CN117247948A - CmD53 gene and cloning, expression and application of mutant thereof - Google Patents

CmD53 gene and cloning, expression and application of mutant thereof Download PDF

Info

Publication number
CN117247948A
CN117247948A CN202311111276.2A CN202311111276A CN117247948A CN 117247948 A CN117247948 A CN 117247948A CN 202311111276 A CN202311111276 A CN 202311111276A CN 117247948 A CN117247948 A CN 117247948A
Authority
CN
China
Prior art keywords
cmd53
gene
chrysanthemum
mutant
cmd53m
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311111276.2A
Other languages
Chinese (zh)
Inventor
陈素梅
张一�
李菲
邢莹莹
王新慧
蒋甲福
王利凯
陈发棣
廖园
何玉华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202311111276.2A priority Critical patent/CN117247948A/en
Publication of CN117247948A publication Critical patent/CN117247948A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses cloning, expression and application of CmD53 gene and mutant thereof, wherein the cDNA sequence of CmD53 gene is shown as SEQ ID No:1 is shown in the specification; the cDNA sequence of the CmD53 gene mutant (CmD 53 m) is shown in SEQ ID No: 2. Cloning CmD53 gene and its mutant, and recombining to construct pORE-R4-CmD53 and pORE-R4-CmD53m plant expression vector, and using the expression vector to overexpress CmD53 protein or degradation-resistant CmD53 isoprotein in chrysanthemum cell to regulate chrysanthemum flowering phase. The invention clones chrysanthemum CmD53 gene and constructs CmD53 and CmD53m plant expression vector, adopts agrobacterium-mediated method to introduce the gene into plants, explores the influence of the gene on chrysanthemum flowering phase and new strategy, and provides excellent gene reserve for chrysanthemum flowering phase improvement engineering breeding.

Description

CmD53 gene and cloning, expression and application of mutant thereof
Technical Field
The invention relates to a target gene and a method for regulating and controlling chrysanthemum flowering phase, in particular to an expression vector, a construction method and application of CmD53 gene and a mutant thereof.
Background
The flowering phase regulation of chrysanthemum (Chrysanthemum morifolium) is a key for realizing annual supply of the market. In the chrysanthemum production, the flowering phase regulation is mainly carried out through light temperature regulation, and the defects of high production cost, difficult quality guarantee and the like exist.
The CmD53 gene is derived from the signal path gene of the chrysanthemum 'supernatural horse' strigolactone, is an inhibitor specifically responding to Strigolactone (SL) signals, and the CmD53 protein is dependent on SL-induced degradation. Based on early discovery of exogenous SL analog rac-GR24 (GR 24) treatment to advance chrysanthemum flowering phase, and SL synthesis inhibitor (TIS 108) treatment to delay chrysanthemum flowering, applicants tried to explore the influence of the SL-related CmD53 gene on chrysanthemum flowering phase and a new flowering phase regulation strategy, and provide excellent gene reserve for chrysanthemum flowering phase improvement engineering breeding. However, the research on the CmD53 gene for regulating the flowering time of chrysanthemum has not been reported at present.
Disclosure of Invention
The invention aims to: the invention aims to provide a CmD53 gene and a mutant thereof, which solve the problem of acquiring a brand-new target for regulating and controlling the flowering phase of chrysanthemum. Another object of the present invention is to propose a cloning method of CmD53 gene and its mutant, which solves the problem of how to obtain CmD53 gene and its mutant gene. The third object of the present invention is to provide a plant expression vector of CmD53 gene and its mutant, which solves the problem of how to overexpress CmD53 gene and its mutant in chrysanthemum cells; the fourth object of the invention is to provide a method for delaying chrysanthemum flowering phase, which solves the problem of how to target CmD53 protein to regulate chrysanthemum flowering phase.
The technical scheme is as follows: the cDNA sequence of the CmD53 gene is shown as SEQ ID No:1. The cDNA sequence of the CmD53 gene mutant CmD53m is shown as SEQ ID No: 2.
In a second aspect, the invention provides a cloning method of the CmD53 gene, which specifically comprises the steps of taking cDNA of chrysanthemum as a template, and carrying out PCR reaction by adopting CmD53 gene cloning primers to obtain CmD53 gene fragments; the CmD53 gene cloning primers are as follows:
CmD53-F：ATGCCGACGCCGGTAAGCACAGC；
CmD53-R：TCAACCAACTATGATTCTTGAAGG。
in some embodiments, the cDNA of chrysanthemum 'superhorse' material is used as template, and the open reading frame specific primers CmD53-F and CmD53-R are designed according to the CmD53 gene sequence information, and PCR reaction is carried out, and the product and pMD are obtained 19 Ligation of the T vector gives a pMD comprising the CmD53 gene sequence 19 -T-CmD53 plasmid. pMD (pMD) 19 Transforming DH5 alpha competent cells by the T-CmD53 plasmid, and cloning to obtain a gene with a sequence of SEQ ID No:1, chrysanthemum CmD53 gene.
The invention also provides a cloning method of the CmD53 gene mutant CmD53m, which specifically uses a recombinant vector containing a CmD53 gene sequence as a template, and carries out gene site-directed mutagenesis by using overlap extension PCR to obtain a CmD53 gene mutant fragment.
Preferably, the method of overlap extension PCR is as follows:
(1) To contain the pMD of CmD53 gene sequence 19 The T-CmD53 plasmid is used as a template, and a primer pair I and a primer pair II are adopted to carry out PCR reaction respectively to obtain a target fragment A and a target fragment B;
the primer pair one is as follows:
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC；
CmD53m-SOE-R：AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC；
the primer pair II is as follows:
CmD53m-SOE-F：TCTGATCCATCATTTATCACGAATTATATTGCTGAGG；
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG；
(2) Taking the target fragment A and the target fragment B as a common template, and adopting a primer pair III to carry out PCR reaction to obtain a CmD53 gene mutant fragment containing a carrier homologous sequence, namely a CmD53m fragment;
the primer pair III is as follows:
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC；
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG。
in a third aspect, the present invention provides a plant expression vector pORE-R4-CmD53 comprising the CmD53 gene described above and a plant expression vector pORE-R4-CmD53m comprising the CmD53 gene mutant CmD53m described above. The cloning amplification product CmD53 gene fragment or mutant CmD53m fragment is respectively recombined with a pORE-R4 vector plasmid which is cut by BamH I and EcoR I in a homologous manner, and a plant expression vector pORE-R4-CmD53 or pORE-R4-CmD53m is constructed.
In a fourth aspect, the present invention provides a method for delaying the flowering phase of chrysanthemum comprising increasing the CmD53 protein or CmD53 isoform CmD53m content in a chrysanthemum cell; the CmD53 isoprotein CmD53m is resistant to degradation of chrysanthemums strigolactone and has the same biological function as the CmD53 protein.
Preferably, the method for increasing the content of CmD53 protein in chrysanthemum cells comprises the following steps: and transfecting the plant expression vector containing the CmD53 gene into chrysanthemum cells, and over-expressing the CmD53 protein in the chrysanthemum cells.
Preferably, the method for increasing the CmD53m content of the CmD53 isoprotein in chrysanthemum cells comprises the following steps: transfecting the plant expression vector containing the CmD53 gene mutant CmD53m into a chrysanthemum cell, and overexpressing CmD53 mutant CmD53m protein in the chrysanthemum cell, wherein the CmD53 mutant CmD53m protein lacks 699-702 RGKT amino acid sequences compared with the CmD53 protein.
In some embodiments, the transfection method is preferably an agrobacterium-mediated method, specifically comprising transforming EHA105 agrobacterium competent cells with plant expression vectors, port-R4-CmD 53 and port-R4-CmD 53m, respectively, transforming chrysanthemum 'superbus' by agrobacterium-mediated leaf disc infection, and screening for kanamycin resistance to obtain positive transformed plants. In order to identify positive transformed plants, the applicant also carried out PCR detection verification, qRT-PCR detection verification and Western blot detection verification on CmD53 and CmD53m, and the results show that both CmD53 and CmD53m are successfully over-expressed in chrysanthemum cells.
The beneficial effects are that: compared with the prior art, the invention has the following remarkable advantages: according to the invention, the SL signal path inhibitor CmD53 and the CmD53m gene fragment resistant to SL degradation are introduced into the chrysanthemum plant, the flowering time of the CmD53 and CmD53m over-expression transgenic plant is obviously later than that of a wild control group plant, the transgenic chrysanthemum with obviously delayed flowering is obtained, the defect that the chrysanthemum is delayed to bloom by light supplementing in production is overcome, the production cost is reduced, and the ornamental quality of the chrysanthemum is improved.
Drawings
FIG. 1 agarose gel electrophoresis of chrysanthemum CmD53 gene clone;
FIG. 2 shows the schematic structures of plant expression vectors pORE-R4-CmD53 and pORE-R4-CmD53m; wherein, the A diagram is pORE-R4-CmD53, and the B diagram is pORE-R4-CmD53m;
FIG. 3 is a diagram of the results of PCR detection verification of positive transformed plants; wherein, A is PCR amplification identification of pORE-R4-CmD53 over-expression strain (CmD 53-OE) at DNA level; panel B shows PCR amplification identification of pORE-R4-CmD53m overexpressing strain (CmD 53 m-OE) at the DNA level;
FIG. 4 is a graph of qRT-PCR detection and verification results of positive transformed plants;
FIG. 5 is a statistical plot of flowering phenotype and bud appearance for Wild Type (WT), cmD53-OE and CmD53m-OE plants;
FIG. 6 is a Western blot detection and verification result diagram of positive transformed plants;
FIG. 7 is a statistical plot of flowering phenotype and bud appearance of Wild Type (WT), cmD53-OE and CmD53m-OE plants under GR24 and TIS108 treatment.
Detailed Description
The technical scheme of the invention is further described below with reference to the accompanying drawings.
Example 1: cloning of chrysanthemum CmD53 Gene
Taking chrysanthemum leaf of Shenma as material, taking 0.2g leaf, extracting total RNA of leaf by referring to the operation method of RNA extraction kit (Hua Viea) instruction book, using oligo (dT) 18 The primer and reverse transcriptase M-MLV (RNase H-) reagent (TaKaRa) synthesize cDNA according to the manufacturer's instructions, and according to the sequence information of CmD53 gene in chrysanthemum library, designing specific primer to amplify CmD53;
the upstream primer CmD53-F: ATGCCGACGCCGGTAAGCACAGC (SEQ ID No: 3);
downstream primer CmD53-R: TCAACCAACTATGATTCTTGAAGG (SEQ ID No: 4).
PCR was performed using the reverse transcribed leaf cDNA as a template, and a reaction system of 50. Mu.L: 5X Phusion HF buffer 10.0.0. Mu.L, 2.5. Mu.L (10. Mu.M) each of CmD53-F (10. Mu.M), cmD53-R (10. Mu.M) primers, 4.0. Mu.L of dNTP (2.5 mM), phusion DNA Polymerase 0.5.0.5. Mu.L, 1. Mu.L of cDNA template, ddH 2 O29.5 μl; the reaction procedure: pre-denaturation at 98 ℃ for 30sec;98℃10sec,58℃30sec,72℃60sec,35 cycles; extending at 72℃for 10min. As shown in FIG. 1, the agarose gel electrophoresis result shows that the fragment size is 2,961bp, the PCR product is recovered according to the specification of the gel recovery kit (AXYGEN, USA), and the PCR product is ligated to pMD using the quick ligase Solution I (TaKaRa) 19 -T vector (TaKaRa), the ligation system is: solution I5. Mu.L, pMD 19 T1. Mu.L, 4. Mu.L of PCR product, DH 5. Alpha. Competent cells were transformed by overnight ligation at 16℃and sequenced as SEQ ID No:1.
example 2: construction of plant expression vectors pORE-R4-CmD53 and pORE-R4-CmD53m
(a) Construction of plant expression vector pORE-R4-CmD53
The structure diagram of the plant expression vector pORE-R4-CmD53 is shown in FIG. 2A, bamH I and EcoR I restriction sites are respectively introduced into the upstream and downstream according to the CmD53 gene sequence, and primers CmD53-R4-F and CmD53-R4-R are designed:
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC(SEQ ID No：5)；
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG(SEQ ID No：6)。
to contain the pMD of CmD53 gene sequence 19 -T-CmD53 plasmid as template, PCR reaction, 50. Mu.L reaction system: 5X Phusion HF buffer 10.0.0. Mu.L, 2.5. Mu.L (10. Mu.M) each of the CmD53-R4-F (10. Mu.M), cmD53-R4-R (10. Mu.M) primers, dNTP (2.5 mM) 4.0. Mu.L, phusion DNA Polymerase 0.5.5. Mu.L, pMD 19 1 μl of the T-CmD53 plasmid template, ddH 2 O29.5 μl; the reaction procedure: pre-denaturation at 98 ℃ for 30sec;98℃10sec,58℃30sec,72℃60sec,35 cycles; extending at 72℃for 10min. The PCR product was recovered according to the gel recovery kit, and the product and the pORE-R4 vector were digested with BamH I and EcoR I, respectively, in a 50. Mu.L digestion system of Plasmid/PCR DNA 2.0. Mu.g, bamH I, ecoR I2.5. Mu.L, 10X QuickCut Green Buffer 5.0.5.0. Mu.L, ddH, respectively 2 O up to 50.0. Mu.L, reaction procedure was 37℃for 3h. And (3) recovering an enzyme digestion product, and connecting the gene with a vector by utilizing a seamless cloning homologous recombinase to obtain a plant expression vector pORE-R4-CmD53.
(b) Construction of plant expression vector pORE-R4-CmD53m
The structural schematic diagram of the plant expression vector pORE-R4-CmD53m is shown in FIG. 2B, and the CmD53m protein lacks 4 amino acid Residues (RGKT) at 699-702, and the residues have the effect of resisting SL-induced degradation after mutation or deletion in D53 mutant of rice and in Arabidopsis thaliana SMXL6D (Jiang et al, 2013; zhou et al, 2013; wang et al, 2015). To contain the pMD of CmD53 gene sequence 19 The T-CmD53 plasmid is used as a template, overlap extension PCR (SOE PCR) is used for carrying out gene site-directed mutagenesis, two pairs of primers CmD53-R4-F and CmD53m-SOE-R, cmD m-SOE-F and CmD53-R4-R are designed for carrying out PCR reaction respectively to obtain two fragments A and B,
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC(SEQ IDNo：5)；
CmD53m-SOE-R：AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC(SEQ IDNo：7)
CmD53m-SOE-F：TCTGATCCATCATTTATCACGAATTATATTGCTGAGG(SEQ IDNo：8)
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG(SEQ ID No：6)。
50 μLPCR reaction system: 5X Phusion HF buffer 10.0.0. Mu.L, cmD53-R4-F (10. Mu.M) and CmD53M-SOE-R (10. Mu.M) primers [ or CmD53M-SOE-F (10. Mu.M) and CmD53-R4-R (10. Mu.M) each 2.5. Mu.L]，dNTP(2.5mM)4.0μL，Phusion DNA Polymerase 0.5μL，pMD 19 1 μl of the T-CmD53 plasmid template, ddH 2 O29.5 μl; the reaction procedure: pre-denaturation at 98 ℃ for 30sec;98 deg.c 10sec,58 deg.c 30sec,72 deg.c 45sec,25 cycles; extending at 72℃for 10min. And (3) recovering a PCR product A fragment (2,131 bp) and a PCR product B fragment (889 bp) according to a gel recovery kit, and carrying out PCR amplification by taking the A fragment and the B fragment as a common template and taking CmD53-R4-F and CmD53-R4-R as primers to obtain an A+B fragment, namely a CmD53m (2,990 bp) gene fragment containing a carrier homologous sequence. 50 μLPCR reaction system: 5X Phusion HF buffer 10.0.0. Mu.L, 2.5. Mu.L each of CmD53-R4-F (10. Mu.M) and CmD53-R4-R (10. Mu.M), 4.0. Mu.L of dNTP (2.5 mM), phusion DNA Polymerase 0.5.5. Mu.L, 1. Mu.L of A fragment template, 1. Mu.L of B fragment template, ddH 2 O28.5. Mu.L; the reaction procedure: pre-denaturation at 98 ℃ for 30sec;98 deg.C 10sec,58 deg.C 30sec,72 deg.C 60sec,30 cycles; extending at 72℃for 10min. Recovery of PCR product from gel recovery kit the product was digested with BamH I and EcoR I, respectively, with 50. Mu.L of Plasmid/PCR DNA 2.0. Mu.g, bamH I, ecoR I2.5. Mu.L, 10X QuickCut Green Buffer 5.0.0. Mu.L, ddH, respectively, with pORE-R4 vector 2 O up to 50.0. Mu.L, reaction procedure was 37℃for 3h. And (3) recovering an enzyme digestion product, and connecting the gene with a vector by utilizing a seamless cloning homologous recombinase to obtain a plant expression vector pORE-R4-CmD53m.
Example 3: agrobacterium-mediated transformation of CmD53 and CmD53m genes into chrysanthemum 'Shenma'
Extracting plasmid pORE-R4-CmD53 and plasmid pORE-R4-CmD53m, respectively transforming EHA105 Agrobacterium competent cells, selecting positive clone, activating in YEB liquid culture medium containing 50mg/L Kan and 50mg/L Rif, shaking overnight at 28deg.C, and culturing to OD 600 About 0.5; the cells were collected by centrifugation at 4000rpm for 10min at room temperature and the pellet was suspended in equal volumes in MS infection buffer for infection. Adopts chrysanthemum leaf disk of 'shenma' as transformation receptorCulturing for 3d in a preculture medium, immersing in the dyeing solution for 8-10 min, sucking the bacterial liquid on the surface of the leaf disc by filter paper, inoculating the bacterial liquid on a co-culture medium, culturing for 3d in a dark way, transferring to a selective culture medium for subculture for 4 generations, transferring to a rooting culture medium for culturing when the differentiated resistant buds grow to 2-3 cm, and obtaining the resistant plants initially.
Plant medium based on MS medium (1L): MS powder 4.74 g+sucrose 30 g+agar 6.6-7.0 g, pH=5.8;
pre/co-culture medium: ms+6-BA 1.0mg+NAA0.5 mg,pH =5.8;
selection medium 1: ms+6-BA 1.0mg+NAA0.1 mg+350mg Carb+12mg Kan,pH =5.8;
selection medium 2: ms+6-BA 1.0mg+NAA0.1 mg+350mg Carb+12mg Kan,pH =5.8;
selection medium 3: ms+6-BA 1.0mg+NAA0.1 mg+350mg Carb+10mg Kan,pH =5.8;
selection medium 4: ms+6-BA 1.0mg+NAA0.1 mg+350mg Carb+9mg Kan,pH =5.8;
rooting medium: ms+8mg kan, ph=5.8;
sterilizing at 116 deg.C for 30min, and adding antibiotic after cooling to below 60deg.C.
Example 4: molecular identification of CmD53 and CmD53m transgenic chrysanthemum
The resistant plants of the chrysanthemum 'superhorse' transformed by the CmD53 and CmD53m genes are subjected to PCR detection on DNA level, qRT-PCR detection on transcription level and Western blot detection on protein level.
(a) PCR detection
Extracting genome DNA of positive transformed plant leaves and wild plant leaves obtained by kanamycin resistance screening, designing PCR identification primers 35S-F and CmD53-R, and carrying out PCR amplification by taking the extracted DNA as a template, wherein an amplification system is as follows: 1.0. Mu.L of DNA template, 2.5. Mu.L of 10 XPCR Buffer, 2.0. Mu.L of dNTP, 0.2. Mu.L of rTaq, 1. Mu.L of primer each, and ddH 2 O up to 25.0. Mu.L. The amplification procedure was: pre-denaturation at 94℃for 5min;94 ℃ for 30sec,56 ℃ for 30sec,72 ℃ for 3min,35 cycles; extending at 72℃for 10min. The amplified product is detected by agarose gel electrophoresis and sequenced, and the length containing CmD53 is amplified3,255 bp (FIG. 3A), comprising a fragment of CmD53m of 3,247bp in length (FIG. 3B); the primer sequences are as follows:
upstream primer 35S-F: GACGCACAATCCCACTATCC (SEQ ID No: 9);
downstream primer CmD53-R: TCAACCAACTATGATTCTTGAAGG (SEQ ID No: 4).
In FIG. 3M DL5000 DNA marker.
(b) qRT-PCR detection
Extracting total RNA of leaves of positive transformed plants and wild plants, reversely transcribing into first-strand cDNA, diluting ten times, and carrying out qRT-PCR detection, wherein an amplification system is thatPremix Ex TaqTMII 10.0μL，Forward primer(10μM)1.0μL，Reverse primer(10μM)1.0μL，cDNA template 5.0μL，RNase Free dH 2 O3.0. Mu.L, amplification procedure was 95℃for 2min;95℃15sec,60℃15sec,72℃20sec,40 cycles; finally, a dissolution profile program was added. Repeating each sample for 3 times, analyzing according to the data to obtain CT values of each sample, and calculating the relative expression conditions of each transgenic plant and the wild type gene by taking the expression of the wild type plant as a reference value (figure 4);
the length of the amplified fragment of the specific primer is 226bp, and the primer sequence is as follows:
the upstream primer CmD53-qRT-F: ATTTGAGCCGTTTGACTTCG (SEQ ID No: 10);
downstream primer CmD53-qRT-R: ACCACCCTGCTTCTCCCTAG (SEQ ID No: 11).
Taking the gene fragment amplified by CmEF1 alpha as an internal reference, wherein the fragment length is 151bp, and the primer sequence is as follows:
the upstream primer CmEF1 alpha-F: TTTTGGTATCTGGTCCTGGAG (SEQ ID No: 12);
downstream primer CmEF1 α -R: CCATTCAAGCGACAGACTCA (SEQ ID No: 13).
In FIG. 4, the respective groups are the relative expression levels of the CmD53 gene for the Wild Type (WT), cmD53-OE transgenic lines (OE-1, OE-2, OE-3) and CmD53m-OE transgenic lines (mOE-1, mOE-2, mOE-3), respectively.
(c) Western blot detection
Wild-type, cmD53 overexpressing transgenic plants and CmD53M overexpressing transgenic plant tissue cultures grown on MS medium for 3 weeks were transferred to MS medium containing 50 μm MG132 for pretreatment for 2h, and then to MS medium containing 10 μm GR24, sampled at time points 0, 10, 30min of treatment. Grinding 0.2g plant tissue into powder in liquid nitrogen, adding 1ml Pierce TM The IP lysis buffer (containing 1 Xprotease inhibitor) was mixed with shaking, and after standing on ice for 20min, it was centrifuged at 13,000Xg for 10min, and the supernatant was pipetted into a new tube and protein quantification was performed using BCA protein concentration assay kit. Adding 5 XSDS-PAGE loading buffer to 30 μg protein sample to 1X, mixing well, boiling for 10min, performing SDS-PAGE gel electrophoresis (130V, 90 min), and performing gel electrophoresis on gold Rui eBlot TM L1 fast wet transfer (PVDF film) for 12min. Blocking the blocking solution at normal temperature for 15min, and washing the membrane with 1×PBS (containing 0.05% Tween-20) for 3 times each for 10min; primary antibodies were diluted 1:1000 with CmD53 antibody (Abmart) and Actin antibody (Invitrogen), respectively, incubated overnight at 4 ℃ and washed 3 times; the secondary antibodies were diluted 1:10000 with secondary antibody dilutions, respectively, and incubated at 4℃for 4h and developed with enhanced chemiluminescent reagents (Thermo Scientific, USA). Western blot results show (FIG. 6 CmD53 antibody detection of Wild Type (WT), cmD53-OE-1 and CmD53M-OE-1 plants at various time points under GR24 treatment CmD53 protein levels. Actin protein levels were used as loading controls) that CmD53 protein levels were rapidly decreased within 30min in GR24 treated WT plants; endogenous CmD53 protein and CmD53-GFP fusion protein in CmD53-OE-1 plants are also obviously degraded within 30 min; whereas endogenous CmD53 protein in CmD53m-OE-1 plants was also degraded, the CmD53m-GFP protein was stable in the presence of GR24, indicating that CmD53m is insensitive to GR 24-mediated degradation.
Example 5: flowering time statistical analysis of CmD53 and CmD53m overexpressing transgenic plants
Culturing the created CmD53 and CmD53m over-expressed transgenic chrysanthemum in a long sunlight culture room for one month, transplanting, topping chrysanthemum seedlings, collecting wild chrysanthemum cuttings and transgenic chrysanthemum cuttings for 2-3 weeks, cutting chrysanthemum cuttings in a culture medium containing 1:1:1 (v/v/v)In the substrate cave dish of soil, vermiculite and perlite, the temperature is 23+/-1 ℃ and the light intensity is 100 mu mol m -2 s -1 Cutting and rooting culture under a culture room with long sunlight (16 h/8 h dark), transplanting into a flowerpot with the diameter of 7cm, and culturing. Plants grown for 45d under long sunlight are transferred into short sunlight, the bud appearance of the plants is observed, and the bud appearance time of each plant is recorded. By observing the phenotype of CmD53 or CmD53m transgenic chrysanthemum, it was found that both CmD53-OE and CmD53m-OE plants showed delayed flowering compared to WT plants (panel a in fig. 5 is flowering phenotype of Wild Type (WT), cmD53-OE and CmD53m-OE plants. Panels are taken at the bud and flowering phase; red arrows indicate flower buds; scale = 2cm; panel B in fig. 5 is time statistic of flower bud appearance (n = 30) of Wild Type (WT), cmD53-OE and CmD53m-OE plants).
Wild-type and transgenic plants were further treated with exogenous strigolactone artificial analogues GR24 and artificial inhibitor TIS108 to observe the flowering phenotype. GR24 or TIS108 was formulated with Dimethylsulfoxide (DMSO) as a 100mM stock solution, which was diluted with clear water to a working concentration of 10. Mu.M at the time of use, and solvent DMSO was used as a control group (Mock). And (3) spraying the whole cutting seedling growing for 40d under long sunlight for 1 time every other day under the long sunlight condition, switching to short sunlight (8 h/16 h) after spraying for 3 times, and continuously spraying for 1 time every other day for 3 times, wherein the total spraying is 6 times. Spraying until the water drops naturally drop, and keeping the humidity of the leaves after spraying. Culturing and observing the bud emergence condition of the plants under short sunlight, and recording the bud emergence time of each plant. The days in advance of CmD53m-OE flowering phase after GR24 treatment was less than that of CmD53-OE after GR24 treatment (FIG. 7, panel A shows the flowering phenotype of wild-type (WT), cmD53-OE and CmD53m-OE plants with GR24 and TIS 108. Mock: solvent control; GR: GR24; TIS: TIS108; scale = 2cm; FIG. 7, panel B shows the bud time statistics (n = 12) of wild-type (WT), cmD53-OE and CmD53m-OE plants with GR24 and TIS 108. CmD53m over-expression delayed flowering is more stable and efficient since CmD53m is no longer susceptible to GR 24-mediated degradation.

Claims (10)

1. A CmD53 gene, wherein the cDNA sequence is as set forth in SEQ ID No:1.
2. A method for cloning the CmD53 gene according to claim 1, wherein: taking cDNA of chrysanthemum as a template, and adopting CmD53 gene cloning primers to carry out PCR reaction to obtain CmD53 gene fragments; the CmD53 gene cloning primers are as follows:
CmD53-F：ATGCCGACGCCGGTAAGCACAGC；
CmD53-R：TCAACCAACTATGATTCTTGAAGG。
3. a plant expression vector comprising the CmD53 gene of claim 1.
4. A CmD53 gene mutant, which is characterized in that the cDNA sequence is as shown in SEQ ID No: 2.
5. A method for cloning a mutant CmD53 gene according to claim 4, wherein: the CmD53 gene mutant fragment is obtained by carrying out gene site-directed mutagenesis by using a recombinant vector containing a CmD53 gene sequence as a template and utilizing overlap extension PCR.
6. The method for cloning the CmD53 gene mutant according to claim 5, wherein the overlap extension PCR method comprises:
(1) To contain the pMD of CmD53 gene sequence 19 The T-CmD53 plasmid is used as a template, and a primer pair I and a primer pair II are adopted to carry out PCR reaction respectively to obtain a target fragment A and a target fragment B;
the primer pair one is as follows:
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC；
CmD53m-SOE-R：AATATAATTCGTGATAAATGATGGATCAGAAAGGTTC；
the primer pair II is as follows:
CmD53m-SOE-F：TCTGATCCATCATTTATCACGAATTATATTGCTGAGG；
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG；
(2) Taking the target fragment A and the target fragment B as a common template, and adopting a primer pair III to carry out PCR reaction to obtain a CmD53 gene mutant fragment containing a carrier homologous sequence;
the primer pair III is as follows:
CmD53-R4-F：tttctagaaggccttggatccaATGCCGACGCCGGTAAGCACAGC；
CmD53-R4-R：ggccgcaaagtcgacgaattctACCAACTATGATTCTTGAAGG。
7. a plant expression vector comprising the CmD53 gene mutant according to claim 4.
8. A method of delaying the flowering phase of chrysanthemum comprising increasing the expression level of CmD53 protein and/or CmD53 isoprotein in a chrysanthemum cell; the CmD53 isoprotein is resistant to degradation of chrysanthemums strigolactone and has the same biological function as the CmD53 protein.
9. The method for delaying chrysanthemum flowering phase according to claim 8, wherein the method for increasing the expression level of CmD53 protein in chrysanthemum cells comprises the steps of: transfecting the expression vector of claim 3 into a chrysanthemum cell, and overexpressing the CmD53 protein in the chrysanthemum cell.
10. The method for delaying chrysanthemum flowering phase according to claim 8, wherein the method for increasing the expression level of the CmD53 isoprotein in the chrysanthemum cells comprises the following steps: transfecting the expression vector of claim 7 into a chrysanthemum cell, and overexpressing a CmD53 mutant protein in the chrysanthemum cell, wherein the CmD53 mutant protein lacks the 699 th to 702 th RGKT amino acid sequence compared with the CmD53 protein.
CN202311111276.2A 2023-08-31 2023-08-31 CmD53 gene and cloning, expression and application of mutant thereof Pending CN117247948A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311111276.2A CN117247948A (en) 2023-08-31 2023-08-31 CmD53 gene and cloning, expression and application of mutant thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311111276.2A CN117247948A (en) 2023-08-31 2023-08-31 CmD53 gene and cloning, expression and application of mutant thereof

Publications (1)

Publication Number Publication Date
CN117247948A true CN117247948A (en) 2023-12-19

Family

ID=89132209

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311111276.2A Pending CN117247948A (en) 2023-08-31 2023-08-31 CmD53 gene and cloning, expression and application of mutant thereof

Country Status (1)

Country Link
CN (1) CN117247948A (en)

Similar Documents

Publication Publication Date Title
Wan et al. Activation tagging, an efficient tool for functional analysis of the rice genome
CN111778265B (en) Mutant gene, mutant, expression vector and application of zearalenone oxidase
JP2000516806A (en) Shoot meristem-specific promoter sequence
CN113024644A (en) Application of ZmICE1 protein and coding gene thereof in regulation and control of low-temperature stress tolerance of corn
CN112501182A (en) Poplar ERF transcription factor gene and application thereof
CN112779234A (en) Phyllostachys pubescens PeAPX5 gene and application thereof
Ranjan et al. Suppression subtractive hybridization-mediated transcriptome analysis from multiple tissues of aspen (Populus tremuloides) altered in phenylpropanoid metabolism
CN111153975A (en) Plant drought-resistant related protein TaNAC15, and coding gene and application thereof
CN114717241B (en) Rice salt tolerance related gene OsMSRFP, encoding protein and application thereof
CN117247948A (en) CmD53 gene and cloning, expression and application of mutant thereof
CN115851761A (en) Tobacco expansin gene NtEXLA2 and application thereof
CN113913439A (en) Application and method of rice gene OsAL11
CN104694549B (en) The protein of control gene OsHK1 and coding occurs for Rice lateral root
Liu et al. A SHR-IDD-PIN regulatory network mediates minor vein differentiation in rice
CN117143885A (en) CmD14.1 gene and cloning, expression and application of silencing sequence thereof
CN116334093B (en) Application of arabidopsis AtFLZ13 gene in regulation of flowering time of plants
CN114891802B (en) Application of OsDUF6 gene and encoding protein thereof in rice salt tolerance breeding
CN113005106B (en) Application of corn low temperature resistant gene ZmCIPK10.1 in improving plant cold resistance
CN113416747B (en) Method for creating temperature-sensitive male sterile plant
WO2004092380A1 (en) Ubiquitin fused gene promoter and utilization thereof
CN113549602B (en) Phyllostachys pubescens ascorbic acid peroxidase gene PeAPX1 and application thereof
CN110256543B (en) PwNAC1 gene and application of encoding protein thereof in plant stress resistance
CN117925637A (en) Brassinosteroid signal pathway transcription factor for regulating formation of poplar wood and application thereof
CN112321691A (en) Application of OsGF14f protein in regulation and control of cold resistance of rice
Han et al. MdMADS2-transgenic chrysanthemum (Dendranthema grandiflorum (Ramat.) Kitamura) showing the reduction of the days to flowering

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination