CN117265105A

CN117265105A - Primer composition and application thereof

Info

Publication number: CN117265105A
Application number: CN202210665451.1A
Authority: CN
Inventors: 吴鸿菲; 张奉武; 朱苗骏; 王海龙; 谭若颖
Original assignee: BIOVUE TECHNOLOGY Ltd
Current assignee: BIOVUE TECHNOLOGY Ltd
Priority date: 2022-06-13
Filing date: 2022-06-13
Publication date: 2023-12-22

Abstract

The application discloses a primer composition and application thereof, wherein the primer composition comprises a reverse transcription primer, a forward primer, a reverse primer and a probe of at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96. The primer composition can be used for detecting the expression level of 7 miRNAs. The primer composition for determining the expression level of the 7 miRNAs has the advantages of high sensitivity, specificity and accuracy, and is simple and convenient to operate and quick. Further, by the expression levels of the 7 miRNAs, whether the patient has urothelial cell carcinoma is evaluated, and thus the diagnosis of urothelial cell carcinoma can be performed.

Description

Primer composition and application thereof

Technical Field

The application belongs to the technical field of biological detection, and particularly relates to a primer composition and application thereof.

Background

Urothelial cell carcinoma is a malignancy that originates in the urothelium. The urinary system includes the renal pelvis, ureter, bladder, urethra, and epithelial tumors that occur in different parts of the urinary tract share the common nature and may occur in multiple organs at these parts, most commonly bladder cancer. Global incidence is at 11 th of all malignant tumors, wherein the incidence of men is 9.0/10 ten thousand, and the incidence of men is at 7 th of malignant tumors; women are 2.2/10 ten thousand, and ten women are listed after the female; mortality is the thirteenth for all tumors. The occurrence rate of urothelial cell cancer is different in regions, race and sex, and can be seen in all ages, the high occurrence age is 50-70 years, and the occurrence rate is gradually increased with the increase of the ages.

The diagnosis of bladder cancer is based on patient history, symptoms and signs, and is clinically diagnosed by combining laboratory examination, imaging examination, urine cytology and urine tumor marker examination and cystoscopy. Cystoscopy is the most important examination, and pathological examination under cystoscopy is the gold standard for diagnosing bladder cancer, combined with imaging examination of the upper urinary tract to see if renal pelvis and/or ureter tumors are combined. Urine-related assays include urine shed cytology and urine tumor marker detection.

Because cystoscope invasiveness is big, brings great pains for bladder cancer patients, and has no ideal detection means for urothelial cell tumor with disease position in upper urinary tract. MicroRNAs (miRNA) is a newly discovered class of non-coding RNA that modulates transcription and stability of one or more target mRNAs by sequence-specific binding to the 3 'non-coding region (3's UTR) of the mRNA to which it is complementary and antisense. mirnas play an extremely important role in numerous biological activities such as growth, division, differentiation, development, apoptosis, and disease occurrence.

Therefore, it is necessary to develop a diagnostic kit (especially a miRNA diagnostic kit) for detecting and screening urothelial cell cancer, especially early urothelial cell cancer, guiding the treatment and medication of urothelial cell cancer, and prognosis evaluation, which has important medical significance and application prospect.

Disclosure of Invention

The application aims at providing a primer composition for detecting miRNA expression level in urine and application thereof.

The application provides the following technical scheme for solving the technical problems:

in a first aspect, the present application provides a primer composition comprising a reverse transcription primer, a forward primer, a reverse primer and a probe of a fluorescent quantitative PCR of at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96.

In a second aspect, the present application provides a kit comprising the primer composition provided in the first aspect of the present application.

A third aspect of the present application provides the use of a primer composition of the first aspect of the present application or a kit of the second aspect of the present application to determine the expression level of a miRNA in a test urine sample; wherein the miRNA comprises at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96.

In a fourth aspect, the present application provides a method for determining the expression level of a miRNA in a test urine sample using a primer composition according to the first aspect of the present application or a kit according to the second aspect of the present application, comprising the steps of:

a) Obtaining a urine sample to be tested of the individual to be tested;

b) Extracting RNA of the urine sample to be detected;

c) Reverse transcribing the RNA using at least one of the primers shown in SEQ ID NOS.1-7;

d) Performing real-time quantitative PCR on the reverse transcription product of the step c) by adopting other primer pairs of the primer combination of the primers used in the step c), and determining the expression level of miRNA in the urine sample to be detected;

wherein the miRNA comprises at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96.

In a fifth aspect the present application provides the use of a primer composition according to the first aspect of the present application or a kit according to the second aspect of the present application for the preparation of a diagnostic reagent for urothelial cell cancer.

In a sixth aspect the present application provides the use of a primer composition according to the first aspect of the present application or a kit according to the second aspect of the present application for diagnosing urothelial cell carcinoma.

A seventh aspect of the present application provides a method of diagnosing urothelial cell carcinoma using the primer composition of the first aspect of the present application or the kit of the second aspect of the present application.

The present application provides a primer composition prepared by combining 7 kinds of micro ribonucleic acids (micro RNAs, micrornas or mirnas): hsa-miR-133a, hsa-miR-141, hsa-miR-143, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429, hsa-miR-96 and optionally an internal standard microribonucleic acid (hsa-miR-99 a) are subjected to reverse transcription reaction, a universal tail is added to the 3' end, and then fluorescent quantitative PCR amplification is carried out on reverse transcription products of 7 or 8 miRNAs by using specific forward primers, specific probes and universal reverse primers, so that the expression level of 7 miRNAs is detected. The primer composition for determining the expression level of the 7 miRNAs has the advantages of high sensitivity, specificity and accuracy, and is simple and convenient to operate and quick.

Further, by the expression levels of the 7 miRNAs, whether the patient has urothelial cell carcinoma is evaluated, and thus the diagnosis of urothelial cell carcinoma can be performed.

Drawings

FIG. 1 is a graph showing the fluorescent quantitative PCR detection and amplification of 7 miRNAs.

Detailed Description

The terms and descriptions used herein are merely for the purpose of describing particular embodiments and are not intended to limit the application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular.

Definition of the definition

As used herein, the terms "a" and "an" and "the" and similar referents refer to the singular and the plural, unless the context clearly dictates otherwise.

As used herein, the terms "about" and "similar to" refer to an acceptable error range for a particular value as determined by one of ordinary skill in the art, which may depend in part on the manner in which the value is measured or determined, or on the limitations of the measurement system.

The first aspect of the present application provides a primer composition comprising 7 target mirnas: reverse transcription primer, forward primer, reverse primer and probe of fluorescence quantitative PCR of at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96.

The inventor finds that the 7 miRNAs are closely related to urothelial cell cancers in research, for example, hsa-miR-133a is specifically combined with EGFR, FSCN1, GSTP1, TAGLN2 and the like to participate in the processes of cell proliferation, infiltration transfer and the like. hsa-miR-141 and E2F3, BRD3, PTEN and the like are combined specifically to promote proliferation of urothelial cancer cells, so that the kit has potential of becoming a molecular marker for predicting invasive urothelial cancer. hsa-miR-143# is combined with a target gene RICTOR and participates in mTOR-STAT3/microRNA143 pathway regulation of cell growth, and research shows that the miRNA is greatly down-regulated in urothelial cell cancer tissues and is considered as an inhibiting gene of the urothelial cell cancer. hsa-miR-151-5p was found to be overexpressed in some PARP1 up-regulated tumors. hsa-miR-29c regulates urothelial cancer cell growth and invasion by targeting CDK 6. has-miR-29c is associated with certain high-risk characteristics of urothelial cell carcinoma. Overexpression of hsa-miR-429 results in down-regulation of CDKN2B so as to promote cell growth and reduce apoptosis, and the higher the expression level of hsa-miR-429 is, the higher the tumor grading and staging is. hsa-miR-96 has high expression level in human bladder urothelial cell carcinoma, and the miRNA up-regulates MAP4K1 and IRS1, so that the miRNA is a valuable urothelial cell carcinoma diagnosis marker.

The total RNA of urine of a subject is extracted, one, a plurality of or all of 7 reverse transcription primers are used for carrying out reverse transcription on the total RNA, and forward primers, reverse primers and probes of corresponding fluorescent quantitative PCR (qPCR) are further used for carrying out fluorescent quantitative PCR (qPCR), so that the expression level of the miRNA is obtained, and the miRNA can be used for evaluating the risk of the urinary tract epithelial cell cancer.

In some embodiments, the primer composition comprises at least one of the following primer combinations 1 to 7;

wherein the primer combination 1 comprises primers shown in SEQ ID NO.1, SEQ ID NO.8, SEQ ID NO.15 and SEQ ID NO. 22;

the primer combination 2 comprises primers shown as SEQ ID NO.2, SEQ ID NO.9, SEQ ID NO.16 and SEQ ID NO. 22;

the primer combination 3 comprises primers shown as SEQ ID NO.3, SEQ ID NO.10, SEQ ID NO.17 and SEQ ID NO. 22;

the primer combination 4 comprises primers shown as SEQ ID NO.4, SEQ ID NO.11, SEQ ID NO.18 and SEQ ID NO. 22;

the primer combination 5 comprises primers shown as SEQ ID NO.5, SEQ ID NO.12, SEQ ID NO.19 and SEQ ID NO. 22;

the primer combination 6 comprises primers shown as SEQ ID NO.6, SEQ ID NO.13, SEQ ID NO.20 and SEQ ID NO. 22;

The primer combination 7 comprises primers shown as SEQ ID NO.7, SEQ ID NO.14, SEQ ID NO.21 and SEQ ID NO. 22.

Wherein, the primer combination 1 comprises a reverse transcription primer (SEQ ID NO. 1), a forward primer (SEQ ID NO. 8), a probe (SEQ ID NO. 15) and a reverse primer (SEQ ID NO. 22) of hsa-miR-133 a;

primer set 2 comprises reverse transcription primer of hsa-miR-141 (SEQ ID NO. 2), forward primer of fluorescent quantitative PCR (SEQ ID NO. 9), probe (SEQ ID NO. 16) and reverse primer (SEQ ID NO. 22);

primer set 3 comprises a reverse transcription primer of hsa-miR-143# (SEQ ID NO. 2), a forward primer of fluorescent quantitative PCR (SEQ ID NO. 9), a probe (SEQ ID NO. 16) and a reverse primer (SEQ ID NO. 22);

primer set 4 comprises a reverse transcription primer (SEQ ID NO. 3), a forward primer (SEQ ID NO. 10), a probe (SEQ ID NO. 17) and a reverse primer (SEQ ID NO. 22) of hsa-miR-151-5 p;

primer set 5 comprises a reverse transcription primer (SEQ ID NO. 4), a forward primer (SEQ ID NO. 11), a probe (SEQ ID NO. 18) and a reverse primer (SEQ ID NO. 22) of hsa-miR-29 c;

primer set 6 comprises a reverse transcription primer of hsa-miR-429 (SEQ ID NO. 5), a forward primer of fluorescent quantitative PCR (SEQ ID NO. 12), a probe (SEQ ID NO. 19) and a reverse primer (SEQ ID NO. 22);

Primer set 7 comprises reverse transcription primer of hsa-miR-96 (SEQ ID NO. 6), forward primer of fluorescent quantitative PCR (SEQ ID NO. 13), probe (SEQ ID NO. 20) and reverse primer (SEQ ID NO. 22);

wherein the reverse primer used is a universal reverse primer.

Preferably, the primer composition further comprises a primer combination 8, the primer combination 8 comprising a reverse transcription primer (SEQ ID NO. 23), a forward primer (SEQ ID NO. 24) of fluorescent quantitative PCR, a probe (SEQ ID NO. 25) and a reverse primer (SEQ ID NO. 22) of an endogenous control (internal standard) miRNAhsa-miR-99 a.

The inventor finds that the expression level of hsa-miR-99a in healthy people or urine with urothelial cell carcinoma is almost the same, so that the hsa-miR-99a can be used for correcting the expression level of target miRNA.

Wherein, the reverse transcription primer, the forward primer of the fluorescence quantitative PCR (also simply called as forward primer in the application), the probe and the reverse primer in each group of primer combination are matched for use, and are used for reverse transcription and fluorescence quantitative PCR (RT-qPCR) of one target miRNA; after extracting total RNA from urine by a conventional method, carrying out reverse transcription by using reverse transcription primers shown in SEQ ID NO.1 to SEQ ID NO.7 and SEQ ID NO.23 to obtain cDNA of the target miRNA; the forward primer, the probe and the reverse primer are used for carrying out fluorescent quantitative PCR of target miRNA by taking cDNA of the miRNA as a template; wherein, the probe is connected with a reporting fluorescent group, such as FAM and VIC groups, which are conventional in the art, the application is not limited herein, the probe sequence provided in the application is only a nucleotide sequence, and the reporting fluorescent group is connected with the probe sequence under the condition that no special description exists, and the selection and connection mode of the fluorescent group are conventional in the art. The inventor finds that the primer composition has very high specificity to the target miRNA, has almost no cross reaction with other miRNAs in the same family with the target miRNA, and can be used for specific detection of the target miRNA; in addition, various primers of 7 target miRNAs and internal standard miRNAs have little cross reaction with other target miRNAs, so that the primer composition can be independently used for measuring the expression level of each target miRNA, and can also be used in a mixed mode, namely, reverse transcription primers shown in SEQ ID No.1 to SEQ ID No.7 and SEQ ID No.23 can be independently used for reverse transcription of each target miRNA, and can also be mixed for reverse transcription of a plurality of or all target miRNAs; the forward primers shown in SEQ ID No.8 to SEQ ID No.14 and SEQ ID No.24, the probes shown in SEQ ID No.15 to SEQ ID No.21 and SEQ ID No.25 and the reverse primer shown in SEQ ID No.22 can be used independently for qPCR of each target miRNA in a matched manner, and can also be mixed for qPCR of a plurality of or all target miRNAs. The primer composition for detecting the target miRNA in urine is simple and convenient to operate and high in accuracy.

In some embodiments, the primer composition comprises primer combinations 1 to 8;

the primer combination 7 comprises primers shown as SEQ ID NO.7, SEQ ID NO.14, SEQ ID NO.21 and SEQ ID NO. 22;

the primer combination 8 comprises primers shown as SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25 and SEQ ID NO. 22.

The inventor finds that the expression level of 7 target miRNAs is measured simultaneously in the research, and the hsa-miR-99a is used as an internal standard for correction, so that the obtained miRNA expression level result is more accurate, and the method is further used for diagnosing urothelial cell carcinoma and has higher accuracy.

In the kit of the application, the primers included in the same primer combination can be packaged independently, or reverse transcription primers can be packaged independently according to functions, and forward primers, reverse primers and probes can be collectively called qPCR primers, and can be packaged in a mixed manner; in different primer combinations, primers (reverse transcription primers or qPCR primers) having the same function may be packaged separately or in a mixed package.

In some embodiments, the kit further comprises a reaction buffer for real-time quantitative PCR, dNTPs, and a DNA polymerase.

dNTPs in this application refer to a mixture of four deoxynucleotides, and DNA polymerase for real-time quantitative PCR is a routine choice in the art for achieving qPCR, for example, taq enzyme, etc. can be selected, and the application is not limited herein; the reaction buffer for real-time quantitative PCR in the application can adopt a reaction buffer for real-time quantitative PCR which is conventional in the art, and the components of the reaction buffer can comprise Tris-HCl, magnesium chloride and nuclease water as main components and can also comprise a preservative; in some embodiments, the dNTPs may be mixed with a reaction buffer.

In some embodiments, the kit further comprises a reaction buffer for reverse transcription, dNTPs, and a reverse transcriptase.

As the reverse transcriptase, there can be used a reverse transcriptase conventional in the art, such as MLV reverse transcriptase, thermostable reverse transcriptase, etc., and the present application is not limited thereto. The reaction buffer used for reverse transcription may be a reverse transcription reaction buffer conventional in the art, and its main component may include potassium chloride, tris-HCl, DTT, magnesium chloride, etc., and in some embodiments dNTPs may be mixed with the reaction buffer.

In some embodiments, an RNase inhibitor (RNase inhibitor), which is a conventional agent in reverse transcription processes, is also included, as the application is not limited herein.

In some embodiments, the kit further comprises a positive quality control, a simulated positive mixed solution of 7 target mirnas and internal standard mirnas as a main component, and/or a negative quality control, a simulated negative mixed solution of 7 target mirnas and internal standard mirnas as a main component. The simulated positive mixed solution is that the miRNA content in the mixed solution simulates the expression level of 8 miRNAs in urine of a patient with positive urothelial cell carcinoma; the simulated negative mixed solution means that the miRNA content in the mixed solution simulates the symptoms of a patient with urothelial cell cancer, such as bladder occupation, kidney occupation and the like, and urine abscission cells check the expression level of 8 miRNAs in urine of a healthy person without urothelial abnormal cells. Preferably, in the positive quality control, the score value calculated by the score value calculation formula of the present application is greater than or equal to 0.51; in the negative quality control product, the score value calculated by the score value calculation formula of the application is less than 0.51.

In some embodiments, the positive quality control comprises 0.125pM hsa-miR-133a,211.318pM hsa-miR-141,0.145pM hsa-miR-143#,14.698pM hsa-miR-151-5p,727.720pM hsa-miR-29c,106.310pM hsa-miR-429,207.426pM hsa-miR-96 and 1.382pM hsa-miR-99a miRNA. In some embodiments, the negative quality control comprises 0.560pM hsa-miR-133a,65.531pM hsa-miR-141,0.260pM hsa-miR-143#,8.592pM hsa-miR-151-5p,234.759pM hsa-miR-29c,109.416pM hsa-miR-429,95.897pM hsa-miR-96 and 16.592pM hsa-miR-99a miRNA.

The positive quality control product and the negative quality control product can be used for providing positive control and negative control for the accuracy of the detection result of the kit, and other positive/negative quality control products can be adopted by the person skilled in the art to achieve the purpose, and the application is not limited herein.

In some embodiments, the kit further comprises de-RNase water; the RNase-free water may also be referred to as RNase-free water, nuclease-free water or nuclease-free water, and refers to water from which the nuclease is removed after treatment, which is a conventional reagent in the art, and is not limited herein, in some embodiments, the RNase-free water in the kit of the present application may be used as a template-free control (NTC), i.e. the RNase-free water is used to replace a "template", and other reaction components are the same as those in the detection group, and the Ct value detected in the template-free control is required to be greater than 35.

In some embodiments, the kit comprises a detection instruction, and a calculation formula for a urothelial cell cancer correlation evaluation value (Score value).

A third aspect of the present application provides the use of a primer composition of the first aspect of the present application or a kit of the second aspect of the present application to determine the expression level of a miRNA in a test urine sample; wherein the miRNA comprises at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96; preferably, the miRNA comprises hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96; preferably, the miRNA expression level is corrected by an endogenous control; preferably, the endogenous control is hsa-miR-99a.

a) Obtaining a urine sample to be tested of the individual to be tested;

b) Extracting RNA of the urine sample to be detected;

In the application, the urine sample to be detected can be morning urine or any urine, and the inventor discovers that the primer composition or the kit for detecting the miRNA expression level in the urine sample to be detected has high specificity, accuracy and sensitivity no matter the urine sample to be detected is morning urine or any urine.

The method for extracting the RNA of the urine sample to be detected is not limited, and the inventor discovers that the primer composition has similar sensitivity and accuracy in the miRNA expression level by carrying out RT-qPCR on the RNA of the urine sample to be detected extracted by adopting different methods, such as a magnetic bead method, a column passing method, a Trizol method and the like.

In the step c), reverse transcription can be carried out on the RNA sample by adopting reverse transcription primers shown in SEQ ID NO.1-7 to obtain cDNA of 7 miRNAs respectively, or the mixture of the cDNA of 7 miRNAs can be obtained by mixing the reverse transcription primers shown in SEQ ID NO.1-7 and then carrying out reverse transcription on the RNA sample.

In the step d), qPCR can be performed on a single target miRNA by adopting qPCR primers of different target miRNAs respectively, or qPCR can be performed on a plurality of target miRNAs after mixing qPCR primers of different target miRNAs, so that the expression levels of the plurality of miRNAs are obtained simultaneously. Because qPCR is performed on a plurality of target miRNAs at the same time, a plurality of different reporting fluorescence needs to be connected to the probe, in order to reduce interference between the reporting fluorescence and improve accuracy of results, qPCR is preferably performed on a single target miRNA by adopting qPCR primers of different target miRNAs, and expression levels of the target miRNAs are respectively obtained.

In some embodiments, the final concentration of reverse transcription primers in step c) is each independently 10 to 50nM, preferably 25nM;

in some embodiments, the final concentration of dntps in the reverse transcription system of step c) is 0.125 to 0.5mM, preferably 0.25mM;

in some embodiments, the final concentration of reverse transcriptase in the reverse transcription system of step c) is 1 to 5U/. Mu.L, preferably 3.4U/. Mu.L;

in some embodiments, the reverse transcription conditions of step c) include: slow reaction: 11-13 ℃ for 28-32 minutes; 40-45 ℃ for 28-32 minutes; 94-96 deg.c for 4-6 min; keeping at 4 ℃; or a rapid reaction: 11-13 ℃ for 4-6 minutes; 37-50 ℃ for 8-12 minutes, preferably 42 ℃; 94-96 deg.c for 4-6 min and 4 deg.c; preferably, the reaction is slow: 12 ℃ for 30 minutes, 42 ℃ for 30 minutes, 95 ℃ for 5 minutes, and 4 ℃ for holding; or a rapid reaction: 12 ℃ for 5 minutes, 42 ℃ for 10 minutes, 95 ℃ for 5 minutes, and 4 ℃ for holding;

In some embodiments, in the real-time quantitative PCR of step d), the final concentration of forward primer is each independently 0.9-1.8 μm; preferably 1.5. Mu.M;

in some embodiments, in the real-time quantitative PCR of step d), the final concentration of probes is each independently 0.2-0.5 μm; preferably 0.3. Mu.M;

in some embodiments, the final concentration of reverse primer in the real-time quantitative PCR of step d) is 0.5-1.5. Mu.M; preferably 0.7. Mu.M;

in some embodiments, the final concentration of DNA polymerase in the real-time quantitative PCR of step d) is 0.1-0.5U/. Mu.L, preferably 0.25U/. Mu.L;

in some embodiments, the conditions of the real-time quantitative PCR of step d) comprise: the heat activation time is 1-10 minutes, and the annealing temperature is 58-62 ℃, preferably 60 ℃; optionally, a 72℃extension step is also included.

It will be appreciated that the thermal activation temperature of qPCR is mainly dependent on the kind of DNA polymerase used, for example when chemically modified blocked Taq enzyme is used, and the thermal activation time is preferably 10 minutes, and the skilled person can choose the thermal activation time according to the kind of DNA polymerase used, for example according to the description of the DNA polymerase product specification, and the present application is not limited thereto. In addition, unless specifically indicated otherwise, other components of the reverse transcription and qPCR reaction systems and reaction conditions are conventional in the art, and are commercially available or of known composition, amounts and conditions, and are not limited herein.

In some embodiments, the miRNA expression level is corrected by an endogenous control; in some embodiments, the miRNA that serves as an endogenous control may be hsa-miR-99a.

In some embodiments, the step of endogenous control correction comprises:

e) Reversing the RNA by using a primer shown in SEQ ID NO. 23;

f) Carrying out real-time quantitative PCR on the reverse transcription product of the step e) by adopting primers shown in SEQ ID NO.24, SEQ ID NO.25 and SEQ ID NO.22, and determining the expression level of hsa-miR-99a in the urine sample to be detected;

g) And carrying out endogenous control correction on the expression level of miRNA in the urine sample to be tested by using the expression level of hsa-miR-99a.

In some embodiments, when endogenous control (internal standard) corrections are included, the reverse transcription primer of the internal standard miRNA can be mixed with the reverse transcription primer of the target miRNA, while performing reverse transcription of the target miRNA and the internal standard miRNA; in some embodiments, the final concentration of reverse transcription primer of the miRNA of interest is 10-50 nM, preferably 25nM; when an endogenous control is included, the reverse transcription reaction conditions and other components of the reaction system may be the same as when no endogenous control is included.

In some embodiments, qPCR detection of internal standard miRNA hsa-miR-99a can be carried out independently, or qPCR primers of hsa-miR-99a can be mixed with qPCR primers of each target miRNA to carry out double fluorescence quantitative PCR detection, wherein a probe of the target miRNA and a probe of hsa-miR-99a are connected with different reporting fluorophores. The inventors found in the study that the primer composition of the present application was highly specific, sensitive and accurate, both for single qPCR (qPCR for only one miRNA) and for dual or multiplex qPCR detection (qPCR for more than two mirnas).

In some embodiments, the final concentration of the forward primer of the internal standard miRNA is 0.9-1.8 μm; preferably 1.5. Mu.M;

in some embodiments, the final concentration of probes of the internal standard miRNA is each independently 0.2-0.5 μΜ; preferably 0.3. Mu.M;

in some embodiments, the internal standard miRNA qPCR reaction conditions and other components of the reaction system may be the same as qPCR of the target miRNA;

in some embodiments, the method for detecting the expression level of miRNA in a test urine sample comprises the steps of:

a) Obtaining a urine sample to be tested of the individual to be tested;

b) Extracting RNA of the urine sample to be detected;

c) Reverse transcription of the RNA is carried out by using the primers shown in SEQ ID NO. 1-8;

d) Performing fluorescence quantitative PCR on the reverse transcription product by adopting other primers of primer combinations 1-8, and determining the expression level of miRNA in the urine sample to be detected; the expression level of the miRNA is corrected by endogenous control hsa-miR-99 a;

wherein the miRNA comprises hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96.

In some embodiments, the urothelial cell carcinoma may be selected from at least one of low malignant potential urothelial cell carcinoma, low grade urothelial cell carcinoma, high grade urothelial cell carcinoma, non-fractionated urothelial cell carcinoma, in situ urothelial cell carcinoma;

in some embodiments, the urothelial cell cancer may be selected from at least one of bladder cancer, ureter cancer, urethra cancer, renal pelvis cancer;

in some embodiments, the urothelial cell carcinoma may be a urothelial cell-derived urinary tract malignancy or a non-urothelial cell-derived urinary tract malignancy the seventh aspect of the present application provides a method of diagnosing urothelial cell carcinoma using the primer composition of the first aspect of the present application or the kit of the second aspect of the present application, comprising:

1) Determining the miRNA expression level (Ct value) in the urine sample to be tested by adopting the method of the fourth aspect of the application;

2) The urothelial cell cancer correlation evaluation value (Score value) is obtained by a linear fitting formula (abbreviated herein as Score value calculation formula) of the urothelial cell cancer correlation evaluation model:

Score value=1/(1+exp (k1×ct) _(BCMK-miR02) +k2×Ct _(BCMK-miR03) -k3×Ct _(BCMK-miR04) +k4×Ct _(BCMK-miR05) +k5×Ct _(BCMK-miR08) +k6×Ct _(BCMK-miR09) –k7×Ct _(BCMK-miR10) –k8×Ct _(BCMK-miR06) +k); (formula I)

Wherein the value range of k1 is-0.0010; k2 is 0.4929-0.6553; k3 is 0.3072-0.3675; k4 is 0.7136 to 0.9977; k5 is-0.0010 to 0.0010; k6 is-0.0010-0.1116; k7 is-0.0010-0.2395; k8 is 0.8943-1.0668; k is 1.7478-2.8581;

preferably, the method comprises the steps of,

score value=1/(1+exp (0.0001×ct) _(BCMK-miR02) +0.6254×Ct _(BCMK-miR03) -0.3466×Ct _(BCMK-miR04) +0.9502×Ct _(BCMK-miR05) +0.0001×Ct _(BCMK-miR08) +0.0001×Ct _(BCMK-miR09) -0.2058×Ct _(BCMK-miR10) -1.0231×Ct _(BCMK-miR06) + 2.5881) (formula II);

3) Obtaining diagnosis results of urothelial cell cancer according to Score value: when the Score value detected by the sample is more than or equal to 0.51, judging that the sample is positive; otherwise, the result is negative.

In some embodiments, the urine sample comprises a urothelial cell cancer positive urine sample or a urothelial cell cancer negative urine sample; the positive urine sample of the epithelial cell cancer can be a urine sample of the urinary tract epithelial cell cancer before operation, a residual sample of the urinary tract epithelial cell cancer after operation or a recurrent sample of the urinary tract epithelial cell cancer after operation; the urothelial cell cancer negative urine sample can be a healthy human urine sample, a urine sample of benign diseases of the urinary tract system or a urine sample without recurrence after urothelial cell cancer operation.

The primer composition of the present application and its use are described below by way of specific examples. It should be understood that the examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1 primer Synthesis and specificity test

1. Primer set design

The 7 microRNA (hereinafter also referred to as target miRNA) sequences obtained from the http:// www.mirbase.org/database are shown in Table 1.

Table 1:7 microRNA sequences

The application adopts a two-step RT-qPCR method (reverse transcription fluorescence quantitative PCR) to detect miRNA. The reverse transcription step adopts specific reverse transcription, 6-7 bases in the specific reverse transcription primer of the application are specifically paired with target miRNA, and a universal joint is added at the 5' end. The qPCR step uses specific forward primers and probes, plus universal reverse primers for amplification.

(1) Reverse transcription primer design

The reverse transcription primer is roughly divided into 2 regions,

region one: the 3 '-end of the reverse transcription primer is paired with the 3' -end of the target miRNA by about 6-7 bases, the complementary of the reverse transcription primer and the forward primer is not more than 2 bases, and the Tm is not lower than 12 ℃.

Area two: the 5' -end of the reverse transcription primer is 37-40 bases, the Tm is controlled at 45-57 ℃, and the reverse transcription primer is roughly divided into three parts:

11-12 bp each of the 5 'end and the 3' end, and all or partial complementarity can be formed in the primer or the primer

About 15 bp in the middle, no more than 3 bases of complementarity can be formed in the primer or within the primer

The segment of sequence is not complementary with 6-7 bases complementary with miRNA in the first region, and the second region is not crossed with the human gene transcript in comparison. The reverse transcription primer sequences are detailed in Table 2.

Table 2: reverse transcription primer sequences

(2) qPCR primer design

Forward primer

The forward primer is about 15-19 bp in length and is completely complementary with the 5 'end of miRNA, the 3' end of the forward primer is complementary with the 3 'end of the reverse transcription primer by not more than 3 bases and the 3' end of the probe by not more than 3 bases, the Tm is controlled between 55-65 ℃, and the sequence is shown in Table 3.

Table 3: forward primer sequences

ID	miRNA name	FP-ID	Forward primer (5 'to 3')
				BCMK_miR02	hsa-miR-133a	miR02-FP17	gcgcgtaacactgtctggtaaag(SEQ ID NO.8)
BCMK_miR03	hsa-miR-141	miR03-FP18	gcgcgtttggtccccttcaacc(SEQ ID NO.9)
				BCMK_miR04	hsa-miR-143#	miR04-FP19	gcgcgtaacactgtctggtaaag(SEQ ID NO.10)
BCMK_miR05	hsa-miR-151-5p	miR05-FP17	ccgcggtgcagtgctgcatctct(SEQ ID NO.11)
				BCMK_miR08	hsa-miR-29c	miR08-FP18	ccgctcgaggagctcacagtc(SEQ ID NO.12)
BCMK_miR09	hsa-miR-429	miR09-FP17	gcgcgtagcaccatttgaaatcg(SEQ ID NO.13)
				BCMK_miR10	hsa-miR-96	miR10-FP15	accgctttggcactagcaca(SEQ ID NO.14)

Probe with a probe tip

The 3 '-end of the probe sequence is 6-8 bases and complementary to miRNA, the 5' -end is consistent with a part of the reverse transcription primer, and the probe sequence is shown in Table 4.

Table 4: probe sequence

The probe sequences in the table only show the nucleotide sequences of probes, wherein the reporter fluorophore is not shown, and the probe sequence of the probe miR02-PB6 containing the reporter fluorophore can be FAM-ctggatacgaccagctg-MGB, and the connection mode of the reporter fluorophore in the rest probes is the same.

Reverse primer

The reverse primer is completely identical to the second reverse transcription primer, has the sequence of 5'-GCAGGGTCCGAGG-3' and has no cross with human gene transcripts.

Name: urp_sl

Sequence: 5 '. Fwdarw.3': TGCAGGGTCCGAGG (SEQ ID NO. 22)

2. Preparation of miRNA template to be tested

And 7 micro RNA sequences are obtained from an http:// www.mirbase.org/database to synthesize hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96 miRNA templates (manufactured and bioengineered (Shanghai) stock Co., ltd.). After dissolution according to the primer instructions, solutions of 0.5pM were prepared, respectively.

RT-qPCR and primer specific detection

3.1 reverse transcription reaction

The 7 miRNA templates were taken at a concentration of 0.5pM in 4. Mu.L, 7 reverse transcription primers shown in Table 2 were added at a final concentration of 50nM each, respectively, dNTPs at 0.25mM, reverse transcriptase at 3.4U/. Mu.L (Ningbo Shang Ning Biotechnology Co., ltd., MLV reverse transcriptase), RNase inhibitor at 0.25U/. Mu.L, and the total amount of RNase inhibitor was 20. Mu.L using nuclease-free water. After gentle mixing, centrifugation was performed and the reverse transcription procedure was run on an ABI9700 nucleic acid amplification apparatus: 12℃for 5 minutes, 42℃for 10 minutes, 95℃for 5 minutes, 4℃hold. 7 reverse transcription products were obtained.

3.2qPCR detection

Taking 7 reverse transcription products obtained in 3.1, respectively split charging 2. Mu.L into 7 qPCR reaction tubes, adding one forward primer and the corresponding probe shown in Table 3 into each tube, respectively, with the final concentration of 1.5. Mu.M and 0.3. Mu.M, then adding qPCR reaction buffer with the final concentration of 1X, 0.7. Mu.M reverse primer and 0.25U/. Mu.L Taq enzyme into the 7 qPCR reaction tubes, and supplementing 20. Mu.L with nuclease-free water. After gentle mixing, centrifugation was performed and the mixture was placed on an ABI7500 fluorescent quantitative PCR machine to run the program: the temperature was maintained at 95℃for 10 minutes, followed by 15 seconds at 95℃and 40 cycles running at 60℃for 1 minute, fluorescence was collected at 60℃stage, reported as FAM, and calibrated as ROX. The specific reaction and cross reaction Ct values between 7 miRNAs and the template are shown in Table 5, and the reaction Ct values of the primer and the non-specific template are all larger than 37, so that the 7 miRNAs have no cross reaction, and the primer specificity is very good. Fig. 1 shows amplification curves of 7 miRNA primer probe sets for amplifying specific templates, and each of the seven miRNA amplifications exhibited an S-type amplification curve.

Table 5: results of cross-reaction of 7 miRNA primer sets

Example 2 Dual fluorescent quantitative PCR specific detection

1. Endogenous control (internal standard miRNA) selection

In the present application, by detecting the expression of 125 mirnas in 673 urine samples (227 cases of urothelial cancer and 446 cases of non-urothelial cancer), the average value of 125 mirnas is used for homogenization treatment, and comparing the expression difference of two types of samples of urothelial cancer and non-urothelial cancer, preferably, the mirnas with almost no difference in the two types of samples: hsa-miR-99a (BCMK_miR 06) serving as an endogenous control or an internal standard miRNA (after homogenization treatment, the average Ct value of hsa-miR-99a in urothelial cancer is 25.0807, and the average Ct value in non-urothelial cancer is 25.0816)

2. Design of internal standard gene detection primer

The design principle of the internal standard gene primer is the same as that of the target miRNA in the example 1, and the sequence is as follows:

reverse transcription primer

Name: miR06-RTP6

Sequence: 5 '. Fwdarw.3': GTCGTATCCAGTGCAGGGTCCGAGGTCTGGATACGACCACAAG (SEQ ID NO. 23)

qPCR forward primer:

name: miR06-FP16

Sequence: 5 '. Fwdarw.3': CCGCAACCCGTAGATCCGAT (SEQ ID NO. 24)

qPCR probe:

name: miR06-PB7

Sequence: 5 '. Fwdarw.3': vic-CTGGATACGACCACAAGA-MGB (SEQ ID NO. 25)

qPCR reverse primer is a universal primer:

Name: urp_sl

Sequence: 5 '. Fwdarw.3': TGCAGGGTCCGAGG (SEQ ID NO. 22)

3. Preparation of to-be-detected synthetic miRNA template

The internal standard miRNA sequences obtained from the http:// www.mirbase.org/database are shown in table 6, and the miRNA template is synthesized. After dissolution according to the synthesis instructions, solutions of 0.5pM were prepared, respectively.

Table 6: internal standard miRNA sequence

RT-qPCR detection

Adding 4 mu L (7 samples) of target miRNA templates with the concentration of 0.5pM or 4 mu L (7 samples) of internal standard miRNA templates with the concentration of 0.5pM or 1 of the 7 target miRNA templates and the internal standard miRNA templates respectively into a reaction system: 1 were mixed together in a total of 4 μl (7 samples), and RT-qPCR detection was performed using nuclease-free water as a template-free control (NTC), and the reverse transcription reaction system was a mixture of 8 reverse transcription primers, the system components and reverse transcription reaction conditions were the same as those of 3.1 of example 1; the qPCR detection system contains a forward primer corresponding to a target miRNA template with a final concentration of 1.5 mu M, a probe corresponding to a target miRNA with a final concentration of 0.3 mu M (reporting fluorescence is FAM), an internal standard miRNA forward primer with a final concentration of 1.5 mu M and an internal standard miRNA probe with a final concentration of 0.3 mu M (reporting fluorescence is VIC), the rest of reaction components and the reaction procedure are the same as those of 3.2 of example 1, and the qPCR collects FAM and VIC channel fluorescence signals at the stage of 60 ℃. As shown in Table 7-1 and Table 7-2, the detection Ct values showed no crossover between the two reported fluorescence, and the single and double Ct values showed no difference, which indicated that the primer combination of the present application had high specificity.

TABLE 7-1 Single, double fluorescence quantitative PCR detection of Ct values

TABLE 7-2 Single, double fluorescence quantitative PCR detection of Ct values

Example 3 preparation of kit and determination of minimum detection limit

1. Preparation of the kit

According to the property and application of the detection component reagent, the reagent is combined into a plurality of components. The components comprise three major parts:

a first part: reverse transcription reagent

The reverse transcription reagent comprises a reverse transcription reaction solution (5X, 5X MMLV-containing reaction buffer, 1.25mM dNTP,2.5mM MgCl) ₂ The 8 miRNA reverse transcription primers of the present application, each at a concentration of 125 nM), and reverse transcriptase (40X, 150U/. Mu.LMLV reverse transcriptase, 10U/. Mu.L RNase inhibitor).

A second part: qPCR reagent

The qPCR reagent comprises qPCR reaction buffer solution (2X), taq enzyme (5U/. Mu.L), 7 miRNA primer sets (BCM K_miR02 primer set: hsa-miR-133a and hsa-miR-99a, BCM K_miR03 primer set: hsa-miR-141 and hsa-miR-99a, BCM K_MIR04 primer set: hsa-miR-143# and hsa-miR-99a, BCM K_MIR05 primer set: hsa-miR-151-5p and hsa-miR-99a, BCM K_MIR08 primer set: hsa-miR-29c and hsa-miR-99a, BCM K_MIR09 primer set: hsa-miR-429 and hsa-miR-99a, BCM K_MIR10 primer set: hsa-96 and miR-99a, the primer sets are 10X, the forward target primer set: 15 mu M, the forward target primer is 3 mu M, and the reverse target miRNA probe is 3 mu.M, and the forward target miRNA probe is 7 mu.M.

Third section: quality control product

The composition and concentration of the quality control products including the positive quality control product and the negative quality control product are shown in Table 11.

2. Minimum detection limit measurement

2.1 establishment of minimum detection limit

Solution template molecule copy number was determined using digital PCR and configured to give 5 pM/. Mu.L (3X 10) of each miRNA template concentration ⁶ Copy number/. Mu.L, 1700 copies/. Mu.L of urine converted to urine sample) was diluted to 5X 10 with a 10-fold gradient using artificial urine ^-4 pM/. Mu.L (300 copies/. Mu.L, converted to urine sample 0.17 copies/. Mu.L urine) for a total of 5 concentration gradients.

After extracting RNA using 80. Mu.L of each of 5 gradient samples using a nucleic acid extraction or purification kit (magnetic bead method) manufactured by Jiangsu Shuo Biotech Co., ltd., (recording No. Su Taixie: 20210555), 4. Mu.L was used for the reverse transcription reaction, 4. Mu.L of a reverse transcription reaction solution, 0.5. Mu.L of reverse transcriptase, and reverse transcription primers of 8 miRNAs each having a final concentration of 50nM were added to the reaction system, 20. Mu.L was made up with nuclease-free water, and the reverse transcription reaction was performed on ABI9700, and the reaction procedure was the same as that of 3.1 of example 1.

Taking reverse transcription products of the samples with 5 gradients in the previous step, respectively split charging 2 mu L of each of the 7 qPCR reaction tubes, respectively adding 2 mu L of one group of 7 miRNA primer groups in the kit in the embodiment into each tube, then adding 10 mu L of qPCR reaction buffer solution and 1 mu L of Taq enzyme into the 7 qPCR reaction tubes, and supplementing 20 mu L of the buffer solution with water without nuclease. After gentle mixing, centrifugation was performed, and each miRNA in these 5 gradient mixtures was detected on an ABI7500 real-time fluorescent quantitative PCR instrument, and the reaction procedure was the same as 3.2 of example 1. Table 8-1 and Table 8-2 below show the Ct values of the 7 groups of miRNAs, and the concentrations are considered to be detectable when Ct < 35 in combination with the corresponding detection results of real-time fluorescence PCR. The minimum detection limit concentration of the kit (primer composition) of the present application was 3000 copies/. Mu.L (1.7 copies/. Mu.L urine as converted to urine sample).

Table 8-1: the lowest detection limit is established to detect Ct value

Table 8-2: the lowest detection limit is established to detect Ct value

2.2 verification of minimum detection limit

Templates for determining the molecular copy number of the template solution using digital PCR were prepared as a mixture of 3000 copies/. Mu.L (1.7 copies/. Mu.L urine converted to urine sample) of each miRNA, and 20 copies were prepared in total. 80 mu L of nucleic acid is extracted by using a nucleic acid extraction reagent, and then RT-qPCR detection is carried out, wherein the detection method is the same as 2.1 in the embodiment, the detection is repeated for 20 times, and the detection Ct is shown in Table 9 in detail. The number of Ct < 35 in 20 times of detection is not less than 95%.

Table 9: the lowest detection limit verifies and detects the Ct value

Example 4 quality control establishment and verification

Scheme for establishing quality control product

Clinical samples confirmed by clinical gold standards (including urine samples of patients with urothelial cell carcinoma and healthy people) were tested using the kit of example 3 and the reaction conditions of 2.1 in example 3 to obtain Ct values of 8 mirnas (including internal standard) of the present application in each clinical sample as reference basis for the configuration of quality control.

The 8 synthesized miRNAs with the measured concentration are mixed in equal quantity, diluted into 5pM miRNA mixed solution, the mixed solution is subjected to gradient dilution with 10 times as gradient, the miRNA mixed solution with 5 gradients of 0.0005 pM-5 pM is obtained, and the detection is carried out according to the detection flow of the urine miRNA detection kit. A linear equation was obtained for the concentration of these 8 mirnas as a function of Ct.

According to the linear equation, the Ct value measured by the clinical sample is subjected to linear regression, and the concentration of the corresponding miRNA in the clinical sample is calculated.

And according to the calculated miRNA concentration of the clinical sample, diluting the synthesized miRNA to the corresponding concentration according to the calculated measured concentration, and mixing to obtain a quality control product, wherein the sample mixed with the miRNA concentration in the urine sample of the patient with the urothelial cell cancer is used as a positive quality control product, and the sample mixed with the miRNA concentration in the urine sample of the healthy person is used as a negative quality control product.

Quality control article reference sample traceability

a. Positive sample

Patients with initial or recurrent urothelial cancer do not undergo any symptomatic treatment or examination, such as cystoscopy, surgery, chemoradiotherapy or other symptomatic treatment, within three months prior to urine collection. The cystoscope biopsy or pathological examination result after operation is "high-grade urothelial cancer", and can be selected as a strong positive reference standard sample. The patient leaves a urine sample before cystoscope or preoperatively. And detecting the selected positive reference sample by using a kit, wherein the detection model operation Score value is not lower than 0.51.

b. Negative sample

The B ultrasonic diagnosis is adopted to confirm that symptoms such as bladder occupation, kidney occupation and the like are not caused, and urine is collected by healthy people without urothelial abnormal cells in the urine abscission cell examination, and the urine is used as a standard sample of a negative reference. The selected negative reference sample detection model operation Score value is not higher than 0.51.

Equivalent method establishment

The 8 miRNAs of the present application were combined into one mixed solution at equal concentrations. The mixed solution was subjected to gradient dilution with a gradient of 10 times to obtain a mixed solution of miRNAs with a total of 5 gradients of 0.0005pM to 5pM, and the Ct value of each miRNA of each concentration gradient was detected according to the detection procedure described in the above-mentioned quality control product establishment protocol, and the results are shown in Table 10 below.

Table 10: concentration gradient detection results

Average Ct	5pM	0.5pM	0.05pM	0.005pM	0.0005pM
						BCMK-miR02	22.1	25.2	28.5	32.0	35.2
BCMK-miR03	24.7	27.8	31.2	33.8	39.7
						BCMK-miR04	21.8	25.1	28.5	32.0	35.3
BCMK-miR05	21.9	25.5	28.8	32.0	35.2
						BCMK-miR08	22.9	26.4	29.8	33.3	36.5
BCMK-miR09	26.1	28.5	32.0	35.2	38.3
						BCMK-miR10	28.2	30.9	33.9	37.9	40.0
BCMK-miR06	21.9	25.1	28.4	31.8	35.2

According to the detection Ct value of each miRNA under different concentrations and the two variables of the logarithm of dilution factors, establishing a linear regression equation of each miRNA, and according to the linear regression equation, the conversion formula of the detection Ct and the concentration of each miRNA is as follows:

table 11: conversion formula of concentration and Ct value of each miRNA

/>

Quality control reference sample selection and configuration

Urine samples of 1 patient with urothelial cell carcinoma were selected, and high-grade urothelial cell carcinoma was confirmed by tissue biopsy and used as a reference sample for positive quality control. 1 example of urine samples of healthy people is selected, no urinary system occupation is confirmed by B ultrasonic, and urine abscission cells are detected normally and used as a reference sample of negative quality control products. The results of the 2 samples obtained by the method described in this example were as follows:

table 12: quality control article reference sample detection Ct value and Score value

The Ct value detected by the sample is used as a reference, and the small RNA concentration (pM) of each quality control product is obtained by performing back-pushing calculation according to the Ct value and a concentration conversion formula and according to the dilution times during extraction and detection, wherein the small RNA concentration (pM) of each quality control product is shown in the following table:

table 13: quality control product each miRNA concentration

According to the concentrations shown in the table, positive quality control and negative quality control were prepared.

Quality control verification

Detecting the prepared quality control products according to the method described in the embodiment, and comparing the Ct value, the Score value and the difference between the Ct value and the Score value of each quality control product and the detection result of the original reference sample with the following table:

table 14: configuring quality control product detection result and difference between the quality control product detection result and original reference sample

/>

The quality control product is prepared according to the method, the Ct value is less than 10% compared with the detection result of the original reference sample, and the detection result of the urothelial cell carcinoma shown by the detection Score value is always the same as the pathological result of the original reference sample. The quality control product can be stably, effectively provided for a long time by the method.

Example 5 assay precision verification

Templates for determining the copy number of the template molecules of the solution using digital PCR were configured to be 3×10 for 8 mirnas each ⁵ The mixed solution of copy number/mu L (170 copies/mu L urine converted to urine sample) is a medium-high concentration precision reference, and each miRNA is 3×10 ⁴ The copy number/. Mu.L (converted to 17 copies/. Mu.L urine in urine samples) of the mixture was used as a medium-low value precision reference, and 20 parts of each precision reference was prepared. 80. Mu.L of RNA was extracted using a nucleic acid extraction or purification kit (magnetic bead method) manufactured by Jiangsu Shuo Biotech Co., ltd., (recording number: su Taixie: 20210555), and then subjected to RT-qPCR detection by the same method as that of example 3, wherein the medium and high concentration precision detection Ct is shown in Table 15 and the medium and low concentration precision reference detection Ct is shown in Table 16. The result shows that the Ct variation coefficient (CV%) of the detected miRNA is not more than 5% in 20 times of detection under the conditions of medium-high concentration and medium-low concentration; kits or primer compositions of the present application are described for detecting differencesThe target miRNA has high precision in concentration.

Table 15: detection result of medium-high concentration precision reference

/>

Table 16: detecting Ct by medium-low concentration precision reference

/>

Example 6 specificity of the kit to detect sequence-similar miRNAs

1. Sequence-similar miRNA template preparation

The sequence of miRNAs (hsa-miR-133 a-5p, hsa-miR-141-5p, hsa-miR-143-3p, hsa-miR-151a-3p, hsa-miR-29c-5p, hsa-miR-96-3p, hsa-miR-99a-3 p) of the same family of 7 microRNAs is obtained in an http:// www.mirbase.org/database, and is shown in Table 17. Wherein, hsa-miR-141-5p, hsa-miR-141 and hsa-miR-429 belong to miR-8, so that hsa-miR-141-5p can be used as sequence similar templates of hsa-miR-141 and hsa-miR-429. The 7 miRNA templates were synthesized and dissolved according to instructions to prepare a mixed solution (designated 7ref_mirna pool) having a concentration of 0.5pM for each miRNA.

Table 17: sequence-specific reference templates

/>

2. Detection of sequence-similar miRNA templates using primer compositions of the present application

4. Mu.L of the above sequence-similar miRNA template mixture was used at a concentration of 0.5pM each, and RT-qPCR was performed using nuclease-free water as a template-free control (NTC) in the same manner as in 2.1 of example 3. Meanwhile, mixed liquor of 7 target miRNAs with the same concentration and an internal standard miRNA template is used as positive control, and water without nuclease is used as negative control. The test is repeated twice, the detection results are shown in the table 18-1 and the table 18-2 in detail, and the results show that the primer of the target miRNA of the application has no cross with the miRNA of the same family with similar sequence, and the detection specificity is good.

Table 18-1: sequence-like miRNA detection cross-reactions

Table 18-2: sequence-like miRNA detection cross-reactions

/>

Example 7 detection of urine samples prepared under different conditions

The kit of the embodiment 3 of the application is used for detecting urine samples with different volumes, different sampling modes and different storage conditions.

1. Urine sample detection of different volumes

Urine samples were divided into 1.5mL,7mL,14mL each of 1 tube, and the urine pretreatment and RNA extraction methods included: 1200g at room temperature, centrifuging for 15 min, completely removing the supernatant, suspending the sediment with 1mL of DPBS, transferring to a 1.5mL centrifuge tube, centrifuging for 5 min at 2000g at room temperature, and completely removing the supernatant; the precipitation was performed by using a kit for extracting or purifying nucleic acid (magnetic bead method) manufactured by Jiangsu Shuoshi Biotech Co., ltd., (recording No. Su Taixie: 20210555) to extract total RNA, respectively, and then RT-qPCR detection was performed by using the kit of example 3 of the present application, and the detection method was the same as that of 2.1 in example 3. The results of the detection are shown in Table 19. The correlation between the 3 volume urine detection results is more than 0.98, and the correlation is good. The kit is suitable for detecting urine samples with different volumes. The urine collection tube commonly used in clinic is a 12mL urine collection tube, and the volume of about 7mL is a suitable volume.

Table 19: urine sample detection results (Ct value) of different volumes

	1.5mL	7mL	14mL
				hsa-miR-133a	31.15	32.00	32.00
hsa-miR-141	23.41	24.14	24.25
				hsa-miR-143#	32.00	32.00	31.65
hsa-miR-151-5p	26.41	27.63	27.52
				hsa-miR-29c	21.72	22.66	22.20
hsa-miR-429	24.11	25.29	24.93
				hsa-miR-96	29.52	30.46	30.01
Mean hsa-miR-99a	27.19	28.13	28.28
				Adjacent volume detection correlation		0.992	0.995

2. Sample detection under different urine retention conditions

Urine samples for different time periods were studied. According to the related urine sample collection flow of GB/T38775-2020 'collection and treatment of human urine sample' and WS/T348-2011 'collection and treatment guide of urine specimen', equal volumes of morning urine and random urine are respectively collected for the same patient, and 8 pairs of samples are collected, wherein 3 pairs of urothelial cell carcinoma and 5 pairs of non-urothelial cell carcinoma are obtained. The total RNA of the urine sample was obtained by the pretreatment and RNA extraction method of the present example, and RT-qPCR was performed using the kit of example 3, using the same method as 2.1 in example 3. And (5) detecting that the Ct value is brought into a Score value calculation formula to calculate the Score value. The calculated Score values for the two sampling modes are shown in table 20. The Score value calculation results of the morning urine and the random urine on the urothelial cell carcinoma model are not different, so that the kit is applicable to miRNA detection of urine samples under different taking conditions. The sampling mode is more convenient for sampling random urine, and the random urine is more excellent.

Table 20: comparison of detection results of morning urine and random urine

3. Sample detection under different storage conditions

Urine samples were aliquoted into 4 aliquots of 7mL each. One part of the sample was tested at time 0 using the kit, the other three parts were each not added with a preservative, one part was added with 0.05% (v/v) Proclin300, and one part was added with 0.1% (v/v) Proclin300, and the samples were stored at 25℃or below for 72 hours and then RNA was extracted, and the sample treatment method and the RNA extraction method were the same as those described in the related methods of this example. The kit of example 3 was used for detection, and the detection method was the same as that of example 3, 2.1, in parallel with two experiments. The results of the detection are shown in Table 21. The sample is placed below 25 ℃ for 72 hours, contains a preservative, has correlation with detection at 0 time of more than 0.98, and contains 0.1% (v/v) Proclin300 optimally. The kit is applicable to detection of fresh urine samples and urine samples stored for a period of time, such as within 72 hours; in addition, the addition of a certain amount of preservative, such as 0.1% (v/v) Proclin300, to the stored urine sample is beneficial to improving the accuracy of the test results.

Table 21: detection results of different storage conditions

Example 8 clinical sample detection accuracy determination

The total RNA of the urine sample was obtained using not less than 7mL of the random urine sample using the pretreatment of urine and the RNA extraction method described in example 6, and was detected using the kit of example 3, and the detection method was the same as 2.1 in example 3. The Ct value of each miRNA of 8 obtained is calculated by using Score value calculation formula II of the present application to obtain Score value of the sample, and the result is recorded. And analyzing the sensitivity and the specificity of different break points of the ROC curve by adopting a subject working characteristic curve (ROC) method, and calculating a Johnson index, wherein a critical value corresponding to the maximum break point is used as a threshold value for positive judgment of urothelial cell carcinoma. 353 cases of clinical samples calculate the area under ROC curve (AUC) to be 0.901, analyze the sensitivity and the specificity of different break points of the ROC curve, the maximum value of about dengue index is 0.678, the critical value corresponding to the break point is 0.51, and the sensitivity and the specificity are used as the criterion of urothelial cell carcinoma, namely the yin and yang of the urothelial cell carcinoma is judged to have the Score value of 0.51, namely the Score value is more than or equal to 0.51, and the urothelial cell carcinoma is judged to be positive, the Score value is less than 0.51, and the urothelial cell carcinoma is judged to be negative. And judging the yin and yang of the Score value obtained by sample detection by using the standard, and comparing the judging result with a gold standard diagnosis result corresponding to the sample, wherein the positive sample contrast compliance rate, namely the sensitivity is 0.864, and the negative sample compliance rate, namely the specificity is 0.828. In detail, the sensitivity of various different classes of urothelial cell carcinomas and the specificity of different classes of control samples are detailed in Table 22.

Table 22: accuracy of detection of various samples

From the results, the primer composition and the kit can be used for diagnosing urothelial cell cancer (such as bladder cancer), and have higher diagnosis accuracy for different types of bladder cancer, such as low-malignant potential urothelial cell cancer, low-grade urothelial cell cancer, high-grade urothelial cell cancer, non-classified urothelial cell cancer and in-situ urothelial cell cancer. In contrast, the specificity of the existing clinical commonly used abscisic detection is high, but the sensitivity is only about 30%. NMP22 detection sensitivity is only about 70%, and specificity is less than 70%. Comprehensive comparison shows that the sensitivity of the kit is above 86%, the detection specificity for health such as detection is above 90%, the detection specificity for patients with benign diseases of the urinary system is above 70%, and the overall specificity is 82.8%, so that the kit has more obvious advantages compared with the existing detection means.

In addition, the kit can be used for detecting renal pelvis cancer or ureter cancer, at present, the upper urinary tract malignant tumor cannot be diagnosed through cystoscopy, and an effective diagnosis means for the upper urinary tract malignant tumor is not available, and the kit provides a diagnosis means for the upper urinary tract malignant tumor.

In addition, the primer composition and the kit can be used for detecting the cancer of the epithelial cells and also can be used for detecting the malignant tumor of the urinary tract which does not originate from the urothelial cells; can be used for detecting primary urothelial cell carcinoma, and also can be used for detecting postoperative urothelial cell carcinoma residues or postoperative urothelial cell carcinoma recurrence.

By adopting the kit to detect the benign diseases of the urinary system, the primer composition or the kit can relatively accurately distinguish the benign diseases of the urinary system from the urothelial cell carcinoma, and the primer composition and the method have higher accuracy.

Example 8 suitability test of RNA extraction method

Taking 4 urine samples, dividing each sample into two parts, and carrying out pretreatment on the urine samples as described in example 6, taking a precipitate, extracting by adopting two extraction kits in parallel, wherein each part is 7mL, and the method comprises the following steps of: the RNA extraction kit selects a total RNA rapid extraction kit (magnetic bead method) of a nucleic acid extraction or purification reagent provided by Shuoshi company (Su Taixie is 20210555), and is extracted according to the extraction operation flow of a urine total RNA nucleic acid extractor matched with an automatic Shuoshi extractor (method A), B: the RNA extraction kit adopts miRNeasy Mini Kit (Cat#: 1038703) produced by Qiagen company to extract total RNA from urine according to the animal cell extraction flow in the reagent specification (method B). The RNA obtained by extraction was detected by using the kit of example 3, and the detection method was the same as that of 2.1 in example 3. The Ct value is carried into the formula to calculate Score value, and the distribution of the selected samples, the correlation of the extraction results of the two extraction kits and the prediction result are shown in table 23. The RNA detection results obtained by the extraction of the two extraction methods (a column passing method and a magnetic bead method) are consistent. The RNA extraction reagent of the Shuoshi company is a magnetic bead method, and an automatic extractor can be used for automatic RNA extraction, so that the operation and the applicability are better.

Table 23: comparison of detection results of two RNA extraction kits

Example 9 test of anti-interference Capacity of kit

One positive and one negative clinical samples were selected, each divided into 12 parts, each 7mL. After the sample was treated and total RNA was obtained by the pretreatment of urine sample and the RNA extraction method described in example 6, each sample was tested by using the kit of example 3, and an equal volume of nuclease-free water was added to the sample as a control. Interfering substances: urea (12 mg/mL), bilirubin (0.15 mg/mL), heme (1 μg/mL), albumin (4 mg/mL), blood (100 cells/μl); exogenous interfering substances: epirubicin (125 μg/mL), gemcitabine (2.5 mg/mL), BCG (0.3 mg/mL), cefonicid (1.96 mg/mL), levofloxacin (0.36 mg/mL), vitamin C (0.5 mg/mL). Wherein urea, bilirubin, heme, albumin, blood are possible naturally occurring interfering substances in urine, epirubicin, gemcitabine, BCG vaccine are common medicines for bladder cancer perfusion treatment, and cefonicid and levofloxacin are common medicines for urinary tract infection treatment. The measurement was performed under the conditions of 2.1 of example 3, and the Ct value obtained by the measurement was substituted into the formula to calculate Score value, and the results are shown in table 24. Compared with a control (a urine sample without the addition of the interfering substances), the detection result of the sample with the addition of the various interfering substances is not affected by the judgment of yin and yang, which shows that by adopting the primer composition and the detection method, an accurate result can be obtained under the condition that the interfering substances exist.

TABLE 24 detection results of addition of interfering substances to clinical samples

The method is based on a fluorescence quantitative PCR technology, and judges whether a patient has urothelial cell cancer or not by detecting miRNA (micro ribonucleic acid) related to occurrence, development and metastasis of urothelial cell tumor, substituting Ct values of the miRNA into a calculation formula of a urothelial cell cancer related evaluation value (Score value) obtained by detecting and modeling a large number of clinical samples. The detection result of the detection kit has quite high sensitivity and specificity, and the detection of the detection kit is used for evaluating urothelial cell cancers, providing basis for further cystoscopy or for auxiliary diagnosis of the urothelial cell cancers of patients incapable of performing cystoscopy due to poor patient compliance or other medical reasons, and providing reference for clinicians.

In addition, the kit provided by the application is a method for evaluating that a patient has urothelial cell cancer by detecting miRNA in urine, and compared with cystoscope, the kit is easy to sample, simple and convenient to detect, can not bring pain to the patient, and is more easy to accept and popularize.

The miRNA fluorescence quantitative PCR detection kit provided by the matter has the advantages of high sensitivity and good specificity, and the minimum detection limit of each target miRNA and internal standard miRNA can reach 1.7 copies/mu L urine. The application can be used for detecting various urine samples, such as fresh urine or urine stored for less than 72 hours at the temperature below 25 ℃, morning urine or random urine, and is easy to collect, store and transport. The primer composition and the method can be used for diagnosing urothelial cell cancer, detecting recurrence, evaluating surgical effect and screening. The application can be used for diagnosing, recrudescing and detecting the epithelial cell cancer of bladder, ureter, renal pelvis cancer and urethra, evaluating the effect of operation, screening and the like.

Sequence listing

<110> Shanghai Xiangqiong biotechnology Co., ltd

<120> a primer composition and use thereof

<130> MTI220202

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 1

gtcgttacca gtgcagggtc cgaggactgg taacgaccca tct 43

<210> 2

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 2

gtcgtatcca gtgcagggtc cgaggactgg atacgaccag ctgg 44

<210> 3

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 3

gtcgttacca gtgcagggtc cgaggactgg taacgaccca tct 43

<210> 4

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 4

ctcgttacca gtgcagggtc cgaggactgg taacgagacc aga 43

<210> 5

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 5

ctcgttacca gtgcagggtc cgaggactgg taacgagact agac 44

<210> 6

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 6

gtcgtaacca gtgcagggtc cgaggacact ggttacgact aaccga 46

<210> 7

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 7

ggcgtaggca gtgcagggtc cgaggtctgc ctacgccacg gttt 44

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 8

gcgcgtaaca ctgtctggta aag 23

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 9

gcgcgtttgg tccccttcaa cc 22

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 10

gcgcgtaaca ctgtctggta aag 23

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 11

ccgcggtgca gtgctgcatc tct 23

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 12

ccgctcgagg agctcacagt c 21

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 13

gcgcgtagca ccatttgaaa tcg 23

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 14

accgctttgg cactagcaca 20

<210> 15

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 15

ctggatacga ccagctg 17

<210> 16

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 16

ctggtaacga cccatc 16

<210> 17

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 17

ctggtaacga gaccag 16

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 18

ctggtaacga gactagac 18

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 19

cactggttac gactaaccg 19

<210> 20

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 20

ctacgccacg gtttt 15

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 21

actggctacg acagcaaa 18

<210> 22

<211> 14

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 22

tgcagggtcc gagg 14

<210> 23

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 23

gtcgtatcca gtgcagggtc cgaggtctgg atacgaccac aag 43

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 24

ccgcaacccg tagatccgat 20

<210> 25

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 25

ctggatacga ccacaaga 18

<210> 26

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 26

uuuggucccc uucaaccagc ug 22

<210> 27

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 27

uaacacuguc ugguaaagau gg 22

<210> 28

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 28

ggugcagugc ugcaucucug gu 22

<210> 29

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 29

ucgaggagcu cacagucuag u 21

<210> 30

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 30

uagcaccauu ugaaaucggu ua 22

<210> 31

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 31

uaauacuguc ugguaaaacc gu 22

<210> 32

<211> 23

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 32

uuuggcacua gcacauuuuu gcu 23

<210> 33

<211> 22

<212> RNA

<213> Artificial Sequence

<220>

<223> synthetical nucleic acid

<400> 33

aacccguaga uccgaucuug ug 22

Claims

1. A primer composition comprising a reverse transcription primer, a forward primer of a fluorescent quantitative PCR, a reverse primer, and a probe of at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429, hsa-miR-96.

2. The primer composition of claim 1, comprising at least one of the following primer combinations 1 to 7;

preferably, the primer composition further comprises a primer combination 8, wherein the primer combination 8 comprises the primers shown in SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 and SEQ ID No. 22.

3. The primer composition according to claim 1, comprising the following primer combinations 1 to 8;

4. A kit comprising the primer composition of any one of claims 1-3.

5. The kit of claim 4, further comprising a reaction buffer for real-time quantitative PCR, dNTPs, and a DNA polymerase.

6. The kit of claim 4, further comprising a reaction buffer for reverse transcription, dNTPs, and a reverse transcriptase.

7. The kit of claim 4, further comprising a positive quality control and/or a negative quality control; preferably, the method further comprises a specification, wherein the specification comprises a score value calculation formula:

score value=1/(1+exp (k1×ct) _(BCMK-miR02) +k2×Ct _(BCMK-miR03) -k3×Ct _(BCMK-miR04) +k4×Ct _(BCMK-miR05) +k5×Ct _(BCMK-miR08) +k6×Ct _(BCMK-miR09) –k7×Ct _(BCMK-miR10) –k8×Ct _(BCMK-miR06) +K))；

preferably, the method comprises the steps of,

score value=1/(1+exp (0.0001×ct) _(BCMK-miR02) +0.6254×Ct _(BCMK-miR03) -0.3466×Ct _(BCMK-miR04) +0.9502×Ct _(BCMK-miR05) +0.0001×Ct _(BCMK-miR08) +0.0001×Ct _(BCMK-miR09) -0.2058×Ct _(BCMK-miR10) -1.0231×Ct _(BCMK-miR06) +2.5881))。

8. Use of the primer composition of any one of claims 1-3 or the kit of any one of claims 4-7 to determine the expression level of a miRNA in a test urine sample; wherein the miRNA comprises at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96; preferably, the miRNA comprises hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96; preferably, the miRNA expression level is corrected by an endogenous control; preferably, the endogenous control is hsa-miR-99a.

9. A method for determining the expression level of miRNA in a test urine sample using the primer composition of any one of claims 1-3 or the kit of any one of claims 4-7, comprising the steps of:

a) Obtaining a urine sample to be tested of the individual to be tested;

b) Extracting RNA of the urine sample to be detected;

wherein the miRNA comprises at least one of hsa-miR-133a, hsa-miR-141, hsa-miR-143#, hsa-miR-151-5p, hsa-miR-29c, hsa-miR-429 and hsa-miR-96;

preferably, the miRNA expression level is corrected by an endogenous control;

preferably, the step of endogenous control correction comprises:

e) Reversing the RNA by using a primer shown in SEQ ID NO. 23;

g) Endogenous control correction is carried out on the expression level of miRNA in the urine sample to be tested by utilizing the expression level of hsa-miR-99 a;

preferably, the final primer concentrations in step c) are each independently 10 to 50nM, preferably 25nM;

preferably, the final concentration of dNTPs in the reverse transcription system of step c) is 0.125-0.5 mM, preferably 0.25mM;

preferably, in the reverse transcription system of step c), the final concentration of reverse transcriptase is 1 to 5U/. Mu.L, preferably 3.4U/. Mu.L;

preferably, the reverse transcription conditions of step c) comprise: slow reaction: 11-13 ℃ for 28-32 minutes; 40-45 ℃ for 28-32 minutes; 94-96 deg.c for 4-6 min; keeping at 4 ℃; or a rapid reaction: 11-13 ℃ for 4-6 minutes; 37-50 ℃ for 8-12 minutes, preferably 42 ℃; 94-96 deg.c for 4-6 min and 4 deg.c; preferably, in the real-time quantitative PCR of step d), the final concentration of the forward primer is each independently 0.9-1.8. Mu.M; preferably 1.5. Mu.M;

preferably, in the real-time quantitative PCR of step d), the final concentration of probes is each independently 0.2-0.5. Mu.M; preferably 0.3. Mu.M;

preferably, in the real-time quantitative PCR of step d), the final concentration of the reverse primer is 0.5-1.5. Mu.M; preferably 0.7. Mu.M;

preferably, in the real-time quantitative PCR of step d), the final concentration of DNA polymerase is 0.1-0.5U/. Mu.L, preferably 0.25U/. Mu.L;

Preferably, the conditions of the real-time quantitative PCR of step d) comprise: the heat activation time is 1-10 minutes, and the annealing temperature is 58-62 ℃, preferably 60 ℃; optionally, a 72℃extension step is also included.

10. Use of the primer composition of any one of claims 1 to 3 or the kit of any one of claims 4 to 7 for the preparation of a urothelial cell cancer diagnostic reagent; preferably, the urothelial cell cancer is selected from at least one of bladder cancer, ureter cancer, urethra cancer, renal pelvis cancer; preferably, the urothelial cell carcinoma is selected from a urothelial cell-derived urinary tract malignancy or a non-urothelial cell-derived urinary tract malignancy.