gly?Val?Gly?Phe?Arg?Val?Gly?Gly

500 510 520 530 540 550GAA?ACT?GGA?AGC?AAA?TAC?TTC?GTC?CTT?CAA?GTT?CAC?TAT?GGC?GAT?ATC?AGT?GCT?TTT?CGAGlu?Thr?Gly?Ser?Lys?Tyr?Phe?Val?Leu?Gln?Val?His?Tyr?Gly?Asp?Ile?Ser?Ala?Phe?Arg

(follow-up)

560 570 580 590 600 610GAT?AAT?CAC?AAA?GAC?TGC?TCT?GGC?GTG?TCC?GTA?CAT?CTC?ACA?CGT?GTG?CCC?CAG?CCT?TTAAsp?Asn?His?Lys?Asp?Cys?Ser?Gly?Val?Ser?Val?His?Leu?Thr?Arg?Val?Pro?Gln?Pro?Leu

620 630 640 650 660 670ATT?GCG?GGC?ATG?TAC?CTT?ATG?ATG?TCT?GTT?GAC?ACT?GTC?ATA?CCA?CCA?GGA?GAG?AAA?GTAIle?Ala?Gly?MET?Tyr?Leu?MET?MET?Ser?Val?Asp?Thr?Val?Ile?Pro?Pro?Gly?Glu?Lys?Val

680 690 700 710 720 730GTG?AAT?GCT?GAC?ATT?TCG?TGC?CAA?TAC?AAA?ATG?TAT?CCA?ATG?CAT?GTG?TTT?GCC?TAC?AGAVal?Asn?Ala?Asp?Ile?Ser?Cys?Gln?Tyr?Lys?MET?Tyr?Pro?MET?His?Val?Phe?Ala?Tyr?Arg

740 750 760 770 780 790GTC?CAC?ACT?CAC?CAT?TTA?GGT?AAG?GTG?GTG?AGC?GGA?TAC?AGA?GTA?AGA?AAC?GGA?CAG?TGGVal?His?Thr?His?His?Leu?Gly?Lys?Val?Val?Ser?Gly?Tyr?Arg?Val?Arg?Asn?Gly?Gln?Trp

800 810 820 830 840 850ACA?CTG?ATT?GGA?CGC?CAG?AAC?CCC?CAG?CTG?CCA?CAG?GCT?TTC?TAC?CCT?GTG?GAA?CAC?CCCThr?Leu?Ile?Gly?Arg?Gln?Asn?Pro?Gln?Leu?Pro?Gln?Ala?Phe?Tyr?Pro?Val?Glu?His?Pro

860 870 880 890 900 910GTT?GAT?GTT?ACT?TTT?GGT?GAT?ATA?CTG?GCA?GCC?AGA?TGT?GTG?TTC?ACT?GGT?GAA?GGG?AGGVal?Asp?Val?Thr?Phe?Gly?Asp?Ile?Leu?Ala?Ala?Arg?Cys?Val?Phe?Thr?Gly?Glu?Gly?Arg

920 930 940 950 960 970ACA?GAG?GCC?ACC?CAT?ATC?GGC?GGC?ACT?TCT?AGT?GAC?GAA?ATG?TGT?AAC?CTG?TAC?ATC?ATGThr?Glu?Ala?Thr?His?Ile?Gly?Gly?Thr?Ser?Ser?Asp?Glu?MET?Cys?Asn?Leu?Tyr?Ile?MET

980 990 1000 1010 1020 1030TAT?TAC?ATG?GAA?GCC?AAA?TAT?GCA?CTT?TCC?TTC?ATG?ACC?TGT?ACA?AAG?AAC?GTG?GCT?CCATyr?Tyr?MET?Glu?Ala?Lys?Tyr?Ala?Leu?Ser?Phe?MET?Thr?Cys?Thr?Lys?Asn?Val?Ala?Pro

1040 1050 1060 1070 1080 1090GAT?ATG?TTC?AGA?ACT?ATC?CCA?GCA?GAG?GCC?AAT?ATC?CCA?ATT?CCT?GTC?AAA?CCG?GAC?ATGAsp?MET?Phe?Arg?Thr?Ile?Pro?Ala?Glu?Ala?Asn?Ile?Pro?Ile?Pro?Val?Lys?Pro?Asp?MET

1100 1110 1120 1130 1140 1150GTT?ATG?ATG?CAC?GGG?CAT?CAC?AAA?GAA?GCA?GAA?AAC?AAA?GAA?AAG?AGT?GCT?TTA?ATG?CAGVal?MET?MET?His?Gly?His?His?Lys?Glu?Ala?Glu?Asn?Lys?Glu?Lys?Ser?Ala?Leu?MET?Gln

1160 1170 1180 1190CAG?CCA?AAA?CAG?GGA?GAG?GAA?GAA?GTA?TTA?GAG?CAG?GAT?CCT?TTC?CAT?GGln?Pro?Lys?Gln?Gly?Glu?Glu?Glu?Val?Leu?Glu?Gln?Asp?Pro

3. P of Rats HM expression of gene product as claimed in claim 1, the structure that it is characterized in that described P of Rats HM expression plasmid are to be built into insect baculovirus transfer expression plasmid pBacPHM2 by P of Rats HM gene being inserted insect baculovirus transfer expression vector pBacPAK8.

4. P of Rats HM expression of gene product as claimed in claim 1, it is characterized in that the expression of described P of Rats HM, be to shift the recombinant virus BacPHM that the autographa californica nuclear polyhedrosis virus BacPAK6 linearizing DNA cotransfection Spodoptera frugiperda cell sf21 of expression plasmid pBacPHM2 and modification obtains, infect the sf21 cell again and express by insect baculovirus.

5. P of Rats HM expression of gene product as claimed in claim 1, what it is characterized in that described expression obtains is activity expression product single function amidating enzyme of recombinating.

6. P of Rats HM expression of gene product as claimed in claim 1, it is characterized in that it can directly apply to carries out amidation to peptidylglycine and modifies processing.

Images