CN117247990A

CN117247990A - RNA sample processing system based on topological capture

Info

Publication number: CN117247990A
Application number: CN202310729223.0A
Authority: CN
Inventors: 张经纬; 刘铁民; 李婷
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2022-06-17
Filing date: 2023-06-19
Publication date: 2023-12-19
Also published as: WO2023241721A1

Abstract

The present application discloses cDNA synthesis methods with improved high throughput reverse transcription, template switching, and pre-amplification to increase the yield and average length of cDNA libraries produced at high throughput from single cells or single nuclei. The methods and systems allow single-or multi-operation chemical and/or biochemical treatment to be performed within a partition by forming a plurality of partitions (e.g., permselective compartments) for single-cell or single-cell nuclear encapsulation. Reverse transcription or full-length cDNA pre-amplification steps are performed in the reaction compartment partitions, and transposase complex-mediated fragmentation of full-length transcriptome amplification products is performed in each partition. This process leaves the pool-forming intermediate fragmented template DNA from the same cell or nucleus in the permselective compartment. Next, a partition (e.g., a droplet) is formed secondarily by microfluidic control of the droplet, and the droplet is wrapped with a permselective compartment of fragmented full-length transcriptome amplification product from a single cell and a barcode oligonucleotide microsphere, and the fragmented full-length transcriptome is labeled by a barcode on the oligonucleotide microsphere.

Description

RNA sample processing system based on topological capture

Technical Field

The present invention relates to a system and method for separating analytes (e.g., cells, bacteria, viruses, nucleic acids, biochemical compounds, and/or other materials) and targeted capture of biomolecules in a reaction compartment surrounded by a permselective membrane and processing the encapsulated biomolecules through a reaction/flow scheme to perform a multi-step reaction. Biomolecules derived from the same analyte are enriched in a reaction compartment surrounded by a permselective membrane by a specific capture reagent. The rest of the biomolecules can freely pass through the selective permeable membrane, thereby realizing the exchange of various reaction substances required by purification, cleaning or multi-step reaction. After treatment with an external stimulus, the capture of the enriched biomolecules and their reacted derivatives can be released in the desired step from the reaction compartment enclosed by the permselective membrane. The methods disclosed herein exemplify genotyping or phenotyping single cells using a reaction compartment surrounded by a permselective membrane.

Background

Genome-wide transcriptome analysis is widely used, with early methods of obtaining RNA from a large number of tissue samples for sequencing. However, this conventional method relies on the global analysis of gene expression in millions of cells at a time, often masking the biologically significant differences in gene expression in certain specialized cells in specific tissues. Also, in diseased tissues such as healthy tissues or tumors, the number of certain cells is rare, and there is no technique for analyzing them other than the single cell method.

Single cell gene expression analysis overcomes these limitations and can be used to mine gene regulatory networks across the whole genome, especially for stem cells with high heterogeneity and cell populations in early embryonic development. In combination with living cell imaging systems, single cell transcriptome analysis further facilitates a deep understanding of processes such as cell differentiation, cell reprogramming and transdifferentiation and related gene regulation networks. Applying this technique clinically, it is theoretically possible to continuously track the dynamic changes in gene expression under physiological or pathological conditions, thereby monitoring the progression of the disease. Another field of application for single cell transcriptome analysis is the discovery of gene expression profiles of subcellular components, such as the analysis of the transcriptome of genes specifically expressed in axons or dendrites of neurons, which often play an important role in the biological function of the cell.

In 1990, the subject group of Norman Iscove demonstrated for the first time that transcriptome analysis of single cells was feasible, which achieved exponential amplification of cDNA molecules using PCR technology. In the early 90 s of the 20 th century, eberwire et al invented a new technology that could obtain cdnas from individual living neuronal cells and then transcribe these cdnas as templates to generate RNA for linear amplification of RNA. With the advent of the chip age, scientists have made extensive comparisons and studies of gene expression differences between single cells using these linear and exponential amplification techniques. In 2008, high-throughput RNA sequencing technology was developed, and later, this technology was combined with the previously developed nucleic acid amplification technology, and single cell transcriptomes were studied more carefully. In 2009, tang, university of cambridge, england, studied on single mouse blastomeres (blastometre) found that thousands of gene expression could be detected using single cell transcriptome technology compared to chip technology (nat. Methods6,377-382,2009). The procedure originally used for single-cell chip studies was used for single-cell mRNA-Seq sequencing, but it was difficult to obtain good data from single cells, and it was not possible to distinguish between differences in the organism itself or technical differences due to low starting amounts of RNA; furthermore, the mRNA-Seq method preferentially amplifies the 3' end of the mRNA and does not produce full transcriptome coverage.

In 2012, illumina corporation combined with Sandberg laboratories developed the leading technique for such analysis: smart-seq. The new method improves the coverage level of transcripts, has higher sensitivity and quantitative accuracy, and enhances the analysis of variable transcript isomers and the capability of distinguishing SNP phenomena. Although there are some errors in the estimated expression levels using single cell assays, many different expressed genes can be identified with fewer cells.

In 2013 Sandberg laboratories published on Nature Methods as Smart-seq2 (non-patent documents 1:Simone Picelli,Rickard Sandberg,et al.Smart-seq2for sensitive full-lengthtranscriptome profiling in single cells. Aperture Methods,2013S ep temper, doi: 10.1038/nmeth.2639.) this improved technique yields on average longer cDNA molecules and higher yields than Smart-seq. Smart-seq2 transcriptome libraries have improved discoverability, increased coverage and lower technical bias. And Smart-seq2 can be completely used with existing universal reagents, rather than commercial kits, and sequencing libraries can be constructed cost effectively.

The Smart-seq2 method uses oligo-dT, TSO, ISPCR primer with fixed sequence to carry out reverse transcription amplification, which can effectively improve the amplification efficiency of cDNA. However, when sequencing is performed using, for example, an Illumina high-throughput sequencer, the proportion of available data obtained from a high-throughput sequencing library constructed using this method is low, which can adversely affect subsequent data analysis.

Disclosure of Invention

1. An RNA sample processing system based on topological capture, comprising:

a) A selectively permeable membrane as an outer layer of the reaction compartment, the selectively permeable membrane being capable of selectively permeable to an RNA sample processing reagent;

b) The content is positioned inside the reaction compartment, and comprises an RNA capture reagent and RNA to be analyzed; wherein,

the RNA to be analyzed and the RNA capture reagent are connected into a whole, or the RNA to be analyzed and the RNA capture reagent form a complex through interaction, or the RNA to be analyzed and the RNA capture reagent generate nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after conversion through biological or chemical reaction;

the selective permeable membrane is capable of selectively retaining the whole or complex or nucleic acid content formed by the connection of the RNA capture reagent and the RNA to be analyzed;

the diameter of the whole or complex or nucleic acid content is greater than 1/2 of the pore size of the membrane pores of the permselective membrane.

2. The topology capture-based RNA sample processing system of item 1, wherein,

the RNA capture reagent, the RNA to be analyzed and the whole or complex formed by connecting the RNA capture reagent and the RNA to be analyzed are positioned in the reaction compartment, or the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after the conversion is liquid, gel or semi-liquid;

The reaction compartment also contains an osmotic pressure regulator inside;

preferably, the osmolality adjusting agent is dextran.

3. The topology capture-based RNA sample processing system of any one of items 1 to 2, wherein,

the capture reagent is a colloidal polymer compound polymerized by an oligonucleotide primer with double bonds or polymerized by an oligonucleotide primer with double bonds and one or more compound monomers with double bonds;

and carrying out reverse transcription reaction on the RNA capture reagent and the RNA to be analyzed to obtain a product molecule with the diameter larger than 1/2 of the aperture of the selectively permeable membrane.

4. The topology capture-based RNA sample processing system of item 3, wherein,

and carrying out reverse transcription reaction on the RNA capture reagent and the RNA to be analyzed, and then carrying out PCR amplification reaction to obtain a product molecule with the diameter larger than 1/2 of the aperture of the selective permeable membrane.

5. The topology capture-based RNA sample processing system of any one of items 1 to 4, wherein,

after the RNA to be analyzed, and the RNA capture reagent and the RNA to be analyzed are linked into a whole or a complex, or the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after the transformation, the RNA to be analyzed is further captured by the following second capture reagent:

The second capture reagent is a complex of DNA transposase and DNA;

preferably, the DNA transposase is Tn5, the DNA having a transposase recognition sequence at its end.

6. The topology capture-based RNA sample processing system of any one of items 1 to 5, wherein,

the RNA to be analyzed is derived from the same cell or cell nucleus; preferably, the RNA to be analyzed is in an intact cell or nucleus.

7. A method of manufacturing a topology capture-based RNA sample processing system according to any one of claims 1 to 6, comprising the steps of:

preparing a first phase comprising a tonicity adjusting agent and a first aqueous solvent;

preparing a second phase in which the selectively permeable membrane forming material and the second aqueous solvent are mixed;

the RNA capture reagent is added in the first phase or the second phase;

mixing RNA to be analyzed in intact cells or nuclei into a first phase or a second phase; mixing the RNA to be analyzed in the intact cell or nucleus preferably to a first phase;

mixing the first phase and the second phase to form a mixed hydrophilic phase, and mixing the mixed hydrophilic phase with the oily solvent to prepare a water-in-oil emulsion; and

solidifying or semi-solidifying the water-in-oil emulsion to form a selectively permeable membrane;

Demulsification of the water-in-oil emulsion after the solidification or semi-solidification reaction to obtain a reaction compartment which is provided with a selective permeable membrane at the outer layer and is internally provided with contents;

the reaction compartment having the selectively permeable membrane on the outer layer and the contents inside is mixed with the cell lysate to release the RNA in the cells or nuclei or heated to release the RNA in the cells or nuclei to contact the RNA capture reagent.

8. A method of manufacturing a topologically captured based RNA sample processing system comprising the steps of:

preparing a first phase comprising an RNA capture reagent, an osmolality adjusting agent, and a first aqueous solvent;

mixing the cell lysate to a first phase or a second phase; preferably, the cell lysate is in a different phase than the cells or nuclei;

mixing the first phase and the second phase to form a mixed hydrophilic phase, and mixing the mixed hydrophilic phase with the oily solvent to prepare a water-in-oil emulsion; and the cell lysate assists in releasing RNA within the cell or nucleus for contact with the RNA capture reagent; and

and demulsifying the water-in-oil emulsion after the solidification or semi-solidification reaction to obtain a reaction compartment which is provided with a selective permeable membrane on the outer layer and the content inside.

9. A method of preparing a second generation sequencing (NGS) library using the topology capture-based RNA sample processing system of any of items 1-6, the method comprising:

(a) A composition is formulated comprising: an RNA sample; a first strand complementary deoxyribonucleic acid (cDNA) primer; a template switch oligonucleotide; a reverse transcriptase; and dNTPs;

annealing the cDNA synthesis primer to the RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and performing a reverse transcriptase reaction by contacting the RNA-cDNA intermediate with a Template Switching Oligonucleotide (TSO), wherein the TSO comprises or does not comprise a Locked Nucleic Acid (LNA) at its 3' -end, complementary to the RNA molecule and complementary to the TSO under conditions suitable for extension of the first cDNA strand;

(b) Performing two-strand synthesis amplification on the RNA-cDNA intermediate under amplification conditions sufficient to produce a product double-stranded DNA to yield a second DNA strand;

(c) Labeling the second DNA of the product with a transposome comprising a transposase and a transposon nucleic acid comprising a transposon end domain and a second post-labeling amplification primer binding domain to produce a labeled sample;

(d) Carrying out PCR amplification on the spliced DNA fragments to obtain amplification products;

the RNA sample is the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed by connecting the RNA to be analyzed and the RNA capturing reagent into a whole, or forming a complex by the interaction of the RNA to be analyzed and the RNA capturing reagent, or generating conversion by biological or chemical reaction of the RNA to be analyzed and the RNA capturing reagent,

wherein (a) - (d) are carried out in the reaction compartment as referred to in any one of items 1-6.

10. The method of claim 9, wherein the reverse transcription reaction is performed in the presence of a methyl donor and a metal salt.

11. The method of claim 11, wherein the methyl donor is betaine.

12. The method of claim 11, wherein the metal salt is a magnesium salt.

13. The method of claim 12, wherein the magnesium salt has a concentration of 7mM or more.

14. The method of claim 9, wherein the template switching oligonucleotide comprises one or two ribonucleotide residues and 0 or more Locked Nucleic Acid (LNA) residues.

15. The method of claim 14, wherein the one or two ribonucleotide residues is riboguanine.

16. The method of claim 14, wherein the locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

17. The method of claim 16, wherein the locked nucleic acid residue is locked guanine.

18. The method of claim 17, wherein the template switching oligonucleotide comprises three nucleotide residues at the 3' -end characterized by the formula rgrg+n, wherein +n represents a locked nucleotide residue.

19. The method of claim 18, wherein the template switching oligonucleotide comprises rgrg+g.

20. The method of claim 10, wherein the methyl donor is betaine and the metal salt is MgCl at a concentration of at least 9mM ₂ 。

21. The method of claim 9, wherein the template switching oligonucleotide is selected from the group consisting of: rGrG+G,

preferably SEQ ID NO.1 AAGCAGTGGTATCACGCAGGAGTACrGrG+G,

rGrG+N, preferably SEQ ID NO.2 AAGCAGTGGTATCACGCAGGAGTACrGrG+N,

+G +G+G, preferably SEQ ID No.3: AAGCAGTGGTATCAACGCAGAGTAC +G+G+G and

rG+G+G, preferably SEQ ID NO.4 AAGCAGTGGTATCACGCAGGAGTACrG+G.

22. The method according to claim 9, wherein the cDNA is synthesized in a solution mixed with the oligonucleotide primer or on a colloidal polymer compound formed by polymerizing the double bond-containing oligonucleotide primer with one or more double bond-containing compound monomers.

23. The method of item 22, wherein the oligonucleotide primer comprises SEQ ID NO.5:5' -AAGCAGTGGTATCAACGCAGAGTACT VN and/or NNNNNNNNNNN, wherein "N" is any nucleobase and "V" is "A" or "C" or "G".

24. A method of analyzing gene expression in a plurality of single cells, the method comprising the steps of: preparing a cDNA library according to the method of item 9; and sequencing the cDNA library.

25. A Template Switching Oligonucleotide (TSO), wherein it comprises a locked nucleotide residue at the 3' -end.

26. The template switch oligonucleotide of claim 25, wherein it comprises three nucleotide residues at the 3' -terminus selected from the group consisting of +n+n+ N, N +n+ N, NN + N, rN +n and rnrn+n, wherein each occurrence of N is independently a deoxyribonucleotide residue, each occurrence of rN is independently a ribonucleotide residue, and each occurrence of +n is independently a locked nucleotide residue.

27. The template switch oligonucleotide according to item 25, wherein the locked nucleotide residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

28. The template switching oligonucleotide of claim 27, wherein the three nucleotide residues are selected from nn+ G, rNrN + G, GG + N, rGrG +g and gg+g.

29. The method according to claim 9, wherein the RNA is released by cleavage from a single cell in a reaction compartment surrounded by a permselective membrane.

30. The single cell of claim 29, wherein the single cell is encapsulated by a microfluidic system into a reaction compartment surrounded by a permselective membrane.

31. The method of claim 9, wherein the transposase is a Tn5 transposase.

32. The method of claim 31, wherein the transposon end domain comprises a Tn5 transposon end domain.

33. The method of item 9, wherein the method further comprises combining the first double stranded product cDNA with a second double stranded product DNA to produce a combined cDNA sample, and then labeling the combined cDNA sample.

34. The method of item 9, wherein the method further comprises quantifying one or more RNA species of the RNA sample.

35. The method of item 9, wherein the method is performed in a reaction compartment surrounded by a permselective membrane.

36. A method of preparing a second generation sequencing (NGS) library using ribonucleic acid (RNA) samples in a reaction compartment surrounded by a permselective membrane, the method comprising:

annealing the cDNA synthesis primer to the RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and performing a reverse transcriptase reaction by contacting the RNA-cDNA intermediate with a Template Switching Oligonucleotide (TSO), wherein the TSO comprises or does not comprise a Locked Nucleic Acid (LNA) at its 3' -end, complementary to the RNA molecule under conditions suitable for extension of the first DNA strand, such that it is complementary to the TSO;

(b) Labeling the product mRNA/cDNA hybrid duplex with a transposome comprising a transposase and a transposon nucleic acid comprising a transposon end domain and a second post-labeling amplification primer binding domain to produce a labeled sample;

(c) Carrying out PCR amplification on the spliced DNA fragments to obtain amplification products,

Wherein (a) - (c) are carried out in the reaction compartment as referred to in any one of items 1-6.

37. The method of claim 36, wherein the reverse transcription reaction is performed in the presence of a methyl donor and a metal salt.

38. The method of claim 37, wherein the methyl donor is betaine.

39. The method of claim 37, wherein the metal salt is a magnesium salt.

40. The method of claim 37, wherein the magnesium salt has a concentration of at least 7 mM.

41. The method of claim 35, wherein the template switching oligonucleotide comprises one or two ribonucleotide residues and the 0 or more Locked Nucleic Acid (LNA) residues.

42. The method of claim 41, wherein the one or two ribonucleotide residues is riboguanine.

43. The method of claim 41, wherein the locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

44. The method of claim 43, wherein the locked nucleic acid residue is locked guanine.

45. The method of claim 36, wherein the template switching oligonucleotide comprises three nucleotide residues at the 3' -end characterized by the formula rgrg+n, wherein +n represents a locked nucleotide residue.

46. The method of claim 45, wherein the template switching oligonucleotide comprises rgrg+g.

47. The method of claim 37, wherein the methyl donor is betaine and the metal salt is MgCl at a concentration of at least 9mM ₂ 。

48. The method of claim 36, wherein the template switching oligonucleotide is selected from the group consisting of:

rGrG+G, preferably SEQ ID NO.1 AAGCAGTGGTATCACGCAGGCAGTACCrGrG+G, ii.rGrG+N, preferably SEQ ID NO.2 AAGCAGTGGTATCACGCAGGCAGTACCrGrG+N,

+G +G+G, preferably SEQ ID No.3: AAGCAGTGGTATCAACGCAGAGTAC +G+G+G and

rG+G+G, preferably SEQ ID NO.4 AAGCAGTGGTATCACGCAGGAGTACrG+G.

49. The method according to claim 37, wherein the cDNA is synthesized in a solution mixed with the oligonucleotide primer or on a colloidal polymer compound polymerized from the double bond-containing oligonucleotide primer and one or more double bond-containing compound monomers.

50. The method of item 49, wherein the oligonucleotide primer comprises SEQ ID NO.5:5' -AAGCAGTGGTATCAACGCAGAGTACT VN and/or NNNNNNNNNNN, wherein "N" is any nucleobase and "V" is "A" or "C" or "G".

51. A method of analyzing gene expression in a plurality of single cells, the method comprising the steps of: preparing a cDNA library using the method according to item 36; and sequencing the cDNA library.

52. A Template Switching Oligonucleotide (TSO) comprises a locked nucleotide residue at its 3' -most end.

53. The template switch oligonucleotide of item 52, comprising three nucleotide residues at the 3' -terminus selected from the group consisting of +n+n+ N, N +n+ N, NN + N, rN +n and rnrn+n, wherein each occurrence of N is independently a deoxyribonucleotide residue, each occurrence of rN is independently a ribonucleotide residue, and each occurrence of +n is independently a locked nucleotide residue.

54. The template switching oligonucleotide of item 52, wherein the locked nucleotide residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

55. The template switching oligonucleotide of claim 53, wherein the three nucleotide residues are selected from nn+ G, rNrN + G, GG + N, rGrG +g and gg+g.

56. The method of claim 54, wherein the RNA is an RNA that is released by cleavage in a single cell in a reaction compartment surrounded by a permselective membrane.

57. The single cell of claim 56, wherein the single cell is encapsulated by a microfluidic system into a reaction compartment surrounded by a permselective membrane.

58. The method of claim 36, wherein the transposase comprises a Tn5 transposase.

59. The method of claim 58, wherein the transposon end domain comprises a Tn5 transposon end domain.

60. The method of claim 36, wherein the method further comprises combining the first double stranded product cDNA with the second double stranded product cDNA to produce a combined cDNA sample, and then labeling the combined cDNA sample.

61. The method of claim 36, wherein the method further comprises quantifying one or more RNA species of the RNA sample.

62. The method of claim 36, wherein the method is performed in a reaction compartment surrounded by a permselective membrane.

The technical scheme of the application has the following beneficial effects:

1. the exchange of various reactive substances required for purification, washing or multi-step reactions is achieved by means of a "semipermeable compartment"; 2. enriching for specific biomolecules by a capture reagent; 3. thereby realizing high-flux single-cell full-length transcriptome sequencing.

Drawings

FIG. 1A shows a reaction compartment surrounded by a gel-like polymer formed by polymerizing an oligonucleotide (primer) encapsulating a double bond with one or more double bond-containing compound monomers and a selectively permeable membrane of cells using a microfluidic system.

FIG. 1B shows a reaction compartment surrounded by selectively permeable membranes surrounding cells using a microfluidic system.

FIG. 2A. The analyte is a DNA molecule and the capture reagent may be one or more of a protein, a nucleic acid, and a complex formed by the two.

FIG. 2B. The analyte is an RNA/DNA hybrid molecule, and the capture reagent may be one or more of a protein, a nucleic acid, and a complex formed by the two.

FIG. 2℃ The analyte is an RNA molecule and the capture reagent may be a colloidal polymer compound formed by polymerizing an oligonucleotide (primer) having a double bond with one or more monomers of a compound having a double bond.

FIG. 2D. The analyte is an RNA molecule and the capture reagent may be an oligonucleotide (primer).

Figure 3. Microfluidic device system for producing droplets containing aqueous two phases and targeted capture reagent.

FIG. 4. Injection of a first fluid (phase I solution, rich in dextran), a second fluid (phase II solution, rich in polyethylene glycol based polymer), a continuous phase (carrier oil is fluorinated oil and contains a surfactant, such as PFPE-PEG-PFPE (perfluoropolyether-polyethylene glycol-perfluoropolyether) triblock copolymer) into a microfluidic chip by a microfluidic device system; the targeted capture reagent enters the microfluidic system from the first fluid, the second fluid, the continuous phase (carrier oil), or any two or three.

Fig. 5. Method of hardening the outer layer II phase by initiating polymerization.

FIG. 6. Demulsification release reaction compartments and sample preparation system surrounded by selectively permeable membranes.

FIG. 7 shows a reaction compartment surrounded by selectively permeable membranes.

FIG. 8 reaction compartment surrounded by selectively permeable membrane after gel formation.

FIG. 9. Reaction compartment enclosed by permselective membrane after demulsification.

FIG. 10 mRNA capture microspheres and cells in the reaction compartment; microspheres-2.7 microns; the outer wall pore size is about 50nm.

FIG. 11 is an electron micrograph of a reaction compartment surrounded by a selectively permeable membrane.

FIG. 12 shows cell lysis in a reaction compartment surrounded by a permselective membrane.

FIG. 13 genomic DNA was removed from a reaction compartment surrounded by a selectively permeable membrane.

FIG. 14 fluorescent staining of single-cell mRNA reverse transcription cDNA amplification in a reaction compartment surrounded by selectively permeable membranes.

FIG. 15 shows an alkali-soluble agarose gel of single-cell mRNA reverse-transcribed cDNA amplification in a reaction compartment surrounded by a selectively permeable membrane.

FIG. 16 Qsep characterization of single cell mRNA reverse transcribed cDNA amplification in a selectively permeable membrane enclosed reaction compartment.

FIG. 17 shows reverse transcription of single-cell mRNA and cDNA amplification in a reaction chamber surrounded by a selectively permeable membrane, followed by namocell sorting.

FIG. 18 disruption of cDNA amplified library within a selectively permeable membrane enclosed reaction compartment.

FIG. 19 shows Qsep characterization of cDNA amplified library breaks in selectively permeable membranes enclosed reaction compartments.

FIG. 20 RNA/DNA hybrid cleavage within a selectively permeable membrane enclosed reaction compartment.

FIG. 21 Bioanalzyer 2100 characterization of RNA/DNA hybrid disruption within a selectively permeable membrane enclosed reaction compartment.

FIG. 22. Reaction compartments consisting of selectively permeable membranes are glued (magnetic bead topology capture).

FIG. 23 after gel formation of the selectively permeable membrane composed reaction compartments (magnetic bead topological capture).

FIG. 24 after demulsification of the selectively permeable membrane-composed reaction compartments (magnetic bead topological capture).

FIG. 25 cell lysis (magnetic bead topological capture) was performed in a reaction compartment consisting of selectively permeable membranes.

FIG. 26 removal of genomic DNA (magnetic bead topological capture) was performed within a reaction compartment consisting of selectively permeable membranes.

FIG. 27 fluorescent staining (magnetic bead topological capture) of single cell mRNA reverse transcription cDNA amplification was performed in a reaction compartment consisting of selectively permeable membranes.

Detailed Description

Specific embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The description and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As used throughout the specification and claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the invention, but is not intended to limit the scope of the invention, as the description proceeds with reference to the general principles of the description. The scope of the invention is defined by the appended claims.

As used herein, "substantially free" with respect to a particular component is used herein to mean that the particular component is not purposefully formulated into the composition and/or is present as a contaminant or in trace amounts only. Thus, the total amount of the specific components resulting from any accidental contamination of the composition is less than 0.05%, preferably less than 0.01%. Most preferred are compositions wherein the amount of a particular component is undetectable using standard analytical methods.

As used in this specification, "a" or "an" may mean one or more. As used in the claims, the word "a" or "an" when used with the word "comprising" may mean one or more than one.

The term "or" is used in the claims to mean "and/or" unless explicitly indicated to mean only alternatives or alternatives are mutually exclusive, although the content support of the present application only refers to the definitions of alternatives and "and/or". As used herein, "another" may mean at least a second or more.

Throughout this application, the term "about" is used to indicate that the value includes the inherent variation in the error of the device, and the method is used to determine the value or variation that exists between subjects.

The various biomaterials described in the examples were obtained by merely providing an experimental route for achieving the objectives of the specific disclosure and should not be construed as limiting the source of biomaterials of the present invention. In fact, the source of the biological material used is broad, and any biological material that is available without violating law and ethics may be used instead as suggested in the examples.

The present application provides in a first aspect an RNA sample processing system based on topological capture.

In one embodiment, there is provided an RNA sample processing system based on topological capture, comprising:

a) A selectively permeable membrane as an outer layer of the reaction compartment, the selectively permeable membrane being capable of selectively permeable to an RNA sample processing reagent; b) The content is positioned inside the reaction compartment, and comprises an RNA capture reagent and RNA to be analyzed; wherein the RNA to be analyzed and the RNA capture reagent are connected into a whole, or the RNA to be analyzed and the RNA capture reagent form a complex through interaction, or the RNA to be analyzed and the RNA capture reagent generate nucleic acid contents of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after conversion through biological or chemical reaction; the selective permeable membrane is capable of selectively retaining the whole or complex or nucleic acid content formed by the connection of the RNA capture reagent and the RNA to be analyzed; the diameter of the whole or complex or nucleic acid content is greater than 1/2 of the pore size of the membrane pores of the permselective membrane. Advantageously, the diameter of the resulting whole or complex or nucleic acid content is greater than 0.5 times, 0.6 times, 0.7 times, 3/4, 0.8 times, 0.9 times, 1 times, 1.5 times, 2 times, 2.5 times, 3 times or more the pore size of the membrane pores of the permselective membrane.

In the context of the present application, a "reaction compartment" means a semi-enclosed reaction space surrounded by a semi-permeable membrane, which allows for the exchange of part of the substance (depending on its molecular size, hydrophobic/hydrophilic, charge carrying, etc.), in particular for the present application molecules of smaller pore size relative to the semi-permeable membrane can freely enter or exit said reaction compartment, while molecules of larger pore size relative to the semi-permeable membrane can be trapped inside the reaction compartment. In the context of the present application, a "permselective membrane" is sometimes also written as a "semipermeable membrane", in particular a membrane structure that can selectively allow the passage of a substance on both sides of the membrane according to the difference in molecular size, hydrophobic/hydrophilic, and charge-carrying physical/chemical factors. In the context of the present specification, the "pore size of the semipermeable membrane pores" is understood as the average of the actual distances of the two points furthest apart on the respective membrane pores of the semipermeable membrane. In the context of the present specification, nucleic acids refer to deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), unless otherwise specified. In the context of the present specification, the corresponding english for "diameter" is equivalent diameter, more specifically, it is understood as "stokes diameter", meaning that the diameter of a sphere of interest is the stokes diameter of the particle of interest when the particle of interest has the same final sedimentation velocity as the sphere.

In yet another embodiment, the above-mentioned topologically captured RNA sample processing system is provided, wherein the RNA capture reagent, the RNA to be analyzed, and the whole or complex formed by the connection of the RNA capture reagent and the RNA to be analyzed, or the nucleic acid content of the deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after the conversion is liquid, gel or semi-liquid; the reaction compartment also contains an osmotic pressure regulator inside; preferably, the osmolality adjusting agent is dextran.

In the context of this specification, "topology acquisition" is a term of art, and "topology" corresponds to english topology. Topological capture is a new concept of a combination of supramolecular chemistry and topology: the mechanical interlocking structure based on non-covalent bond action is formed by combining a permselective membrane and particles and is used for targeted retention of biomolecules. In particular, the present application describes a semipermeable membrane structure in the form of a "net-like" which has a defined retention effect for molecules of large diameter (which generally correspond to molecules of large molecular weight, but also with regard to the shape of the molecules), which retention effect can be adjusted by the pore size of the membrane pores of the "net-like semipermeable membrane". In yet another embodiment, the RNA sample processing system based on topological capture is provided, wherein the capture reagent is a colloidal polymer compound polymerized by a double bond-bearing oligonucleotide primer itself or polymerized by a double bond-bearing oligonucleotide primer and one or more double bond-bearing compound monomers;

And carrying out reverse transcription reaction on the RNA capture reagent and the RNA to be analyzed to obtain a product molecule with the diameter larger than 1/2 of the aperture of the selectively permeable membrane. Advantageously, the diameter of the resulting whole or complex or nucleic acid content is greater than 0.5 times, 0.6 times, 0.7 times, 3/4, 0.8 times, 0.9 times, 1 times, 1.5 times, 2 times, 2.5 times, 3 times or more the pore size of the membrane pores of the permselective membrane.

In the context of the present specification, a "double-bond oligonucleotide primer" refers to a "dual-action primer" which has both the function of a general PCR primer and the function of "forming a molecule of larger diameter by polycondensation, which in turn acts as a capture reagent for the RNA to be analyzed". In yet another embodiment, there is provided the above-described topologically captured-based RNA sample processing system, wherein,

and carrying out reverse transcription reaction on the RNA capture reagent and the RNA to be analyzed, and then carrying out PCR amplification reaction to obtain a product molecule with the diameter larger than 1/2 of the aperture of the selective permeable membrane. Advantageously, the diameter of the resulting whole or complex or nucleic acid content is greater than 0.5 times, 0.6 times, 0.7 times, 3/4, 0.8 times, 0.9 times, 1 times, 1.5 times, 2 times, 2.5 times, 3 times or more the pore size of the membrane pores of the permselective membrane.

In the context of the present specification, the term "RNA to be analyzed" refers specifically to mRNA, which can undergo reverse transcription reaction under the action of reverse transcriptase and an appropriate solvent at a temperature to produce cDNA, thereby forming an mRNA/cDNA hybrid strand. The reverse transcription reaction may be performed in a reverse transcription PCR instrument. In the context of the present specification, PCR is an english abbreviation for "polymerase chain reaction". PCR is to use the fact that DNA becomes single-stranded at a high temperature of 95 ℃ in vitro and primer and single-stranded are combined according to the base complementary pairing principle at a low temperature (usually about 60 ℃), then the temperature is regulated to the optimal reaction temperature (about 72 ℃) of DNA polymerase, and the DNA polymerase synthesizes complementary strand along the direction from phosphoric acid to pentose (5 '-3'). The PCR instrument based on polymerase manufacturing is actually a temperature control device, and can accurately control the denaturation temperature, renaturation temperature and extension temperature. Double replication amplification of a trace amount of nucleic acid as a substrate is accomplished by the combined action of a DNA polymerase and temperature cycling.

In one embodiment, there is provided the above-described topologically captured-based RNA sample processing system, wherein,

after the RNA to be analyzed, and the RNA capture reagent and the RNA to be analyzed are linked into a whole or a complex, or the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed after the transformation, the RNA to be analyzed is further captured by the following second capture reagent: the second capture reagent is a complex of DNA transposase and DNA; preferably the DNA transposase is Tn5, the DNA having a transposase recognition sequence at its end, in particular a transposase with an ME sequence of 19bp at both ends. Here, the mechanism by which Tn5 transposase can act as a second capture reagent (to form a larger diameter molecule to be trapped) is for the 3' -OH of Tn5 to nucleophilically attack the target sequence, forming a 9bp cohesive end between transposon insertion sites, with covalent bonds between the 3' -OH of the transposon and the 5' -P of the target DNA. Tn5 forms a complex with the broken short piece of DNA based on the affinity of its dimer protein interactions, maintaining the order and proximity of the original DNA molecules. )

In one embodiment, a topology capture-based RNA sample processing system is provided, wherein the RNA to be analyzed is derived from the same cell or cell nucleus; preferably, the RNA to be analyzed is in an intact cell or nucleus. In the context of the present specification, the RNA to be analyzed is initially in an intact cell or nucleus and then undergoes a stage of cell lysis, in a state of release from the cell/nucleus, when captured by the capture reagent.

The present application relates in a second aspect to a method of manufacturing the above described topologically captured based RNA sample processing system.

In one embodiment, a method of manufacturing the above-described topologically captured-based RNA sample processing system is provided, comprising the steps of: preparing a first phase comprising a tonicity adjusting agent and a first aqueous solvent; preparing a second phase in which the selectively permeable membrane forming material and the second aqueous solvent are mixed;

the RNA capture reagent is added in the first phase or the second phase; mixing RNA to be analyzed in intact cells or nuclei into a first phase or a second phase; mixing the RNA to be analyzed in the intact cell or nucleus preferably to a first phase; mixing the first phase and the second phase to form a mixed hydrophilic phase, and mixing the mixed hydrophilic phase with the oily solvent to prepare a water-in-oil emulsion; solidifying or semi-solidifying the water-in-oil emulsion to form a selectively permeable membrane;

Demulsification of the water-in-oil emulsion after the solidification or semi-solidification reaction to obtain a reaction compartment which is provided with a selective permeable membrane at the outer layer and is internally provided with contents; the reaction compartment having the selectively permeable membrane on the outer layer and the contents inside is mixed with the cell lysate to release the RNA in the cells or nuclei or heated to release the RNA in the cells or nuclei to contact the RNA capture reagent.

The first aqueous solvent comprises one or more of the following group: ethanol, formaldehyde, polyvinyl alcohol, dextran, hydroxypropyl starch, ficoll, methoxypolyethylene glycol, polyethylene glycol, dextran, potassium phosphate, glucose, other inorganic salts (K) ⁺ ,Na ⁺ ,Li ⁺ ,(NH ₄ ) ⁺ ,PO ₄ ^3– ,SO ₄ ^2- ) Polyethylene glycol, polypropylene glycol, ethyl hydroxyethyl cellulose, ethylene oxide-propylene oxide, poly (N-isopropyl acrylamide), poly (methyl methacrylate-co-methacrylic acid);

or alternatively

The second aqueous solvent comprises one or more of the following group: ethanol, formaldehyde, polyvinyl alcohol, dextran, hydroxypropyl starch, ficoll, methoxypolyethylene glycol, polyethylene glycol, dextran, potassium phosphate, glucose, other inorganic salts (K) ⁺ ,Na ⁺ ,Li ⁺ ,(NH ₄ ) ⁺ ,PO ₄ ^3– ,SO ₄ ^2- ) Polyethylene glycol, polypropylene glycol, ethyl hydroxyethyl cellulose, ethylene oxide-propylene oxide, poly (N-isopropyl acrylamide), poly (methyl methacrylate-co-methacrylic acid);

Preferably, the first aqueous solvent and the second aqueous solvent are both water;

it is further preferred that the osmolality adjusting agent is dextran and the concentration of the dextran in the first aqueous solvent is 3% -10%; most preferably the osmolality adjusting agent is dextran and the concentration of the dextran in the first aqueous solvent is 5.5%;

it is further preferred that the oil phase solvent is selected from one or more of the following group: perfluoropolyether-polyethylene glycol-perfluoropolyether triblock copolymers, HFE-7500 fluorinated oils, squarane oils, silicone oils, and mineral oils;

most preferably, the oil phase solvent is a perfluoropolyether-polyethylene glycol-perfluoropolyether triblock copolymer.

The adjusting conditions of the curing or semi-curing reaction are the illumination intensity and illumination time of ultraviolet light;

preferably, the catalyst used for the curing or semi-curing reaction is a TEMED initiator selected from one or more of the following groups: 2-hydroxy-2-methyl-1-phenylpropanone, 1-hydroxycyclohexylphenyl ketone, 2-methyl-2- (4-morpholino) -1- [4- (methylthio) phenyl ] -1-propanone, 2,4, 6-trimethylbenzoyl-diphenylphosphine oxide, ethyl 2,4, 6-trimethylbenzoyl-phenylphosphonate, 2-dimethylamino-2-benzyl-1- [4- (4-morpholino) phenyl ] -1-butanone, 2-hydroxy-2-methyl-1- [4- (2-hydroxyethoxy) phenyl ] -1-propanone, MBF benzoyl methyl formate, benzoin derivatives (benzoin, benzoin dimethyl ether, benzoin diethyl ether, benzoin isopropyl ether, benzoin butyl ether), benzils (diphenylethanone, α -dimethoxy- α -phenylacetophenone), alkylphenones (α, α -diethoxy, α -hydroxyalkyl-benzophenone), acyl phosphorus oxides (arylphosphine oxides, bisphenylphenyl ketone), dibenzoyl ketone, xanthone, 4-mercaptobenzophenone, xanthone; diaryl iodonium salts, triaryliodonium salts, alkyl iodonium salts, isopropylbenzene ferrocene hexafluorophosphate salts;

The selectively permeable film forming material is selected from one or more of the following group: polyolefins, olefin copolymers, acrylics, vinyl polymers, polyesters, polycarbonates, polyamides, polyimides, formaldehyde resins, polyurethanes, ether polymers, cellulosics, thermoplastic elastomers, and thermoplastic polyurethane materials;

preferably, the selectively permeable membrane forming material is a hydrogel matrix material; more preferably, the selectively permeable membrane forming material is polyethylene glycol diacrylate (PEGDA), still more preferably, the PEGDA is present in the second aqueous solvent at a concentration of 1% to 10%,

most preferably it is PEGDA and the concentration of said PEGDA in the second aqueous solvent is 3%.

In the present context, demulsification can be achieved by shaking and mixing with the use of surfactants followed by high-speed centrifugation.

In yet another embodiment, a method of manufacturing the above-described topologically captured-based RNA sample processing system is provided, comprising the steps of: preparing a first phase comprising an RNA capture reagent, an osmolality adjusting agent, and a first aqueous solvent; preparing a second phase in which the selectively permeable membrane forming material and the second aqueous solvent are mixed; mixing RNA to be analyzed in intact cells or nuclei into a first phase or a second phase; mixing the RNA to be analyzed in the intact cell or nucleus preferably to a first phase;

Mixing the cell lysate to a first phase or a second phase; preferably, the cell lysate is in a different phase than the cells or nuclei; mixing the first phase and the second phase to form a mixed hydrophilic phase, and mixing the mixed hydrophilic phase with the oily solvent to prepare a water-in-oil emulsion; and the cell lysate assists in releasing RNA within the cell or nucleus for contact with the RNA capture reagent; solidifying or semi-solidifying the water-in-oil emulsion to form a selectively permeable membrane; and demulsifying the water-in-oil emulsion after the solidification or semi-solidification reaction to obtain a reaction compartment which is provided with a selective permeable membrane on the outer layer and the content inside.

The present application relates in a third aspect to a method of preparing a second generation sequencing (NGS) library based on a topologically captured RNA sample processing system.

In one embodiment, a method for preparing a second generation sequencing (NGS) library based on a topologically captured RNA sample processing system is provided, the method comprising: (a) formulating a composition comprising: an RNA sample; a first strand complementary deoxyribonucleic acid (cDNA) primer; a template switch oligonucleotide; a reverse transcriptase; and dNTPs; annealing the cDNA synthesis primer to the RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and performing a reverse transcriptase reaction by contacting the RNA-cDNA intermediate with a Template Switching Oligonucleotide (TSO), wherein the TSO comprises or does not comprise a Locked Nucleic Acid (LNA) at its 3' -end, complementary to the RNA molecule and complementary to the TSO under conditions suitable for extension of the first cDNA strand; (b) Performing two-strand synthesis amplification on the RNA-cDNA intermediate under amplification conditions sufficient to produce a product double-stranded DNA to yield a second DNA strand; (c) Labeling the second DNA of the product with a transposome comprising a transposase and a transposon nucleic acid comprising a transposon end domain and a second post-labeling amplification primer binding domain to produce a labeled sample;

the RNA sample is the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed by connecting the RNA to be analyzed and the RNA capture reagent into a whole, or forming a complex by the interaction of the RNA to be analyzed and the RNA capture reagent, or performing biological or chemical reaction on the RNA to be analyzed and the RNA capture reagent to generate and convert the RNA to be analyzed and the RNA capture reagent,

wherein (a) - (d) are carried out in the reaction compartment described above.

In the context of the present specification, the designation of second generation sequencing is to distinguish from the first generation DNA sequencing technology that was developed in the 70 s of the 20 th century, and is therefore also referred to as "next generation sequencing"; since millions or even billions of different DNA fragments can be sequenced simultaneously, this technique is also known as "high throughput sequencing" (where the nucleic acid "disruption" step provides for high throughput sequencing). Second generation sequencing reduces the cost of DNA sequencing by at least 5 orders of magnitude, making it widely used in various fields of biology. Based on the principle of sequencing, second generation sequencing is generally classified into sequencing-by-synthesis and sequencing-by-ligation. The second generation sequencing of the present application is based on sequencing-by-synthesis. In the context of the present specification, LNA is an english abbreviation of locked nucleic acid, chinese called "locked nucleic acid" or "locked nucleic acid". LNA can combine with DNA or RNA to form hybrid oligonucleotide molecule, so that PCR reaction, microarray chip, in situ hybridization and other hybridization principle based techniques can be improved by LNA introduction. The nucleic acid can increase the melting problem of the primer or the probe, strengthen the stability of the substances, and can be applied to the technologies of real-time fluorescence quantitative PCR and the like.

In the context of this specification, cDNA is a collection of clones of DNA (complementary DNA) that are complementary to cellular messenger RNA (i.e., mRNA). While TSO is known as Template switch oligo, a template switching oligonucleotide, is an oligonucleotide that is added by reverse transcriptase to the 5-end of a non-template strand during reverse transcription for downstream cDNA amplification. During first strand synthesis, when the 5 'end of the RNA template is reached, the terminal transferase activity of MMLV reverse transcriptase adds some additional nucleotides (mainly deoxycytidine) at the 3' end of the newly synthesized cDNA strand. In this application, TSO is used to coordinate reverse transcriptase to initiate reverse transcription of the transcriptome.

In yet another embodiment, the above method is provided wherein the reverse transcription reaction is performed in the presence of a methyl donor and a metal salt. In the context of the present specification, a methyl donor refers to a related compound that provides a methyl (-CH 3) group to the acceptor during the reaction.

In yet another embodiment, the above method is provided, wherein the methyl donor is betaine.

In yet another embodiment, the above method is provided wherein the metal salt is a magnesium salt.

In yet another embodiment, the above method is provided wherein the template switch oligonucleotide comprises one or two ribonucleotide residues and 0 or more Locked Nucleic Acid (LNA) residues.

In yet another embodiment, the above method is provided, wherein the one or two ribonucleotide residues are riboguanines.

In yet another embodiment, the above method is provided wherein the locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

In yet another embodiment, the above method is provided, wherein the locked nucleic acid residue is locked guanine.

In yet another embodiment, the above method is provided wherein the template switch oligonucleotide comprises three nucleotide residues at the 3' -end characterized by the formula rgrg+n, wherein +n represents a locked nucleotide residue.

In yet another embodiment, the above method is provided, wherein the template switch oligonucleotide comprises rgrg+g.

In a further embodiment, the above method is provided wherein the methyl donor is betaine and the metal salt is MgCl at a concentration of at least 9mM ₂ 。

In a further embodiment, the above method is provided, wherein

The template switch oligonucleotide is selected from the group consisting of:

+G +G+G, preferably SEQ ID No.3: AAGCAGTGGTATCAACGCAGAGTAC +G+G+G and

rG+G+G, preferably SEQ ID NO.4 AAGCAGTGGTATCACGCAGGAGTACrG+G.

In the context of the present specification, rG and rC refer to G and C, respectively, as ribonucleic acids in a further embodiment, the above method is provided, wherein the cDNA is synthesized in a solution mixed with the oligonucleotide primer or on a colloidal polymer formed by polymerizing the double bond-bearing oligonucleotide primer with one or more double bond-bearing compound monomers.

In yet another embodiment, the above method is provided wherein the oligonucleotide primer comprises SEQ ID NO.5:5' -AAGCAGTGGTATCAACGCAGAGTACT30VN and/or NNNNNN NNNN, wherein "N" is any nucleobase and "V" is "A" or "C" or "G".

In a fourth aspect, the present application provides a method of analyzing gene expression in a plurality of single cells.

In a specific embodiment, the above method is provided, wherein the method comprises the steps of: preparing a cDNA library according to the above method; and sequencing the cDNA library.

The present application provides in a fifth aspect a Template Switching Oligonucleotide (TSO).

In a specific embodiment, the above TSO is provided wherein one locked nucleotide residue is contained at its 3' -end.

In yet another embodiment, the TSO described above is provided wherein it comprises three nucleotide residues at the 3' -terminus selected from the group consisting of +n+n+ N, N +n+ N, NN + N, rN +n+n and rnrn+n, wherein each occurrence of N is independently a deoxyribonucleotide residue, each occurrence of rN is independently a ribonucleotide residue, and each occurrence of +n is independently a locked nucleotide residue.

In yet another embodiment, the TSO described above is provided wherein the locked nucleotide residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.

In yet another embodiment, the above TSO is provided wherein the three nucleotide residues are selected from nn+ G, rNrN + G, GG + N, rGrG +g and gg+g.

In a specific embodiment, a pooling method by second generation sequencing as described above is provided, wherein the RNA is an RNA that is released by cleavage from a single cell in a reaction compartment surrounded by a permselective membrane.

In yet another embodiment, the above method is provided wherein the single cell is encapsulated by a microfluidic system into a reaction compartment surrounded by a permselective membrane.

In yet another embodiment, the above method is provided, wherein the transposase is a Tn5 transposase.

In yet another embodiment, the above method is provided, wherein the transposon end domain comprises a Tn5 transposon end domain.

In yet another embodiment, the above method is provided, wherein the method further comprises combining the first double stranded product cDNA with a second double stranded product DNA to produce a combined cDNA sample, and then labeling the combined cDNA sample.

In a further embodiment, the above method is provided, wherein the method further comprises quantifying one or more RNA species of the RNA sample.

In yet another embodiment, the above method is provided wherein the methods are all performed in a reaction compartment surrounded by a permselective membrane.

In one embodiment, a method of library creation by second generation sequencing is provided, wherein the method comprises: (a) formulating a composition comprising: an RNA sample; a first strand complementary deoxyribonucleic acid (cDNA) primer; a template switch oligonucleotide; a reverse transcriptase; and dNTPs; annealing the cDNA synthesis primer to the RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and performing a reverse transcriptase reaction by contacting the RNA-cDNA intermediate with a Template Switching Oligonucleotide (TSO), wherein the TSO comprises or does not comprise a Locked Nucleic Acid (LNA) at its 3' -end, complementary to the RNA molecule under conditions suitable for extension of the first DNA strand, such that it is complementary to the TSO;

the RNA sample is the nucleic acid content of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed by the above-mentioned RNA to be analyzed and the RNA capture reagent connected into a whole, or the RNA to be analyzed and the RNA capture reagent form a complex through interaction, or the RNA to be analyzed and the RNA capture reagent are subjected to biological or chemical reaction to generate conversion, wherein (a) - (c) are carried out in the above-mentioned reaction compartment.

In yet another embodiment, the above method is provided wherein the reverse transcription reaction is performed in the presence of a methyl donor and a metal salt.

In yet another embodiment, the above method is provided, wherein the magnesium salt has a concentration of at least 7 mM.

In yet another embodiment, the above method is provided wherein the template switch oligonucleotide comprises one or two ribonucleotide residues and the 0 or more Locked Nucleic Acid (LNA) residues.

In yet another embodiment, the above method is provided wherein the one or two ribonucleotide residues are riboguanines.

In yet another embodiment, the above method is provided wherein the template switch oligonucleotide is selected from the group consisting of:

+G +G+G, preferably SEQ ID No.3: AAGCAGTGGTATCAACGCAGAGTAC +G+G+G and iv. RG+G+G, preferably SEQ ID NO.4 AAGCAGTGGTATCACGCAGGAGTACrG+G.

In yet another embodiment, the above method is provided wherein the cDNA is synthesized in a solution mixed with the oligonucleotide primer or on a colloidal polymer formed by polymerizing the double bond-bearing oligonucleotide primer with one or more double bond-bearing compound monomers.

In yet another embodiment, the above method is provided wherein the oligonucleotide primer comprises SEQ ID NO.5:5' -AAGCAGTGGTATCAACGCAGAGTACT30VN and/or NNNNNNNNNNNN, wherein "N" is any nucleobase and "V" is "A" or "C" or "G". "T30" represents 30T.

In a further embodiment, the above method is provided, wherein the method comprises the steps of: preparing a cDNA library using the above method; and sequencing the cDNA library.

In yet another embodiment, the above method is provided wherein the 3' -most end thereof comprises a locked nucleotide residue. In yet another embodiment, the above method is provided wherein the RNA is an RNA that is released by cleavage in a single cell in a reaction compartment surrounded by a permselective membrane.

In yet another embodiment, the above method is provided wherein the reaction compartment enclosed by the selectively permeable membrane is enclosed by a microfluidic system.

In yet another embodiment, the above method is provided, wherein the transposase comprises a Tn5 transposase.

In yet another embodiment, the above method is provided, wherein the method further comprises combining the first double stranded product cDNA with the second double stranded product cDNA to produce a combined cDNA sample, and then labeling the combined cDNA sample.

In yet another embodiment, there is provided the method described herein above, wherein the methods are all performed in a reaction compartment surrounded by a permselective membrane.

Examples section

Example 1: single cell mRNA Capture (break DNA double strand)

Materials and reagents

Device fabrication and operation. Polydimethylsiloxane (PDMS) microfluidic devices were fabricated and operated using the standard procedure described (fig. 3). Figure 3 shows a microfluidic device system for producing droplets containing aqueous two phases and targeted capture reagent.

Preparation of a target Capture reagent in an aqueous two-phase System (ATPS). All chemicals were ordered from Sigma-Aldrich and Fisher Scientific. APS (ammonium persulfate), 10% (w/v) dextran (MW 500K), 5'Acrydite poly T primer (double bond containing oligonucleotide primer) SEQ ID NO.6:5`Acrydite AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT), 5% (w/v) PEGDA (MW 8K), 5% (v/v) PEGDA (MW 575), 0.5% (w/v) were prepared as droplets of a two-aqueous system (hereinafter referred to as ATPS droplets). Other concentrations of PEGDA (MW 8K) and PEGDA (MW 575) and other high molecular weight polymers may be used. The solutions containing all the above components were mixed and centrifuged in a table centrifuge and liquid-liquid phase separation was induced to obtain an upper phase I-phase solution and a lower phase II-phase solution, respectively, see fig. 3 and 4.

Emulsification (see figures 3 and 4). For the formation of a reaction compartment surrounded by a selectively permeable membrane of larger size, as shown in fig. 1A and 1B: the reaction compartments enclosed by the droplets and selectively permeable membranes were created using microfluidic chips with a height of 50 μm and a width of 40 μm nozzles (see fig. 3 and 4). Typical flow rates used are: phase (phase I solution) enriched with PEGD (M) A and 5'Acrytite poly T primers, flow rate of 200. Mu.L/h, mixed solution (phase II solution) enriched with dextran and cells, flow rate of 100. Mu.L/h and droplet stabilizing oil (carrier oil) (2% PEG-PFPE) ₂ HFE 7500) at a flow rate of 600. Mu.L/h. By the apparatus shown in fig. 3, the aqueous two-phase system droplets can be obtained by the process shown in fig. 4.

Crosslinking (FIG. 5). The aqueous two-phase system droplets were collected in 1.5ml tubes and used with high pressureUVP (UVP, 95-0127-01) of the intensity ultraviolet inspection lamp is exposed at 365nm wavelength for 2.5 min for immediate crosslinking (as shown in FIG. 8, showing the state of gel formation after crosslinking). 5'Acrydite poly T primer and PEGDA Shell were hardened and then demulsifier (2% PEG-PFPE) ₂ HFE 7500) by centrifugation, the resulting permselective membrane-enclosed reaction compartment was recovered from aqueous two-phase droplets (fig. 9).

Cell lysis, removal of rRNA and genomic DNA. The lysis of the encapsulated cells was carried out by suspending the reaction compartment enclosed by the permselective membrane in a lysis buffer containing: 200. Mu.g/mL proteinase K (Invitrogen, AM 2546), 0.1% (v/v) Triton X-100 (Sigma-Aldrich, T8787-100 ML), 10mM Tris-HCl [ pH 7.5] and 1mM EDTA. The selectively permeable membrane suspended in lysis buffer was surrounded by a reaction compartment incubated at 37℃for 30 minutes and then at 50℃for another 30 minutes (as shown in FIG. 12, showing the state after lysis).

In the above procedure, RNA was captured by the capture reagent (5'Acrydite Poly T primer after hardening) and remained in the reaction compartment (FIGS. 2C and 10 show conceptual and experimental results of the hardened PolyT-harboring oligonucleotides (primers) and cells, respectively, captured by mRNA in the reaction compartment). After cleavage, the reaction compartment surrounded by the selectively permeable membrane was subjected to rRNA removal and genomic DNA removal (FIG. 13), and two kits were provided, namely, MGIEasy rRNA removal kit (accession numbers: MGI, 1000005953), DNase I (accession numbers: thermo Scientific, EN 0521)), probe hybridization, RNase H digestion and DNase I digestion were performed based on the ratios and temperatures of tables 1 to 6 below, respectively, to thereby effect rRNA removal and genomic DNA removal, and centrifugal washing of the reaction compartment surrounded by the selectively permeable membrane was required after the end of the previous procedure in each procedure. As shown in FIG. 13, there was no fluorescence under the fluorescence microscope, indicating that genomic DNA had been removed.

Relevant experimental parameters for probe hybridization:

TABLE 1 hybridization reaction mixture was prepared on ice

Component (A)	Volume of
		Reaction compartment surrounded by selectively permeable membrane	18μL
Hybridization buffer	5μL
		Probe mixture	2μL
Total amount of	25μL

TABLE 2 temperature control program for hybridization reactions

Temperature (temperature)	Time
		Thermal cover 105 DEG C	On
95℃	2min
		95℃-22℃	0.1℃/s
22℃	5min

Table 3 RNase H digestion:

component (A)	Volume of
		The product of the previous step	25μL
RNaseH	2μL
		RNaseH buffer	3μL
Total amount of	30μL

TABLE 4 temperature control program for RNase H digestion

Temperature (temperature)	Time
		Heat cover (45 degree centigrade)	On
37℃	30min
		4℃	∞

Table 5 DNase I digestion:

TABLE 6 temperature control program for DNase I digestion

Reverse transcription and amplification of mRNA. The reaction compartment surrounded by the permselective membrane obtained in the previous step was suspended in reverse transcriptase containing 0.5U/. Mu.L Superscript IV, 1XFirst StrandBuffer and then incubated at 50℃for an additional 30 minutes. PCR, like macroscopic reaction, is used to amplify specific region fragments of cDNA or specific genes. Each amplification of 35 cycles was performed using the KAPAPCR kit (KAPABiosystems, KK 2602). In all enzymatic reactions, the selectively permeable membrane enclosed reaction compartments occupy approximately 40-50% of the final reaction volume (fig. 14, 15, 16 and 17). FIG. 14 shows fluorescent staining of single cell mRNA reverse transcribed cDNA amplification in a reaction compartment consisting of selectively permeable membranes; FIG. 15 shows the results of single cell mRNA reverse transcription cDNA amplification in a selectively permeable membrane composed reaction compartment; FIG. 16 shows Qsep characterization of single cell mRNA reverse transcribed cDNA amplification in a selectively permeable membrane composed reaction compartment; FIG. 17 shows single-cell mRNA reverse-transcribed cDNA amplification in a reaction compartment consisting of selectively permeable membranes, flow analysis and sorting.

Disruption and capture of amplification products. The cDNA amplification products were disrupted using a DNA disruption kit (NexteraXT DNA Library Preparation Kit (24 samples), FC-131-1024). Short pieces of DNA (fragmented nucleic acids) can be maintained in multimeric state using Tn5 transposase dimer (Tn 5-adapter) as capture reagent, remaining in the reaction compartment surrounded by permselective membrane (FIG. 2A shows a schematic of the whole process, FIG. 18 shows a disruption of the cDNA amplification library, FIG. 19 shows a Qsep characterization of the disruption of the cDNA amplification library). For subsequent single cell sequencing.

Example 2: single cell mRNA Capture (breaking RNA/DNA hybrid strand, i.e.without PCR amplification, example of direct reverse transcription post-break)

Materials and reagents

Preparation of ATPS and target capture reagent. All chemicals were ordered from Sigma-Aldrich and Fisher Scientific. Using APS (ammonium persulfate), 10% (w/v) dextran (MW 500K), 5'Acrytide poly T primers: for example, SEQ ID NO.6 may be used: 5`Acrydite AAGCAGTGGTATCAACGCAGAGTACTTTT TTTTTTTTTTTTTTTTTTTTTTTTTT, 5% (w/v) PEGDA (MW 8K), 5% (v/v) PEGDA (MW 575), 0.5% (w/v) ATPS droplets (hereinafter referred to as ATPS droplets) were prepared. Other concentrations of PEGDA (MW 8K) and PEGDA (MW 575) and other high molecular weight polymers may be used. Mixing the solutions containing all the above components, and inducing liquid-liquid phase separation in a table centrifuge to obtain upper phase i.e. phase I solution and lower phase II phase solution, respectively.

Emulsification (fig. 4). For larger size permselective membrane enclosed reaction compartments are created as shown in fig. 1A and 1B: the reaction compartments enclosed by the droplets and selectively permeable membranes were created using microfluidic chips with a height of 50 μm and a width of 40 μm. Typical flow rates used are: phase (phase I solution) rich in PEGD (M) A at a flow rate of 200. Mu.L/h, phase (phase II solution) rich in dextran and cells at a flow rate of 100. Mu.L/h and a droplet stabilizing oil (carrier oil) (2% PEG-PFPE) ₂ HFE 7500) at a flow rate of 600. Mu.L/h.

Due to the increased viscosity of the two-phase system, drop break-up by the ejector mechanism can be observed, which can shift the drop generation mode by adjusting the flow rate of the system. Here, fig. 4 shows injection of a first fluid (phase I solution, rich in dextran), a second fluid (phase II solution, rich in polyethylene glycol based polymer), a continuous phase (carrier oil is fluorinated oil and comprises a surfactant, such as PFPE-PEG-PFPE (perfluoropolyether-polyethylene glycol-perfluoropolyether) triblock copolymer) into a microfluidic chip by a microfluidic device system; the targeted capture reagent enters the microfluidic system from the first fluid, the second fluid, the continuous phase (carrier oil), or any two or three.

Crosslinking (FIG. 5). The emulsion was collected in a 1.5ml tube and immediately crosslinked using a high intensity ultraviolet inspection lamp UVP (UVP, 95-0127-01) at 365nm wavelength for 2.5 minutes (FIG. 8, showing the state of gel after crosslinking). After hardening of the PEGDA shell, a demulsifier (2% PEG-PFPE) was used ₂ HFE 7500) from the emulsion, the resulting permselective membrane enclosed reaction compartment was recovered (fig. 9). Here, fig. 5 shows a method of hardening the outer layer II phase by initiating polymerization. FIG. 8 shows permselectivity after gellingA reaction compartment surrounded by a membrane. Figure 9 shows the reaction compartment enclosed by the permselective membrane after demulsification.

Cell lysis, removal of rRNA genomic DNA. The lysis of the encapsulated cells was carried out by suspending the reaction compartment enclosed by the permselective membrane in a lysis buffer containing: 200. Mu.g/mL proteinase K (Invitrogen, AM 2546), 0.1% (v/v) Triton X-100 (Sigma-Aldrich, T8787-100 ML), 10mM Tris-HCl [ pH 7.5] and 1mM EDTA. The selectively permeable membrane suspended in lysis buffer was surrounded by a reaction compartment incubated at 37℃for 30 minutes and then at 50℃for another 30 minutes (FIG. 12, showing the state after lysis). Here, fig. 12 shows cell lysis in a reaction compartment surrounded by a permselective membrane.

In this process, RNA is captured by the capture reagent (Acrytide polyT primer) and then remains in the reaction compartment (FIG. 2C, FIG. 10. Double-bond oligonucleotides (primers) and cells captured by mRNA in the reaction compartment). After cleavage, the reaction compartment surrounded by the permselective membrane was subjected to rRNA removal and genomic DNA removal (FIG. 13). Here, fig. 13 shows removal of genomic DNA in a reaction compartment surrounded by a permselective membrane.

Relevant experimental parameters for probe hybridization:

TABLE 7 preparation of hybridization reaction mixtures on ice

TABLE 8 temperature control program for hybridization reactions

Rnase H digestion:

TABLE 10 temperature control program for RNase H digestion

Dnase I digestion:

TABLE 12 temperature control program for DNase I digestion

Reverse transcription and disruption of mRNA. The reaction compartment, surrounded by a permselective membrane, was suspended in reverse transcriptase containing 0.5U/. Mu.L Superscript IV, 1X First Strand Buffer and then incubated for an additional 30 minutes at 50 ℃. The RNA/DNA hybrid of the amplified product was broken using a DNA breaking kit (Nextera XT DNA Library Preparation Kit (24 samples), FC-131-1024). The short stretches of RNA/DNA hybrid can be maintained in multimeric state using Tn5 dimer as capture reagent, remaining in the reaction compartment enclosed by the permselective membrane (FIGS. 2B, 20 show disruption of RNA/DNA hybrid and FIG. 21). Here, FIG. 20 shows RNA/DNA hybrid cleavage within a reaction compartment surrounded by a permselective membrane.

While FIG. 21 shows a Bioanalzyer 2100 representation of RNA/DNA hybrid disruption within a selectively permeable membrane enclosed reaction compartment.

Example 3: single cell mRNA capture (magnetic bead topology capture, break DNA double strand)

Materials and reagents

Preparation of ATPS and target capture reagent. All chemicals were ordered from Sigma-Aldrich and Fisher Scientific. ATPS droplets were prepared using APS (ammonium persulfate), 10% (w/v) dextran (MW 500K), 5' biotylinylatedpoly t primer, streptavidin magnetic beads, 5% (w/v) PEGDA (MW 8K), 5% (v/v) PEGDA (MW 575), 0.5% (w/v). Other concentrations of PEGDA (MW 8K) and PEGDA (MW 575) and other high molecular weight polymers may be used. The solutions containing all ingredients were mixed and liquid-liquid phase separation was induced in a bench top centrifuge.

Streptavidin magnetic beads are coupled with 5'biotinylated polyT primers. Coupling of 5' biotylinylatedpolyt was performed by suspending the magnetic beads in a buffer containing: 10mM Tris-HCl (pH 7.5), 1mM EDTA,1M NaCl,0.05%Tween-20,1uM 5'biotinylatedpolyT. Placing the mixture on a rotary mixer, and carrying out rotary mixing at room temperature for 30min to prepare the capture reagent.

Emulsification (fig. 4). For the reaction compartments enclosed by the larger size permselective membrane, as shown in fig. 1: the reaction compartments enclosed by the droplets and selectively permeable membranes were created using microfluidic chips with a height of 50 μm and a width of 40 μm. Typical flow rates used are: PEGD (M) A-rich phase I solution-flow rate of 200. Mu.L/h, dextran, cell, capture reagent-rich phase II solution-flow rate of 100. Mu.L/h and droplet stabilizing oil (2% PEG-PFPE) ₂ HFE 7500) -flow rate was 600. Mu.L/h. As the viscosity of the two-phase system increases, drop break-up by the ejector mechanism can be observed, which can shift the drop generation mode by adjusting the flow rate of the system (fig. 4 and 22). Here, fig. 4 shows the injection of a first fluid (I-phase-compatible) into a microfluidic chip by a microfluidic device systemLiquid, rich in dextran), second fluid (phase II solution, rich in polyethylene glycol based polymer), continuous phase (carrier oil is fluorinated oil and comprises surfactant, for example PFPE-PEG-PFPE (perfluoropolyether-polyethylene glycol-perfluoropolyether) triblock copolymer); the targeted capture reagent enters the microfluidic system from the first fluid, the second fluid, the continuous phase (carrier oil), or any two or three. Here, fig. 22 shows a state before gel formation of the reaction compartment composed of the selectively permeable membrane (magnetic bead topological capture).

Crosslinking (FIG. 5). The emulsion was collected in a 1.5ml tube and immediately crosslinked using a high intensity ultraviolet inspection lamp UVP (UVP, 95-0127-01) at 365nm wavelength for 2.5 minutes (FIG. 23). After hardening of the PEGDA shell, a demulsifier (2% PEG-PFPE) was used ₂ HFE 7500) from the emulsion, the resulting permselective membrane enclosed reaction compartment was recovered (fig. 24). Here, fig. 5 shows a method of hardening the outer layer II phase by initiating polymerization. Here, fig. 23 shows a state (magnetic bead topology capture) after gel formation of a reaction compartment composed of selectively permeable membranes. Here, fig. 24 shows the reaction compartment composed of selectively permeable membranes after demulsification (magnetic bead topological capture).

Cell lysis, removal of rRNA genomic DNA. The lysis of the encapsulated cells was carried out by suspending the reaction compartment enclosed by the permselective membrane in a lysis buffer containing: 200. Mu.g/mL proteinase K (Invitrogen, AM 2546), 0.1% (v/v) Triton X-100 (Sigma-Aldrich, T8787-100 ML), 10mM Tris-HCl [ pH 7.5] and 1mM EDTA. The selectively permeable membrane suspended in lysis buffer was surrounded by a reaction compartment incubated at 37℃for 30 minutes and then at 50℃for a further 30 minutes (FIG. 25). Here, fig. 25 shows cell lysis (magnetic bead topological capture) in a reaction compartment composed of selectively permeable membranes.

In the process, RNA is retained in the reaction compartment after being captured by streptavidin magnetic beads.

After cleavage, the reaction compartment surrounded by the permselective membrane was subjected to rRNA removal and genomic DNA removal (FIG. 26). In this case, the removal of genomic DNA (magnetic bead topological capture) in a reaction compartment composed of selectively permeable membranes is shown in FIG. 26.

Relevant experimental parameters for probe hybridization:

TABLE 13 preparation of hybridization reaction mixtures on ice

TABLE 14 temperature control program for hybridization reactions

Rnase H digestion:

TABLE 16 temperature control program for RNase H digestion

Dnase I digestion:

component (A)	Volume of
		The product of the previous step	30μL
DNaseI	5μL
		DNaseI buffer	15μL
Total amount of	50μL

TABLE 18 temperature control program for DNase I digestion

Reverse transcription and amplification of mRNA. The reaction compartment, surrounded by a permselective membrane, was suspended in reverse transcriptase containing 0.5U/. Mu.L Superscript IV, 1XFirst StrandBuffer and then incubated for an additional 30 minutes at 50 ℃. PCR, like macroscopic reaction, is used to amplify specific region fragments of cDNA or specific genes. Each amplification of 35 cycles was performed using the KAPAPCR kit (KAPABiosystems, KK 2602) according to manufacturer's recommendations. In all enzymatic reactions, the selectively permeable membrane enclosed reaction compartments occupy approximately 40-50% of the final reaction volume (fig. 27). FIG. 27 shows fluorescent staining (magnetic bead topological capture) of single cell mRNA reverse transcription cDNA amplification in a reaction compartment consisting of selectively permeable membranes.

Disruption and capture of amplification products. The amplified products were broken using a DNA breaking kit (Nextera XT DNA Library Preparation Kit (24 samples), FC-131-1024) according to the manufacturer's recommendations. The use of Tn5 dimer as a capture reagent maintains short fragments of DNA in a multimeric state, leaving a reaction compartment surrounded by a permselective membrane.

Although the embodiments of the present invention have been described above with reference to the accompanying drawings, the present invention is not limited to the above-described specific embodiments and application fields, and the above-described specific embodiments are merely illustrative, and not restrictive. Those skilled in the art, having the benefit of this disclosure, may effect numerous forms of the invention without departing from the scope of the invention as claimed.

Claims

1. An RNA sample processing system based on topological capture, comprising:

2. The topology capture-based RNA sample processing system of claim 1, wherein,

the reaction compartment also contains an osmotic pressure regulator inside;

preferably, the osmolality adjusting agent is dextran.

3. The topology capture-based RNA sample processing system of any one of claims 1-2, wherein,

4. The topology capture-based RNA sample processing system of claim 3, wherein,

5. The topology capture-based RNA sample processing system of any one of claims 1 to 4, wherein,

the second capture reagent is a complex of DNA transposase and DNA;

6. The topologically captured based RNA sample processing system of any one of claims 1-5, wherein,

7. A method of manufacturing a topology capture based RNA sample processing system according to any one of claims 1 to 6, comprising the steps of:

the RNA capture reagent is added in the first phase or the second phase;

9. A method of preparing a second generation sequencing (NGS) library using the topologically captured based RNA sample processing system of any one of claims 1 to 6, the method comprising:

an RNA sample is formed by integrating the RNA to be analyzed and the RNA capture reagent according to any one of claims 1 to 6, or forming a complex by interaction between the RNA to be analyzed and the RNA capture reagent, or forming nucleic acid contents of deoxyribonucleic acid (DNA) and/or ribonucleic acid (RNA) formed by the conversion of the RNA to be analyzed and the RNA capture reagent through biological or chemical reaction,

wherein (a) - (d) are carried out in a reaction compartment as referred to in any one of claims 1-6.