CN117255807A - Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123 - Google Patents

Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123 Download PDF

Info

Publication number
CN117255807A
CN117255807A CN202180088872.6A CN202180088872A CN117255807A CN 117255807 A CN117255807 A CN 117255807A CN 202180088872 A CN202180088872 A CN 202180088872A CN 117255807 A CN117255807 A CN 117255807A
Authority
CN
China
Prior art keywords
seq
amino acid
acid sequence
cdr
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180088872.6A
Other languages
Chinese (zh)
Inventor
L·高蒂尔
A·蒂伦斯
B·罗西
C·阿玛拉
C·尼古拉齐
M·凯龙
F·杜菲
A·维罗内-奥多斯
J·贝宁加
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Aventis France
Innate Pharma SA
Original Assignee
Sanofi Aventis France
Innate Pharma SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanofi Aventis France, Innate Pharma SA filed Critical Sanofi Aventis France
Priority claimed from PCT/IB2021/062494 external-priority patent/WO2022144836A1/en
Publication of CN117255807A publication Critical patent/CN117255807A/en
Pending legal-status Critical Current

Links

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The present disclosure relates to multifunctional binding proteins comprising a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or a variant thereof, all or part of which, wherein said first ABD specifically binds to human CD123 and said second ABD specifically binds to human NKp46, and wherein all or part of said immunoglobulin Fc region or variant thereof is directed against a human Fc-gamma receptor. The disclosure also relates to methods for preparing the binding proteins, compositions thereof, and uses thereof, including the treatment or prevention of proliferative disorders, including Acute Myelogenous Leukemia (AML) and myelodysplastic syndrome (MDS).

Description

Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123
Technical Field
The present disclosure relates to multifunctional binding proteins comprising a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or all or part of a variant thereof, wherein said first ABD specifically binds human CD123 and said second ABD specifically binds human NKp46, and wherein all or part of said immunoglobulin Fc region or variant thereof is directed against a human Fc-gamma receptor.
The disclosure also relates to methods of making the binding proteins, compositions thereof, and uses thereof, including the treatment or prevention of proliferative disorders, including Acute Myelogenous Leukemia (AML) and myelodysplastic syndrome (MDS).
Background
Acute Myelogenous Leukemia (AML) and myelodysplastic syndrome (MDS) are heterogeneous clonal neoplastic diseases, thought to be caused by sub-populations of leukemic stem cells that are often resistant to conventional chemotherapy and may further lead to disease recurrence.
Natural Killer (NK) cells are a subset of lymphocytes involved in non-routine immunization. NK cells provide an effective immune surveillance mechanism by which unwanted cells, such as tumor or virus infected cells, can be eliminated. Characteristics and biological properties of NK cells include expression of surface antigens (including CD16, CD56 and/or CD 57), absence of α/β or γ/δ TCR complexes on the cell surface, the ability to bind and kill cells, particularly cells incapable of expressing "self" MHC/HLA antigens, in an MHC non-limiting manner by activating specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells expressing ligands of NK activating receptors, and the ability to release protein molecules called cytokines that stimulate immune responses.
Natural Killer (NK) cells are also of interest due to their potential anti-tumor properties.
Nevertheless, there remains an urgent need for agents useful in the treatment or prevention of proliferative disorders such as Acute Myelogenous Leukemia (AML) and myelodysplastic syndrome (MDS).
There is also a need for a new NK adapter with therapeutic effect.
There is also a need for new compounds that are easier to manufacture and/or administer without side effects or with reduced side effects. In particular, there is a need for novel compounds that have no or reduced risk of cytokine release syndrome (e.g., no or reduced release of IL-6-associated cytokines) in patients.
Disclosure of Invention
In one embodiment, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or a variant thereof, all or part, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) And immunoglobulinsLight chain variable domain (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
In certain embodiments, the binding protein comprises three polypeptide chains (I), (II) and (III) forming two ABDs, as defined below:
V 1A -C 1A -hinge 1 -(C H 2-C H 3) A (I)
V 1B -C 1B -hinge 2 -(C H 2-C H 3) B -L 1 -V 2A -C 2A -hinge 3 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
hinge 1 Hinge 2 And hinge 3 Is the same or different and corresponds to all or part of an immunoglobulin hinge region;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 Is an amino acid linker.
In certain embodiments, C 1B Is immunoglobulin heavy chain constant domain 1 (C H 1)；C 2A Is immunoglobulin heavy chain constant domain 1 (C H 1)；C L Corresponds to immunoglobulin kappa light chain constant domain (C κ )；(C H 2-C H 3) A An amino acid sequence corresponding to SEQ ID NO. 69; (C) H 2-C H 3) B An amino acid sequence corresponding to SEQ ID NO. 70; hinge 1 Corresponds to SEQThe amino acid sequence of ID NO. 74; hinge 2 An amino acid sequence corresponding to SEQ ID NO. 75; hinge 3 An amino acid sequence corresponding to SEQ ID NO. 77; l (L) 1 An amino acid sequence corresponding to SEQ ID NO. 76.
In certain embodiments, residue N297 of the Fc region or variant thereof comprises N-linked glycosylation according to EU numbering.
In certain embodiments, all or part of the Fc region or variant thereof binds to a human CD16A (fcyriii) polypeptide.
In certain embodiments, the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
In certain embodiments, the polypeptide chains (I) and (II) are linked by C 1A With hinges 2 At least one disulfide bridge linkage between them, and/or wherein the polypeptide chains (II) and (III) are linked by a hinge 3 And C 2B At least one disulfide bridge linkage therebetween.
In certain embodiments, V 1A Is V L1 And V is 1B Is V H1 . In certain embodiments, V 2A Is V H2 And V is 2B Is V L2 。
In certain embodiments, (a) V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29; (b) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32; (c) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 33; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35; (d) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38; (e) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; containing the amino acid sequence of SEQ ID NO. 8CDR-L2; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40; (f) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29; (g) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32; (h) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 Comprises a containingCDR-H1 of the amino acid sequence of SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 33; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35; (i) V (V) H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38; or (j) V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40.
In certain embodiments, (a) V H1 And V L1 Amino acid sequences corresponding to SEQ ID NOS 41 and 43, respectively, or amino acid sequences corresponding to SEQ ID NOS 42 and 44, respectively;
and/or (b) V H2 And V L2 Amino acid sequences corresponding to SEQ ID NOs 45 and 53, respectively; the amino acid sequences of SEQ ID NOS 46 and 54, respectively; amino acid sequences of SEQ ID NOs 47 and 55, respectively; respectively SAmino acid sequences of EQ ID NOs 48 and 56; the amino acid sequences of SEQ ID NOs 49 and 57, respectively; amino acid sequences of SEQ ID NOs 50 and 58, respectively; amino acid sequences of SEQ ID NOs 51 and 59, respectively; or the amino acid sequences of SEQ ID NOS 52 and 60, respectively.
In some embodiments of the present invention, in some embodiments,
(a)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; v (V) L2 An amino acid sequence comprising SEQ ID NO. 53;
(b)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(c)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(d)V H1 An amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(e)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 57;
(f)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 50; v (V) L2 An amino acid sequence comprising SEQ ID NO. 58;
(g)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(h)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 60;
(i)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 53;
(j)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(k)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(l)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(m)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; v (V) L2 An amino acid sequence comprising SEQ ID NO. 57;
(n)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 50; v (V) L2 Comprising the amino acid sequence of SEQ ID NO. 58.
(o)V H1 An amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(p)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; v (V) L2 Comprising the amino acid sequence of SEQ ID NO. 60.
In certain embodiments, polypeptide (I) comprises the amino acid sequence of SEQ ID NO. 64; the polypeptide (II) comprises the amino acid sequence of SEQ ID NO. 65; and polypeptide (III) comprises the amino acid sequence of SEQ ID NO. 66.
In certain embodiments, polypeptide (I) consists of the amino acid sequence of SEQ ID NO. 64; the polypeptide (II) consists of the amino acid sequence of SEQ ID NO. 65; and polypeptide (III) consists of the amino acid sequence of SEQ ID NO. 66.
In one embodiment, the present disclosure relates to a pharmaceutical composition comprising a binding protein as defined above and a pharmaceutically acceptable carrier.
In one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a binding protein as defined above.
In one embodiment, the present disclosure relates to an expression vector comprising a nucleic acid molecule as defined above.
In one embodiment, the present disclosure relates to an isolated cell comprising a nucleic acid molecule as defined above.
In one embodiment, the present disclosure relates to an isolated cell comprising an expression vector as defined above. In certain embodiments, the host cell is a mammalian cell.
In one embodiment, the present disclosure relates to a method of preparing a binding protein as defined above, comprising the steps of: (a) Introducing an expression vector as defined above into a host cell; (b) Culturing the host cell under conditions suitable for expression of the binding protein; and (c) optionally recovering the expressed binding protein.
In one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a binding protein as defined above, and characterized in that it comprises a first and a second Antigen Binding Domain (ABD) toAnd an immunoglobulin Fc region or all or part of a variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) And immunoglobulin light chain variable domain (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
Amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
In one embodiment, the present disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding one or more polypeptide chains of a binding protein as defined above.
In one embodiment, the present disclosure relates to an isolated cell comprising a nucleic acid molecule as defined above.
In one embodiment, the present disclosure relates to an isolated cell comprising an expression vector as defined above.
In one embodiment, the present disclosure relates to a method of preparing the binding protein comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 66;
(b) Optionally recovering the expressed recombinant polypeptide.
In one embodiment, the present disclosure relates to a method of treating or preventing hematological cancer, the method comprising administering to a subject in need of such treatment or prevention a pharmaceutical composition as defined above.
In one embodiment, the present disclosure relates to a method of treating or preventing myelodysplastic syndrome (MDS) or lymphoproliferative disorder, comprising administering to a subject in need of such treatment or prevention a pharmaceutical composition as defined above.
In one embodiment, the present disclosure relates to a method of treating or preventing Acute Myelogenous Leukemia (AML), which comprises administering to a subject in need of such treatment or prevention a pharmaceutical composition as defined above.
In one embodiment, the present disclosure relates to a method of treating or preventing CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML), which comprises administering to a subject in need of such treatment or prevention a pharmaceutical composition as defined above.
In one embodiment, the present disclosure relates to a method of treating or preventing CD64 positive Acute Myeloid Leukemia (AML), the method comprising administering to a subject in need of said treatment or prevention a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein said first ABD specifically binds human CD123 and said second ABD specifically binds human NKp46, and wherein all or part of said immunoglobulin Fc region or variant thereof binds human Fc-gamma receptor.
Drawings
If not otherwise stated, the binding proteins of the present disclosure are oriented in the amino-terminal direction ("N-terminal" or "N-term") on the left and in the carboxy-terminal direction ("C-terminal" or "C-term") on the right, according to standard usage and convention.
FIG. 1 is a three-dimensional schematic of the F25 form, which is a variant of the bispecific F5 form, comprising a human NKp46 binding site and a human CD123 binding site. In fig. 1, the C-terminus of the polypeptide is on the left and the N-terminus is on the right.
FIGS. 2A-2D show two-dimensional schematic diagrams of forms F25, F5, F26 and F6, respectively, including the relevant domains of each polypeptide chain. In fig. 2A to 2D, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. The human NKp46 binding domain is formed by the VH/VL pair on the left. The human CD123 binding domain is formed by the VH/VL pair on the right.
Fig. 2A shows a two-dimensional schematic of the form F25. This representation represents the claimed "NKp46-cd123_f25" binding protein.
Fig. 2B shows a two-dimensional schematic of the form F5. F5 differs from F25 in that the C of the NKp46 binding domain L And C H Couple and contain C H 1 domain and V L Third polypeptide chain exchange of domains.
Fig. 2C shows a two-dimensional schematic of the form F26. The F26 differs from F25 of FIG. 2A in that it differs from F25 at each C H The Fc-silent N297S mutation is included in both domains 2.
FIG. 2D showsA two-dimensional schematic of the form F6 is shown. The F6 differs from F5 of FIG. 2B in that it differs from F5 of FIG. C in that it differs from F6 of FIG. 2B in that it differs from F H The Fc-silent N297S mutation is contained in both domains 2.
Figure 2E shows a two-dimensional detailed representation of a variant of the F25 format. The F25 version of the representation corresponds to the representation in fig. 2A.
FIG. 3 shows the proposed mechanism of action of NK cell engagers (NKCE) for killing after combined binding of CD123 expressing tumor cells (i.e. AML cell line; i.e. MOLM-13) and NK cells expressing NKp46 and Fc gamma receptor (CD 16 a). Is transferred and adapted from Gauthier, L.et al ("Multifunctional natural killer Cell engagers targeting NKp46 trigger protective tumor immunity". Cell 177,1701-1713 (2019)).
FIGS. 4A-4B report the in vitro cytotoxicity of the NKp46-CD123_F25 binding proteins of the present disclosure against the AML cell line (MOLM-13) or primary AML blast, respectively. Figure 4A shows in vitro cytotoxicity of NKp46-cd123_f25 binding proteins of the present disclosure and a negative isotype control variant that binds only to form F25 of NKp46 (NKp 46-ic_f25) against AML cell line (MOLM-13). Figure 4B reproduces the same experiment using ex vivo patient samples, in which NKp46-cd123_f25, NKp46-ic_f25, anti-CD 123 ADCC enhancing antibody without specificity for NKp46 (reference 1) and negative isotype control Fc optimized antibody with increased ADCC activity and no specificity for both NKp46 and CD123 (IC-hIgG 1-ADCC-enh) were evaluated against primary AML blasts.
FIG. 5 provides in vitro cytotoxicity data (EC) of NKp46-CD123_F25 binding proteins and NKp46-CD123_F6 binding proteins of the present disclosure against MOLM-13AML cell lines using fresh healthy donor NK cells 50 Data), which NKp46-cd123_f25 binding protein is capable of activating human NK cells by binding to both NKp46 and CD16a in its Fc-competent form, thereby inducing ADCC activity (F25), and which NKp46-cd123_f6 binding protein activates human NK cells by binding to only NKp46 but not CD16a in its Fc-silent form, thereby inducing reduced ADCC activity (F6).
Figures 6A-6B upper panels report in vitro cytotoxicity of NKp46-cd123_f25 binding proteins of the present disclosure, anti-CD 123 ADCC enhancing antibodies without binding to NKp46 (reference 1) and negative isotype control Fc-optimized antibodies with increased ADCC activity and no specificity for both NKp46 and CD123 (ic_hig1-ADCC-enh) against different AML cell lines. The AML cell lines tested were: THP-1, a cell line expressing CD64 (+) and CD32 (+) (FIG. 6A); MOLM-13, a cell line that does not express CD64 (-) but expresses CD32 (+) (FIG. 6A); THP-1CD64KO, a cell line knocked out of CD64 (-) but expressing CD32 (+) (FIG. 6B); and THP-1CD32KO, a cell line expressing CD64 (+) and knocked out CD32 (-) (FIG. 6B). The lower panels of FIGS. 6A and 6B report the phenotype of malignant AML cell lines and subclones and the expression of CD123, CD64, CD32a/B by flow cytometry analysis. Background staining of AML cells with mouse-IgG 2a (ic_mouse IgG2 a) and mouse-IgG 1 (ic_mouse IgG 1) isotype controls is also shown.
Figures 7A-7B report the in vitro induction of NK degranulation as measured by the percentage of CD107A positive NK cells against primary AML blasts from two different donors. The primary AML blast from donor #1 was CD64 (+) (fig. 7A), and the primary AML blast from donor #2 was CD64 (-) (fig. 7B). The binding proteins tested were the NKp46-cd123_f25 binding protein of the present disclosure, an anti-CD 123 ADCC enhancing antibody that is not specific for NKp46 (reference 1), a negative isotype control variant that does not bind CD123 but binds to form F25 of NKp46 and CD16a (NKp 46-ic_f25), and a negative isotype control Fc-optimized antibody that has increased ADCC activity and is not specific for both NKp46 and CD123 (ic_hig1-ADCC-enh).
FIG. 8 reports the dose-dependent antitumor activity of the muNKp46-huCD123_F25 binding protein (carrying anti-murine NKp46 and anti-human CD123 binding domains and also referred to as mo NKp46-huCD 123) against MOLM-13 human cells in a severe combined immunodeficiency mouse (SCID) mouse model.
Figures 9A-9C report CD123 positive basophil depletion up to 28 days after administration of the NKp46-cd123_f25 binding protein of the present disclosure at 3000 μg/kg or 3mg/kg (figure 9A), at 3 μg/kg (figure 9B) and at 0.5 μg/kg (figure 9C) in non-human primates (M1, M2, M3, M4 and M6).
FIGS. 10A-10B report the in vitro cytotoxicity of two NKp46-CD123NKCE Fc competent binding proteins (NKp 46-CD123_F25 and NKp46-CD123_F5 of the present disclosure) and a control variant (CD 123-IC_F5) of form F5 that binds CD123 and CD16a but does not bind NKp46 against two AML cell lines MOLM-13 (FIG. 10A) and THP-1 (FIG. 10B) in the presence of NK cell healthy donor sample (D648).
The left panel of fig. 11 reports CD123 positive basophil depletion in healthy donor PBMCs induced in vitro (n=10) by treatment with NKp46-cd123_f25 (CD 123-NKCE; dose range 0.001 to 10 μg/mL), NKCE isotype control NKp46-ic_f25 (IC-NKCE; not binding to CD123 but binding to NKp46 and CD16 a) (dose range 0.001 to 10 μg/mL) or CD3-CD123 bispecific T cell engager (CD 123-TCE tool; 0.001 to 0.1 μg/mL). The middle panel reports the maximum consumed activity of NKp46-CD123_F25 at the highest dose tested (10. Mu.g/mL, 68 nM). The right panel reports the EC of CD123 positive basophil depletion calculated from NKp46-cd123_f25 dose response of PBMCs of six healthy donors 50 (pM)。
FIG. 12 shows IL-1 beta, TNF-alpha, IFN-gamma (written as INFg on the figure) and IL-6 cytokine release in vitro from healthy donor PBMC (N=10) after treatment with NKp46-CD123_F25, NKCE isotype control NKp46-IC_F25 (not binding to CD123 but binding to NKp46 and CD16 a) at doses of 0.1, 1 and 10 μg/mL or dual-specific T cell adapter tool (TCE tool) co-targeting CD123 and CD3 binding sites at doses of 0.1 μg/mL.
FIGS. 13A-13F show individual IL-6 and IL-10 plasma concentration versus time curves for 6 male cynomolgus monkeys (M1-M6) associated with NKp46-CD123_F25 binding protein concentrations of 3000 μg/kg (FIGS. 13A and 13B), 3 μg/kg (FIGS. 13C and 13D), 0.5 μg/kg (FIG. 13E) and <0.5 μg/kg (FIG. 13F).
Fig. 14A shows cytotoxicity of NKp46-cd123_f25 binding proteins of the present disclosure against AML blast cells from patients expressing (# AML5, # AML 6) or not expressing (# AML1, # AML 2) CD64 as compared to an anti-CD 123 ADCC enhancing antibody (reference 1) that is not specific for NKp46 and a negative isotype control Fc optimized antibody (IC-hIgG 1-ADCC-enh) that has increased ADCC activity and is not specific for both NKp46 and CD 123. Malignant cells from AML patients are used as targets, and purified healthy donor NK cells are used as effectors. The results of all healthy donor NK cells tested are shown.
FIG. 14B reports the phenotype of malignant AML cells from the patient used in FIG. 14A, which shows the expression of CD33, CD123, CD32a/B and CD64 by flow cytometry analysis.
FIG. 15A is a comparison of cytotoxicity of NKCEs targeting CD123 on tumor cells and not engaging NK cells (IC-CD123_F6) or engaging NK cells only through CD16a (IC-CD123_F25) or engaging NK cells only through NKp46 (NKp 46-CD123_F6) or co-engaging NKp46+CD16 (NKp 46-CD123_F25). MOLM-13 cells were used as target cells and purified resting healthy donor NK cells were used as effectors. Two NK donors are shown.
Figure 15B reports cytotoxicity of the NKp46-cd123_f25 binding proteins of the present disclosure against AML cell line MOLM-13 compared to a negative isotype control NKCE molecule that does not bind CD123 (NKp 46-ic_f25). Results for five healthy NK cell donors are shown.
FIG. 16A is a flow cytometry analysis of NK cells and malignant cells from AML patients (AML #8- # 10). The upper panel shows the expression of CD123 on AML blast cells (gating for CD33 positive population); the middle panels show the expression of CD64 on CD 123-positive AML blast cells (CD 64 staining black and isotype control grey); and the lower panel shows the expression of NKp46 and CD16a on NK AML sample NK cells.
FIG. 16B is an analysis of CD107a/B expression of NK cells after overnight treatment of PBMC from AML patient samples expressing CD64 (AML#8 and # 9) and not expressing CD64 (AML#10) at the cell surface of their blast cells with NKp46-CD 123-F25 (CD 123-NKCE), anti-CD 123 ADCC-enhancing antibody (reference 1 or CD123-IgG1+ in the figure) without specificity for NKp46, control isoforms NKp46-IC_F25 (600 and 120 ng/mL) that do not bind CD123 but bind NKp46 and CD16a (IC-NKCE), and IgG1 isotype control (600 ng/mL) (IC-IgG 1+).
FIG. 17 shows the percentage of marker expression (CD 107, CD69, TNF-. Alpha., IFN-. Gamma.and MIP-. 1. Beta.) of NK cells treated with increasing concentrations of NKp 46-CD123. Sup.F25 compared to controls comprising binding proteins (NKp 46-IC-. Sup.25) that bind only to NKp46 and CD16 in experimental settings using NK cells (NK+MOLM-13 versus NK only) with or without co-culture with MOLM-13 cells. Results for three NK cell donors are shown.
FIG. 18 shows the activity of the surrogate muNKp46-huCD123_F25 bispecific antibody (also known as molKp 46-huCD 123) against disseminated human AML, MOLM-13, in SCID mice. MOLM-13 cells were injected intravenously on day 0 in a single administration. Treatment was administered by intraperitoneal route on day 1 after tumor implantation. An isotype control antibody (muNKp 46-IC) that binds to muNKp46 and murine fcγr but not huCD123 was administered at 0.5 mg/kg. muNKp46-hucd123_f25 and reference 1 were administered at 5, 0.5, 0.25 and 0.05 mg/kg. The control group was not treated. The graph shows Kaplan-Meier curves for animals treated with muNKp46-hucd123_f25 bispecific antibody, reference 1 and control at 5, 0.5, 0.25 and 0.05 mg/kg. * **: p <0.001 compared to the control group; * *: p <0.01 compared to the control group; * : p <0.05 compared to control; # # # #: p <0.001 compared to reference 1; #: p <0.05 compared to reference 1. n=5 to 10 mice/group.
FIG. 19 is a graph evaluating the effect of NK consumption on the in vivo efficacy of surrogate muNKp46-huCD123_F25 bispecific antibodies in SCID mice bearing disseminated human MOLM-13 tumor cells. NK consumption was induced by 2 intraperitoneal administrations of anti-desialylated GM1 serum one day before tumor cell implantation and on day 5 post-implantation. MOLM-13 cells were injected intravenously on day 0 in a single administration. Treatment was administered intraperitoneally on day 1 post tumor implantation. Controls were also evaluated, including isotype control antibody that bound muNKp46 and murine fcγr but not huCD123 (muNKp 46-IC) and a second isotype control antibody that bound huCD123 and murine fcγr but not murine NKp46 (IC-huCD 123). The graph shows Kaplan-Meier curves of animals treated with muNKp46-huCD123_F25 bispecific antibody and control (muNKp 46-IC, IC-huCD 123) at 0.5, 0.25 and 0.05 mg/kg. n=10 mice/group. * **: p <0.001 compared to the control group; * *: p <0.01 compared to the control group; # # # #: p <0.001 compared to the same treatment + NK consumption; #: p <0.05 compared to the same treatment + NK consumption.
FIG. 20A depicts the depletion of CD123 positive basophils from M3 and M4 blood from monkeys treated as a single 1 hour intravenous infusion at a low dose of 3 μg/kg. Blood samples were collected before dosing (pre-dose) and 24 hours after the start of infusion and analyzed by flow cytometry. CD123 positive basophils are shown in the gate.
FIG. 20B shows the number of circulating CD123 positive basophils (open symbols) and total CD123 positive leukocytes (closed symbols) at study time in monkeys M1 (orange) and M2 (purple) treated with 3mg/kg as a single 1 hour intravenous infusion and in monkeys M3 (red) and M4 (blue) treated with 3 μg/kg as a single 1 hour intravenous infusion.
FIG. 20C reports cytokine production in cynomolgus monkeys treated as a single 1 hour intravenous infusion with high and low doses of 3mg/kg and 3 μg/kg, respectively. Plasma IL-6 and IL-10 concentrations are shown prior to dosing (0) and at 1.5, 5 and 24 hours after initiation of treatment.
Fig. 20D reports plasma NKp46-cd123_f25 (CD 123-NKCE) concentrations of cynomolgus monkeys treated with high and low doses of 3mg/kg and 3 μg/kg monitored 1.5, 5, 24, 48, 72, 168, 240, 336, 504, and 672 hours (i.e., days 0.04, 0.06, 0.21, 1, 2, 3, 7, 10, 14, 21, and 28) after 1 hour infusion was started. The lower limit of quantitation (LLOQ; 0.25 ng/mL) is indicated by the horizontal dashed line.
FIG. 21A shows the Toxicological Kinetics (TK) of the NKp46-CD123_F25 (CD 123-NKCE) molecule in male monkey M5 treated at a dose of 3 mg/kg/administration for four weeks weekly (on days 1, 8, 15 and 22). Plasma CD123-NKCE concentrations were determined on day 1, day 8, day 15, 1, 1.5, 5, 24 and/or 72 hours before (pre-dose) and after 1 hour of infusion, and 1, 1.5, 5, 24 and 168 hours before and after the last quarter of 1 hour of infusion, on day 22. Values below the lower limit of quantitation (LLOQ: 0.25 ng/mL) are not reported in the figures. Infusion days are indicated by vertical dashed lines.
FIG. 21B is an analysis of interleukin-6 production in monkey M5 treated with a high dose of 3 mg/kg/administration weekly for four weeks. Plasma IL-6 concentrations were monitored on day 1, day 8, day 15, 1, 1.5, 5 and 24 hours before and after the start of one hour infusion, and 1, 1.5, 5, 24 and 168 hours before and after the last quarter of one hour infusion.
FIG. 21C the number of circulating CD123 positive basophils (open symbols) and total CD123 positive leukocytes (closed symbols) in blood (left panel) or bone marrow (right panel) was quantified for monkey M5 treated at a dose of 3 mg/kg/week, depending on the time point in the study.
Figure 22 graphically depicts THP1 cytotoxic activity in assays using human Peripheral Blood Mononuclear Cells (PBMCs) from 2 Healthy Donors (HD). NK cells and THP1 GFP target cells were incubated in the presence of 0.1, 1, 10 and 100ng/mL NKp46-cd123_f25 or isotype control IC-cd123_f6 thereof that binds CD123 in its Fc-silenced form and induces reduced ADCC activity (F6).
Detailed Description
The present disclosure provides multifunctional binding proteins that bind to one surface biomarker on immune NK cells, namely NKp46, and one antigen of interest, namely CD123, on tumor target cells, and are capable of redirecting NK cells to lyse target cells expressing the CD123 surface biomarker. The multifunctional binding proteins of the present disclosure further comprise all or part of an Fc region or variant thereof that binds to an Fc-gamma receptor (fcγr), in particular activates an Fc-gamma receptor (fcγr), such as fcγriiia, also known as CD16 a.
Exemplary multifunctional binding proteins of the present disclosure also have dimeric Fc domains comprising N-linked glycosylation and binding to activating Fc-gamma receptors (fcγr), such as receptor CD16a, thereby providing advantageous immunopotentiating activity.
Experimental evidence provided by the present inventors suggests that optimal NK cell modulation, in particular NK cell activation, can be achieved in vitro for the AML cell lines MOLM-13 and THP1 and ex vivo for the original samples from AML patients (e.g. peripheral blood lymphocytes from AML patients), and with a better safety profile, by conjugating NKp46, fcγr such as CD16a and cell surface biomarker CD 123.
Importantly, the in vitro cytotoxic activity of the NKp46-CD123 binding proteins of the present disclosure was reproduced ex vivo, characterized by the form reported herein as "F25" and comprising a central fragment crystallizable (Fc) region that remains bound to the human CD16 polypeptide.
Accordingly, the present inventors provide experimental support for the therapeutic properties of bispecific NKp46/CD16-CD123 binding proteins, particularly for the treatment and prevention of AML and other proliferative disorders.
The inventors further provide experimental evidence that NKp46-CD123 binding proteins activate NK cells in the original sample from AML patients, regardless of their CD64 expression status.
Therefore, the engagement of NK cells by binding to the cell surface marker NKp46/CD16 proved to be a robust and reproducible strategy for use as a drug.
I. Definition of the definition
As used herein, "CD123" markers or "cluster of differentiation 123" are also referred to as "interleukin 3 receptor alpha (IL 3 RA)" or "IL3R", "IL3RX", "IL3RY", "IL3RAY", "hlL-3RA", and represent interleukin 3 specific subunits of heterodimeric cytokine receptors. The functional interleukin 3 receptor is a heterodimer comprising a specific alpha chain (IL-3A; CD 123) and an IL-3 receptor beta chain (beta theta; CD 131) shared with receptors for granulocyte macrophage colony-stimulating factor (GM-CSF) and interleukin 5 (IL-5). CD123 is a type I integral transmembrane protein of deduced molecular weight of about 43kDa that contains an extracellular domain involved in IL-3 binding, a transmembrane domain and a short cytoplasmic tail of about 50 amino acids. The extracellular domain consists of two regions: an N-terminal region of about 100 amino acids, the sequence of which exhibits similarity to the equivalent regions of the GM-CSF and IL-5 receptor alpha chain; and a region adjacent to the transmembrane domain that contains four conserved cysteine residues and motifs common to other members of this cytokine receptor family. The IL-3 binding domain comprises a Cytokine Receptor Motif (CRM) of about 200 amino acid residues consisting of two IG-like folding domains. The extracellular domain of CD123 is highly glycosylated, with N-glycosylation required for both ligand binding and receptor signaling. The protein family aggregates three members: IL3RA (CD 123A), CSF2RA, and IL5RA. The overall structure is very conserved among the three members, but the sequence homology is very low. A 300 amino acid subtype of CD123 has been found to date, but is only accessible at the RNA level in the GetEntry database under accession number ACM 24116.1. The reference sequences for the full length human CD123 protein, including the signal peptide, can be obtained from NCBI databases under accession numbers np_002174.1 and Uniprot accession number P26951. The extracellular domain (ECD) of human CD123 consists of the amino acid sequence of SEQ ID NO: 86. CD123 (interleukin-3 receptor alpha chain IL-3 Ra) is a tumor antigen that is overexpressed in a variety of hematological tumors. Most AML blast cells express surface CD123 and this expression does not vary with the subtype of AML. Higher expression of CD123 on AML at diagnosis has been reported to be associated with a worse prognosis. CD123 expression has been reported in other hematological malignancies including myelodysplasia, systemic mastocytosis, blast plasmacytoid dendritic cell tumor (BPDCN), ALL, and hairy cell leukemia.
As used herein, "natural killer cells" or "NK cells" refer to a sub-population of lymphocytes involved in non-conventional immunity. NK cells can be identified by certain characteristics and biological properties, such as the expression of specific surface antigens including CD16, CD56 and/or CD57, the absence of NKp46, alpha/beta or gamma/delta TCR complexes on the cell surface for human NK cells, the ability to bind and kill cells that fail to express "self" MHC/HLA antigens by activating specific cell lysis mechanisms, the ability to kill tumor cells or other diseased cells that express ligands for NK activated receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit immune responses. Any of these features and activities can be used to identify NK cells using methods well known in the art. Any sub-population of NK cells will also be covered by the term NK cells. In the context of this document, "active" NK cells refer to biologically active NK cells, which include NK cells that have the ability to lyse target cells or enhance the immune function of other cells. NK cells can be obtained by various techniques known in the art, such as isolation from blood samples, cytoplast, tissue or cell collection, and the like. Useful protocols involving NK cell assays can be found in the following documents: natural Killer Cells Protocols (edited by Campbell KS and Colonna M.) Human Press. Pages 219-238 (2000).
As used herein, "NKp46" marker or "natural cytotoxicity trigger receptor 1" is also referred to as "CD335" or "NKp46" or "NK-p46" or "LY94", which refers to a protein or polypeptide encoded by the Ncr1 gene. The reference sequence for the full-length human NKp46 protein is available from NCBI database under accession number np_ 004820. The human NKp46 extracellular domain (ECD) corresponds to the amino acid sequence of SEQ ID NO. 84. The human NKp46 mRNA sequence is described in NCBI accession No. nm_ 004829.
As used herein, the term "Fc-gamma receptor" or "fcγr" or "fcγreceptor" may refer to activation and inhibition of fcγr. The Fc-gamma receptor (FcgammaR) is a cellular receptor for the Fc region of immunoglobulin G (IgG). Upon binding of complexed IgG, fcγr can modulate cellular immune effector functions, thereby linking adaptation to the innate immune system, including ADCC-mediated immune responses. In humans, six classical fcγrs are currently reported: a high affinity receptor (fcyri) and five low to medium affinity fcyri's (fcyriia, fcyriib and fcyriic, fcyriiia and fcyriiib). All fcγrs bind the same region on IgG Fc, but have different high (fcgcri) and low (fcgcrii and fcgcriii) affinities. At the functional level, most fcγrs are activating receptors that can induce the cellular responses mentioned above, including ADCC mediated immune responses. Fcyri, fcyriia, fcyriic, and fcyriiia are activating receptors characterized by an intracellular immune receptor tyrosine activating motif (ITAM), whereas fcyriib has an inhibitory motif (ITIM) and is therefore inhibitory. Unless otherwise specified, the term fcγr encompasses activating receptors, including fcγri (CD 64), fcγriia (CD 32 a), fcγriiia (CD 16 a) and fcγriiib (CD 16 b), and preferably fcγriiia (CD 16 a).
As used herein, the term "fcyriiia (CD 16 a)" or "fcyriiia" or "CD16a" or "CD16" or "cluster of differentiation 16" may refer to 50-65kDa cell surface molecules expressed as transmembrane receptors on mast cells, macrophages and natural killer cells. Fcγriiia is an activating receptor that contains an Immunoreceptor Tyrosine Activating Motif (ITAM) in the related fcrγ chain, which is required for receptor expression, surface assembly and signaling. CD16a is a low affinity receptor for IgG and is an important receptor for mediating ADCC (antibody dependent cell-mediated cytotoxicity) of NK cells. The high affinity receptor CD16a is preferentially found on NK cells and monocytes and induces Antibody Dependent Cellular Cytotoxicity (ADCC) upon IgG binding.
As used herein, the term "fcγrii CD32", "fcγrii", "FCGR2" or "CD32A" or "CD32" or "cluster of differentiation 32" is a surface receptor glycoprotein belonging to the Ig gene superfamily. CD32A is expressed on all bone marrow cells but not on lymphocytes. CD32 has low affinity for the Fc region of IgG antibodies in monomeric form, but high affinity for IgG immune complexes. CD32 has two main functions: cellular response regulation and immune complex uptake. Cellular responses mediated by CD32 include phagocytosis, cytokine stimulation, and endocytosis. Deregulated CD32 is associated with different forms of autoimmunity, including systemic lupus erythematosus. In humans, there are three major CD32 subtypes: CD32A, CD B and CD32C. While CD32A and CD32C are involved in activating cellular responses, CD32B is inhibitory and balances the activation properties of CD 32A. CD32A is an activated subtype of CD32 that can be found on a variety of immune cells. Notably, CD32A (fcyriia) mediates effector functions of granulocytes, monocytes, B cells, platelets and dendritic cells following low affinity binding of aggregated IgG. Cytoplasmic ITAM, when combined with IgG immune complexes, can promote phagocytic activity and cytokine secretion by neutrophils and macrophages.
As used herein, the term "hfcyricd 64", "hfcyri" or "CD64" or "colony 64" is a surface receptor constitutively expressed on monocytes and macrophages only, but upregulated on granulocytes following cytokine stimulation.
As used herein, the terms "form 5" or "F5", "form 25" or "F25", "form F6" or "F6" and "form 26" or "F26" refer to specific binding protein configurations of bispecific or multispecific antibodies that are specifically designed to engineer multiple antigen-binding domains into a single antibody molecule. Comprising an NKp46 binding domainAnd CD123 binding domain the multifunctional binding proteins of the present disclosure were prepared based on the F25 format, as exemplified in fig. 1 and 2. F25 and form F26 differ from forms F5 and F6, respectively, by a C between the second and third polypeptide chains H 1/C L Pairs are exchanged to form C L /C H 1 pair. The F5 and F6 forms have been previously described in international patent application WO 2017114694, which is incorporated herein by reference.
As used herein, the term "bispecific binding protein" refers to a binding protein that specifically binds to two different antigen targets (e.g., human NKp46 and human CD 123) via two different Antigen Binding Domains (ABDs).
As used herein, the term "specifically binds to" or "specifically binds" refers to an Antigen Binding Domain (ABD) to at least about 1x 10 -6 M、1x 10 -7 M、1x 10 -8 M、1x 10 -9 M、1x 10 -10 M、1x 10 -11 M、1x 10 -12 M or greater Kd binds to an epitope-containing antigen (e.g., human NKp46 and/or human CD 123), and/or the ability to bind to an epitope with an affinity that is at least twice greater than its affinity for a non-specific antigen.
As used herein, the term "specifically binds to a human NK46 polypeptide" may refer to specific binding to a polypeptide comprising the amino acid sequence of SEQ ID No. 84.
As used herein, the term "specifically binds to a human CD123 polypeptide" may refer to specific binding to a polypeptide comprising the amino acid sequence of SEQ ID No. 86.
As used herein, the term "binds to a human Fc-gamma receptor polypeptide" may refer to the binding of a polypeptide comprising the amino acid sequence of SEQ ID No. 87 or SEQ ID No. 88.
Competitive binding assays and other methods for determining specific binding are described further below and are well known in the art. Expression such as "specific binding" or "specific for" may be used interchangeably. Those terms are not to be construed as merely referring to those antibodies, polypeptides and/or multi-chain polypeptides that actually bind to the target/binding partner, but rather, although Those that are provided in non-binding form but retain specificity for the target. Binding specificity may be determined by the affinity constant KA (or K A ) And dissociation constant KD (or K) D ) To quantitatively determine.
As used herein, the term "affinity", concentration (EC 50), or equilibrium dissociation constant (KD) means the binding strength of an antibody or polypeptide to an epitope. The affinity of an antibody is given by a specific type of equilibrium constant (which is the dissociation constant KD), defined as [ Ab ]]x[Ag]/[Ab-Ag]Wherein [ Ab-Ag]Is the molar concentration of the antibody-antigen complex, [ Ab ]]Is the molar concentration of unbound antibody, [ Ag ]]Is the molar concentration of unbound antigen. The affinity constant KA is defined as 1/KD. Preferred methods for determining affinity of mabs can be found in the following documents: harlow et al, antibodies A Laboratory Manual, cold Spring Harbor Laboratory Press, cold spring harbor, new York, 1988; coligan et al, editions, current Protocols in Immunology, greene Publishing Assoc. And Wiley Interscience, new York, (1992,1993); and Muller, meth. Zymol.92:589-601 (1983), which is incorporated herein by reference in its entirety. One preferred and standard method for determining affinity of a mAb well known in the art is to use Surface Plasmon Resonance (SPR) screening (e.g., by using BIAcore TM The SPR analysis apparatus performs analysis). In a non-limiting manner, K is less than 50nM as determined by SPR and under physiological conditions (e.g., under normal buffer conditions at a pH in the range of 6 to 8) D May be generally considered to be indicative of the specificity of the antigen-Antigen Binding Domain (ABD) interaction.
Illustratively, and according to some specific and exemplary embodiments, the binding proteins reported herein comprise:
-an antigen binding domain that under physiological conditions is at a K of less than 10nM D In particular with a K of less than 0.5nM D Specifically binds to human CD123 as determined by SPR;
-an antigen binding domain that under physiological conditions is at a K of less than 50nM D In particular with a K of less than 20nM D Specifically binds to human NKp46 as determined by SPR.
As used herein, the term "and/or" is a grammatical conjunctive term that is to be interpreted as covering one or more instances in which it is connected. For example, the phrase "such native sequence proteins can be prepared using standard recombinant and/or synthetic methods" indicates that the native sequence proteins can be prepared using standard recombinant and synthetic methods, or the native sequence proteins can be prepared using standard recombinant methods, or the native sequence proteins can be prepared using synthetic methods.
As used herein, "treatment" refers to therapeutic use (i.e., for a subject with a given disease) and means reversing, alleviating, inhibiting the progression of one or more symptoms of such disorders or conditions. Thus, treatment refers not only to treatment that results in complete cure of the disease, but also to treatment that slows disease progression and/or prolongs survival of the subject.
As used herein, "prevent" means prophylactic use (i.e., for a subject predisposed to a given disease), and encompasses treatment of patients with relapsed AML.
As used herein, the term "therapeutically effective amount" of a multifunctional binding protein or pharmaceutical composition thereof means a sufficient amount of an antibody-like multifunctional binding protein to treat the cancer disease at a reasonable benefit/risk ratio applicable to any medical treatment. However, it will be appreciated that the total daily amount of the polypeptides and compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific polypeptide employed; the specific composition employed, the age, weight, general health, sex and diet of the patient; the time of administration, route of administration and rate of excretion of the particular polypeptide employed; duration of treatment; a medicament for use in combination or simultaneously with the particular polypeptide employed; and similar factors well known in the medical arts. For example, it is well known in the art to start doses of the compound at levels below those required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved.
As used herein, the terms "subject" or "individual" or "patient" are used interchangeably and may encompass a human or non-human mammal, a rodent or a non-rodent. The term includes, but is not limited to, mammals, e.g., humans (including men, women and children), other primates (monkeys), pigs, rodents (e.g., mice and rats, rabbits, guinea pigs, hamsters), cows, horses, cats, dogs, sheep, and goats.
As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "pharmaceutically acceptable carrier" encompasses a variety of pharmaceutically acceptable carriers, including mixtures thereof.
As used herein, "plurality" may thus include "two" or "two or more".
As used herein, "antibody" or "immunoglobulin" may refer to a natural or conventional antibody in which two heavy chains are linked to each other by disulfide bonds, and each heavy chain is linked to a light chain by disulfide bonds. There are two types of light chains, namely Lanbuda (lambda) and Kapa (kappa). The existence of five major heavy chain classes (or isotypes) determines the functional activity of an antibody molecule: igM, igD, igG, igA and IgE. Each chain contains a different sequence domain. The light chain comprises two domains or regions, i.e., the variable domains (V L ) And constant domain (C L ). Heavy chains typically comprise four domains, i.e., the variable domains (V H ) And three constant domains (C H 1、C H 2 and C H 3, collectively referred to as C H ). Specifically, classes IgG, igA and IgD have three heavy chain constant region domains, designated C H 1、C H 2 and C H 3, a step of; and IgM and IgE classes have four heavy chain constant region domains, C H 1、C H 2、C H 3 and C H 4. The variable regions of both the light chain (VL) and heavy chain (VH) determine the binding recognition and specificity for an antigen. The constant region domains of the light Chain (CL) and heavy Chain (CH) confer important biological properties such as antibody chain association, secretion, transplacental mobility, complement binding and binding to Fc receptors (FcR). Fv fragments are immunoglobulinsThe N-terminal portion of an antigen binding fragment (Fab) of a protein, and consists of a variable portion of one light chain and one heavy chain.
As used herein, references to "IgG" or "immunoglobulin G" generally include IgG1, igG2, igG3, and IgG4 unless otherwise defined. In particular, igG is IgG1.
As used herein, the term "antibody-like" or "immunoglobulin-like" polypeptide may also refer to non-conventional or synthetic antigen binding polypeptides or binding proteins, including single domain antibodies and fragments thereof, particularly the variable heavy chains of single domain antibodies, as well as chimeric, humanized, bispecific or multimeric antibodies.
As used herein, the term "multifunctional binding protein" encompasses a multi-chain protein, including but not limited to antibody-like polypeptides or protein forms, comprising at least one first variable region (e.g., a first immunoglobulin heavy chain variable domain (V H ) And/or immunoglobulin light chain variable domain (V L ) And at least one second variable region that specifically binds to a human NKp46 polypeptide (e.g., a second immunoglobulin heavy chain variable domain (V H ) And/or immunoglobulin light chain variable domain (V L )). Although not particularly limited to a particular type of construct, one general embodiment is specifically contemplated throughout the specification: polypeptide constructs reported in WO 2015197593 and WO 2017114694, each of which applications is incorporated herein by reference. In particular, multifunctional binding proteins, such as those reported in WO 2015197593 and WO 2017114694, may encompass any construct comprising one or more polypeptide chains.
As used herein, the term "humanized" as in "humanized antibody" refers to polypeptides (i.e., antibodies or antibody-like polypeptides) that are entirely or partially of non-human origin and that have been modified to replace certain amino acids, particularly in the framework regions of the heavy and light chains, to avoid or minimize an immune response in humans. The constant domain of the humanized antibody is human C for the majority of the time H And C L A domain. Many methods for humanizing antibody sequences are known in the art; see for example,Almagro&a review of Franson (2008) Front biosci.13:1619-1633. One common approach is CDR grafting or antibody remodeling, which involves grafting CDR sequences of a donor antibody (typically a mouse antibody) into the framework scaffold of a human antibody of different specificity.
For chimeric antibodies, humanization typically involves modification of the framework regions of the variable region sequences. Amino acid residues that are part of a CDR will not typically be altered in connection with humanized binding, but in some cases it may be desirable to alter individual CDR amino acid residues, e.g., to remove glycosylation sites, deamidation sites, or unwanted cysteine residues. N-linked glycosylation is performed by attaching an oligosaccharide chain to an asparagine residue of the tripeptide sequence Asn-X-Ser or Asn-X-Thr, wherein X may be any amino acid other than Pro. Removal of the N-glycosylation site can be achieved by mutating the Asn or Ser/Thr residues to different residues, in particular by means of conservative substitutions. Deamidation of asparagine and glutamine residues can be performed depending on factors such as pH and surface exposure. Asparagine residues are particularly prone to deamidation, mainly when present in the sequence Asn-gly, and to a lesser extent in other dipeptide sequences such as Asn-Ala. When such deamidation sites, in particular Asn-Gly, are present in the CDR sequences, it may therefore be desirable to remove said sites, typically by conservative substitution removal of one of the residues involved. Substitutions in the CDR sequences to remove one of the residues involved are also intended to be encompassed by the claimed multifunctional binding proteins.
As used herein, the term "conservative amino acid substitution" refers to a substitution in which an amino acid residue is replaced with an amino acid residue having a side chain with similar physicochemical properties. Families of amino acid residues with similar side chains are known in the art and include amino acids with the following side chains: basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). When the amino acids belong to two different classes (i.e., tyrosine and phenylalanine), both are acceptable. For reference, the following classifications will be followed throughout the specification unless stated otherwise.
As used herein, the term "domain" may be any region in a protein that is associated with a particular structure or functional entity, typically defined based on sequence homology or identity. Thus, the term "region" as used in the context of the present disclosure is broader in that it may include additional regions beyond the corresponding domains.
As used herein, the term "linker region," "linker peptide" or "linker polypeptide" or "amino acid linker" or "linker" refers to any amino acid sequence suitable for covalently linking two polypeptide domains (e.g., two antigen binding domains) together and/or covalently linking an Fc region to one or more variable regions (e.g., one or more antigen binding domains). Although the term is not limited to a particular size or polypeptide length, such amino acid linkers are typically less than 50 amino acids in length, preferably less than 30 amino acids in length, such as 20 or less than 20 amino acids in length, such as 15 or less than 15 amino acids in length. Such amino acid linkers may optionally comprise all or part of an immunoglobulin polypeptide chain, such as all or part of an immunoglobulin hinge region. Alternatively, the amino acid linker may comprise a polypeptide sequence that is not derived from an immunoglobulin hinge region, or even a polypeptide sequence that is not derived from an immunoglobulin heavy or light polypeptide chain.
As used herein, an immunoglobulin hinge region or fragment thereof may thus be considered a specific type of linker that is derived from an immunoglobulin polypeptide chain.
As used herein, the term "hinge region" or "hinge" refers to a region that is generally flexible and is defined by the corresponding heavy chain polypeptideProduced, and which separates the Fc and Fab portions of certain isotypes of immunoglobulins, more particularly IgG, igA or IgD isotypes. Such hinge regions are known in the art and depend on the isotype of the immunoglobulin under consideration. For the natural IgG, igA and IgD isotypes, the hinge region will therefore be C H 1 domain and C H The 2 domains are separated and are typically cleaved upon papain digestion. On the other hand, the region corresponding to the hinge in IgM and IgE heavy chains is typically formed by an additional constant domain that is less flexible. In addition, the hinge region may comprise one or more cysteines that participate in interchain disulfide bonds. When applicable, except by C H The hinge region may comprise one or more binding sites for fcγreceptor in addition to the fcγr binding site generated by domain 2. Furthermore, depending on the isoform under consideration, the hinge region may comprise one or more post-translational modifications, such as one or more glycosylated residues. Thus, it will be readily understood that the volumetric term "hinge" throughout this specification is not limited to a particular set of hinge sequences or a particular location on a structure. Unless otherwise indicated, hinge regions still specifically contemplated include all or part of a hinge from an immunoglobulin belonging to one isotype selected from: igG isotype, igA isotype and IgD isotype; in particular the IgG isotype.
As used herein, the term "CH domain" or "C H The domain "or" constant domain "may be used interchangeably and refers to any one or more heavy chain immunoglobulin constant domains. Such C H The domains naturally fold into immunoglobulin-like domains, but they may be partially disordered in isolated form (e.g., when the constant domain (C L ) When irrelevant, C H 1 domain). Unless otherwise indicated, the terms may thus refer to C H 1 domain, C H 2 domain, C H 3 domain; or any combination thereof.
As used herein, the term "CH1 domain" or "C H 1 domain "or" constant domain 1 "can be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 1.
As used herein, the term "CH2 domain" or "C H 2 domain "or" constant domain 2 "may be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 2.
As used herein, the term "CH3 domain" or "C H 3 domain "or" constant domain 3 "may be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 3.
As used herein, as in (C H 2-C H 3) A And (C) H 2-C H 3) B The term "C" in H 2-C H 3 "thus means comprising immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3) Is a polypeptide sequence of (a).
As used herein, the term "CL domain" or "C L The domain "is used interchangeably and refers to the corresponding light chain immunoglobulin constant domain. Unless otherwise indicated, the term may thus encompass kappa (kappa or K ) Or C of the light chain of the immunoglobulin of the Lanbuda (lambda) class L Domains, including all known subtypes (e.g., lambda 1 、λ 2 、λ 3 And lambda (lambda) 7 ). In particular, when C L When the domain is kappa, it may also be referred to herein as Ckappa or C K Or C k A domain.
As used herein, the term "pair C (C H 1/C L ) Or pair C (C) H 1/C L ) "means one constant heavy chain domain 1 and one constant light chain domain (e.g., kappa (kappa or kappa) K ) Or a light chain of an immunoglobulin of the Lanbuda (lambda) class); thereby forming a heterodimer. Unless otherwise specified, the term thus may encompass all possible combinations when the constant chain domains forming the pair are not present on the same polypeptide chain. Preferably, correspond to C H 1 and C L The domains will thus be chosen to be complementary to each other such that they form a stable pair C (C H 1/C L )。
Advantageously, the method comprisesWhen the binding protein comprises a plurality of paired C domains, e.g., a "pair C 1 (C H 1/C L ) And one pair C 2 (C H 1/C L ) "when forming each C of the pair H 1 and C L The domains will be selected such that the pairs are complementary at C H 1 and C L Domains are formed between. Complementary C H 1 and C L Examples of domains have been described previously in international patent applications WO 2006064136 or WO 2012089814 or WO 2015197593 A1.
Unless otherwise indicated, the term "pair C 1 (C H 1/C L ) "OR" pair C 2 (C H 1/C L ) "may refer to a heavy chain made up of identical or different constant heavy chain 1 domains (C H 1) And the same or different constant light chain domains (C L ) Different constant pair domains (C 1 And C 2 ). Preferably, the term "pair C 1 (C H 1/C L ) Or pair C2 (C H 1/CL) "may refer to a chain composed of the same constant heavy chain 1 domain (C H 1) And the same constant light chain domain (C L ) Different constant pair domains (C 1 And C 2 )。
As used herein, the term "Fc region" or "fragment crystallizable region" or alternatively "Fc portion" encompasses all or part of an "Fc domain" which may thus include an immunoglobulin hinge region (which naturally carries the first binding site of fcγr), C H 2 domain (which naturally carries a second binding site for FcgammaR) and C of an immunoglobulin (e.g.of an IgG, igA or IgD immunoglobulin) H 3 domains and/or C (e.g. of IgM and IgE) of immunoglobulins, where applicable H 4 or a portion thereof. Preferably, the Fc region comprises at least C H 2 domain and C H All or part of the 3 domain, and optionally all or part of the immunoglobulin hinge region. Thus, the term may refer to a molecule comprising a sequence of a non-antigen binding fragment obtained by digestion of an antibody or otherwise produced, in monomeric or multimeric form, and may contain a hinge region. In particular, the original immunization of native FcThe source of the globulin is of human origin and may be any immunoglobulin, but IgG1 is preferred. Natural Fc molecules are composed of monomeric polypeptides that can be linked into dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent associations. The number of intermolecular disulfide bonds between monomer subunits of a native Fc molecule ranges from 1 to 13, depending on the class (e.g., igG, igA, and IgE) or subclass (e.g., igG1, igG2, igG3, igGA1, and IgGA 2). An example of a natural Fc is a disulfide-bonded dimer resulting from papain digestion of IgG. The term "native Fc" as used herein generally refers to monomeric, dimeric and multimeric forms. Under this term, the "Fc region" may thus comprise or consist of: c (C) H 2-C H 3 (e.g., (C) H 2-C H 3) A Or (C) H 2-C H 3) B Or a binding pair thereof, and optionally all or part of an immunoglobulin hinge region, comprising a binding site for human fcγr. The term "Fc region" may refer to a native or variant Fc region unless otherwise specified.
The term "Fc variant" as used herein refers to a molecule or sequence that is modified from a native Fc but still comprises the binding site for the receptor FcRn (neonatal Fc receptor). Exemplary Fc variants and their interactions with the receptor are known in the art. Thus, the term "Fc variant" may include a molecule or sequence that is humanized from a non-human natural Fc. Furthermore, native fcs contain regions that can be removed because the structural features or biological activity they provide are not required for the antibody-like binding proteins of the invention. Thus, the term "Fc variant" includes molecules or sequences that lack one or more native Fc sites or residues, or in which one or more Fc sites or residues have been modified, which affect or participate in: (1) disulfide bond formation, (2) incompatibility with the selected host cell, (3) N-terminal heterogeneity when expressed in the selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors outside of the salvage receptor, or (7) Antibody Dependent Cellular Cytotoxicity (ADCC).
Fragments according to the present disclosure can crystallize (Fc) regions (e.g., native or variant) retaining the ability to bind human Fc-gamma receptor polypeptides (fcγ), which are generally understood to beOccurs over the binding of the Fc-hinge region of the antibody to the native Fc region. For reference, the overall structure of IgG1, igG2 and IgG4 is similar, with sequence homology exceeding 90%, the main difference being the hinge region and C H 2, which form the primary binding site to fcγr. The hinge region also serves as a flexible linker between the Fab and Fc portions.
Further contemplated are Fc regions having one or more amino acid modifications (e.g., substitutions, deletions, insertions) in one or more portions as Fc regions that increase the affinity and avidity of the variant Fc region for fcγr (including activating and inhibiting fcγr). In some embodiments, the one or more amino acid modifications increase the affinity of the Fc region for fcyriiia and/or fcyriia. In another embodiment, the variant Fc region further specifically binds fcyriib with a lower affinity than the Fc region of a reference parent antibody (e.g., an antibody having the same amino acid sequence as the antibody except for one or more amino acid modifications in the Fc region). Thus, the native and variant Fc regions contemplated herein typically comprise domains capable of binding to human CD16 (i.e., C H 2) for example, a human Fc domain comprising N-linked glycosylation at amino acid residue N297 (numbering according to EU).
As used herein, the term "Fc competent" thus refers to a binding protein capable of specifically binding fcγr, in particular activating fcγr, in particular one selected from fcγri (CD 64 a), fcγriia (CD 32 a) and fcγriiia (CD 16 a), and more particularly fcγriiia (CD 16 a).
Alternatively, several modifications have been reported to directly affect binding to fcγr, including mutations at residue 297 (according to EU numbering), or alternatively at residues 234 and 235 in the lower hinge region (according to EU numbering system).
As used herein, the term "Fc silencing" refers to a binding protein having an Fc region that lacks a binding site to fcγr (e.g., lacks C having the binding site H 2 and an Fc region having a hinge region of said binding site); in particular fcyri, fcyriia and fcyriiia, and more particularly fcyriiia (CD 16 a).
As used herein, the term "variable" as in "variable domain" refers to portions of a related binding protein whose sequences vary widely between antibodies and are used for specific recognition and binding of a particular antibody to its particular target. However, variability is not evenly distributed throughout the variable domains of antibodies. Variability is concentrated in three segments of the light and heavy chain variable domains called complementarity determining regions (CDRs; i.e., CDR1, CDR2 and CDR 3), also known as hypervariable regions. The more conserved portions of the variable domains are referred to as Framework (FR) regions or sequences.
As used herein, the term "VH domain" or "V H Domain "is used interchangeably and refers to the corresponding heavy chain immunoglobulin variable domain.
As used herein, the term "VL domain" or "V L Domain "is used interchangeably and refers to the corresponding light chain immunoglobulin variable domain.
Where the VH or VL domain is associated with a first Antigen Binding Domain (ABD) or with a second antigen binding domain, respectively, they may also be referred to herein as "V H 1 "and" V L 1", or" V H 2 "and" V L 2”。
The term "binding pair V (VH/VL)", "V H /V L For OR (V) H /V L ) For "or" V L /V H For OR (V) L /V H ) The pair "may be used interchangeably. The heavy and light chain variable domains can be paired in parallel to form an Antigen Binding Domain (ABD). Each binding pair comprises V H And V L Both zones. Unless indicated otherwise, these terms do not specify which immunoglobulin variable regions are V H Or V L Regions and which ABDs will specifically bind to proteins expressed on the surface of immune effector cells or target cells (e.g., NKp46 and CD 123).
As used herein, the term "hypervariable region" refers to the amino acid residues of an antibody that are responsible for antigen binding. The term may be replaced with the term "complementarity determining region" or "CDR".
Thus, as used herein, "complementarity determining regions" or "CDRs" refer to amino acid sequences that collectively define the binding affinity and specificity of a native Fv region of a native immunoglobulin binding site. The light and heavy chains of immunoglobulins each have three CDRs designated CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3, respectively. Thus, a conventional antibody antigen binding domain comprises six CDRs, including sets of CDRs from each of the heavy and light chain variable regions. Furthermore, as used herein, "framework regions" (FR) refer to amino acid sequences inserted between CDRs, i.e., those portions of immunoglobulin light and heavy chain variable regions that are relatively conserved between different immunoglobulins of a single species. The light and heavy chains of immunoglobulins each have four FRs, designated FR-L1, FR-L2, FR-L3, FR-L4 and FR-H1, FR-H2, FR-H3 and FR-H4, respectively. Thus, the light chain variable domain may thus be named (FR-L1) - (CDR-L1) - (FR-L2) - (CDR-L2) - (FR-L3) - (CDR-L3) - (FR-L4), and the heavy chain variable domain may thus be named (FR-H1) - (CDR-H1) - (FR-H2) - (CDR-H2) - (FR-H3) - (CDR-H) - (FR 4-H3).
Hypervariable regions typically comprise amino acid residues from the "complementarity determining regions" or "CDRs" (e.g., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; kabat et al 1991) and/or those residues from the "hypervariable loops" (e.g., residues 26-32 (L1), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain; chothia and Lesk; J.mol. Biol 1987; 196:917-917). Numbering of amino acid residues in this region is performed by the method described in Kabat et al, supra. Thus, phrases such as "Kabat positions", "variable domain residues numbered according to Kabat", and "according to Kabat" herein refer to such numbering systems for either heavy chain variable domains or light chain variable domains. Using the Kabat numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids, which correspond to a shortening or insertion of the FR or CDR of the variable domain. For example, the heavy chain variable domain may include a single amino acid insert following residue 52 of CDR H2 (residue 52a according to Kabat) and residues inserted following heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c according to Kabat, etc.). The Kabat numbering of residues of a given antibody may be determined by aligning regions of antibody sequence homology with the sequences of "standard" Kabat numbering.
Optionally, the CDRs are defined by EU, kabat, chotia or IMGT numbers. Correspondence between those classifications is known in the art, referenceOr international ImMunoGeneTics information->(CNRS and Meng Beili Yes university) and are further detailed as in Lefranc (biomalecules; 2014;4, 1102-1139) and Dondelinger (Frontiers in Immunology;2018;9, 2278).
Unless otherwise indicated, the numbering of residues will be considered herein by reference to EU, kabat, chotia or IMGT numbering convention. If a conflict occurs with respect to the exact position of the hypervariable region within the reference sequence, the Kabat numbering convention is in control. If the exact positions of the constant regions in the reference sequences conflict, the EU numbering convention will be followed.
As used herein, the term "cytotoxicity" refers to the property of a compound (e.g., a multifunctional binding protein according to the present disclosure) to be toxic to tumor cells. Cytotoxicity can be induced by different mechanisms of action and thus can be categorized as cell-mediated cytotoxicity, apoptosis, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP) or complement-dependent cytotoxicity (CDC).
As used herein, the term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a cell-mediated immune defense mechanism whereby effector cells of the immune system actively lyse target cells whose membrane surface antigens have been bound by specific antibodies or multifunctional binding proteins of the present disclosure.
As used herein, the terms "proliferative disorder", "hyperproliferative disorder" and/or "cancer" refer not only to solid tumors, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and distal metastases thereof, but also to hematological cancers, including tumors of hematopoietic and lymphoid tissues, such as lymphomas, myelomas and leukemias. Leukemias include, but are not limited to, acute myelogenous leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.
As used herein, "Acute Myelogenous Leukemia (AML)" is a clonal disorder that is manifested clinically as heterogeneity and increased proliferation of undifferentiated medulloblasts. Without wishing to be bound by theory, the leukemic grade is maintained by a small population of LSCs (leukemia stem cells) (AML-LSCs), which have unique self-renewal capacity and are capable of differentiating into leukemia progenitor cells. These progenitor cells produce a large number of leukemic blast cells that are readily detected in patients at the time of diagnosis and recurrence, ultimately leading to death. AML-LSC is generally reported as resting cells, in contrast to rapidly dividing clonogenic progenitor cells.
In the case of AML, the term "recurrence" may be defined specifically as the recurrence of AML after complete remission. In this sense, "complete mitigation" or "CR" may be defined as follows: normal value of neutrophils>1.0*10 9 Per liter), hemoglobin level of 10g/dl and platelet count>100*10 9 L) independent of erythrocyte infusion; less than 5% of blasts, no clusters or collections of blasts, and no Auer rods in bone marrow examination; and normal maturation of blood cells (morphology; bone marrow cell differential count image) and absence of extramedullary leukemia.
As used herein, a "myelodysplastic syndrome" ("MDS"), previously known as a pre-leukemia, is a collection of blood disorders that involve the ineffective production (or dysplasia) of myeloid blood cells. They represent a series of clonal hematopoietic stem cell disorders characterized by progressive bone marrow failure and an increased risk of progression to acute myelogenous leukemia ("AML", also known as "acute myelogenous leukemia"). International prognostic scoring systems ("IPSS") are widely used to identify patients with high risk characteristics based on the severity of cytopenia, percentage of myeloblasts, and cytogenetic abnormalities.
As used herein, "pharmaceutically acceptable carrier" is intended to include any and all carriers (e.g., any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like) compatible with pharmaceutical administration, particularly parenteral administration. The use of such media and agents for pharmaceutically active substances is known. Such media may be used in the compositions of the present disclosure unless any conventional media or agent is incompatible with the active compound. For example, formulations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol/water solutions, emulsions or suspensions, including saline and buffered media. In a non-exhaustive manner, pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1M (e.g., 0.05M) phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solutions, ringer's dextrose, dextrose and sodium chloride, lactated ringer's solution or fixed oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (such as those based on ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. More specifically, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (in the case of water-soluble solutions) or dispersions, as well as sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and should be fluid to the extent that easy injectability exists. It should be stable under the conditions of manufacture and storage and in embodiments will be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycols, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like). In certain embodiments, isotonic agents, for example, sugars, polyalcohols (e.g., mannitol, sorbitol), or sodium chloride are included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition absorption delaying agents (e.g., aluminum monostearate and gelatin).
As used herein, and unless otherwise indicated, the term "at least one" may encompass "one or more" or even "two or more/two or more" (or "multiple/multiple"). For example, it may encompass 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more than 100.
As used herein, and unless otherwise indicated, the term "less than.+ -." may encompass all values from 0 to the respective threshold. For example, it may encompass less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or less than 100 (where applicable).
As used herein, the term "cell" may encompass any prokaryotic or eukaryotic cell. Cell types that are particularly contemplated are those suitable for the production and/or engineering of recombinant antibodies or fragments or polypeptide chains thereof. In a non-exhaustive manner, such cells may be selected from: bacterial cells, yeast cells, mammalian cells, non-mammalian cells, insect cells, and plant cells.
The terms "host cell", "host cell line" and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells" which include primary transformed cells and progeny derived therefrom, irrespective of the number of passages. The offspring may not be exactly identical in nucleic acid content to the parent cell, but may contain mutations. Included herein are mutant offspring that have the same function or biological activity as selected or selected in the original transformed cell. Host cells are any type of cellular system that can be used to produce the binding proteins of the present disclosure. Thus host cells may include cultured cells, for example, mammalian cultured cells such as CHO cells, HEK cells, BHK cells, NS0 cells, SP2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, per.c6 cells or hybridoma cells, bacterial cells, yeast cells, insect cells and plant cells, to name a few.
An "isolated" nucleic acid molecule or polynucleotide is intended to be a nucleic acid molecule DNA or RNA that has been removed from its natural environment. For example, for the purposes of this disclosure, a recombinant polynucleotide encoding a polypeptide contained in a vector is considered isolated. Other examples of isolated polynucleotides include recombinant polynucleotides maintained in heterologous host cells or polynucleotides purified (partially or substantially) in solution. An isolated polynucleotide includes a polynucleotide molecule contained in a cell that normally contains the polynucleotide molecule, but the polynucleotide molecule is present extrachromosomally or at a chromosomal location different from its native chromosomal location. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the present disclosure, as well as positive and negative strand forms, as well as double stranded forms. Isolated polynucleotides or nucleic acids according to the present disclosure further include such molecules synthetically produced. In addition, the polynucleotide or nucleic acid may be or include regulatory elements such as promoters, ribosome binding sites or transcription terminators.
The term "vector" or "expression vector" is intended to mean a vehicle by which a nucleic acid, particularly a DNA or RNA sequence (e.g., an exogenous gene), can be introduced into a host cell to transform the host and facilitate expression (e.g., transcription and translation) of the introduced sequence.
Binding proteins
In one embodiment, the present disclosure relates to a binding protein characterized in that it comprises:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID No. 1 to SEQ ID No. 12, or a variant thereof having one or more conservative substitutions;
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the disclosure relates to a binding protein characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide,
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising at least one CDR selected from SEQ ID No. 13 to SEQ ID No. 40, or a variant thereof having one or more conservative substitutions;
and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID No. 1 to SEQ ID No. 12, or a variant thereof having one or more conservative substitutions; and
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising at least one CDR selected from SEQ ID No. 13 to SEQ ID No. 40, or a variant thereof having one or more conservative substitutions;
and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising three CDRs selected from SEQ ID No. 1 to SEQ ID No. 12, or a variant thereof having one or more conservative substitutions; and
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising three CDRs selected from the group consisting of SEQ ID NO 13 through to SEQ ID NO 40, or a variant thereof having one or more conservative substitutions, and
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) And immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regionsCDR-1 to CDR-3, respectively)
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and comprising an immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3, respectively),
and
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising an immunoglobulin heavy chain variable region (V) having three complementarity determining regions (at least one selected from the group consisting of SEQ ID NOs: 1 to 6) H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions (at least one selected from the group consisting of SEQ ID NOS: 7 to SEQ ID NO: 12) L )；
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising an immunoglobulin heavy chain variable region (V) having three complementarity determining regions (at least one selected from the group consisting of SEQ ID NO:13 through SEQ ID NO: 26) H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions (at least one selected from the group consisting of SEQ ID NO:27 through SEQ ID NO: 40) L )；
And
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising an immunoglobulin heavy chain variable region (V) having three complementarity determining regions (at least two selected from the group consisting of SEQ ID NOS: 1 through SEQ ID NO: 6) H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions (at least two selected from SEQ ID NOS: 7 to SEQ ID NO: 12) L )；
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising an immunoglobulin heavy chain variable region (V) having three complementarity determining regions (at least two selected from the group consisting of SEQ ID NO:13 through SEQ ID NO: 26) H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions (at least two selected from SEQ ID NOS: 27 to SEQ ID NO: 40) L )；
And
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that it comprises:
(i) A first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising an immunoglobulin heavy chain variable region (V H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions selected from SEQ ID NO. 7 through SEQ ID NO. 12 L )；
(ii) A second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising an immunoglobulin heavy chain variable region (V H ) And an immunoglobulin light chain variable region (V) having three complementarity determining regions selected from SEQ ID NO 27 through SEQ ID NO 40 L )；
And
(iii) An immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In some embodiments, the binding protein is characterized in that the first ABD specifically binds human CD123 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises CDRs-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 1 through SEQ ID NO. 3, respectively, or the amino acid sequences of SEQ ID NO. 4 through SEQ ID NO. 6, respectively.
According to some embodiments of the first general purposeThe binding protein is characterized in that the first ABD specifically binds human CD123 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 7 to SEQ ID NO. 9 or SEQ ID NO. 10 to SEQ ID NO. 12, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises CDRs-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 13 through SEQ ID NO. 15, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises CDRs-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 16 through SEQ ID NO. 18, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises CDRs-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 19 through SEQ ID NO. 21, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises CDRs-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 22 through SEQ ID NO. 24, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) The immunoglobulin heavy chain variable domain comprises a CDR-H1 corresponding to the amino acid sequences of SEQ ID NO. 16, SEQ ID NO. 25 and SEQ ID NO. 26, respectively,H2 and H3.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDRs-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 27 through SEQ ID NO. 29, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDRs-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 30 through SEQ ID NO. 32, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDRs-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 33 through SEQ ID NO. 35, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDRs-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 36 through SEQ ID NO. 38, respectively.
According to some embodiments of this first general purpose, the binding protein is characterized in that the second ABD specifically binds human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) The immunoglobulin light chain variable domain comprises CDRs-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO:39, SEQ ID NO:31 and SEQ ID NO:40, respectively.
According to one embodiment, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or a variant thereof, all or part, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) Andimmunoglobulin light chain variable domain (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NO. 1 to SEQ ID NO. 3 or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO. 4 to SEQ ID NO. 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO. 7 to SEQ ID NO. 9 or SEQ ID NO. 10 to SEQ ID NO. 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NO. 13 to SEQ ID NO. 15, respectively;
amino acid sequences of SEQ ID NO. 16 to SEQ ID NO. 18, respectively;
amino acid sequences of SEQ ID NO. 19 to SEQ ID NO. 21, respectively;
amino acid sequences of SEQ ID NO. 22 to SEQ ID NO. 24, respectively; or alternatively
Amino acid sequences of SEQ ID NO. 16, SEQ ID NO. 25 and SEQ ID NO. 26, respectively;
and
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NO. 27 to SEQ ID NO. 29, respectively;
amino acid sequences of SEQ ID NO. 30 to SEQ ID NO. 32, respectively;
amino acid sequences of SEQ ID NO. 33 to SEQ ID NO. 35, respectively;
amino acid sequences of SEQ ID NO. 36 to SEQ ID NO. 38, respectively; or alternatively
Amino acid sequences of SEQ ID NO. 39, SEQ ID NO. 31 and SEQ ID NO. 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
Those skilled in the art will readily appreciate that the binding proteins described above may consist of a single polypeptide chain or may be multimeric and thus comprise multiple (two or more) polypeptide chains.
According to some embodiments, the binding protein is a multimeric binding protein, and the two antigen-binding domains may be at least partially produced from different polypeptide chains.
Optionally, when the binding protein comprises multiple polypeptide chains (e.g., two or three polypeptide chains), some of these polypeptide chains may be covalently linked. When two polypeptide chains are covalently linked, the one or more covalent linkers may advantageously be selected from disulfide bonds or any other covalent linkers, including one or more peptide bonds bridging one polypeptide chain to another polypeptide chain and/or one or more linker peptides bridging one polypeptide chain to another polypeptide chain.
According to some embodiments, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) forming two ABD:
V 1A –C 1A –L 3 –(C H 2-C H 3) A (I)
V 1B –C 1B –L 4 –(C H 2-C H 3) B –L 1 –V 2A –C 2A –L 2 (II)
V 2B -C 2B (III)
wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constantDomain 1 and C L Is an immunoglobulin light chain constant domain;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 、L 2 、L 3 、L 4 Are optional independent amino acid linkers, which may be the same or different.
In some embodiments, (C) H 2-C H 3) A And (C) H 2-C H 3) B Each comprising at least one identical C H 2, e.g.C corresponding to the amino acid sequence of SEQ ID NO:71 H 2 domain.
In some embodiments, (C) H 2-C H 3) A And (C) H 2-C H 3) B Are identical or different and may comprise a polypeptide sequence selected from the amino acid sequences of SEQ ID NO:69 or SEQ ID NO: 70.
In some embodiments, L 1 、L 2 、L 3 And L 4 May be the same or different and may comprise all or part of an amino acid sequence selected from SEQ ID NO 74 to SEQ ID NO 79; for example, one or more than four consecutive amino acids of the amino acid sequence selected from SEQ ID NO:74 to SEQ ID NO: 79.
According to some embodiments, L 1 、L 2 、L 3 And L 4 May be the same or different and may comprise all or part of an immunoglobulin hinge region (e.g., an immunoglobulin hinge region selected from the group consisting of amino acid sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78 and/or SEQ ID NO: 79); for example four or more than four consecutive amino acids of an immunoglobulin hinge region, such as an immunoglobulin hinge region selected from the group consisting of amino acid sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78 and/or SEQ ID NO: 79.
According to some more specific embodimentsCase L 2 、L 3 And L 4 May be the same or different and may comprise all or part of an immunoglobulin hinge region (e.g., an immunoglobulin hinge region selected from the group consisting of the sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78 and/or SEQ ID NO: 79); for example, four or more consecutive amino acids of an immunoglobulin hinge region (e.g., an immunoglobulin hinge region selected from the group consisting of sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78 and/or SEQ ID NO: 79).
According to some more specific embodiments, L 2 、L 3 And L 4 May be the same or different and may comprise four or more than four contiguous amino acids of an immunoglobulin hinge region (e.g., an immunoglobulin hinge region selected from the sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78 and/or SEQ ID NO: 79), and L 1 All or part of the linker corresponding to the amino acid sequence of SEQ ID NO. 76 may be comprised.
According to some embodiments, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) forming two ABD, as defined below:
V 1A –C 1A –L 3 –(C H 2-C H 3) A (I)
V 1B –C 1B –L 4 –(C H 2-C H 3) B –L 1 –V 2A –C 2A –L 2 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Formation of binding pair V which specifically binds to human CD123 polypeptide 1 (V H1 /V L1 )；
V 2A And V 2B Formation of binding pair V which specifically binds to human NKp46 polypeptide 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 、L 2 、L 3 、L 4 Are optional independent amino acid linkers, which may be the same or different.
In one embodiment, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) forming two ABDs, as defined below:
V 1A -C 1A -hinge 1 -(C H 2-C H 3) A (I)
V 1B -C 1B -hinge 2 -(C H 2-C H 3) B -L 1 -V 2A -C 2A -hinge 3 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
hinge 1 Hinge 2 And hinge 3 Is the same or different and corresponds to all or part of an immunoglobulin hinge region;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 Is an amino acid linker.
In one embodiment, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) forming two ABDs, as defined below:
V 1A -C 1A -hinge 1 -(C H 2-C H 3) A (I)
V 1B -C 1B -hinge 2 -(C H 2-C H 3) B -L 1 -V 2A -C 2A -hinge 3 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Formation of binding pair V which specifically binds to human CD123 polypeptide 1 (V H1 /V L1 )；
V 2A And V 2B Formation of binding pair V which specifically binds to human NKp46 polypeptide 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
hinge 1 Hinge 2 And hinge 3 Is the same or different and corresponds to all or part of an immunoglobulin hinge region;
(C H 2-C H 3) A and (C) H 2-C H 3) B Is the same or differentAnd comprises an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 Is an amino acid linker.
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1A comprising C L A domain;
C 1B comprising C H 1 domain;
C 2A comprising C H 1 domain;
C 2B comprising C L A domain.
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1A Comprising C H 1 domain;
C 1B comprising C L A domain;
C 2A comprising C L A domain;
C 2B comprising C H 1 domain.
According to some of those embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1A comprising C H 1 domain;
C 1B comprising C L A domain;
C 2A comprising C H 1 domain;
C 2B comprising C L A domain.
According to some of those embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1A comprising C L A domain;
C 1B comprising C H 1 domain;
C 2A comprising C L A domain;
C 2B comprising C H 1 domain.
In some embodiments, C is formed 1A 、C 1B 、C 2A And C 2B C of (2) L And C H The 1 domains may be the same or different. Thus, in some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
-C 1A and C 2A Is identical and contains C L A domain; or alternatively
-C 1A And C 2B Is identical and contains C L A domain; or alternatively
-C 1B And C 2A Is identical and contains C L A domain; or alternatively
-C 1B And C 2B Is identical and contains C L A domain.
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
-C 1A and C 2A Is identical and contains C H 1 domain; or alternatively
-C 1A And C 2B Is identical and contains C H 1 domain; or alternatively
-C 1B And C 2A Is identical and contains C H 1 domain; or alternatively
-C 1B And C 2B Is identical and contains C H 1 domain.
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V H And V is 1B Is V L 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V L And V is 1B Is V H 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 2A Is V H And V is 2B Is V L 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 2A Is V L And V is 2B Is V H 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V H And V is 1B Is V L The method comprises the steps of carrying out a first treatment on the surface of the And V is 2A Is V H And V is 2B Is V L 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V L And V is 1B Is VH; and V is 2A Is V H And V is 2B Is V L 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V H And V is 1B Is V L The method comprises the steps of carrying out a first treatment on the surface of the And V is 2A Is V L And V is 2B Is V H 。
In some embodiments of polypeptide chains (I), (II) and (III): v (V) 1A Is V L And V is 1B Is V H The method comprises the steps of carrying out a first treatment on the surface of the And V is 2A Is V L And V is 2B Is V H 。
In some embodiments of the binding protein, V 1A Is V L1 And V is 1B Is V H1 The method comprises the steps of carrying out a first treatment on the surface of the And V is 2A Is V H2 And V is 2B Is V L2 。
In some embodiments of the binding protein, V 1A Is V L1 And V is 1B Is V H1 。
In some embodiments of the binding protein, V 2A Is V H2 And V is 2B Is V L2 。
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1B is immunoglobulin heavy chain constant domain 1 (C H 1)；
C 2A Is immunoglobulin heavy chain constant domain 1 (C H 1)；
C L Corresponds to immunoglobulin kappa light chain constant domain (C κ )；
(C H 2-C H 3) A An amino acid sequence corresponding to SEQ ID NO. 69;
(C H 2-C H 3) B an amino acid sequence corresponding to SEQ ID NO. 70;
L 2 or hinge 1 An amino acid sequence corresponding to SEQ ID NO. 74;
L 3 or hinge 2 An amino acid sequence corresponding to SEQ ID NO. 75;
L 4 or hinge 3 An amino acid sequence corresponding to SEQ ID NO. 77;
L 1 an amino acid sequence corresponding to SEQ ID NO. 76.
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by:
C 1B is immunoglobulin heavy chain constant domain 1 (C H 1)；
C 2A Is immunoglobulin heavy chain constant domain 1 (C H 1)；
C L Corresponds to immunoglobulin kappa light chain constant domain (C κ )；
(C H 2-C H 3) A An amino acid sequence corresponding to SEQ ID NO. 69;
(C H 2-C H 3) B an amino acid sequence corresponding to SEQ ID NO. 70;
hinge 1 An amino acid sequence corresponding to SEQ ID NO. 74;
hinge 2 An amino acid sequence corresponding to SEQ ID NO. 75;
hinge 3 An amino acid sequence corresponding to SEQ ID NO. 77;
L 1 an amino acid sequence corresponding to SEQ ID NO. 76.
In some embodiments of the binding protein:
(a)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29;
(b)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32;
(c)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 33; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35;
(d)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; amino acid sequence containing SEQ ID NO 9 CDR-L3 of (b); v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38;
(e)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40;
(f)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29;
(g)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; contains SEQ ICDR-L3 of the amino acid sequence of D NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32;
(h)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 33; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35;
(i)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38;
(j)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; amino acid sequence containing SEQ ID NO. 11CDR-L2 of column; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40.
In some embodiments of the binding protein:
(a)V H1 and V L1 Amino acid sequences corresponding to SEQ ID NOS 41 and 43, respectively, or amino acid sequences corresponding to SEQ ID NOS 42 and 44, respectively;
and/or
(b)V H2 And V L2 Corresponding to
Amino acid sequences of SEQ ID NOs 45 and 53, respectively;
the amino acid sequences of SEQ ID NOS 46 and 54, respectively;
Amino acid sequences of SEQ ID NOs 47 and 55, respectively;
amino acid sequences of SEQ ID NOs 48 and 56, respectively;
the amino acid sequences of SEQ ID NOs 49 and 57, respectively;
amino acid sequences of SEQ ID NOs 50 and 58, respectively;
amino acid sequences of SEQ ID NOs 51 and 59, respectively; or alternatively
The amino acid sequences of SEQ ID NOS 52 and 60, respectively.
In some embodiments of the binding protein:
(a)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; v (V) L2 An amino acid sequence comprising SEQ ID NO. 53;
(b)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(c)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(d)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(e)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 57;
(f)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 50; v (V) L2 An amino acid sequence comprising SEQ ID NO. 58;
(g)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(h)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 60;
(i)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 53;
(j)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(k)V H1 comprising the amino acid sequence of SEQ ID NO. 42；V L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(l)V H1 An amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(m)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; v (V) L2 An amino acid sequence comprising SEQ ID NO. 57;
(n)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 50; v (V) L2 Comprising the amino acid sequence of SEQ ID NO. 58.
(o)V H1 An amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(p)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; v (V) L2 Comprising the amino acid sequence of SEQ ID NO. 60.
In some embodiments, the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
In some embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by: the polypeptide chain (I) is covalently linked to the polypeptide chain (II), in particular by one or more disulfide bonds.
According to some of those embodiments of the binding protein, polypeptide chains (I), (II) and (III) are characterized by: the polypeptide chain (II) is covalently linked to the polypeptide chain (III) by one or more disulfide bonds.
In one placeIn some embodiments, polypeptide chains (I) and (II) are linked by C 1A With hinges 2 At least one disulfide bridge between and/or wherein the polypeptide chains (II) and (III) are linked by a hinge 3 And C 2B At least one disulfide bridge therebetween.
In some embodiments, the binding protein is characterized by an Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide (e.g., (C H 2-C H 3) A Or (C) H 2-C H 3) B Or hinge 1 –(C H 2-C H 3) A Or hinge 2 –(C H 2-C H 3) B ) Comprising C H 2, said domain having an N-linked glycosylation at residue N297 according to EU numbering.
In some embodiments, the binding protein is characterized in that residue N297 of the Fc region or variant thereof comprises N-linked glycosylation according to EU numbering.
In some embodiments, the binding protein is characterized in that all or part of the Fc region or variant thereof binds to a human Fc-gamma receptor polypeptide. In some embodiments, the binding protein is characterized in that all or part of the Fc region or variant thereof binds to a human CD16A (fcyriii) polypeptide.
In one embodiment, the binding protein comprises:
-a polypeptide comprising the amino acid sequence of SEQ ID No. 61, a polypeptide comprising the amino acid sequence of SEQ ID No. 62 and a polypeptide comprising the amino acid sequence of SEQ ID No. 63, or a variant thereof having at least 80% sequence identity; or alternatively
-a polypeptide comprising the amino acid sequence of SEQ ID No. 64, a polypeptide comprising the amino acid sequence of SEQ ID No. 65 and a polypeptide comprising the amino acid sequence of SEQ ID No. 66, or a variant thereof having at least 80% sequence identity; and/or
-a polypeptide comprising the amino acid sequence of SEQ ID No. 61 or 64, a polypeptide comprising the amino acid sequence of SEQ ID No. 62 or 65 and a polypeptide comprising the amino acid sequence of SEQ ID No. 63 or 66, or a variant thereof having at least 80% sequence identity.
In some embodiments, the binding protein comprises:
-a polypeptide comprising the amino acid sequence SEQ ID No. 61, a polypeptide comprising the amino acid sequence SEQ ID No. 62 and a polypeptide comprising the amino acid sequence SEQ ID No. 63, or a variant thereof having at least 80% sequence identity; or alternatively
-a polypeptide comprising the amino acid sequence of SEQ ID No. 64, a polypeptide comprising the amino acid sequence of SEQ ID No. 65 and a polypeptide comprising the amino acid sequence of SEQ ID No. 66, or a variant thereof having at least 80% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 61, a polypeptide comprising the sequence of SEQ ID NO. 62 and a polypeptide comprising the amino acid sequence of SEQ ID NO. 63, or a variant thereof having at least 80% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and a polypeptide comprising the amino acid sequence of SEQ ID NO. 66, or a variant thereof having at least 80% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 61, a polypeptide comprising the amino acid sequence of SEQ ID NO. 62, and a polypeptide comprising the amino acid sequence of SEQ ID NO. 63, or a variant thereof having at least 90% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and a polypeptide comprising the amino acid sequence of SEQ ID NO. 66, or a variant thereof having at least 90% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 61, a polypeptide comprising the amino acid sequence of SEQ ID NO. 62, and a polypeptide comprising the amino acid sequence of SEQ ID NO. 63, or a variant thereof having at least 95% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and a polypeptide comprising the amino acid sequence of SEQ ID NO. 66, or a variant thereof having at least 95% sequence identity.
In some embodiments, the binding protein comprises: a polypeptide (I) comprising the amino acid sequence of SEQ ID NO. 61, a polypeptide (II) comprising the amino acid sequence of SEQ ID NO. 62, and a polypeptide (III) comprising the amino acid sequence of SEQ ID NO. 63.
In some embodiments, the binding protein comprises:
-a polypeptide (I) consisting of the amino acid sequence of SEQ ID No. 61;
-a polypeptide (II) consisting of the amino acid sequence of SEQ ID No. 62; and
-a polypeptide (III) consisting of the amino acid sequence of SEQ ID NO. 63.
In some embodiments, the binding protein comprises: a polypeptide (I) comprising the amino acid sequence of SEQ ID NO. 64, a polypeptide (II) comprising the amino acid sequence of SEQ ID NO. 65, and a polypeptide (III) comprising the amino acid sequence of SEQ ID NO. 66.
In some embodiments, the binding protein comprises:
-a polypeptide (I) consisting of the amino acid sequence of SEQ ID No. 64;
-a polypeptide (II) consisting of the amino acid sequence of SEQ ID No. 65; and
-a polypeptide (III) consisting of the amino acid sequence of SEQ ID NO. 66.
In some variants of those embodiments, the binding protein comprises a polypeptide sequence derived from an immunoglobulin chain (particularly an IgG-type immunoglobulin), and/or an amino acid sequence selected from any of SEQ ID No. 1 to SEQ ID No. 79, which may thus include any variant sequence having conservative substitutions, and/or any variant having a certain degree of percent sequence identity to a reference sequence; in particular a reference sequence derived from an immunoglobulin chain.
In some embodiments, the binding protein comprises a polypeptide sequence derived from an immunoglobulin chain of the IgG type, in particular of the IgG1, igG2, igG3 or IgG4 type, preferably of the IgG1 type.
When variants of Fc and constant regions and non-CDR polypeptide sequences from variable regions are contemplated herein, they may consist of Fc and constant regions and non-CDR polypeptide sequences having at least 80% sequence identity to a reference polypeptide sequence; more particularly, having at least 90% sequence identity to a reference polypeptide sequence; and preferably has at least 95% sequence identity to the reference polypeptide sequence.
Alternatively, when variants of a polypeptide sequence include CDR polypeptide sequences (e.g., CDR1, CDR2, and CDR3 from one of the VH or VL domains), those variants will be understood herein to have no modifications in their CDR polypeptide sequences.
In some embodiments, the binding protein comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOS.67 to 73.
In some embodiments, the binding protein comprises an amino acid sequence having at least 90% sequence identity to an amino acid sequence selected from SEQ ID NOS: 67 to 73.
In some embodiments, the binding protein comprises an amino acid sequence having at least 95% sequence identity to an amino acid sequence selected from SEQ ID NOS.67 to 73.
In some embodiments, the binding protein comprises an Fc region or variant thereof having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOS: 69 to 73.
In some embodiments, the binding protein comprises an Fc region or variant thereof having at least 90% sequence identity to an amino acid sequence selected from SEQ ID NOS: 69 to 73.
In some embodiments, the binding protein comprises an Fc region or variant thereof having at least 95% sequence identity to an amino acid sequence selected from SEQ ID NOS: 69 to 73.
In some embodiments, the binding protein comprises C having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO 69 or 70 H 2-C H 3 or a variant thereof; or alternatively comprises C having at least 80% sequence identity with the amino acid sequence of SEQ ID NO:71 H 2 or a variant thereof; or alternatively comprise a toolC having at least 80% sequence identity with the amino acid sequence of SEQ ID NO 72 or 73 H 3 or a variant thereof.
In some embodiments, the binding protein comprises a C having at least 90% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO 69 or 70 H 2-C H 3 or a variant thereof; or alternatively comprises C having at least 90% sequence identity with the amino acid sequence SEQ ID NO:71 H 2 or a variant thereof; or alternatively comprises C having at least 90% sequence identity with the amino acid sequence of SEQ ID NO 72 or 73 H 3 or a variant thereof.
In some embodiments, the binding protein comprises a C having at least 95% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO 69 or 70 H 2-C H 3 or a variant thereof; or alternatively comprises C having at least 95% sequence identity with the amino acid sequence of SEQ ID NO:71 H 2 or a variant thereof; or alternatively comprises C having at least 95% sequence identity with the amino acid sequence of SEQ ID NO 72 or 73 H 3 or a variant thereof.
Preferably, the multispecific binding protein of the present disclosure is a bispecific binding protein.
The present disclosure further relates to a pharmaceutical composition comprising a binding protein as defined above and a pharmaceutically acceptable carrier.
Thus, in one embodiment, the present disclosure relates to a pharmaceutical composition comprising a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region or variant thereof that binds a human Fc-gamma receptor polypeptide.
Thus, in one embodiment, the present disclosureDisclosed is a pharmaceutical composition comprising a binding protein as defined above comprising all or part of a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) And immunoglobulin light chain variable domain (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof is directed against a human Fc-gamma receptor.
Preferably, the binding proteins and pharmaceutical compositions thereof according to the present disclosure are sterile and suitable for parenteral use.
Medical application
The disclosed binding proteins and compositions thereof are particularly suitable for use as medicaments. Further disclosed herein are methods and uses for preparing such medicaments.
Accordingly, in one embodiment, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful as medicaments.
According to some embodiments of this third general object, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful in methods of treating or preventing cancer.
According to some embodiments of this third general object, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful in methods of treating or preventing hematological cancers.
According to some embodiments of this third general object, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful in methods of treating or preventing myelodysplastic syndrome (MDS) or lymphoproliferative disorders.
According to some embodiments of this third general object, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful in methods of treating or preventing Acute Myelogenous Leukemia (AML).
According to some embodiments of this third general object, the present disclosure relates to a binding protein comprising:
(i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region that binds a human Fc-gamma receptor polypeptide; the binding proteins are useful in methods of treating or preventing CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML).
In some embodiments, the disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region, or all or part of a variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) And immunoglobulin light chain variable domain (V L ) Wherein each V H And V L IncludedThree complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful as medicaments.
In some embodiments, the disclosure relates to a binding protein, comprising all or part of a first and a second Antigen Binding Domain (ABD) and an immunoglobulin Fc region or variant thereof, wherein saidEach of the ABDs comprises an immunoglobulin heavy chain variable domain (V H ) And immunoglobulin light chain variable domain (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
Amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful in methods of treating or preventing cancer.
According to some embodiments of this third main object, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable region (V H ) And immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 Comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful in methods of treating or preventing hematological cancers.
According to some embodiments of this third main object, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable region (V H ) And immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
And is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful in methods of treating or preventing myelodysplastic syndrome (MDS) or lymphoproliferative disorders.
According to some embodiments of this third main object, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable region (V H ) And immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 Comprising CDR-L1, L2 and L3 corresponding to amino acid sequences SEQ ID NO 7 to 9 or 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful in methods of treating or preventing Acute Myelogenous Leukemia (AML).
According to some embodiments of this third main object, the present disclosure relates to a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable region (V H ) And immunoglobulin light chain variable region (V L ) Wherein each V H And V L Comprising three complementarity determining regions (CDR-1 through CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-V H1 comprising the amino acid sequences corresponding to SEQ ID NOS 1 to 3, respectively, or the CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOS 4 to 6, respectively, and
-V L1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOS 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOS 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-V H2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and is also provided with
-V L2 Comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor; the binding proteins are useful in methods of treating or preventing CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML).
The disclosure also relates to the use of the binding proteins mentioned above in the preparation of a medicament.
The disclosure also relates to the use of the above mentioned binding proteins as a medicament.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of cancer.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of cancer characterized by tumor cells expressing CD123 at the surface.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of cancer characterized by tumor cells expressing CD123 and CD64 on the surface.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of hematological cancers.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of hematological cancers characterized by tumor cells that express CD123 at their surface.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of hematological cancers characterized by tumor cells that express CD123 and CD64 at the surface.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of myelodysplastic syndrome (MDS) or lymphoproliferative disorders.
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of Acute Myelogenous Leukemia (AML).
The disclosure also relates to the use of the above mentioned binding proteins in the manufacture of a medicament for the treatment or prevention of CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML).
In one aspect, there is provided a method for treating cancer characterized by tumor cells expressing CD123 and CD64 on the surface, comprising administering to an individual suffering from such cancer a binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In one aspect, there is provided a method for treating a CD123 expressing tumor (e.g., hematological malignancy, AML) in an individual susceptible to tumor cells having CD64 expressed on the surface, comprising administering to the individual a binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide.
In one aspect, there is provided a method for treating hematological malignancy (e.g., AML) in an individual, the method comprising administering to the individual a binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide.
In another aspect, a method of treating hematological malignancy (e.g., AML) in an individual is provided, the method comprising: (a) Assessing or determining whether malignant cells (e.g., AML cells) from the individual express CD64 on their surface; and (b) if the individual is determined to have malignant cells (e.g., AML cells) that express CD64 on their surface (e.g., at a predetermined level), administering to the individual a binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide.
In another aspect, there is provided a method for depleting malignant cells in an individual and/or directing NK cell-mediated cytotoxicity to malignant cells that express CD64 (e.g., an individual with AML), the method comprising administering to an individual having malignant cells that express CD64 at the surface (e.g., AML cells) a binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide.
In another aspect, there is provided a method of depleting NK cells from malignant cells expressing both CD123 and CD64, the method comprising contacting the malignant cells (e.g., AML cells) with a binding protein in the presence of NK cells, the binding protein comprising: (i) a first Antigen Binding Domain (ABD) comprising a variable region that binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that binds a human NKp46 polypeptide, and (iii) all or part of an Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide.
Assessment of CD64 expression of malignant cells (e.g., AML cells), such as expression at their surface, may be performed by any suitable method. In general, biological samples from an individual, e.g., from a blood sample or a suitable biopsy, can be obtained and evaluated, and the expression of CD64 in tumor cells can be determined using an assay such as: immunohistochemical (IHC) assays, fluorescence Activated Cell Sorting (FACS) assays, such as quantitative FACS, ELISA, immunoblots (e.g., western blot, dot blot, or intracellular western blot), and other immunoassays. anti-CD 64 antibodies for use in such assays are available in the art.
IV.Means for preparing binding proteins
Further disclosed herein are means for preparing the binding proteins of the present disclosure in vitro. As used herein, "binding protein of the present disclosure" refers to a multifunctional binding protein comprising all or part of first and second Antigen Binding Domains (ABDs) and an immunoglobulin Fc region or variant thereof, wherein the first ABD specifically binds human CD123 and the second ABD specifically binds human NKp46, and wherein all or part of the immunoglobulin Fc region or variant thereof is directed against a human Fc-gamma receptor. It also refers to all specific embodiments of the binding protein described throughout the disclosure.
More particularly, the provided means may involve the preparation of a binding protein comprising all or part of first and second Antigen Binding Domains (ABDs) and an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (VH) and an immunoglobulin light chain variable domain (VL), wherein each VH and VL comprises three complementarity determining regions (CDR-1 to CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-VH1 comprising CDRs-H1, H2 and H3 corresponding to amino acid sequences of SEQ ID NOs 1 to 3, respectively, or corresponding to amino acid sequences of SEQ ID NOs 4 to 6, respectively, and
-VL1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-VH2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and
-VL2 comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
Thus, in one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a binding protein of the present disclosure.
Thus, in one embodiment, the present disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding a binding protein of the present disclosure.
Thus, in one embodiment, the present disclosure relates to an isolated cell comprising a nucleic acid molecule of the present disclosure.
Thus, in one embodiment, the present disclosure relates to an isolated cell comprising an expression vector of the present disclosure.
According to a specific embodiment, the cell is a eukaryotic cell, in particular an insect cell or a mammalian cell. In one embodiment, the cell is a mammalian cell and the expression vector is a mammalian expression vector.
Thus, in one embodiment, the present disclosure relates to a method for preparing a binding protein of the present disclosure, the method comprising the step of preparing a binding protein comprising (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Cultivating one or more host cells under conditions suitable for expression of one or more recombinant polypeptides comprising (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, and/or (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and/or (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide;
(b) Optionally recovering the expressed one or more recombinant polypeptides.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Cultivating one or more host cells under conditions suitable for expression of one or more recombinant polypeptides comprising (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, and (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide;
(b) Optionally recovering the expressed one or more recombinant polypeptides.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, and (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin FC region or variant thereof that binds a human FC-gamma receptor polypeptide;
(b) Optionally recovering the expressed recombinant polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO:61 or 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO:62 or 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO:63 or 66;
(b) Optionally recovering the expressed recombinant polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 66;
(b) Optionally recovering the expressed recombinant polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for co-expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO. 61 or 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 62 or 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 63 or 66;
(b) Optionally recovering the co-expressed recombinant polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for co-expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 66;
(b) Optionally recovering the expressed recombinant polypeptide.
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (I) a first polypeptide chain (I), (II) a second polypeptide chain (II), and (III) a third polypeptide (III) that form two Antigen Binding Domains (ABD), one ABD specifically binding to a human CD123 polypeptide, and the other ABD specifically binding to a human NKp46 polypeptide; characterized in that the three polypeptide chains (I), (II) and (III) consist of:
V 1A –C 1A –L 3 –(C H 2-C H 3) A (I)
V 1B –C 1B –L 4 –(C H 2-C H 3) B –L 1 –V 2A –C 2A –L 2 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 、L 2 、L 3 、L 4 Are optional independent amino acid linkers, which may be the same or different;
(b) Optionally recovering the expressed polypeptide chains (I), (II) and (III).
According to some embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for co-expressing a plurality of recombinant polypeptides, the plurality comprising (I) a first polypeptide chain (I), (II) a second polypeptide chain (II), and (III) a third polypeptide (III) that form two Antigen Binding Domains (ABD), one ABD specifically binding to a human CD123 polypeptide and the other ABD specifically binding to a human NKp46 polypeptide; characterized in that the three polypeptide chains (I), (II) and (III) consist of:
V 1A –C 1A –L 3 –(C H 2-C H 3) A (I)
V 1B –C 1B –L 4 –(C H 2-C H 3) B –L 1 –V 2A –C 2A –L 2 (II)
V 2B -C 2B (III)
wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 、L 2 、L 3 、L 4 Are optional independent amino acid linkers, which may be the same or different;
(b) Optionally recovering the coexpressed polypeptide chains (I), (II) and (III).
Thus, according to some specific embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, said plurality comprising (I) a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO:61 or 64, (II) a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO:62 or 65, and (III) a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO:63 or 66;
(b) Optionally recovering the expressed polypeptide chains (I), (II) and (III).
Thus, according to some specific embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for co-expression of a plurality of recombinant polypeptides, said plurality comprising (I) a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO:61 or 64, (II) a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO:62 or 65, and (III) a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO:63 or 66;
(b) Optionally recovering the coexpressed polypeptide chains (I), (II) and (III).
Methods for preparing the binding proteins of the present disclosure, such as those defined above, may further comprise the previous step of providing nucleic acids encoding all or one or more portions of the binding proteins, particularly isolated nucleic acids (i.e., recombinant nucleic acids), to one or more host cells. In particular, such a step may comprise or consist of transfecting the one or more host cells with a nucleic acid encoding all or one or more parts of the binding protein, in particular an isolated nucleic acid.
Thus, according to some specific embodiments, the present disclosure relates to a method for preparing a binding protein, the method comprising the steps of:
(a) Providing nucleic acid encoding all or one or more portions of the binding protein to one or more host cells;
(b) Culturing the one or more host cells under conditions suitable for expression of one or more recombinant polypeptides comprising (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, and/or (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, and/or (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide;
(c) Optionally recovering the expressed one or more recombinant polypeptides.
In one embodiment, a method for preparing a binding protein of the present disclosure comprises the steps of:
(a) Providing one or more nucleic acids encoding a first polypeptide chain (I), a second polypeptide chain (II), and a third polypeptide chain (III);
(b) Transfecting one or more host cells with the one or more nucleic acids;
(c) Culturing the one or more host cells under conditions suitable for expression (or co-expression) of the one or more polypeptide chains; and
(d) Optionally recovering the expressed (or co-expressed) polypeptide chain(s) (I), (II) and (III).
In one embodiment, a method for preparing a binding protein of the present disclosure comprises the steps of:
(a) Providing one or more nucleic acids encoding a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO. 61 or 64, a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO. 62 or 65, and a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO. 63 or 66;
(b) Transfecting one or more host cells with the one or more nucleic acids;
(c) Culturing the one or more host cells under conditions suitable for expression (or co-expression) of the one or more polypeptide chains; and
(d) Optionally recovering the expressed (or co-expressed) polypeptide chain(s) (I), (II) and (III).
In some embodiments, a method of preparing a binding protein of the present disclosure comprises:
(a) Providing a first nucleic acid encoding a first polypeptide chain according to any of the amino acid sequences of SEQ ID NO. 61 or 64, a second nucleic acid encoding a second polypeptide according to any of the amino acid sequences of SEQ ID NO. 62 or 65, and a third nucleic acid encoding a third polypeptide chain according to any of the amino acid sequences of SEQ ID NO. 63 or 66; and
(b) Expressing the first, second and third nucleic acids in one or more host cells to produce binding proteins comprising the first, second and third polypeptide chains, respectively;
(c) Optionally loading the resulting protein onto an affinity purification support, optionally a protein a support, and recovering the binding protein.
Thus, one of skill in the art will readily appreciate that such methods of making binding proteins of the present disclosure may encompass the production and assembly of some or all of the polypeptides, polypeptide chains, and/or regions (e.g., variable regions and Fc regions or variants thereof) mentioned above within one or more host cells as part of an in vitro production method.
Alternatively, the methods may encompass the production of some or all of the polypeptides, polypeptide chains, and/or regions mentioned above within one or more host cells, as well as their assembly outside of the one or more host cells. The step of contacting the polypeptide, polypeptide chain and/or region may thus be accomplished simultaneously or sequentially.
According to some embodiments, one or more of the regions may be present in one or more different polypeptide chains or fragments thereof.
For reference, the "F25" form of the binding protein described herein in the examples section has four predicted interchain disulfide bridges:
-a disulfide bridge connecting a cysteine within the CL domain of polypeptide (I) to a first cysteine within the hinge region of polypeptide chain (II);
-two disulfide bridges linking the two cysteines within the hinge region of polypeptide chains (I) and (II);
-a disulfide bridge connects the C-terminal cysteine at the CL domain of polypeptide chain (III) with the C-terminal cysteine on polypeptide chain (II).
In some embodiments, the present disclosure relates to a method for preparing a binding protein of the present disclosure, the method comprising the step of contacting: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, said variable region comprising at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs 1 to 12, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, said variable region comprising at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs 13 to 40, and (iii) an Fc region or a variant thereof that binds a human Fc-gamma receptor polypeptide, in particular a human CD16a Fc-gamma receptor polypeptide.
In some embodiments, the present disclosure relates to a method for preparing a binding protein of the present disclosure, the method comprising the step of contacting: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, said variable region comprising at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID nos. 1 to 6 and at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID nos. 7 to 12, (ii) a second Antigen Binding Domain (ABD) comprising a variable region suitable for specific binding to a human NKp46 polypeptide, said variable region comprising at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID nos. 13 to 26 and at least one Complementarity Determining Region (CDR) selected from the group of amino acid sequences consisting of SEQ ID nos. 27 to 40, and (iii) an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide, in particular a human CD16a Fc-gamma receptor polypeptide.
In some embodiments, the present disclosure relates to a method for preparing a binding protein of the present disclosure, the method comprising the step of contacting: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, said variable region comprising at least two Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 1 to 6 and at least two Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 7 to 12, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, said variable region comprising at least two Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 13 to 26 and at least two Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 27 to 40, and (iii) an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide, in particular a human CD16 Fc-gamma receptor polypeptide.
In some embodiments, the disclosure relates to a method for preparing a binding protein related to the disclosure, the method comprising the step of contacting: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, said variable region comprising three Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 1 to 6 and three Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 7 to 12, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human NKp46 polypeptide, said variable region comprising all or part of an immunoglobulin Fc region or variant thereof selected from the group of amino acid sequences consisting of SEQ ID NOs 13 to 26 and three Complementarity Determining Regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs 27 to 40, and (iii) binding a human Fc-gamma receptor polypeptide, in particular an human CD16 Fc-gamma receptor polypeptide.
In some embodiments, the disclosure relates to a method for preparing a binding protein related to the disclosure, the method comprising the step of contacting: (i) a first Antigen Binding Domain (ABD) comprising a variable region that specifically binds a human CD123 polypeptide, (ii) a second Antigen Binding Domain (ABD) comprising a variable region that is adapted to specifically bind a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof that binds a human Fc-gamma receptor polypeptide, in particular a human CD16 Fc-gamma receptor polypeptide; characterized in that the step of contacting said regions comprises contacting a plurality of polypeptide chains selected from the amino acid sequences SEQ ID NOS: 61 to 66.
All or part of one or more of the antigen binding domains and immunoglobulin Fc regions or variants thereof mentioned above may be expressed in vitro by recombinant means in isolated cells or cell populations, in particular in eukaryotic cells, and preferably in mammalian or insect cells. Most preferably, the expression system involves mammalian cells.
According to alternative embodiments, one or more of the antigen binding domains and portions of the Fc region or variants thereof mentioned above may be expressed in a first isolated population of cells, while one or more of the antigen binding domains and other portions of the Fc region or variants thereof mentioned above may be expressed in a second isolated population of cells.
According to alternative embodiments, one or more of the antigen binding domains mentioned above and all parts of the immunoglobulin Fc region or variants thereof may be expressed in the same isolated cell population and then recovered such that they are brought into contact during or at the end of the recovery step.
Thus, a method for preparing a binding protein may comprise the steps of:
(a) Expressing at least one of the first antigen binding domain and/or the second antigen binding domain and/or all or part of the immunoglobulin Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell;
(b) Recovering all or part of said first antigen binding domain and/or said second antigen binding domain and/or said Fc region or variant thereof.
According to one of the preferred embodiments, the present disclosure relates to a method for preparing a binding protein related to the present disclosure, the method comprising the steps of:
(a) Expressing at least one of the first antigen binding domain and/or the second antigen binding domain and/or all or part of the Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell;
(b) Recovering all or part of the first antigen binding domain and/or the second antigen binding domain and/or the Fc region or variant thereof;
(c) Contacting all or part of said first antigen binding domain and/or said second antigen binding domain and/or said Fc region or variant thereof, step (b) and step (c) being effected simultaneously or sequentially.
Preferably, the method for preparing a binding protein comprises the steps of:
(a) Expressing all or part of the first and second antigen binding domains and the immunoglobulin Fc region or variant thereof in an isolated cell;
(b) Recovering all or part of the first and second antigen binding domains and the immunoglobulin Fc region or variant thereof;
(c) Contacting all or part of said first antigen binding domain and said second antigen binding domain with said immunoglobulin Fc region or variant thereof, step (b) and step (c) being effected simultaneously or sequentially.
Advantageously, when all or part of the first and second antigen binding domains and the immunoglobulin Fc region or variant thereof are expressed in the same isolated cell or cell population and/or the same cell culture thereof, they may be contacted during the recovery step, thereby preparing the binding protein.
Alternatively, when all or part of the first antigen binding domain and/or the second antigen binding domain and/or the immunoglobulin Fc region or variant thereof is expressed in a different isolated cell or cell population, it may be contacted after the recovery step.
The recovery step may consist of any method known in the art. In a non-exhaustive manner, recovery of an expressed polypeptide (e.g., expressed polypeptide chain (s)) bearing one or more antigen binding domains and all or part of an Fc region or variant thereof may include the steps of:
(b1) Recovering the isolated cells or cell cultures thereof,
(b2) The isolated cells or cell cultures thereof are optionally subjected to centrifugation, depth filtration, membrane filtration, ultrafiltration and/or diafiltration.
Sequence listing
In protein sequencing notation as used herein, the left hand direction is the amino-terminal direction ("N-terminal" or "N-term") and the right hand direction is the carboxy-terminal direction ("C-terminal" or "C-term") according to standard usage and convention.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
Examples
Materials and methods
A.1. By EXPI-293F TM NKp46-CD123 NKCE expression by transient transfection of cells.
The sequence encoding each polypeptide chain of the NKp46-CD123_F25 binding protein of the present disclosure was inserted between HindIII and BamHI restriction sites in the pTT-5 vector. EXPI-293F cells (Life Technologies) were CO-transfected with three vectors (formulated as endotoxin free medium preparation (midi prep)) in the presence of PEI (37 ℃, 5% CO2, 150 rpm). The cells were used to inoculate culture flasks (EXPI 293 medium, gibco) at a density of 1X 106 cells/ml. For reference, for the NKp46-CD123_F25 binding protein, we used a DNA ratio of 0.1. Mu.g/ml (polypeptide chain I), 0.4. Mu.g/ml (polypeptide chain II) or 0.8. Mu.g/ml (polypeptide chain III). Valproic acid (final concentration 0.5 mM), glucose (4 g/L) and tryptone N1 (0.5%) were added. After six days the supernatant was collected and passed through a Stericup filter with 0.22 μm pores.
Purification of NKCE.
The NKp46-cd123_f25 binding protein of the present disclosure was purified from the supernatant using rProtein A Sepharose flash flow (GE Healthcare, reference 17-1279-03) after harvest. Then at Na 2 HPO 4 /KH 2 PO 4 The samples were dialyzed against 50mM pH 6.2 phosphate buffer and purified by cation exchange Chromatography (CIEX). Samples were filtered on a 0.22 μm full time prior to injection into two "tandem" columns HiTrap SP-HP 1mL (see 17-1151-01) from GE Healthcare. The initial buffer and the elution buffer are respectively Na 2 HPO 4 /KH 2 PO 4 50mM pH 6.2 and Na 2 HPO 4 /KH 2 PO 4 25mM pH 6.2;1M sodium chloride. Elution was performed using a linear gradient (elution buffer) of 0% to 50% over 100 CV. The peak of interest was finally dialyzed against PBS1X overnight at 4 ℃ with stirring.
A.3. Biological sample
The healthy human buffy coat is composed of Etablissengdu Sang (EFS, marseil; AC-2019-3428). Peripheral mononuclear cells (PBMCs) were isolated from the buffy coat by using Ficoll density gradient centrifugation. By using a bead-based negative selection kit from StemCell or MiltenyiHuman NK cells were purified from PBMC.
Acute Myelogenous Leukemia (AML) samples from patients were provided by institute Patli-Calmettes (Ma Saishi, SA-IPH-MImAbs Contract).
A.4. Cell lines
Acute Myeloid Leukemia (AML) cell line expressing CD 123: MOLM-13 and THP-1 were purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2mM L-glutamine, 1mM sodium pyruvate and non-essential amino acid 1X). 25mM HEPES was added to the medium for THP-1 cells.
THP-1CD64KO and THP-1CD32KO cells were produced with CRISPR/Cas endonuclease. THP-1 cells were cultured in RPMI-1640 (10% SVF, 2mM L-Glu, 1mM sodium pyruvate, 0.1mM non-essential amino acid). To generate CD 64-deficient THP-1 cells, two sgRNAs (CD 64.1: CUUGAGGUGUCAUGCGUGGA (SEQ ID NO: 80); CD64.2: AAGCAUCGCUACACAUCAGC (SEQ ID NO:81; synthetic) were used at a CAS9:sgRNA ratio (Alt-R) of 1:9 TM The 2,5.106 cells were nuclear transfected with S.p.Cas9 nuclease 3NLS,Integrated DNA Technology (Neon Transfection System,100ul tip, 1700V,20ms,1 pulse). The lack of CD64 expression was monitored by flow cytometry and cells were sorted or subcloned.
To generate CD32 knock-out (KO) THP-1 cells, a pair of sgRNAs (CD 32A: AUGUAUGUCCCAGAAACCUG; CD32B: AAGCAUAUGACCCCAAGGCU (Integrated DNA Technologies)) were used at a CAS9:sgRNA ratio (Alt-R) of 1:9 TM S.p. cas9 nuclease 3NLS,Integrated DNA Technology) pair 2.5.10 6 The individual cells were subjected to nuclear transfection (Neon Transfection System, 100. Mu.L tip, 1700V,20ms,1 pulse). Cell sorting was performed on THP-1CD32KO cells alone. Following cell sorting, the lack of CD32 expression was monitored by flow cytometry.
A.5. NK cell based cytotoxicity assays
Loading target cells 51 Cr (for MOLM-13, THP-1 or THP-1CD64KO, THP-1CD32KO cells) or calcein AM (Life technologies, reference: C3100MP or equivalent) (for AML blast cells from patient samples). Antibody, labeled target cells and antigen to be testedFresh or overnight human NK cells from healthy donors were added sequentially to each well of round bottom 96 well plates to obtain a 10:1 (E: T) ratio. After 4h of co-incubation, the supernatant was transferred to Lumaplate (for 51 Cr) or flat bottom culture plates (for calcein AM).
For the base of 51 Cytotoxicity assay of Cr, release from dead target cells 51 Cr is expressed using TopCount NXT TM (microplate scintillation and luminescence counter; perkin Elmer). Radioactivity was measured by counting gamma emissions per well during 60s and these results were expressed as cpm = counts per minute.
For calcein-based cytotoxicity assays, calcein AM released from dead target cells was determined by using a Luminoter @Multimode plate reader (Perkinelmer): fluorescence emission at λ=516 nm after excitation at λ=495 nm was quantified Relative Fluorescence Units (RFU) were measured.
For analysis, the percent specific lysis was calculated using the following formula:
where er=experimental release, sr=spontaneous release, and mr=maximum release
EC of each antibody 50 Was determined by plotting an appropriate nonlinear regression curve ("selection of log (agonist) versus response-variable slope (four parameters)" model) using Graphpad Prism software.
Phenotypic analysis of AML cells
The expression of CD32, CD64 and CD123 on AML samples derived from patient blood and on AML cell lines was controlled by flow cytometry using the following: anti-human CD33-BB515 (BD Biosciences 564588 clone WM 53), anti-human CD45-Viogreen (Miltenyi 130-096-906 clone 5B 1), anti-human CD123-AF647 (BD Biosciences563599 clone 9F 5), anti-human CD32-PE (Beckman Coulter IM1935 clone 2E 1), anti-human CD64-PE (Beckman Coulter IM3601U clone 22), anti-human CD123-PE (Biolegend 306006 clone 6H 6), and isotype control antibodies mIgG1-PE (IC-1;BD Biosciences 555749 clone MOPC-21) and mIgG2a-PE (IC-2a;Beckman Coulter A09142 clone 7T4-1F 5). Target cells were saturated with normal mouse serum diluted 1/10e in Staining Buffer (SB) and then mixed with antibodies conjugated to the dye. During 30min post staining, cells were fixed in BD Cellfix diluted 1/10e in H2O and analyzed by flow cytometry using FACS Canto II. FSC-A, FSC-H, SSC-A, SSC-H, FL2-A, FL-A and FL7-A or FSC-A, FSC-H, SSC-A, SSC-H, FL1-A, FL2-A, FL-A, FSC-A, FL5-A and FL8-A (for AML samples derived from patient blood) parameters were recorded and analyzed using FlowJo software. The phenotypic analysis results are shown in fig. 6A, 6B and 14B.
A.6. NK cell degranulation assay using AML samples
To test NK cell activation as in fig. 7, test antibodies, AML blasts and autologous NK cells derived from AML patients were added sequentially to each well of a round bottom 96-well plate. Anti-human CD107a and CD107b antibodies were added to each well for 4 hours after overnight incubation with the NKp46-cd123_f25 binding protein of the present disclosure. Cells were then washed and stained with the following mixture: vitality markers, APC conjugated anti-human CD45, BB515 conjugated anti-human CD33, peCy7 conjugated anti-human CD56, BV510 conjugated anti-human CD3 antibodies. Cells were then washed, fixed and analyzed by flow cytometry. Data obtained by analysis using Flowjo software to determine whether it is identified as viable CD45 + CD33 - CD56 + CD3 - CD107 expression on NK cells of cells to analyze NK cell degranulation.
To test NK cell activation and cytokine/chemokine production against MOLM-13 cells via the NKp46-cd123_f25 binding protein as in fig. 17, flow cytometry analysis was performed using the following antibody markers: CD69, CD107a/b, IFN alpha, TNF alpha, MIP1 beta.
First, pure from a third list of independent donors was pooled in the presence of increasing concentrations of NKp46-CD123_F25 or control (NKp 46-IC_F25 and no antibody) The primary human NK cells were incubated with or without MOLM-13 cells at a 1:1 ratio (50,000 cells/well; U-bottom 96 well plate) for 4h at 37 ℃. At the same time, BD Golgistop is used in each well TM Added to the experimental and control samples at a final dilution of 1/6000. Positive control of NK cell activation was performed by using final 125ng/mL PMA and final 1 μg/mL IONO added to 50,000 resting NK cells per well (data not shown).
After 4h incubation, cells were washed in staining buffer (PBS containing 0.2% BSA, 2mM EDTA and 0.02% sodium azide) and stained with the following extracellular antibody mixtures according to the incubation and dilution ratios recommended by the manufacturer: anti-human CD3-Pacific Blue, anti-human CD56-Pe-Vio770, anti-human CD69-FITC, anti-human CD107a (LAMP-1) -APC, anti-human CD107b-APC. Following the fixation and permeabilization steps, intracellular staining was performed using the following intracellular antibody mixtures: anti-human IFNγ -BV605, anti-human TNFα -BUV395 and anti-human MIP1 β -PE. To eliminate aggregates, the antibody mixture was centrifuged at 16,000g for 10min at 4 ℃, washed and resuspended in sample buffer.
LSR Fortessa equipped with BD FACSdiva acquisition software for measuring parameters FSC-A, FSC-H, SSC-A, SSC-H, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13 and FL-16 TM Flow cytometry was performed on X-20. All data were analyzed using FlowJo software.
Percentage of NK cell samples were labeled using GraphPad prism. The top of the activation value corresponds to the maximum activation observed. Half maximum effective concentration (EC 50 ) The values are calculated using a 4-parameter logistic nonlinear regression model corresponding to the following equation:
calculated activation bottom, calculated activation top, slope and 95% Confidence Interval (CI) values are AND EC 50 The same model is used for the calculation.
These parameters were calculated for each activation marker (CD 69, CD107 a/b), cytokine (IFNα, TNF α) and chemokine (MIP 1 β).
A.7. Human recombinant proteins, cloning, production and purification (SPR)
A sequence encoding the extracellular domain (ECD) of human NKp46 (Gln 22-Asn255, NCBI reference: NM-004829.5) was inserted between HindIII and XbaI restriction sites in the SLX192 vector (Selexis). The C-terminal 6xHis tag was added for purification. The following primers were used for PCR on human PBMC: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCCTGC 3' and 5'CCGCCCCGACTCTAGATCAATGGTGATGGTGGTGATGATTCTGGGCAGTGTGATCC C3'. The sequence of the amplicon was checked. The CHO cell line is then transfected with the vector and clones producing the protein are selected. The proteins were purified from the culture supernatant using Ni-NTA beads (Qiagen, # 1018244) and subjected to S200 size exclusion chromatography to ensure that aggregates were eliminated before characterization of binding kinetics by Surface Plasmon Resonance (SPR). The recombinant human NKp 46-derived polypeptide sequence is reported herein as SEQ ID NO. 84; which includes a portion of the extracellular domain of NKp 46.
The sequence encoding the ECD of cynomolgus monkey NKp46 (Gln 17-Asn254, NP-001271509.1) was cloned into the SLX192 vector between HindIII and XbaI restriction sites. The C-terminal Flag-M2 tag was added for purification. Primers used to amplify the expected sequences from cynomolgus PBMCs were: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC 3' and 5'CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAGTGT GGTCC 3'. Following sequence verification, CHO-K1SV cell lines were transfected with the vector and selected to generate cell clones. The recombinant cynomolgus monkey NKp46-FlagM2 protein sequence is reported herein as SEQ ID NO. 85; it includes a portion of the extracellular domain of NKp46 (GenBank accession number: CAC 41080.1). The first three batches (150602 CCe, 150618CCe, 2 and 150715CCe, 3) were purified by M2 affinity chromatography. The beads were incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS1X and eluted with 150 ng/. Mu.l of eluting peptide in PBS 1X. The proteins were then dialyzed against PBS 1X. Subsequent batches (161003 CDe batch 1 and 161116CDe batch 2) were purified by affinity chromatography by coupling the anti-NKp 46 antibody HUX1-M-H46-17E1 with an AminoLink coupling resin according to the manufacturer's instructions (GE Healthcare, #20381, batch QB 213815). The beads were then incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS1X and eluted using glycine 0.1M pH 2.5. The protein was then dialyzed against TBS buffer pH7.5 and concentrated to perform preparative size exclusion chromatography on a Superdex 200 Increate 10/300GL column.
Recombinant human CD123 (catalog No. ILA-H52H 6), recombinant human FcgammaRIIIA/CD 16a (V176) (Biotechne, catalog No. 4325-FC) and recombinant human FcgammaRIIIA/CD 16a (V176F) (Biotechne, catalog No. 8894-FC) from ACRO Biosystems were further used.
A.8. An analytical procedure for determining antigen binding properties of a multispecific binding protein by surface plasmon resonance.
The Biacore T200 instrument (cytova, uppsala, catalog No. 28975001) was used with the S-series CM5 sensor chip (cytova, uppsala, catalog No. 29149603).
For binding kinetics measurements using NKp46 and CD123, HBS-EP+ buffer (Cytiva, uppsala, catalog number BR 1006-69) was prepared by mixing 100mL of 10 XHBS-EP+ buffer with 900mL of purified water. Affinity capture of bispecific Ab samples was achieved using a human antibody capture kit (cytova, uppsala, catalog No. BR 1008-39). anti-Fc capture antibody 1:20 was diluted in running buffer and coupled to CM5 chips (cytova, uppsala, cat. No. 29149603) using standard amine coupling using an amine coupling kit (cytova), uppsala, cat. No. BR-100-50) to produce about 8000 Reaction Units (RU). Seven consecutive 1:1 dilutions of human NKp46 (Innate Pharma) or human CD123 (ACRO Biosystems) in HBS-EP+ assay buffer were prepared at concentrations of 1.56nmol/L, 3.13nmol/L, 6.25nmol/L, 12.5nmol/L, 25nmol/L, 50nmol/L and 100 nmol/L. Bispecific antibody was diluted with HBS-EP+ buffer to a concentration of 0.06 μg/mL and used in the experiments at this concentration. The antibody was captured at a flow rate of 10 μl/min for 90sec to yield a maximum reaction (Rmax) value of about 30 RU. Measurements were performed in multicycle kinetic experiments of both antigens. In each multi-cycle experiment, anti-human Fc antibody was obtained by immobilization on a series of S CM5 sensor chips (human antibody Capture kit, cytiva, uppsala, catalog number BR 1008-39) Antibodies are captured by the body. Human and cynomolgus monkey NKp46 (Innate Pharma) or human CD123 (ACRO Biosystems) diluted in HBS-EP+ buffer were injected at a 1:1 dilution series of 1.56nmol/L to 100nmol/L for 240sec at a flow rate of 30. Mu.L/min followed by a dissociation period of 1200 sec. All analyte concentrations were run in duplicate with multiple buffer blanks for double reference. With regeneration solution (3 mol/L MgCl) 2 ) Regeneration of the capture surface was performed at 30. Mu.L/min for 60sec. For all other antibodies, binding kinetics data was assessed using the 1:1 binding model with mass transfer limitations using Biacore T200 assessment software version 3.0 (cytova, uppsala).
For binding affinity measurements using CD16a, HBS-EP+ buffer (Cytiva, uppsala, catalog number BR 1006-69) was prepared by mixing 100mL of 10 XHBS-EP+ buffer with 900mL of purified water. Affinity capture of human CD16a protein was achieved using His capture kit (cytova, uppsala, catalog No. 28995056). anti-His capture antibodies were diluted 1:20 in running buffer and coupled to CM5 chips (cytova, uppsala, catalog No. 29149603) using standard amine coupling using an amine coupling kit (cytova, uppsala, catalog No. BR-100-50) to generate about 8000 Reaction Units (RU). Ten consecutive 1:1 dilutions of bispecific antibody in HBS-EP+ assay buffer were prepared at concentrations of 5.8nmol/L, 11.7nmol/L, 23.4nmol/L, 46.8nmol/L, 93.75nmol/L, 187.5nmol/L, 375nmol/L, 750nmol/L, 1500nmol/L and 3000 nmol/L. The CD16a (V/F) protein was diluted with HBS-EP+ buffer to a concentration of 0.1ng/mL and used in the experiments at this concentration. CD16a (V176) and CD16a (V176F) were captured on flow cells 2 and 4, respectively, for 30sec at a flow rate of 10 μl/min to yield a maximum reaction (Rmax) value of about 30 RU. Measurements were made in a multi-cycle kinetic experiment. In each multicycle experiment CD16a was captured by anti-His antibodies immobilized on a series S CM5 sensor chip (human antibody capture kit, cytova, uppsala, catalog No. BR 1008-39). Bispecific antibody diluted in HBS-EP+ buffer was injected at a flow rate of 30 μL/min for 120sec in a 1:1 dilution series of 5.8nmol/L to 3000nmol/L followed by a dissociation period of 120 sec. All analyte concentrations were run in duplicate with multiple buffer blanks for double reference. Regeneration of the capture surface was performed at 30 μl/min for 30sec by two consecutive injections of regeneration solution (10 mmol/L glycine pH 1.5). Steady state fitting using SPR reactions for measured antibody concentrations binding affinity (KD values) of bispecific antibodies to human CD16a was assessed using Biacore T200 evaluation software version 3.0 (cytova, uppsala).
A.9. Antitumor activity against MOLM-13 human AML injected in SCID mice.
The efficacy of the murine alternative form muNKp46-hucd123_f25 of NKp46-cd123_f25 was evaluated in Severe Combined Immunodeficiency (SCID) mice transplanted with disseminated human MOLM-13 cells. This alternative is different for the arm targeting NKp46 protein than NKp46-cd123_f25 (since it targets murine protein instead of human protein) and is similar for the other arm to NKp46-cd123_f25 (human CD123 binding arm and human IgG1 competent Fc domain capable of binding all activated murine fcγr, recruiting murine effector cells and inducing ADCC with murine NK cells).
The muNKp46-hucd123_f25 activity was compared to an anti-CD 123ADCC enhancing antibody (reference 1) capable of binding to murine fcγr and recruiting murine effector cells. The muNKp46-hucd123_f25 activity was also compared to an isotype control (muNKp 46-IC) that binds to muNKp46 and murine fcγr but not huCD 123.
Mice were inoculated intravenously with tumor cells on day 0 (5 x10 6 ). Treatment was administered by intraperitoneal route on day 1 after tumor implantation.
In the first experiment (fig. 8), mice were randomized in 4 groups on day 1 after tumor implantation (n=10 mice in the treatment group and n=20 mice in the control group). Munkp46-hucd123_f25 was administered at 0.5, 0.25 and 0.05mg/kg after intra-parenteral (intra-paramnteral) administration on day 1.
In a second experiment (FIG. 18), muNKp46-IC was administered at 0.5 mg/kg. muNKp46-hucd123_f25 and reference 1 were administered at 5, 0.5, 0.25 and 0.05 mg/kg. The control group was not treated.
In a third experiment (fig. 19), mice were randomized into 4 groups (untreated control group; untreated control group + anti-asialoglycol GM1; NKCE control; or NKCE + anti-asialoglycol GM 1). On the day before tumor implantation (day-1) and on day 5 after tumor implantation, the experimental group received NK cell depleting antibody anti-asialoggm 1. Treatment (vehicle or NKCE) was administered intraperitoneally at a single dose of 0.5mg/kg on day 1 after tumor implantation. NKCE includes NKp46-cd123_f25, muNKp46-IC, isotype control antibodies bind huCD123 and murine fcγrs, but not mouse NKp46 (IC-huCD 123).
Mice were examined and adverse clinical reactions were recorded. Individual mice were weighed daily until the end of the experiment (day 70). Mice were euthanized when they became moribund according to predetermined criteria to avoid pain in the animals. The critical pathology-related clinical sign is considered to be quadriplegia, ascites, accessible internal tumor mass, morbidity, or greater than or equal to 20% weight loss.
The primary efficacy endpoints are median survival time in days (MST), percent increase in life (% ILS), and long term survival.
The individual dates of death (if any) for each mouse are reported. The MST for each group was determined and the ratio ILS was calculated and expressed as a percentage:
％ILS＝100x(T-C)/C
where t=mst of the treatment group and c=mst of the control group.
For the purposes of this example, dosages were considered therapeutically active when% ILS was better than 25% and highly active when% ILS was better than 50% (Johnson JI, decker S, zaharevitz D, rubistein LV, venditti JM, schepartz S, kalyland drug S et al Relationships between drug activity in NCI preclinical in vitro and in vivo models and early clinical three.Br.J.cancer.2001; 84 (10): 1424-31).
Long term survival is defined as the number of mice with a survival duration greater than or equal to 2 times the control group MST divided by the total number of mice in the group, expressed as a percentage.
A.10. Antitumor Activity in non-human primate (NHP)
Acceptable flow cytometry panels were used to evaluate cynomolgus monkey blood samples, phenotyping and counting of basophils, and total CD123 immune cells. The panel is composed of antibodies against the following antigens: CD45 (clone D058-1283), CD14 (clone REA 599), CD203c (clone NP4D 6), CD193 (clone 5E 8), igE (clone REA 1049), CD123 (clone CD 123), CD33 (clone AC104.3E3) and the viability marker Zombie Nir (bioleged 423106). 100. Mu.L of whole blood samples collected into 3K-EDTA anticoagulation air vacuum samples were incubated with lysis solution (Biocytox CP 025) for 10min, then centrifuged at 300g for 5min at room temperature with DPBS (Sigma D8537). Resuspended cells were stained with antibody and viability label for 10min at room temperature. A third step of centrifugation is performed to eliminate non-immobilized antibodies. Cells were resuspended in 250 μl of fixative (Biocytex CP 026) and incubated for one hour at room temperature. 100 μl of flow-counting beads (Beckman a 91346) were added to the cell tube and collected on a Gallios Beckman coulter instrument equipped with 3 lasers and 10 colors.
A.11. In vitro effects on CD123+ normal blood cells and associated cytokine release in human Peripheral Blood Mononuclear Cells (PBMC)
PBMCs from human healthy donors (n=10) were inoculated into 190 μl of complete medium (500,000 cells/well) in 96-well U-shaped bottom plates (ultra low binding Costar ref#cls7007) and incubated with serial dilutions of CD123-NKCE, IC-NKCE control and CD123-TCE molecules in the presence of 5% CO2 at 37 ℃ for 20 hours. The absolute concentration of cytokines released in the supernatant was analyzed by flow cytometry to analyze a population of basophils defined as tcrαβ negative, CD14 negative and IgE receptor positive living cells, and by mesoscale discovery (MSD) assay.
Flow cytometry assays
The cell pellet was suspended in cold 50. Mu.L of staining buffer (AutoMACS running buffer Miltenyi Ref#130-091-221) containing 1. Mu.L of human FcR blocking reagent (Miltenyi Ref#130-059-901). The PBMC subset specific marker antibody and the mixture of viability reagents were added to the PBMC suspension according to the supplier's recommendations. As Fluorescence Minus One (FMO) controls, other spots were performed by labeling PBMCs with the same mixture in which each labeled antibody was replaced by its corresponding isotype control. Cells with mixed antibodies were incubated in the dark for 1 hour at 4 ℃ When (1). Then, the cell suspension was centrifuged twice at 300g during 5 minutes at 4℃and the supernatant was discarded and 200. Mu.L of staining buffer was added between each centrifugation. UsingThe cells were analyzed by an analyzer, miltenyi flow cytometer. Use->The software (applied cytometer inc.) performs an analysis of the raw data (fcs file) derived from the flow cytometer. The population was gated from the forward scatter/side scatter plot and single and other living cells were gated on the negative gate of propidium iodide. The gate is set according to FMO control.
Cytokine MSD assay
Cell supernatants were collected and diluted in MSD buffer as recommended by the purchaser. Diluted samples or pre-diluted multi-analyte calibrator samples were added to pre-coated plates provided in the kit. After addition of the solution of detection antibody conjugated to electrochemiluminescent label (MSD SULFO-TAG), the plate was incubated for 2 hours at room temperature. Then, MSD buffer is added, which creates an appropriate chemical environment for Electrochemiluminescence (ECL), and the plate is loaded into an MSD instrument, where application of a voltage to the plate electrode causes the captured label to emit light. The instrument measures the intensity of the emitted light and provides a quantitative measurement of each analyte in the sample.
Analysis of raw data derived from the MSD instrument was performed using Excel software. The concentrations of IL-6, IL-1b, IFNγ and TNF α were determined from the ECL signals by fitting back to a calibration curve established with a 4-parameter logistic model with 1/Y2 weighting.
A.12. Cytokine release determination in non-human primate (NHP) plasma
ECLIA (electrochemiluminescence assay) method using Mesoscale (MSD) pro-inflammatory panel 1 (NHP) kit (ref.k 15056 d) was developed and validated for monkey K 3 Quantification of IL-2, IFN-gamma, IL-6 and IL-10 in EDTA plasma. It is a kindQuantitative sandwich enzyme immunoassays using anti-human IL-2, IL-6, IL10 and IFN-gamma antibodies and ruthenium anti-human IL-2, IL-6, IL-10 and IFN-gamma antibodies immobilized on the surface of the working electrode. 50.0. Mu.L of the diluted sample was dispensed into wells of 96-well plates coated with human anti-human IL-2, IL-6, IL-10 and IFN-gamma antibodies. After an overnight incubation period at room temperature and 3 washing steps, 25.0. Mu.L of sulfotag conjugated anti-human IL-2, IL-6, IL-10 and IFN-gamma antibodies were added. After 3 washing steps, 150 μl of read buffer (2X) was added to create a suitable chemical environment for electrochemiluminescence. The instrument measures the intensity of the emitted light to provide a quantitative measurement of the analyte in the sample. Analysis was performed in duplicate.
Pharmacokinetic and pharmacodynamic studies in non-human primates
CD123-NKCE solutions for administration were prepared temporarily by diluting stock solutions in vehicle and kept at room temperature before and during administration. To avoid adsorption, polypropylene, polycarbonate or PETG containers were used for dilution and these containers were coated with a 0.9% NaCl solution containing 100ppm ps80 prior to use. The tubing (syringe/airfoil needle) for each intravenous administration was coated by successive flushing with 0.9% NaCl solution containing 100ppm PS 80.
Animals were identified as M1 and M2 for males dosed at 0.1 mg/kg/administration, F3 and F4 for females dosed at 0.1 mg/kg/administration, M5 and M6 for males dosed at 3 mg/kg/administration, and F7 and F8 for females dosed at 0.1 mg/kg/administration, respectively. Dosing was performed on days 1, 8, 15 and 22. The toxicity potentially delaying onset and/or the reversibility of the potential toxicity was assessed one week (day 29) and up to 4 weeks (day 50) after the last (4 th) administration. M2, F4, M6 and F8 were euthanized on day 29 and necropsied.
Parameters of each treated animal were evaluated:
-in blood
Before testing (pre-dose)
Day 1, 1.5, 5, 24, 72 hours after the start of infusion
Day 8, 24 hours after infusion was started
Day 15, 1.5 and 24 hours after the start of infusion
Day 22, 24 hours after infusion was started
Day 29 (1 week after last administration; all animals)
Day 50 (4 weeks after the last administration; animals recovered).
-in bone marrow
Before testing (dose front)
Day 9
Day 29 (1 week after last administration; all animals)
Day 50 (4 weeks after last administration; animals recovered)
Blood samples were drawn from the brachial or saphenous vein (continuous sampling) into K3-EDTA polypropylene tubes. The blood sample was placed on wet ice and centrifuged. The plasma samples obtained were frozen at-80 ℃ prior to their analysis. CD123-NKCE concentration was determined in plasma using a dedicated immunoassay method in which CD123-NKCE was captured by biotin-conjugated CD123 recombinant protein and revealed by monkey-absorbed alexa-goat anti-human IgG with a lower limit of quantitation (LLOQ) value of 0.250ng/mL.
Results
NKp46-CD123_F25 binding protein
The F25 form or variant thereof is shown in fig. 1 and 2 and comprises three polypeptide chains. The NKp46-CD123_F25 binding protein comprises three polypeptide chains, including a human CD123 binding domain and a human NKp46 binding domain, respectively, including hypervariable regions comprising the polypeptide sequences SEQ ID NO:1, 2, 3, 7, 8, 9 and SEQ ID NO:13, 14, 15, 27, 28, 29.
Each polypeptide chain (I, II and III) is expressed with a signal (or "leader") sequence that is cleaved intracellularly prior to assembly.
The first polypeptide chain (or "polypeptide chain (I)" or "fragment I" or "fragment 1") comprises V from N-terminus to C-terminus, which corresponds to the amino sequence of SEQ ID NO. 43 L (CD 123 binding) domain, native C derived from human IgG1 K (or Cκ) domain, modified humanIgG1 hinge region ("DKTTCPPCP") wherein residue D (position according to EU numbering) is linked to human C K The C-terminal cysteine of the domain. The Fc region or variant thereof is further derived from a polypeptide comprising C H 2-C H 3 domain natural human IgG1 antibody. Disulfide bridges are potentially formed extracellularly with a second polypeptide chain ("chain II") having native cysteines.
The second polypeptide chain ("polypeptide chain (II)" or "fragment II" or "fragment 2") comprises V from N-terminus to C-terminus, which corresponds to the amino sequence of SEQ ID NO. 41 H (CD 123 binding) domain, native C derived from human IgG1 H 1 domain, unmodified human IgG1 hinge region ("EPKSCDKTHTCPPCP"), and human IgG 1-derived comprising C H 2-C H The Fc region of the 3 domain or variants thereof (wherein C H The last residue of the 3 domain is removed and replaced by a small tetramic acid "STGS" linker), V corresponding to the amino sequence of SEQ ID NO. 45 H (NKp 46 binding) domain, C to the first polypeptide chain H 1 domain identical second native C H 1 domain and C-terminal hinge sequence from human IgG 1.
The third polypeptide chain ("polypeptide chain (III)" or "fragment III" or "fragment 3") comprises V corresponding to the amino sequence of SEQ ID NO 53 L (NKp 46 binding) domain and cysteine-terminated C K A domain.
C of the Fc portion of the NKp46-CD123_F25 binding protein of the present disclosure H The 2 domain is glycosylated at position N297 to ensure binding to CD16 (fcγr).
Overall, the NKp46-cd123_f25 binding protein comprises four predicted interchain disulfide bridges:
(i) C-terminal C of the first polypeptide chain K A disulfide bridge of cysteine linked to a first hinge cysteine of a second polypeptide chain;
(ii) Disulfide bridges formed with the two cysteines of the hinge regions of the first and second polypeptide chains;
(iii) Ligating the last C-terminal cysteine of the second polypeptide chain to the C-terminal of the second polypeptide chain H 1 domain.
The results shown in chapters B3 to B11 relating to in vitro, ex vivo and in vivo activities and safety profiles are obtained with the NKp46-cd123_f25 binding proteins of the present disclosure comprising polypeptides (I), (II) and (III); wherein the polypeptide (I) consists of the amino acid sequence of SEQ ID NO. 64, the polypeptide (II) consists of the amino acid sequence of SEQ ID NO. 65, and the polypeptide (III) consists of the amino acid sequence of SEQ ID NO. 66.
B.3. Characterization of NKp46-CD123_F25 binding protein construct binding to human Fc-gamma receptor by SPR
The NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) was tested by SPR to confirm its affinity to a panel of human fcγ receptors, including both variants of CD64 and CD16a receptors.
Human CD16a-V receptor or CD16a V Refers to a polypeptide construct comprising a fragment of the CD16 human receptor that binds to the Fc region of a natural antibody, mediates antibody-dependent cytotoxicity, and carries valine (V) at position 158, which is also reported in the literature as allotype CD16a V.
Human CD16a-F receptor or CD16a F Refers to a polypeptide construct comprising a fragment of the CD16 human receptor that binds to the Fc region of a natural antibody, mediates antibody-dependent cytotoxicity, and carries phenylalanine (F) at position 158, which is also reported in the literature as allotype CD16a F.
The conclusion of this experiment was that the constant region constituting NKp46-cd123_f25 retains its affinity for a variety of human Fc-gamma receptors, including human CD16 and human CD 64.
B.4. Characterization of NKp46-cd123_f25 binding proteins binding to NKp46 and CD123 by SPR the same experiment was performed with human and monkey forms of NKp 46. The results are summarized in the two tables below (tables 1 and 2).
TABLE 1
TABLE 2
The conclusion of this experiment was that the NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) associated with the present disclosure retained affinity for NKp46 and CD123 targets, which was applicable to both human and monkey subtypes.
NKp46-CD123_F25 binding protein induces AML cytotoxicity
FIG. 4 reports cytotoxicity in vitro against MOLM-13AML cells (FIG. 4A). The same experiment as the target cells was reproduced for the ex vivo patient's maternal cell sample (fig. 4B). Cytotoxicity was assessed as a function of the concentration of NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) tested in the experiment.
Overall, experiments showed that NKp46-cd123_f25 is responsible for dose-dependent cytotoxicity in both in vitro and ex vivo samples. For similar concentrations, cytotoxicity was also observed higher than that observed with the ADCC-enhanced anti-CD 123 antibody without specificity for NKp46 (reference 1). In contrast, the negative control variant of the F25 form, which binds only NKp46 (NKp 46-ic_f25), showed little cytotoxicity under the test conditions. Thus, the experiment supported a synergistic effect of dual binding to both CD123 and NKp46 in Fc competent construct (F25), resulting in cytotoxicity against CD123 positive tumor cells.
FIG. 5 provides for EC-based 50 Is related to the MOLM-13 cell line. An improvement in vitro cytotoxicity (conversion to EC) was observed with the NKp46-CD123_F25 binding protein (NKp 46-CD123_F25) 50 Is reduced). In contrast, the F6 control lacking N-glycosylation at residue 297 (NKp 46-cd123_f6) provides reduced cytotoxicity because it activates NK cells by only engaging NKp46 and not CD16 a. Thus, this second experiment provides evidence of the synergistic effect observed by binding and activation of NKp46 and CD16a NK cell markers.
Thus, in the process of aiming atSpecific lysis was demonstrated with NKp46-cd123_f25 in the presence of human NK cells of CD123 positive MOLM-13AML cells and with anti-CD 123 antibodies (reference 1) enhanced with ADCC without specificity for NKp 46. EC (EC) 50 Values were established based on cell lysis as a function of binder concentration. The results are shown below.
Molecules EC 50 (pM)
Mean +/-sem (4 donors)
NKp46-CD123_F25 80.3±44.9
Reference 1 85.3±41.3
Thus, it was shown that the NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) exhibited cytotoxicity activity at least equal to or superior to that of the ADCC-enhanced anti-CD 123 antibody (reference 1).
Reference 1 is a fully humanized monoclonal antibody suitable for the treatment of AML, which targets the alpha chain of interleukin 3 receptor (IL 3 ra; also known as CD 123) and is optimized for enhanced activation of antibody-dependent cell-mediated cytotoxicity (ADCC) by natural killer cells.
CD64 expression on AML did not affect NKCE cytotoxic activity but negatively affected reference 1 activity
To further record and compare the activities of NKp46-cd123_f25 and the reference 1 antibody, cytotoxicity experiments were performed using different AML cell lines expressing CD123 as targets. Surprisingly, even though THP-1 and MOLM-13 cells expressed comparable levels of CD123 on the cell surface, the reference 1 antibody effectively killed MOLM-13 cells, but was not active on THP-1 cells (FIG. 6A-upper panel). In contrast to the reference 1 antibody, NKp46-cd123_f25 showed comparable killing activity on both AML cell lines (fig. 6A-upper panel). FIG. 6A-bottom panel shows that MOLM-13 and THP-1 cells expressed differently on the cell surface as CD32a/b and CD64 FcγR as analyzed by flow cytometry. MOLM-13 cells had significantly lower CD64 levels and lower CD32a/b levels compared to THP-1 cells (fig. 6A-bottom panel). CD64 (fcyri) is a high affinity receptor for human IgG expressed on healthy monocytes and macrophages and is found to be expressed on AML blast cells in about one third of patients who can be considered CD64 positive acute myelogenous leukemia. To investigate the effect of CD64 expression on NK cell engager (NKCE) cytotoxicity, CD32a/b and CD64 expression was selectively knocked down in THP-1 cells compared to humanized monoclonal antibody reference 1.
Killing experiments with THP-1 subclones expressing CD32a/B but not CD64 or expressing CD64 but not CD32a/B (fig. 6B) showed that CD64 expression on THP-1 was responsible for inhibiting ADCC activity of reference 1, as killing of this antibody was only restored on subclones inactivated on CD64 expression.
Thus, these results indicate that cis-capture of antibody Fc by fcγ R, CD64 on the surface of AML cells may interfere with ADCC by competing with NK cells for CD16a binding.
Interestingly, NKp46-cd123_f25 exhibited consistent killing activity against all AML cell lines and all THP-1 subclones, emphasizing that NKp46-cd123_f25 binding proteins relevant to the present disclosure were more effective for inducing NK cell-mediated cytotoxicity of AML blasts, regardless of CD64 expression status, as compared to reference 1.
Fig. 14A-14B demonstrate that reference 1 activity is negatively affected by CD64 expression on AML cells.
Fig. 14A reports NKp46-cd123_f25 and reference 1 mediated cytotoxicity of primary malignant AML blasts from four representative patients (AML #1, #2, #5 and #6;N =8) assessed ex vivo using healthy donor NK cells as effectors. The reference 1 antibody mediated killing of CD64 negative patient samples (AML #1 and #2; fig. 14A) but had little activity on the blast cells from CD64 positive AML patient samples (AML #5 and #6; fig. 14A) as observed with the MOLM-13 and THP-1 cell lines. Thus, AML #5-AML #6 (reference 1 non-responder) had higher levels of CD32 and CD64 staining than AML #1 and AML #2 (reference 1 responder) (fig. 14B, right panel, peak shift of CD64 and CD32 in the two groups compared to the control).
In contrast, CD 123-targeting trifunctional NKp46-NKCE has a strong anti-tumor effect on both CD64 positive and CD64 negative AML patient samples (fig. 14).
FIGS. 6 and 14 show that CD123-NKp46_F25 is equally effective on the parental THP-1 cell line, THP-1 subclone and MOLM-13 cells, regardless of the status of FcγR expression, and more specifically, regardless of CD64 expression on the target cells. In addition, the trifunctional NKCE molecules also displayed killing activity against all primary malignant AML cells, promoting significant antitumor activity in CD64 positive AML patient samples for which reference 1 was completely inactive (AML #5 and 6) (fig. 14A). For experiments using MOLM-13 cells, the trifunctional molecules (CD 123-NKp46_F25) were more potent than bispecific agents that activated either NKp46 (CD 123-NKp46_F6) or CD16a (CD 123-IC_F25) alone (FIG. 15A), demonstrating potent killing activity (geometric mean EC 50 4.2[95% CI:2.7, 6.3]pM, average observed maximum specific lysis was 71±5%) and good agreement between healthy NK cell donors (fig. 15B).
NK cell activation of NK cell splicer in autologous raw AML samples the property of the NKp46-cd123_f25 binding protein of the present disclosure (NKp 46-cd123_f25) to induce NK degranulation against primary CD64 (+) or CD64 (-) AML blast cells was established by measuring the percentage of CD107 positive NK cells in figure 7.
In general, the experiments provide evidence that the NKp46-cd123_f25 binding proteins of the present disclosure are capable of activating NK cells in a primary sample from an AML patient in an autologous assay, e.g., with primary parent cells and NK cells from the same patient.
These results were further consolidated in a dedicated autologous NK cell activation assay using two additional AML patient samples without (sample 10) and with (samples 8 and 9) CD64 expression (fig. 16A). Likewise, NKp46-CD123-NKCE mediates autologous activation of patient NK cells against their own malignant cells (see transition of CD107 staining), regardless of the status of CD64 expression on the blast cells, whereas reference 1 was active only on CD64 negative samples (sample 10) (fig. 16B).
Thus, this experiment supports the ability of the NKp46-cd123_f25 binding proteins of the present disclosure to activate NK cells ex vivo with respect to both CD64 (+) and CD64 (-) AML cells.
Furthermore, in this autologous assay, the NKp46-cd123_f25 binding protein of the present disclosure is able to bind NK cells in the presence of CD64 (+) cells at much lower concentrations than were observed in the presence of reference 1.
In addition, the average EC on NKp46-cd123_f25 and reference 1 for four AML samples (2 CD64 (+) and 2 CD64 (-)) was also determined in a maternal cell killing assay using six NK healthy donors 50 Quantification was performed and the results reproduced below.
Taken together, these experiments again demonstrate that the parent cell killing activity of the NKp46-cd123_f25 binding protein associated with the present disclosure is superior to that of the reference 1 antibody, even though for the CD64 (-) AML sample, reference 1 is inactive against CD64 (+) AML parent cells.
NKp46-CD123 NK cell adaptor induces anti-tumor Activity against MOLM-13 human AML injected in the SCID mouse model
FIG. 8 reports the dose-dependent antitumor activity of the muNKp46-huCD123_F25 binding protein (muNKp 46-huCD123_F25) using the SCID mouse model, which induced 50% mouse survival at 0.5mg/kg 70 days after tumor implantation. More specifically, the treated control group showed a MST of 27.5 days and 5% long term survivors.
The X-axis indicates the days after tumor implantation consisting of intravenous injection of human MOLM-13, including single compound administration by intraperitoneal (i.p.) route on the first day. The Y-axis indicates the percent survival of 10 mice based on the treatment group and 20 mice based on the control group. * P-value <0.001 compared to control group.
The group treated with 0.5mg/kg of muNKp46-hucd123_f25 showed 66 days of MST, 140% increased lifetime and 50% long term survivors, as compared to the control group, 0.5mg/kg of muNKp46-hucd123_f25 had statistically significant activity (p < 0.0001). For a dose of 0.25mg/kg, the group showed 36 days of MST, 31% increased life span and 10% long term survivors, with no statistical difference from the control group in the induction of muNKp46-huCD123_F25 at 0.25 mg/kg. For a dose of 0.05mg/kg, the group showed 33 days of MST, 20% increased lifetime and no long term survivors, 0.05mg/kg of muNKp46-huCD123_F25 was not statistically different from the control group.
The NKp46-cd123_f25 binding proteins associated with the present disclosure show dose-dependent in vivo antitumor activity with robust activity at 0.5 mg/kg. Those results are summarized in table 3 below:
TABLE 3 Table 3
Thus, this demonstrates that NK cell engagers are effective for in vivo treatment of proliferative disorders in animal models.
Furthermore, for further evaluation of efficacy, the experiments described above and reported in fig. 8 were repeated, but including 5mg/kgmuNKp 46-hucd123_f25nkce or control, and administration of additional groups, reference 1. The results are presented in fig. 18.
Consistent with the study of fig. 8, in the study of fig. 18, the surrogate muNKp46-hucd123_f25 induced statistically significant activity in the human MOLM-13 spreading model at doses of 5, 0.5, 0.25 and 0.05mg/kg, for doses of 5, 0.5 and 0.25mg/kg, with ILS as 100% and long term survivors as 60% compared to the control, and for doses of 0.05mg/kg, ILS as 30% and long term survivors as 10%.
Reference 1 induced statistically significant activity in the human MOLM-13 spreading model at a dose of 5mg/kg, with ILS of 70% and long term survivors of 40%. It was inactive at doses of 0.5, 0.25 and 0.05 mg/kg.
At doses of 0.5 and 0.25mg/kg, the activity of muNKp46-hucd123_f25 was statistically significantly higher than that of reference 1.
The table results of fig. 18 are summarized as follows:
/>
in summary, the muNKp46-hucd123_f25 surrogate showed dose-dependent activity with robust activity from 0.25 mg/kg. These data demonstrate the benefit of NK cells co-engaging with NKp46/fcγr, resulting in improved in vivo efficacy relative to anti-CD 123 antibodies (reference 1).
NKp46-CD123 NK cell adaptor induces in vivo anti-tumor Activity in non-human primate
In two specific pharmacokinetic, pharmacodynamic and safety studies on NHP, it was further demonstrated that there was no pro-inflammatory cytokine release of NKCE in human PBMC in vitro. Cynomolgus monkey was chosen as the relevant species for preclinical pharmacokinetic, pharmacodynamic and toxicological studies based on (1) that the tissue distribution of cynomolgus monkey NKp46 and CD123 is similar to human (Walzer et al PNAS;2007;104:3384-3398 and ChiChiChili et al Sci Transl Med;2015; 7:289) and (2) that the affinity of the antibodies and Fc fragments constituting the CD123-NKCE molecules to cynomolgus monkey antigens and FcgammaR are similar to human molecules as shown in Table 4 below. Specifically, CD16a (FcgammaRIIIA) is a monovalent K for its 158V and 158F subtypes D 0.46.+ -. 0.01. Mu.M and 2.61.+ -. 0.09. Mu.M, respectively, and monovalent K binding of anti-NKp 46 and anti-CD 123 antibody portions to human NKp46 and human CD123 D Respectively is16.3+ -2.9 nM and 0.40+ -0.04 nM.
TABLE 4 Table 4
The results shown in Table 4 were carried out at 25℃pH 5.6; default conditions: pH7.4 at 25 ℃. NA:
is not applicable. SD: standard deviation. K (K) D : dissociation constant.
FIG. 9 further shows complete and sustained depletion of CD123 positive basophils at 3 μg/kg for up to 20 days after injection of the NKp46-CD123_F25 binding protein (NKp 46-CD123_F25) related to the present disclosure and up to 5 hours at 0.5 μg/kg for non-human primates.
Thus, this result suggests that previously obtained in vitro, ex vivo and in vivo results, including those observed in SCID mouse models, for NK cell engagers can be extrapolated to non-human primates.
Overall, CD123 positive immune cell depletion is a marker for the in vivo activity of NKp46-cd123_f25 binding protein in non-human primates. It was found that rapid and sustained depletion of CD123 positive basophils was observed, which occurred about 1.5 hours after the start of infusion and was maintained until day 7, and cell numbers returned to baseline at day 28.
B.10. Comparison of Fc competent forms in cytotoxicity assays, i.e. F5 and 25 forms, respectively
FIGS. 10A and 10B illustrate that the NKp46-CD123_F25 and NKp46-CD123_F5 binding proteins show the same cytotoxic activity against both MOLM-13 and THP-1 AML cell lines by conjugating NK cells (D648) from healthy donors.
The major difference between MOLM-13 and THP-1 cells is related to the expression level of its CD64 marker. MOLM-13 cells do not express CD64 (-), whereas THP-1 cells express high levels of CD64 (+). Both cells expressed CD32a.
Thus, this example reports the change in specific cleavage of three different binding proteins: (i) NKp46-cd123_f5 binding protein in form F5 (NKp 46-cd123_f5), (ii) NKp46-cd123_f25 binding protein in form F25 (NKp 46-cd123_f25), and (iii) negative isotype control variant that binds only form F5 of CD123 (CD 123-ic_f5).
Overall, those results indicate that cytotoxic activity is maintained using two Fc-competent NKp46-CD123 binding proteins in the F5 and F25 forms. In contrast, the negative control produced no detectable cytotoxic activity.
B.11. The NKp46-CD123 NKCE induced CD123 positive basophil depletion is associated with low cytokine release when compared to T cell adaptor tools
Effective cytotoxicity may be related to toxicity in patients. To investigate cytokine release from human PBMCs induced in vitro by CD123-NKCE, the following experiments were performed as predictive assays for potential Cytokine Release Syndrome (CRS) in patients.
Human PBMC (n=10 samples) were incubated with NKp46-cd123_f25 (CD 123-NKCE;0.1, 1 or 10 μg/mL dose; 0.68-68 nM), a negative isotype control variant of form F25 that binds only NKp46 (NKp 46-ic_f25;0.1, 1 or 10 μg/mL dose; 0.68-68 nM), or an anti-CD 123T cell engager antibody tool specific for CD3 and not specific for NKp46 (CD 123-TCE, reference 1.1 μg/mL;1.6 nM) in the presence of a concentration gradient (10) -3 To 10 1 Mu g/mL) for 20 hours.
In human PBMC, CD123 is constitutively expressed on a subset of circulating basophils and plasmacytoid dendritic cells (pdcs). In view of the higher CD123 of basophils than pDC + Expression, the percentage of basophil consumption was monitored for each of the above treatment groups. FIG. 11 shows the promotion of CD123 by treatment of human PBMC with CD123-NKCE + Dose-dependent partial depletion of basophils, with a median maximum depletion of 37% [31;50]And geometric mean EC 50 Values 38 pM (95% CI [12.9; 401)]) Using 10 donor samples6. In contrast, basophil depletion did not occur in large amounts in the presence of the F25 binding molecule lacking the CD123 binding site (NKp 46-ic_f25). Supernatants were collected from the human PBMC treatment groups described above to quantify the amount of cytokine release. Figure 12 demonstrates that in vitro IL-6 and IL-1 beta pro-inflammatory cytokines and TNF-alpha and IFN-gamma cytokine release associated with administration of NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) associated with the present disclosure is significantly lower than the corresponding IL-6 release associated with administration of 100-fold lower doses (0.1 μg/ml) of positive control reference 1 known to induce Cytokine Release Syndrome (CRS).
Even at 42-fold higher concentrations, CD123-NKCE induced cytokine release levels were far lower than CD123-TCE.
FIGS. 11 and 12 show that treatment of PBMC with CD123-NKCE promotes CD123 compared to treatment with CD3-CD123 antibody molecules + Consumption of basophils, but induces significantly lower levels of IL-6, IL-1 beta, TNF-alpha and IFN-gamma release.
In summary, the NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) associated with the present disclosure has shown its ability to bind primary NK cells to target and kill cd123+ primary normal mononuclear cells associated with small cytokine release, and may have a better benefit/risk ratio for the treatment of AML than TCE.
Figures 13A-13F show that very low cytokine release (IL 6 and IL 10) was observed in all treated animals (male cynomolgus monkeys) without any relevant clinical signs after starting injection of NKp46-cd123_f25 binding protein (NKp 46-cd123_f25) relevant to the present disclosure, regardless of dose level and high dose up to 3 mg/kg. IL-2 and IFN gamma cytokine release was not detected. More particularly, transient IL6 and IL10 peaks were detected in non-human primates after a single intravenous injection of F25 construct at 3 mg/kg. Such transient peaks occur from 1 hour to 5 hours and return to baseline within 1 or 2 days.
Furthermore, at doses up to 3mg/kg, those very low levels of IL-6 and IL-10 cytokine release were not associated with clinical signs. This suggests that such NK cell adapters have a good safety profile in non-human primates.
Flow cytometry analysis corresponding to figure 17, commensurate with cytokine/chemokine production, showed that NKp46-cd123_f25 binding protein promoted NK cell activation only when CD123 expressing target cells were present.
Primary donor NK cells incubated in the presence of NKp46-cd123_f25 (n=3) displayed higher expression levels of NK cell activation markers CD107 and CD69 and cytokines TNF- α, IFN- γ and chemokine MIP-1 β in a dose dependent manner when MOLM-13 target cells were present (fig. 17, compare NK alone with nk+molm-13 conditions).
Overall, the experiments provide evidence that NKp46-cd123_f25 binding proteins of the present disclosure activate and commensurately promote cytokine/chemokine production against cd123+ AML cells in primary NK cells without off-target activation of NK cells.
NK cells are a subset of effector lymphocytes responsible for the antitumor activity of NKp46-CD123_F25
To test whether the efficacy of NKp46-cd123_f25 was dependent on the anti-tumor activity of NK cells against MOLM-13 human AML injected in the SCID mouse model, mice underwent NK cell depletion protocol during the experimental setup outlined in B.8.
The results are presented in fig. 18 and 19, and the corresponding table results are shown in table 5 below.
TABLE 5
The treated control group showed a Median Survival Time (MST) of 29 days and no long term survivors.
The muNKp46-IC isotype control showed no activity, with ILS of 7% and no long term survivors. No effect on NK consumption was observed in the group treated with the muNKp46-IC isotype control, with no increase in lifetime and 10% long term survivors.
The IC-huCD123 isotype control had statistically significant activity with ILS of 28% and long-term survivors of 20%. A statistically significant effect on the consumption was observed in the group treated with IC-huCD123 isotype control, with no increase in longevity, and no long-term survivors.
muNKp46-hucd123_f25 had statistically significant activity with ILS of 84% and long term survivors of 40%. A statistically significant effect on the consumption was observed in the group treated with muNKp46-hucd123_f25, with ILS of 14% and no long term survivors.
In conclusion, NK consumption affects the antitumor activity of muNKp46-huCD123_F25, confirming the involvement of NK as an effector cell in the in vivo efficacy of muNKp46-huCD123_F25 NKCE.
Nkp46-CD123 NK cell adapter was safe and effective in NHP in order to confirm the safety profile of Nkp-CD 123 cell adapter in the NHP study performed in fig. 9 and 13, the pharmacokinetics and pharmacodynamics of CD123-NKCE administered by single intravenous injection at high (3 mg/kg) or low (3 μg/kg and 0.5 μg/kg) doses in male cynomolgus monkeys (2 animals for 3mg/kg and 3 μg/kg dose, respectively, and 1 animal for 0.5 μg/kg dose) were queried.
Treatment with CD123-NKCE at two doses of 3mg/kg and 3. Mu.g/kg promoted CD123 in blood of all monkeys + Continuous and complete cell depletion for more than 10 days (as for CD123 in fig. 20A and 20B + Basophils and total CD123 + Exemplified by cells) with very little amount<50 pg/mL) of the pro-inflammatory cytokines IL-6 and IL-10 were released (FIG. 20C) without any associated clinical signs.
CD123 was observed in monkeys treated with the lowest dose (0.5 μg/kg, data not shown) + Transient and partial consumption of cells, but 3 μg/kg is considered the lowest effective dose in this species. The PK curves of two monkeys treated with the highest dose (3 mg/kg) were labeled as anti-drug antibody (ADA) response (number Not shown), occurs 12-14 days after treatment (fig. 20D), and is associated with recovery of CD123 from blood at a later point in time + Cell correlation.
The preclinical safety profile of CD123-NKCE was further queried by a exploratory repeat dose toxicity study in which four monkeys (2/sex/dose) were treated weekly for four weeks at a dose of 3 mg/kg/administration or 0.1 mg/kg/administration by intravenous infusion for one hour (fig. 21). In all monkeys (except one, i.e., monkey M5, male number 5; FIG. 21), exposure to CD123-NKCE was continued for at least two weeks at both doses tested, with the presence of anti-drug antibodies (ADA) detected (data not shown) from the third administration (day 15) (Table 6).
Table 6 below shows the individual CD123-NKCE plasma concentration values after repeated 1 hour intravenous infusion for 4 weeks (on days 1, 8, 15 and 22) at 0.1 and 3 mg/kg/administration to cynomolgus monkeys.
TABLE 6
/>
The numerical values are rounded to three significant digits.
LLOQ (lower limit of quantitation) 0.250ng/mL; outliers of TK analysis were excluded, #; US: unscheduled sampling; # # given as an indication during the 1 hour infusion on day 1 due to technical problems (i.e., 50% of the dose was received subcutaneously)
For both doses, a transient minimal increase in IL-6 concentration was observed after each weekly administration (Table 7, maximum levels of 25 and 160pg/mL for 0.1 and 3 mg/kg/administered dose, respectively). Table 7 shows the individual IL-6 plasma concentration values after repeated 1 hour weekly intravenous infusion of CD123-NKCE at 0.1 and 3 mg/kg/administration to cynomolgus monkeys for 4 weeks (on days 1, 8, 15 and 22).
TABLE 7
LLOQ (lower limit of quantitation): 0.53pg/mL
In particular, no significant IL-6 release was observed in monkey M5 treated at high dose (3 mg/kg/administration), which did not exhibit ADA response throughout the study and was exposed to CD123-NKCE (fig. 21A and 21B), whereas CD123 was observed in both blood and bone marrow of this monkey + Strong PD effect of cell depletion (table 8 and fig. 21C).
Table 8 shows the individual absolute counts of basophils and total CD123 positive cells in blood and bone marrow after repeated 1 hour weekly intravenous infusion of CD123-NKCE at 0.1 and 3 mg/kg/administration to cynomolgus monkeys for 4 weeks.
/>
DL (limit of detection): 1.15 cells/μl (blood) or 2.10 cells/μl (bone marrow); nd: unfinished product
In all other animals, sustained depletion of CD123 expressing cells was observed in the blood 1.5 hours after the first administration and up to 24 hours after the 3 rd administration, and rebound (above baseline) was observed on days 22 to 29 (table 8). Furthermore, for both doses, all treated monkeys showed complete depletion of CD123 positive cells in bone marrow on day 9 (24 hours after the second administration) (table 8; for most animals, the value on day 9 was below the limit of detection), and the CD123 positive population was restored on day 29 (one week after the last administration).
No effect on the electrocardiogram was observed, regardless of dose, possibly attributable to clinical signs, weight or body temperature changes with CD123-NKCE treatment. No compound-related adverse effects on hematology, coagulation, clinical chemistry or urinary parameters were observed. Microscopic examination of the sampled tissue revealed no evidence of organ targeting, and all observations recorded were considered to lie within the background of variation and were not relevant to CD123-NKCE administration.
Overall, these results thus constitute a proof of principle of efficacy of CD123-NKCE in vivo, without signs of toxicity.
B.15. NKp46-CD123 NK cell engager tumor cell killing using healthy donor NK cells
NKp46-cd123_f25 and its isotype control IC-cd123_f6 were tested in an in vitro tumor cell killing assay using NK cells from 2 different Healthy Donors (HD).
NK cell purification and AML cell lines
Human Peripheral Blood Mononuclear Cells (PBMCs) were isolated from anonymous Healthy Donors (HD) by Ficoll density gradient centrifugation. By usingNK cells were purified from these PBMC using whole blood NK cell isolation kit (Miltenyi Biotec). NK cells were allowed to stand overnight in RPMI1640 (Gibco) supplemented with 10% SVF (BioWest) and 1% L-glutamine (Gibco).
THP1 cells (cd123+. Cd64+) were selected for this study based on their CD123 expression. Before the experiment, useThe nucleic Green lentivirus (Sartorius) infects THP1 cells to express Green Fluorescent Protein (GFP).
NK function assay over time in the presence of NKp46-CD123_F25
NK cells and THP1 GFP target cells were incubated at 37℃in the presence of NKp46-CD123_F25 or its isotype control IC-CD123_F6 at 0.1, 1, 10 and 100 ng/mL. Effector to target cell ratio was 1:1. The medium used was the same as NK cell culture. Target cells were monitored by fluorescence imaging over 74h using the Incucyte viable cell analysis system (essensbioscience). The number of live target cells was quantified using the incubates s3 software (2020B).
Conclusion(s)
As shown in FIG. 22, different concentrations (1, 10 and 100 ng/mL) of NKp46-CD123_F25 at a 1:1 effector to target cell ratio enhanced the cytotoxic activity of HD NK cells against THP1 GFP AML cells over time.

Claims (30)

1. A binding protein comprising first and second Antigen Binding Domains (ABDs) and an immunoglobulin Fc region or a variant thereof, all or a portion, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (VH) and an immunoglobulin light chain variable domain (VL), wherein each VH and VL comprises three complementarity determining regions (CDR-1 to CDR-3); and wherein:
(i) The first ABD specifically binds to human CD123 and comprises:
-VH1 comprising CDRs-H1, H2 and H3 corresponding to amino acid sequences of SEQ ID NOs 1 to 3, respectively, or corresponding to amino acid sequences of SEQ ID NOs 4 to 6, respectively, and
-VL1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs 10 to 12, respectively;
(ii) The second ABD specifically binds to human NKp46 and comprises:
-VH2 comprising CDRs-H1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS 13 to 15, respectively;
amino acid sequences of SEQ ID NOS 16 to 18, respectively;
amino acid sequences of SEQ ID NOS 19 to 21, respectively;
amino acid sequences of SEQ ID NOS.22 to 24, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 16, 25 and 26, respectively;
and
-VL2 comprising CDRs-L1, 2 and 3 corresponding to:
amino acid sequences of SEQ ID NOS.27 to 29, respectively;
amino acid sequences of SEQ ID NOS 30 to 32, respectively;
amino acid sequences of SEQ ID NOS.33 to 35, respectively;
amino acid sequences of SEQ ID NOS 36 to 38, respectively; or alternatively
Amino acid sequences of SEQ ID NOS 39, 31 and 40, respectively;
and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
2. The binding protein of claim 1, comprising three polypeptide chains (I), (II) and (III) forming two ABD, as defined below:
V 1A -C 1A -hinge 1 -(C H 2-C H 3) A (I)
V 1B -C 1B -hinge 2 -(C H 2-C H 3) B -L 1 -V 2A -C 2A -hinge 3 (II)
V 2B -C 2B (III)
Wherein:
V 1A and V 1B Forming a binding pair V 1 (V H1 /V L1 )；
V 2A And V 2B Forming a binding pair V 2 (V H2 /V L2 )；
C 1A And C 1B Form pair C 1 (C H 1/C L ) And C 2A And C 2B Form pair C 2 (C H 1/C L ) Wherein C H 1 is immunoglobulin heavy chain constant domain 1 and C L Is an immunoglobulin light chain constant domain;
hinge 1 Hinge 2 And hinge 3 Is the same or different and corresponds to all or part of an immunoglobulin hinge region;
(C H 2-C H 3) A and (C) H 2-C H 3) B Are identical or different and comprise an immunoglobulin heavy chain constant domain 2 (C H 2) And immunoglobulin heavy chain constant domain 3 (C H 3)；
L 1 Is an amino acid linker.
3. The binding protein according to claim 2, wherein:
C 1B is immunoglobulin heavy chain constant domain 1 (C H 1)；
C 2A Is immunoglobulin heavy chain constant domain 1 (C H 1)；
C L Corresponds to immunoglobulin kappa light chain constant domain (C κ )；
(C H 2-C H 3) A An amino acid sequence corresponding to SEQ ID NO. 69;
(C H 2-C H 3) B an amino acid sequence corresponding to SEQ ID NO. 70;
hinge 1 An amino acid sequence corresponding to SEQ ID NO. 74;
hinge 2 An amino acid sequence corresponding to SEQ ID NO. 75;
hinge 3 An amino acid sequence corresponding to SEQ ID NO. 77;
L 1 An amino acid sequence corresponding to SEQ ID NO. 76.
4. The binding protein according to any one of the preceding claims, wherein residue N297 of the Fc region or variant thereof comprises N-linked glycosylation according to EU numbering.
5. A binding protein according to any one of the preceding claims, wherein all or part of the Fc region or variant thereof binds a human CD16A (fcyriii) polypeptide.
6. The binding protein according to any one of claims 2 to 5, comprising at least two polypeptide chains linked by at least one disulfide bridge.
7. The binding protein according to claim 6, wherein the polypeptide chains (I) and (II) are linked by C 1A With hinges 2 At least one of themThe disulfide bridges are linked, and/or wherein the polypeptide chains (II) and (III) are linked by a hinge 3 And C 2B At least one disulfide bridge therebetween.
8. The binding protein according to any one of claims 2 to 7, wherein V 1A Is V L1 And V is 1B Is V H1 。
9. The binding protein according to any one of claims 2 to 8, wherein V 2A Is V H2 And V is 2B Is V L2 。
10. The binding protein according to any one of the preceding claims, wherein:
(a)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29;
(b)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; contains SEQ ICDR-L2 of the amino acid sequence of D NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32;
(c)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 33; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35;
(d)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38;
(e)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 2; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 3; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 7; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 8; CDR-L3 comprising the amino acid sequence of SEQ ID NO 9; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39;CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40;
(f)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 15; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 27; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 28; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 29;
(g)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 18; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 30; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 32;
(h)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 21; v (V) L2 Comprising an amino group comprising SEQ ID NO 33CDR-L1 of the acid sequence; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 34; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 35;
(i)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 24; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 36; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 37; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 38; or alternatively
(j)V H1 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 6; v (V) L1 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO. 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 12; v (V) H2 CDR-H1 comprising an amino acid sequence comprising SEQ ID NO. 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO. 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO. 26; v (V) L2 CDR-L1 comprising an amino acid sequence comprising SEQ ID NO 39; CDR-L2 comprising the amino acid sequence of SEQ ID NO. 31; CDR-L3 comprising the amino acid sequence of SEQ ID NO. 40.
11. The binding protein according to any one of the preceding claims, wherein:
(a)V H1 and V L1 Amino acid sequences corresponding to SEQ ID NOS 41 and 43, respectively, or amino acid sequences corresponding to SEQ ID NOS 42 and 44, respectively;
and/or
(b)V H2 And V L2 Corresponding to
Amino acid sequences of SEQ ID NOs 45 and 53, respectively;
the amino acid sequences of SEQ ID NOS 46 and 54, respectively;
amino acid sequences of SEQ ID NOs 47 and 55, respectively;
amino acid sequences of SEQ ID NOs 48 and 56, respectively;
the amino acid sequences of SEQ ID NOs 49 and 57, respectively;
Amino acid sequences of SEQ ID NOs 50 and 58, respectively;
amino acid sequences of SEQ ID NOs 51 and 59, respectively; or alternatively
The amino acid sequences of SEQ ID NOS 52 and 60, respectively.
12. The binding protein according to claim 11, wherein:
(q)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; v (V) L2 An amino acid sequence comprising SEQ ID NO. 53;
(r)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(s)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(t)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(u)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 57;
(v)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 Comprises SThe amino acid sequence of EQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 50; v (V) L2 An amino acid sequence comprising SEQ ID NO. 58;
(w)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(x)V H1 an amino acid sequence comprising SEQ ID NO. 41; v (V) L1 An amino acid sequence comprising SEQ ID NO. 43; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 60;
(y)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 45; VL (VL) 2 An amino acid sequence comprising SEQ ID NO. 53;
(z)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 46; v (V) L2 An amino acid sequence comprising SEQ ID NO. 54;
(aa)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 47; v (V) L2 An amino acid sequence comprising SEQ ID NO. 55;
(bb)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 48; v (V) L2 An amino acid sequence comprising SEQ ID NO. 56;
(cc)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 49; v (V) L2 An amino acid sequence comprising SEQ ID NO. 57;
(dd)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 IncludedThe amino acid sequence of SEQ ID NO. 50; v (V) L2 An amino acid sequence comprising SEQ ID NO. 58;
(ee)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 51; v (V) L2 An amino acid sequence comprising SEQ ID NO. 59;
(ff)V H1 an amino acid sequence comprising SEQ ID NO. 42; v (V) L1 An amino acid sequence comprising SEQ ID NO. 44; v (V) H2 An amino acid sequence comprising SEQ ID NO. 52; v (V) L2 Comprising the amino acid sequence of SEQ ID NO. 60.
13. The binding protein according to any one of claims 2 to 12, wherein:
-polypeptide (I) consists of the amino acid sequence of SEQ ID No. 64;
-polypeptide (II) consists of the amino acid sequence of SEQ ID No. 65; and is also provided with
The polypeptide (III) consists of the amino acid sequence of SEQ ID NO. 66.
14. The binding protein according to any one of the preceding claims for use as a medicament.
15. The binding protein according to any one of the preceding claims for use in a method of treating or preventing hematological cancer.
16. The binding protein according to any one of the preceding claims for use in a method of treating or preventing myelodysplastic syndrome (MDS) or lymphoproliferative disorder.
17. The binding protein according to any one of the preceding claims for use in a method of treating or preventing Acute Myelogenous Leukemia (AML).
18. The binding protein according to any one of the preceding claims for use in a method of treating or preventing CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML).
19. A pharmaceutical composition comprising the binding protein according to any one of claims 1 to 13 and a pharmaceutically acceptable carrier.
20. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein according to any one of claims 1 to 13.
21. An expression vector comprising the nucleic acid molecule of claim 20.
22. An isolated cell comprising the nucleic acid molecule of claim 20.
23. An isolated cell comprising the expression vector of claim 21.
24. The isolated cell of claim 23, wherein the host cell is a mammalian cell.
25. A method for preparing a binding protein according to any one of claims 1 to 13, comprising the steps of:
(a) Culturing one or more host cells under conditions suitable for expression of a plurality of recombinant polypeptides, the plurality comprising (i) a polypeptide comprising the amino acid sequence of SEQ ID NO. 64, and (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO. 66;
(b) Optionally recovering the expressed recombinant polypeptide.
26. A method of treating or preventing hematological cancer, the method comprising administering to a subject in need of such treatment or prevention the pharmaceutical composition of claim 19.
27. A method of treating or preventing myelodysplastic syndrome (MDS) or a lymphoproliferative disorder, the method comprising administering to a subject in need of such treatment or prevention the pharmaceutical composition of claim 19.
28. A method of treating or preventing Acute Myelogenous Leukemia (AML), the method comprising administering to a subject in need of such treatment or prevention a pharmaceutical composition according to claim 19.
29. A method of treating or preventing CD64 positive and CD64 negative Acute Myelogenous Leukemia (AML), comprising administering to a subject in need of such treatment or prevention the pharmaceutical composition according to claim 19.
30. A method of treating or preventing CD 64-positive Acute Myelogenous Leukemia (AML), the method comprising administering to a subject in need of such treatment or prevention a binding protein comprising a first and a second Antigen Binding Domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein the first ABD specifically binds to human CD123 and the second ABD specifically binds to human NKp46, and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
CN202180088872.6A 2020-12-31 2021-12-30 Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123 Pending CN117255807A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP20306717.8 2020-12-31
US202163256950P 2021-10-18 2021-10-18
US63/256,950 2021-10-18
PCT/IB2021/062494 WO2022144836A1 (en) 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123

Publications (1)

Publication Number Publication Date
CN117255807A true CN117255807A (en) 2023-12-19

Family

ID=89135493

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180088872.6A Pending CN117255807A (en) 2020-12-31 2021-12-30 Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123

Country Status (1)

Country Link
CN (1) CN117255807A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117442721A (en) * 2023-12-20 2024-01-26 苏州艾凯利元生物科技有限公司 A composition comprising NK cells and NK cell adaptor molecules

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117442721A (en) * 2023-12-20 2024-01-26 苏州艾凯利元生物科技有限公司 A composition comprising NK cells and NK cell adaptor molecules
CN117442721B (en) * 2023-12-20 2024-03-15 苏州艾凯利元生物科技有限公司 A composition comprising NK cells and NK cell adaptor molecules

Similar Documents

Publication Publication Date Title
CN111601825B (en) Fully human anti-B Cell Maturation Antigen (BCMA) single-chain antibody and application thereof
JP6496349B2 (en) CD3 binding molecules capable of binding to human and non-human CD3
TWI751102B (en) Antibodies and chimeric antigen receptors specific for cd19
JP6865688B2 (en) ROR1-specific antibodies and chimeric antigen receptors
RU2592672C2 (en) Novel modulators and methods for use thereof
JP6360077B2 (en) Compounds that specifically bind to KIR3DL2 for use in the treatment of peripheral T-cell lymphoma
JP2022545585A (en) Novel anti-CD39 antibody
AU2016342036B2 (en) Methods and compositions for treating systemic mastocytosis
CA3145940A1 (en) Anti-cd39 antibody compositions and methods
EP4101867A1 (en) Anti-cd3 and anti-cd123 bispecific antibody and use thereof
CN114007699A (en) Antagonist anti-CD7 antibodies
CN115335399A (en) Anti-idiotype antibodies directed against GPRC5D target binding domains and related compositions and methods
US20230416383A1 (en) MULTIFUNCTIONAL NATURAL KILLER (NK) CELL ENGAGERS BINDING TO NKp46 AND CD123
CN117255807A (en) Multifunctional Natural Killer (NK) cell adaptor binding to NKp46 and CD123
KR102312222B1 (en) Monoclonal Antibodies Targeting Unique Sialoglycosylated Cancer-Associated Epitopes of CD43
JP2024521408A (en) Multispecific antibodies binding to CD20, NKP46, CD16 and conjugated to IL-2
KR20240067052A (en) anti-CCR8 antibody
WO2022187710A1 (en) Epha2 antibodies
JP2022553927A (en) Treatment of cancer with ILT-2 inhibitors
WO2023104100A1 (en) Antibody binding to bcma and use thereof
WO2022117032A1 (en) Anti-cd22 nano antibody and use thereof
CA3241912A1 (en) Antibody binding to bcma and use thereof
WO2023170434A1 (en) Compositions and methods for modulation of macrophage activity
KR20240046577A (en) Anti-HLA-G antibody
CN116848142A (en) anti-TNFR 2 antibodies and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination