CN117230169B

CN117230169B - Adaptor for sequencing long fragment telomere sequence, pre-library and construction method thereof

Info

Publication number: CN117230169B
Application number: CN202311498478.7A
Authority: CN
Inventors: 纪鑫; 倪守峰; 王伟伟; 田埂
Original assignee: Geneis Beijing Co ltd
Current assignee: Geneis Beijing Co ltd
Priority date: 2023-11-13
Filing date: 2023-11-13
Publication date: 2024-02-13
Anticipated expiration: 2043-11-13
Also published as: CN117230169A

Abstract

The invention discloses a linker, a pre-library and a construction method thereof for sequencing long fragment telomere sequences. The invention designs a telomere specific temperature control anchor joint, which can distinguish and enrich the terminal of a complete telomere and avoid the non-complete terminal from being built into a warehouse when the joint is added for the telomere. Meanwhile, the universal joint design can also prevent amplification of various incomplete telomere fragments formed by enzyme digestion and genome background fragments to a great extent. Therefore, the complete telomere terminal sequence is enriched efficiently, so that the sequence determination is effectively carried out, the distribution state of the telomere length of each chromosome is displayed more truly and accurately, and more accurate association analysis and interpretation are realized.

Description

Adaptor for sequencing long fragment telomere sequence, pre-library and construction method thereof

Technical Field

The present invention relates to gene sequencing, in particular to a linker, a pre-library and a method of constructing the same for sequencing complete or long fragment telomere sequences.

Background

Telomeres are complexes consisting of telomere DNA repeats and related proteins located at the ends of eukaryotic linear chromosomes. Each division of the cell results in shortening of telomeres due to the DNA replication mechanism of the linear chromosome. Telomere changes are closely associated with a variety of diseases, such as cancer, early-aging syndrome, and the like. Thus, detection of telomeres as accurately as possible may provide important information related to disease.

Because the telomere sequence is longer and contains a large number of simple repeated sequences of 6 bases, the repeated units of the human telomere sequence are TTAGGG (forward strand)/CCCTAA (reverse strand), the total length is about 2kb-20kb, and the sequence cannot be determined by using second generation sequencing (NGS, representing platform Illumina and MGI), and only fragments with the length of more than 5kb can be determined by using a method for sequencing long fragments (such as a nanopore sequencing technology).

The conventional database construction method in the sequencing still has the problem that the whole telomere terminal and the genome breakage terminal cannot be distinguished, a large number of breakage terminals can be caused in the extraction process of the genome, a certain amount of incomplete telomere terminals are also present, the number of the incomplete telomere terminals is far more than that of the whole telomere terminals, the conventional telomere database construction method cannot effectively distinguish the complete or long-fragment telomere sequences, the long-fragment telomere sequences have extremely low proportion, the preference of short fragments is serious, the effective data proportion of libraries is low, the sequencing data amount is extremely wasted, the nanopore sequencing is extremely easy to fail, the accurate telomere sequences and the real length distribution state are difficult to detect, and the subsequent analysis and interpretation are seriously affected.

In addition, because of the limitation of the chip hole number of the third-generation sequencing equal-length fragment sequencing platform, the telomere sequence is difficult to be detected by directly establishing a library by the conventional library establishment method, and is difficult to be made up by increasing the data volume, so that the sequence is usually amplified by using the designed telomere specific primer and the other primer on the library connector on the basis of the library with the connector during sequencing, and the telomere sequence is enriched, but because the number of break points generated during extraction is more, a large number of incomplete telomere ends are also generated, the enrichment efficiency is lower, the measured telomere sequence is very few, and the telomere sequence determination cannot be effectively performed. In addition, there are a plurality of chromosome terminal sequences which are not determined, and there are also chromosome terminal sequences which cannot find an ideal primer sequence, so that the method has a limitation that only a part of chromosome terminal sequences can be determined, and the proportion thereof is abnormal.

There is still a need for a linker, pre-library and construction method for sequencing whole or long fragment telomere sequences.

Disclosure of Invention

Aiming at least part of the technical problems in the prior art, the inventor designs a series of telomere specific joints, and can distinguish and enrich the ends of complete telomeres and avoid the non-complete ends from being built into a library when the joints are added to the telomeres. Meanwhile, the invention also designs a universal joint, which greatly prevents the amplification of various incomplete telomere fragments and genome background fragments formed by enzyme digestion. Specifically, the present invention includes the following.

In a first aspect of the invention, there is provided a telomere-specific temperature controlled anchor adaptor comprising a primer binding region, a single base repeat region and a telomere-specific anchor region capable of specifically binding to at least part of the 3' end cantilever of the telomere.

In certain embodiments, a telomere specific temperature controlled anchor linker according to the invention, wherein the Tm value (also sometimes referred to herein as T1) of both the single base repeat region and the telomere specific anchor region is at least 5 ℃ greater than the Tm value (also sometimes referred to herein as T2) of the single base repeat region.

In certain embodiments, the telomere specific temperature controlled anchor linker according to the invention, wherein the telomere specific anchor region is 4-10nt, preferably 6nt in length.

In certain embodiments, the telomere specific temperature controlled anchor linker according to the invention, wherein the sequence of the telomere specific anchor region is capable of specifically binding to the sequence of TTAGGG as a repeat unit.

In certain embodiments, the telomere specific temperature controlled anchor linker according to the invention, wherein the sequence of the telomere specific anchor region is selected from at least one of CCCTAA, ACCCTA, AACCCT, CCTAAC, TAACCC and CTAACC.

In certain embodiments, a telomere specific temperature controlled anchor linker according to the invention, wherein the Tm value of the single base repeat region (i.e., T2) is 37 ℃ or less.

In certain embodiments, a telomere specific temperature controlled anchor linker according to the invention, wherein the single base repeat region is 5-20nt in length.

In certain embodiments, the telomere specific temperature controlled anchor adaptor according to the invention, wherein the Tm (i.e., T3) value of the primer sequence corresponding to the primer binding region is between 55 ℃ and 70 ℃.

In certain embodiments, the telomere specific temperature controlled anchor adaptor according to the invention, wherein the primer is a nested PCR primer.

In certain embodiments, the telomere specific temperature controlled anchor adaptor according to the invention, wherein the primer binding region comprises a binding region of at least 1 primer.

In a second aspect of the invention, there is provided a pre-library construction reagent or kit for gene sequencing comprising the telomere specific temperature controlled anchor adaptor of the first aspect.

In certain embodiments, the pre-library construction reagents or kits for gene sequencing according to the present invention further comprise a universal linker, wherein the universal linker has a phosphorylation modification at the 5 'end, and the 3' end contains a blocking group.

In certain embodiments, the pre-library construction reagents or kits for gene sequencing according to the present invention, wherein the blocking groups include, but are not limited to, dideoxynucleosides, amino groups, phosphorylating groups, and C3/C6/C12 Spacer.

In certain embodiments, the pre-library construction reagents or kits for gene sequencing according to the present invention, wherein the universal adaptor comprises a primer binding region.

In a third aspect of the invention, there is provided a pre-library construction method for sequencing a human whole telomere terminal sequence comprising the steps of:

(1) Preparing a sample fragment with a single base repetitive sequence added at the tail end;

(2) Mixing the sample fragment with a telomere specific temperature controlled anchor linker of the invention, pre-denaturing at a first temperature, and then hybridizing at a second temperature, wherein the terminally appended single base repeat sequence is complementary to the sequence of the single base repeat region;

(3) Extending the 3' -end of the linker to fill in the gap by using polymerase at a third temperature, removing the part of the terminal single base repetitive sequence which is not complementary with the linker, and connecting the 3' -end of the extended linker with the 5' -end of the reverse strand of the telomere double-stranded part by using ligase, thereby completing the addition of the linker;

wherein the first temperature is higher than T1, and the second temperature is higher than a third temperature and is T1 or less.

In certain embodiments, the pre-library construction method for sequencing human whole telomere terminal sequences according to the invention, wherein the first temperature is 50-90 ℃ and the second temperature is 37±5 ℃.

In certain embodiments, the pre-library construction method according to the present invention for sequencing human whole telomere terminal sequences, further comprises (4): a step of cleaving the fragment obtained in the step (3) with a restriction enzyme.

In certain embodiments, the pre-library construction method according to the present invention for sequencing human whole telomere terminal sequences, further comprises (5): a step of adding universal linkers at both ends of the fragments, wherein the universal linkers have a phosphorylation modification at the 5 'end, and the 3' end contains a blocking group; preferably, the universal adaptor comprises a primer binding region.

The temperature control anchor joint and the pre-library designed by the invention for sequencing the human complete telomere terminal sequence effectively enrich the complete telomere terminal sequence, can effectively perform sequence determination on the complete telomere terminal sequence, more truly and accurately show the distribution state of the telomere length of each chromosome, and realize more accurate association analysis and interpretation.

Drawings

FIG. 1 is a schematic diagram of the adaptor, pre-library and construction method of the present invention for sequencing whole or long fragment telomere sequences.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present invention, it is understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

Specific sequences of corresponding primers or probes are provided herein, along with sequence listings in computer-readable form according to relevant regulations. It should be noted that, the sequence in the sequence table in the computer readable form is only used as a reference, and in the case that the sequence in the specification is inconsistent with the sequence in the sequence table in the computer readable form, the content of the sequence in the specification is subject to.

In the following description of sequences, unless otherwise indicated, the direction of the sequences is 5'-3'.

Telomere specific temperature control anchor joint

The invention provides a telomere specific temperature control anchor joint which can be used for analyzing the base sequence of telomeres, particularly long fragment telomeres, particularly human complete telomere terminal sequences. In the present invention, specificity means that the linker can specifically anchor (or bind) to the end of the whole telomere, and temperature-controlled anchor means that the specific binding of the linker and the telomere is achieved by controlling the temperature during the reaction.

The telomere-specific temperature control anchor joint of the invention comprises a primer binding region, a single base repeat region and a telomere-specific anchor region, wherein the telomere-specific anchor region can be specifically combined with at least part of a telomere 3' -end cantilever. The terms "specifically bind," "anchored," "complementary," and "hybridize" are used interchangeably herein and refer to the ability to pair between two nucleotides. That is, if a nucleotide is capable of hydrogen bonding with a nucleotide of another nucleic acid at a given position of the nucleic acids, then the two nucleic acids are considered to be complementary to each other at that position. The complementarity between two single stranded nucleic acid molecules may be "partial" or complete.

"specific hybridization" according to the present invention refers to the binding of a nucleic acid to a target nucleotide sequence in the absence of substantial binding to other nucleotide sequences present in the hybridization mixture under defined stringent conditions. Those skilled in the art will appreciate that appropriate hybridization conditions allow for the presence of sequence mismatches. In particular embodiments, hybridization is performed under stringent hybridization conditions.

The three regions of the telomere-specific temperature controlled anchor linker of the invention each have suitable Tm values to distinguish and enrich for intact telomere ends when used in pre-library construction and to avoid non-intact ends from being pooled. Preferably, the Tm value of both the single base repeat region and the telomere specific anchor region (also sometimes referred to herein as T1) is at least 5 ℃ or more, still preferably 6 ℃ or more, still more preferably 7 ℃ or more, still more preferably 8 ℃ or more higher than the Tm value of the single base repeat region (also sometimes referred to herein as T2), for example, can be at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 ℃ or more higher.

In a preferred embodiment, T1 is above 37 ℃, preferably above 38 ℃, further preferably above 39 ℃, more preferably above 40 ℃, such as 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65 ℃ or above. T2 is 37℃or less, preferably 36℃or less, more preferably 35℃or less, and even more preferably 34℃or less, for example 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20℃or less.

In the present invention, the number of bases in the single-base repeat region is not particularly limited, and can be adjusted according to the number of bases added to the ends of the fragments at the time of the subsequent pre-library construction, and preferably the number of bases is the same as the number of bases added to the ends of the fragments at the time of the subsequent pre-library construction, so that complementary locking of bases by hydrogen bonds at the time of complementary pairing in the nucleic acid molecule is achieved. Thus, a single base repeat region may be a repeat of any one base selected from the group consisting of: adenine (a), guanine (G), thymine (T) and Cytosine (C). The number of bases is preferably 5 to 20nt, more preferably 5 to 18nt, still more preferably 6 to 15nt, still more preferably 8 to 13nt, for example 8, 9, 10, 11, 12, 13 base repeats.

The telomere specific anchoring zone of the telomere specific temperature control anchoring joint can be specifically combined with at least part of a telomere 3' end cantilever. As used herein, the term "cantilever" may sometimes be referred to as overhang, etc., which refers to a single-stranded nucleotide sequence that extends from the 3' -end of a telomere duplex to the outside. The intact telomere ends are typically present as single strands of 6-300 bases in length "3' overlapping", with the repeat units of the single stranded portion being identical to the double stranded portion of the telomere. While the present invention is only exemplary of a corresponding series of telomere specific anchor linkers designed with 6 base TTAGGG, one of skill in the art will be able to design other telomere specific anchor linkers in accordance with the teachings of the present invention.

In a preferred embodiment, the telomere specific anchor region of the invention is capable of specifically binding to a region of at least 3 bases, preferably 4 bases, still preferably 5 bases, more preferably 6 bases, for example 7, 8, 9, 10, 11, 12 or more bases of the 3' end cantilever of the telomere.

In a preferred embodiment, the telomere specific anchor region is 4-10nt in length, and is also preferably 5-8nt, e.g., 5, 6, 7, 8nt. In a specific embodiment, the sequence of the telomere specific anchor region is selected from at least one of CCCTAA, ACCCTA, AACCCT, CCTAAC, TAACCC and CTAACC.

In an exemplary embodiment, the telomere specific temperature controlled anchor linker of the invention comprises the nucleotide sequences shown in SEQ ID Nos. 1-6.

The primer binding region of the telomere-specific temperature controlled anchor linker of the invention contains a primer binding site. In a preferred embodiment, the primer binding region contains 1 primer binding site. In another preferred embodiment, the primer binding region contains 2 primer binding sites. The Tm value (also sometimes referred to as T3) of the primer corresponding to the primer binding region is between 55℃and 70℃and preferably between 55℃and 68℃and more preferably between 57℃and 65℃such as 57, 58, 59, 60, 61, 62, 63, 64, 65 ℃. Preferably, the binding site of the primer of the temperature control anchor linker of the present invention is a binding site of a nested primer, and when 2 binding sites of the nested primer are provided, background noise can be significantly removed compared to a single primer binding site, thereby further enriching the whole telomere sequence.

In a preferred embodiment, the nested primers corresponding to the primer binding region of the telomere-specific temperature controlled anchor adaptor comprise a first primer (outer primer) having the sequence shown in SEQ ID No.7 (GACTGGTCCATATGACTTGC) and a second primer (inner primer) having the sequence shown in SEQ ID No.8 (GCATATGGCATTCTGTCATCC).

The temperature controlled anchor adaptors of the present invention may be used for amplification and enrichment of nucleic acids in a sample to be tested, "amplification" comprising any method by which at least a portion of at least one target nucleic acid is replicated, typically in a template-dependent manner, including, but not limited to, techniques for linearly or exponentially amplifying nucleic acid sequences. Non-limiting methods for performing the amplification step include Ligase Chain Reaction (LCR), ligase Detection Reaction (LDR), polymerase Chain Reaction (PCR), primer extension, strand Displacement Amplification (SDA), multiple Displacement Amplification (MDA), nucleic acid strand-based amplification (NASBA), multiplex amplification, rolling Circle Amplification (RCA), and the like.

The term "sample" as used herein relates to a material or mixture of materials comprising one or more analytes of interest, typically but not necessarily in liquid form. The sample of the invention contains a nucleic acid sample, which may be a complex sample comprising a plurality of different molecules containing the sequence of interest, such a sample may have more than 10, 50, 100 or 200 different nucleic acid molecules.

Herein, a nucleic acid sample includes a DNA fragment, which may be derived from any source, such as genomic DNA, cDNA (from RNA), cfDNA, ctDNA, or an artificial DNA construct, or an artificially fragmented DNA fragment. Any sample containing DNA fragments (e.g., genomic DNA) may be employed herein, including but not limited to blood, tissue samples, or FFPE samples. Preferably, the genomic DNA fragment in the present invention is derived from human genomic DNA.

Pre-library construction reagent or kit for gene sequencing

The invention also provides a pre-library construction reagent or kit for gene sequencing, in particular to a pre-library construction reagent or kit for human telomere gene sequencing, which comprises the telomere specific temperature control anchor joint.

In a preferred embodiment, the kit of the invention further comprises universal adaptors designed to largely prevent amplification of the various non-intact telomere fragments formed by cleavage and genomic background fragments and thus further to efficiently enrich for intact telomere terminal sequences.

The universal linker of the present invention has a phosphorylation modification at the 5 'end and a blocking group at the 3' end, as the term is used herein, any suitable group that prevents extension in the presence of a polymerase using a sequence of the universal linker as a template. Examples of blocking groups include, but are not limited to, any of dideoxynucleosides, amino groups, phosphorylating groups, and C3/C6/C12 Spacer, wherein the dideoxynucleosides include ddC, ddA, ddT or ddG.

In a preferred embodiment, the nested primers corresponding to the primer binding region of the universal adaptor comprise a third primer (outer primer) having the sequence shown in SEQ ID No.9 (GTAATACGACACACTATAGGGC) and a fourth primer (inner primer) having the sequence shown in SEQ ID No.10 (ACTATAGGGCACGCGTGGT).

In a preferred embodiment, the universal linker of the invention comprises a first strand and a second strand complementary to a portion of the first strand, wherein the first strand has a nucleotide sequence as set forth in seq id no: GTAATACGACACACTATAGGGCACGCGTGGTTCGACGGCCCGGGCTGGTTAT (SEQ ID No. 11), the second strand has the nucleotide sequence shown below: TAACCAGCC, the 5 'end of which is modified by phosphorylation, and the 3' end of which contains modification of a blocking group.

In addition to the above components, the kits of the invention optionally include reagents for polymerase chain reaction or high throughput sequencing. Reagents for the polymerase chain reaction include any of those used in conventional PCR, such as a polymerase, a buffer, and the like. Reagents for high throughput sequencing include, but are not limited to, end repair reagents, purification reagents, and the like.

In addition to the components described above, the kits of the invention may also include precautions related to the regulatory manufacture, use, or marketing of the kit. In addition, the kits of the invention may also be provided with detailed instructions for use, storage and troubleshooting. The kit may also optionally be provided in a suitable device, preferably for robotic operation in a high throughput setting.

In certain embodiments, the components of the kits of the invention may be provided in solution, e.g., in aqueous solution. Where present in aqueous solution, the concentration or amount of these ingredients can be readily determined by one skilled in the art according to various needs. For example, for storage purposes, the concentration of the components may be present in a higher form, and the concentration may be reduced to the working concentration by, for example, diluting the higher concentration solution when in the working state or in use.

Where more than one component is present in a kit, the kit will also typically contain a second, third or other additional container in which additional components may be placed separately. In addition, combinations of various components may be included in the container. Any combination or reagent described herein may be a component in a kit.

Pre-library construction method

The invention further provides a pre-library construction method for sequencing the human whole telomere terminal sequence, comprising the step of using the telomere specific temperature controlled anchor adaptor of the invention, as described in detail below.

Step (1)

In step (1), a sample fragment with a single base repeat added at the end is first prepared. The sample fragment contains intact telomeres bearing 3 'overlapping ends and non-intact telomeres or other genomic fragments not containing 3' overlapping ends. Single bases may be selected as a tailing substrate as desired, and in a preferred embodiment, the invention selects dATP and tailing all fragment ends using terminal transferase TdT (multiple A bases). The reaction conditions are not particularly limited and may be adjusted according to actual needs. Preferably, the reaction temperature is from 30 to 45 ℃, preferably from 32 to 40 ℃, and still preferably 37 ℃. The reaction time is 5 to 60 minutes, preferably 10 to 30 minutes.

The step (2) of the invention is a step of connecting a telomere specific temperature control anchor joint. First, the first temperature is pre-denatured, and the pre-denatured temperature should not be too high or too low, which would result in the melting of the double-stranded portion, and too low, which would result in a decrease in the efficiency of subsequent hybridization. Preferably, the pre-denaturation temperature is 50-90 ℃, still preferably 50-60 ℃, such as 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 ℃.

In step (2) of the present invention, the single-stranded temperature-controlled anchor linker is hybridized and sufficiently bound to the 3' -end cantilever portion of the telomere with the polyA tail at a second temperature. In a preferred embodiment, the second temperature is not lower than the third temperature and is not higher than the Tm of the "single base repeat region and the telomere specific anchor region" for the design of the linker. Preferably, the second temperature is 37-42 ℃, most preferably 37 ℃. At this time, the single-chain temperature-controlled anchor linker can only bind to the whole telomere terminal, but other fragments and incomplete telomere terminals cannot bind to the whole telomere terminal, because the anchor base and the polyA part of the whole telomere terminal can be complementarily bound to the linker, the binding stability can be ensured, only the polyA part of other fragments can complementarily bind to the linker, under the control of hybridization and incubation temperature, the linker can be stably bound to the whole telomere terminal, the Tm value of the binding part of other fragments is lower than 30 ℃, and obviously lower than the reaction temperature, so that the binding efficiency of the background fragments and the linker can be reduced, and the aims of integrally reducing the background noise and further enriching the whole telomere sequence can be achieved.

In step (3) of the present invention, the 3' end extension of the linker is nicked up at a third temperature using a polymerase, preferably a T4 DNA polymerase, while excess polyA (the polyA moiety that is not complementary to the linker) is removed by its 3' -5' exonuclease activity. After completion, the extended linker was ligated to the 5' end of the inverted strand (Reverse strand) of the telomere double-stranded portion by T4 ligase, thereby completing the addition of the linker.

In the present invention, the third temperature is 30 to 45 ℃, preferably 32 to 40 ℃, such as 32, 33, 34, 35, 36, 37, 38, 39, 40 ℃.

The method of the present invention further comprises (4): a step of cleaving the fragment obtained in the step (3) with a restriction enzyme. The length of the obtained fragment is longer and can even exceed the read length range of the current main stream long fragment sequencing platform, so that the telomere sequence needs to be reserved, and other parts are broken into small fragments as much as possible. Preferably, the invention selects Hinf I and Rsa I double enzyme cutting the non-telomere part into small fragments, only the telomere sequence and other small sequences can be kept intact after double enzyme cutting, and the non-telomere sequence is cut into small fragments. In a preferred embodiment, the cleavage reaction temperature is from 30 to 45℃and preferably from 32 to 40℃such as 32, 33, 34, 35, 36, 37, 38, 39, 40 ℃.

The method of the present invention further comprises (5): the step of adding universal adaptors to both ends of the fragment, wherein specific sequences of the universal adaptors are described above. The step of filling the ends of the fragment obtained in the step (4) with a single A base is further included before adding universal adaptors to both ends of the fragment, and the ends can be filled with a terminal repair kit known in the art and suitable reaction conditions are used for achieving the above object, without being limited thereto.

The universal adaptor structure of the present invention has been described in detail hereinabove, and is formed by annealing and ligating two primers. Specifically, after the first strand and the second strand are synthesized, they are dissolved in an annealing buffer, mixed in equal proportions, and subjected to pre-denaturation at 80-99 ℃, preferably 85-95 ℃, still preferably 90-95 ℃, and then slowly cooled to 10-35 ℃, preferably 15-30 ℃, still preferably 20-25 ℃ within 0.5-1.5, preferably 1 hour, to finish annealing, and diluted to a working concentration with the buffer for standby.

When universal adaptors are ligated to both ends of other fragments to which no telomere-specific anchor adaptor is added, the resulting pre-library structure cannot be amplified during PCR amplification due to the absence of primer binding sites at both ends, and thus no PCR product is produced, so that fragments other than the intact telomeres generated by cleavage are not amplified by PCR at this time, including incomplete telomeres.

The inventors found that when using the universal adaptor according to the invention to ligate to both ends of the complete telomere structure to which the telomere specific anchor adaptor has been added, a telomere pre-library can be obtained by amplification (e.g.pcr amplification). When performing nested PCR, one-step PCR is performed first using the primers outside the telomere-specific anchor adaptor and the primers outside the universal adaptor. At this time, the primer outside the telomere-specific anchor adaptor is first extended in combination with the telomere-specific anchor adaptor to synthesize a reverse strand, the 3' of which will generate the binding site for the primer outside the universal adaptor, and PCR amplification is initiated.

And finally, taking the one-step PCR product as a template, and performing two-step PCR by using the inner primer of the telomere specific anchor joint and the inner primer of the universal joint to obtain a long fragment sequencing pre-library of the complete telomeres. Through the above steps, intact telomeres are amplified, and non-intact telomeres and other small fragments generated by cleavage cannot be amplified without the adaptor primer binding site, as shown in FIG. 1.

The pre-library of the present invention is suitable for sequencing on long fragment sequencing platforms, including but not limited to Nanopore from Oxford Nanopore Technologies (ONT), sequence II from Pacific Biosciences (PacBio), and the like. Those skilled in the art will appreciate that a high throughput sequencing process can be performed after addition of the sequencing adapter containing the index sequence, depending on the instructions of the corresponding kit of the sequencing platform.

It is noted that other steps or operations may be included before, after, or between steps (1) - (5) of the present invention, such as further optimizing and/or improving the methods described herein. For example, a step of further purifying the product after each step is completed.

Examples

The following shows the use of the engineered telomere-specific temperature controlled anchor junctions and universal junctions of the invention for human complete telomere end sequence sequencing.

1. Sample information

The sample used in this example is whole blood sample collected by EDTA anticoagulant tube, and is preserved at-4deg.C for a short period of time, and preserved at-20deg.C for a long period of time (other DNA of human being can be used in experiments, such as tissue, oral swab, various body fluids, as long as genomic DNA extracted from sample with good preservation condition can be used in the present invention).

2. Experimental procedure

1. DNA extraction

After mixing whole blood samples upside down, 200 μl to 1.5ml centrifuge tubes were aspirated and genomic DNA extraction was performed using Magbead Blood DNA Kit (CW 2361S) with reference to kit instructions steps. The extracted genome DNA is quantified by using Nanodrop 2000, qubit-cube DNA HS Assay Kit and a Qubit3.0 Fluorometer, wherein the Qubit concentration is 265ng/μl, and OD 260/280=1.827. Agarose gel electrophoresis was performed, and the genomic DNA fragment was distributed predominantly at 23kb or more.

2. Addition of polyA tail to 3' single-stranded end of telomere

The reaction system Mixture 1 was prepared in a new 0.2ml PCR tube, and the reagents were prepared on ice, see Table 1 below:

TABLE 1

Mix well and centrifuge, and react for 20 minutes at 37℃with a PCR instrument (hot lid 50 ℃). Immediately, 90 μl (1.8×) VHATS DNA Clean beads (N411-02) was used for purification, and 20 μl of nuclease-free water was redissolved to give product 1.

3. Adapter12T connector

The adapter 12T-Mixture (0.1 mu M) was obtained by mixing 6 primers in equal molar amounts and diluting (the sequences of the primers adapter 12T-1 to adapter 12T-6 are shown as SEQ ID No. 1-6).

The reaction system Mixture 2 was prepared in a new 0.2ml PCR tube, and the reagents were prepared on ice, see Table 2 below:

TABLE 2

The PCR instrument was allowed to react at 60℃for 10min, at 42℃for 10min, and at 37℃for 20min (hot cap 70 ℃). Then, 1 [ mu ] l T DNA Polymerase (5U/mu ] l) is added into the Mixture 2, and the Mixture is sucked, beaten and mixed uniformly.

The PCR instrument was reacted at 37℃for 10min (thermal cover off), and then the reaction tube was immediately transferred to ice.

Mixture 3 was prepared in advance, and the reagents were prepared on ice, as shown in Table 3 below:

TABLE 3 Table 3

When the reaction of the PCR apparatus at 37℃was completed and transferred to ice, the Mixture 3 was added to the tube, and the Mixture was homogenized by pipetting.

The PCR instrument was reacted at 16℃for 2 hours (thermal cover off). Purification was then carried out using 90 μl (1.8×) VHATS DNA Clean beads (N411-02), 43 μl of nuclease-free water redissolution to give product 2.

4. Enzyme digestion scheme

4.1 digestion by enzyme digestion

The reaction system Mixture 4 was prepared in a new 0.2ml PCR tube, and the reagents were prepared on ice, see Table 4 below.

TABLE 4 Table 4

The PCR instrument was allowed to react overnight at 37 ℃ (hot cap 50 ℃), then 90 μl (1.8×) VHATS DNA Clean beads was added for purification, and 50 μl of nuclease-free water was back-dissolved to give product 3.

4.2 telomere fragment enrichment

4.2.1 terminal repair and addition of dA

Using VAHTS Universal Pro DNA Library Prep Kit for Illumina-related reagents, reaction system Mixture 5 was prepared in a new 0.2ml PCR tube, as specified in Table 5 below.

TABLE 5

The PCR instrument was allowed to react at 30℃for 20min, at 65℃for 15min (thermal lid 105 ℃) and then purified using 117 μl (1.8×) VHATS DNA Clean beads, and 60 μl nuclease-free water reconstituted to give product 4.

4.2.2 ligation amplified adaptors

Using Hieff NGS Novel DNA Ligation Module for kit (next holt 12626ES 24), a reaction system Mixture 6 was prepared in a new 0.2ml PCR tube, as shown in Table 6 below.

TABLE 6

The PCR instrument was allowed to react at 20℃for 20min (thermal lid 105 ℃) and then purified by adding 80. Mu.l (0.8X) VHATS DNA Clean beads and 15. Mu.l of nuclease-free water back-dissolved to give product 5.

Adapter is a long and short strand adaptor, and is formed by annealing and connecting two primers, and the sequences of the primers are shown in the specification (adaptor-universal-L/S).

4.2.3 nested amplification of telomere fragments

First round PCR: using TaKaRa LA Taq with GC Buffer (TaKaRa, RR02 AG), a reaction system Mixture 7 was prepared in a new 0.2ml PCR tube, as shown in Table 7 below.

TABLE 7

PCR was performed according to the procedure of Table 8 below to give product 6.

TABLE 8

Second round PCR: using TaKaRa LA Taq with GC Buffer (TaKaRa, RR02 AG), a reaction system Mixture 8 was prepared in a new 0.2ml PCR tube, as shown in Table 9 below.

TABLE 9

The PCR reactions were performed following the procedure of table 10 below, followed by addition of 30 μl (0.6×) VHATS DNA Clean beads for purification and 30 μl nuclease-free water back-solubilization to give product 7.

Table 10

5. Telomere fragment screening

Product 7 was subjected to fragment screening ≡ 2Kb by agarose gel electrophoresis and recovered using Gel Extraction Kit (OMEGA, D2500-02) to give product 8.

6. Nanopore pre-library construction and on-machine sequencing

The fragment-screened enriched telomere fragment (product 8) was pre-library constructed using PCR Barcoding Kit (Nanopore, SQK-PBK 004) and sequenced on-machine. Wherein the PCR amplification reaction was performed using TaKaRa LA Taq with GC Buffer (TaKaRa, RR02 AG).

The following is an example of a telomere sequence obtained using the present method for sequencing:

CGAGTCTTGTTCCAGTTACCAGGTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGCGTTTAACCTA CTATAGGGCACGCGTGGTTCGATGGCCCGGGCTGGTTACGTAATACGACAATTATAGGGCAATGCGTGGTTCGGACGGTCTGGCTGGTTATTTATTAGGGTTAGGGTTAGTTAGGGTTAGGGTTAGTTAGGTTGTGGTTAGGTTAGGCTAGGTTAGGGTTAGGGTTAGGTTAGGTTAGGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTGTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGTTAGGGTTAGGGTTAGGTTAGAGTTAGAGTTAGGTTAGTTAGGGTTAGGGTTAGGTTAGGGTTAGGTTAGTCAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGTTAGGGTTAGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGTTAGGTTATACAGAAGAAGAAGAATAGGTTGAAGCCAGTTAGGTTAGCTAGGTTAGGGTTAGGGTTGTGTTTGAATAGGCTAGGTTAGGCTAGGCAGGGGTGAAATAGGCCAGGCCAGGCCAGGCCAGGCTCAGGCCAAGGCCAGGGTTGTGTGTGTCAGGGTTAGGGTTAGGGTTAGGTTGTGGCTAGGGTTGTGGGTTAGGTTAGGCTAGGGTTAGGCTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGTTAGGCTGGGTCAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGCGTTTTCTGTGCTGAAGCTAGGTTAGGTTAGGGGTTGTGGTTAGGCTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGTGGGTTGTGGTTGTGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTGGGGTTAGTGTTGGGGTTAGGTTAGTTAGGGTTAGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGCTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGTTAGTTGTGTTAGGGTTAGGGTTAGGTTGTAATAGTTAGAAGAAATAGGGTTAGCTAGGTTAGGCTAGGTTAGGGTTAGGGTTAGGGTTAGGTTGAAGAAATAGGTCAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGCTAGGCTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTAAGGGTTAGGGTTAGGGTTGGGGGTTAGGTTAGTTAGGCTAGGGTTAGGTTGTGTGGTTAGGGTTAGGGTTAGAAGCTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGTTAGGGTTAGGGTTGGGGTTGGGGTTAGGGTTGGGGTTAGGGTTGAATTGAGGGTGGGGTTGAATGGGGTTAGGGTGAGGGTGGAATTGAGTTAGGGTTAGGGTGAGTTAGGGTTAGGGTTGGGGTTAGGGTTGGAGTTAGAGTTGGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAATAGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGTTAGGGTTAGGGTTAGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGTGTTAGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGTTAAGAAAATAGAGTTAGAAGAAATAAAATAGGTTAGGGTTAGGGTTAGGGCTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGCTAGGCTAGGTTAGGTTGTGTCAGGCTAGGCTAGGCCAGGCCAGGTTGAAGAATAGGTTTAGGTTGTGTCAGGTTGTAAGGTTAGGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTGTGTGGGTTAGGGTTAGGGGTTAGGATTGGGGTTGGGGGTTAGGTTAGGGTTGGTGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGAAGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAAGGTTAGAAGAAGCTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGTTGAAGTTAGGGTTAGGTTAGTTAGGGTTAGGGTTAGGTTAGGTTAGTTAATAGTTAGGTTAGGGTTAGGGTTAGGG …… …… …… …… …… ……TTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGTTAGTTAGGTTGGGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGTGGTTAGGGTTAGGGTTGGGTTAGGTTAGGGTTAGGCTAGGTTAGGTTAGGCTAGGCTAGAAGAAGCCAGGCTGAAAATAAAATAGCTGAAGAAGCCACAGTTGTAATAGGTTACAGTTTAGGGTTAGGGTTAGGTTGGTGTCAGGGTTAGGCTGAAGAAGAAGCTAGGTTAGGGTTAGGGTTAGGTTGAAGAAGGGCAGGGTTAGGGTTAGGGTTGCTAGGTTGTAAGAAGTTAGCGTTGAAGCTAGGTTAGGTTAGTTAGTGGGTTAGTTAGGGTTAGGGTTAGGTTAGGTTGTGTGTTAGGGTTAGGGTTAAAGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGTTAGAGTTAGGGTTAGGGTTAGGTTAGTTGAAGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAGGGTTAGGGTTAGGCGGTTAGTTGAAGTTAGAAAAAAAAAAAGTGATGACAGAATGCTATATGTAGGTTAAACAATTCCAAGTAGACGCTGAAATAGAGCGACAGGTAAAGTTCTAAAATGGGGACACAAGACTGGCTTAGGCGGCGCCTGTTAAACAACTCCAAATTCGAAATCGAACAGCGACAAATTTG (SEQ ID No. 12), wherein the ellipses represent TTAGGG repeats, the sequence marked with a horizontal line at the 5 'end represents the universal linker 3' end sequence, and the sequence marked with a horizontal line at the 3 'end represents the telomere specific single stranded linker 3' sequence.

The temperature control is adopted, so that the joint addition efficiency and the specificity are improved, meanwhile, by adopting a special universal joint, the amplification of other non-telomere fragments is effectively avoided, compared with other conventional library building methods, the method can remarkably improve the telomere sequence ratio, and the telomere sequence ratio results of different library building methods are shown in the table 11.

TABLE 11

While the invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications or changes may be made to the exemplary embodiments of the present disclosure without departing from the scope or spirit of the invention. The scope of the claims is to be accorded the broadest interpretation so as to encompass all modifications and equivalent structures and functions.

Claims

1. A telomere specific temperature control anchor joint, which is characterized by comprising a primer binding region, a single base repetitive region and a telomere specific anchor region, wherein the telomere specific anchor region can be specifically bound with at least part of a 3' -end cantilever of a telomere, the Tm value of the single base repetitive region and the telomere specific anchor region is at least 5 ℃ higher than that of the single base repetitive region, the Tm value of the single base repetitive region is below 37 ℃, the length of the single base repetitive region is 5-20nt, the Tm value of a primer sequence corresponding to the primer binding region is between 55 ℃ and 70 ℃, the sequence of the telomere specific anchor region is selected from at least one of CCCTAA, ACCCTA, AACCCT, CCTAAC, TAACCC and CTAACC, the nested primer corresponding to the primer binding region comprises a first primer and a second primer, the sequence of the first primer is shown as SEQ ID No.7, and the sequence of the second primer is shown as SEQ ID No. 8.

2. A pre-library construction reagent or kit for gene sequencing comprising the telomere specific temperature controlled anchor adaptor of claim 1.

3. A method of pre-library construction for sequencing a human whole telomere terminal sequence, comprising the steps of:

(2) Mixing the sample fragment with the telomere specific temperature controlled anchor linker of claim 1, pre-denaturing at a first temperature, and then hybridizing at a second temperature, wherein the terminally appended single base repeat sequence is complementary to the sequence of the single base repeat region;

wherein the first temperature is higher than the Tm of the two parts of the single base repeat region and the telomere specific anchor region, the second temperature is higher than the third temperature and is lower than the Tm of the two parts of the single base repeat region and the telomere specific anchor region, the first temperature is 50-90 ℃, and the second temperature is 37+ -5 ℃.

4. The method of pre-library construction for sequencing of human whole telomere terminal sequences of claim 3, further comprising (4): a step of cleaving the fragment obtained in the step (3) with a restriction enzyme.

5. The method of pre-library construction for sequencing of human whole telomere terminal sequences of claim 4, further comprising (5): a step of adding universal linkers at both ends of the fragment, wherein the universal linkers have a 5 '-terminal phosphorylation modification and the 3' -terminal contains a blocking group.