CN117230154A - Method for simultaneously detecting CRISPR off-target effect and chromosome translocation without bias in vivo - Google Patents

Abstract

The invention provides a method for detecting CRISPR off-target effect and chromosome translocation simultaneously without bias in vivo. Specifically, the invention develops in-vivo off-target and chromosome translocation detection tools Genuine-seq based on in-vivo off-target detection method GUIDE-seq, and provides a functional dsODN and a method for constructing Genuine-seq library by using the same.

Description

Method for simultaneously detecting CRISPR off-target effect and chromosome translocation without bias in vivo

Technical Field

The invention relates to the field of biotechnology, in particular to a method for detecting CRISPR off-target effect and chromosome translocation simultaneously without bias in vivo.

Background

CRISPR has played an irreplaceable role as a gene editing tool in the last decade. However, its high off-target effect is not negligible, severely limiting its use in clinical studies. Off-target effects cause serious problems at the organism genome level, and fatal gene mutations lead to animal cancers and plant undesirable phenotypes, and often lead to massive deletions and genome rearrangements. At present, an algorithm-based computer simulation prediction model is adopted to detect and quantify the off-target effect, and software designed by the algorithm is utilized to minimize the off-target effect. However, these scoring-based methods have large deviations and do not screen well for true off-target effects. In addition, several in vitro whole genome detection methods, such as Digenome-seq, SITE-seq, CIRCLE-seq, CHANGE-seq and AID-seq, are also used to detect and quantify off-target effects caused by CRISPR, and these methods have complex library construction processes, large genome sample sizes, and in particular detection results caused by high background signals are inconsistent with in vivo actual results.

Therefore, it is necessary to develop in vivo or cell-based whole genome detection methods to detect true off-target effects. The existing widely applied whole genome detection method based on cells can detect off-target sites, including IDLV capture, BLESS, BLISS and DISCOVER-seq, and the methods can play a good role in detecting genome off-target effect, but have the problems of high background, low sensitivity and the like. GUIDE-seq remains the gold standard for detecting off-target effects in vivo. GUIDE-seq uses non-homologous end joining (NHEJ) pathway mediated exogenous double-stranded oligodeoxynucleotide (dsODNs) to label and enrich double-stranded breaks (DSBs) in the genome of living cells, has low false positive rate, is suitable for multiple cell lines, and can detect low abundance of target sites. However, the expensive sequencing cost and omission of some sites are not negligible problems.

Furthermore, chromosomal translocation is also an important issue for CRISPR off-target effects, as it generally leads to high genotoxicity, although it occurs relatively less frequently. However, when multiple gRNAs are introduced into cells for gene editing, the likelihood of chromosomal translocation is greatly increased. Several methods have been developed to identify chromosomal translocations, such as LAM-HTGTS, PEM-seq, but they generally extend unidirectionally to obtain a translocation sequence based on a targeting sequence, are biased, and require a very large sample size, greatly limiting the application of the detection method in detection of primary cells that are difficult to culture and precious clinical specimens. Therefore, it is urgent to develop an in vivo unbiased method for simultaneously detecting CRISPR off-target effects and chromosomal translocations.

Disclosure of Invention

The invention aims to simultaneously realize detection of chromosome translocation based on detection of in vivo CRISPR off-target sites, and develops in vivo off-target and chromosome translocation detection tools Genuine-seq, namely a functional dsODN and a method for constructing a Genuine-seq library by using the same based on an in vivo off-target detection method GUIDE-seq. The method has the advantages of high sensitivity, more comprehensive off-target detection, high specificity and low false positive rate, and provides the non-preferential chromosome translocation detection for the first time. The invention is applied to the fields of in-vivo off-target and chromosome translocation detection.

In order to solve the problems in the prior art, the invention provides a method for detecting CRISPR off-target effect and chromosome translocation simultaneously without bias in vivo.

The invention develops an in-vivo off-target and chromosome translocation detection tool Genuine-seq based on an in-vivo off-target detection method GUIDE-seq, namely a functional dsODN and a method for constructing a Genuine-seq library by the functional dsODN. The key invention point of the method is that a novel dsODN is invented, the sequence of which is different from that of the dsODN of the GUIDE-seq detection method, the dsODN of the GUIDE-seq is 34bp, and the dsODN of the genuine-seq is 48bp. However, the principle of insertion into off-target genomic sites is consistent, and repair is achieved by integration mediated by non-homologous end joining. The method for constructing the Genuine-seq is also different from GUIDE-seq, and the positive library and the negative library of the original GUIDE-seq are connected together through a unique cyclization step to realize simultaneous library construction and sequencing, so that the method not only can detect the off-target site which can be detected by the GUIDE-seq, but also can realize the detection of chromosome translocation. The principle of GUIDE-seq is that dsODN is integrated at target and off-target sites, then dsODN is used as a primer 1, a connector is used as a primer 2, only one side of sequence information, namely a positive library or a negative library, can be obtained during PCR, and the off-target sites can be obtained only by integrating and comparing the sequence information at two sides. Since the positive and negative pools are separate, the site information on both sides of the dsODN cannot be detected simultaneously, i.e., chromosomal translocation cannot be detected.

The invention designs a functional dsODN which has universality, and the sequence of the dsODN is fixed three parts, namely a Illumina Truseq Read sequence, an SbfI cleavage site and a Illumina Truseq Read sequence. Illumina Truseq Read 1 and Illumina Truseq Read sequences are universal primers for Illumina sequencing, have low matching degree with genome sequences, and can well reduce non-specific introduction in the PCR library establishment process, thereby causing false positive off-target sites. The Sbf I cleavage site can also use other cleavage sites, on the one hand, the Sbf I cleavage site has 8bp recognition sequences, the number of the cleavage sites in the genome is much smaller than that of the 6bp recognition sequences, the enzyme with longer recognition sequences can not cause a great deal of cleavage on the genome, the longer the corresponding dsODN is, the lower the efficiency of repairing the inserted genome by the NHEJ pathway is, the lower the detection rate of the off-target site is, and the better the use of the 8bp Sbf I endonuclease is comprehensively considered. On the other hand, sbfI endonuclease is not affected by methylation, a large amount of methylation is formed during the replication of genomic DNA, some endonucleases are affected by methylation, and the methylated cleavage site is not cleaved, but SbfI endonuclease is not affected by methylation, so it is used. The restriction enzyme cleavage site in the dsODN of GUIDE-Seq is NdeI, which does not participate in the construction process of GUIDE-Seq, but is used for detecting the insertion efficiency of dsODN before construction, while the SbfI restriction enzyme cleavage site of the dsODN of Genuine-Seq is used for detecting the insertion efficiency of dsODN before construction, and also participates in the subsequent construction process, the cyclized DNA is cut, each cyclized DNA contains dsODN sequence, and can be cut by SbfI restriction enzyme, and then PCR construction is carried out.

In the present invention, the functional dsODN sequences are as follows:

"a" means a Illumina Truseq Read 1 sequence,indicates the SbfI cleavage site, < >>Illumina Truseq Read2 sequence is shown. Pho is a phosphate modification, which is a phosphorothioate modification consistent with the modification of the dsODN of GUIDE-seq, with the 5 'phosphate increasing the efficiency of repair ligation and the 3' two consecutive phosphorothioates preventing degradation of the dsODN in the cell.

Specifically, the invention provides the following technical scheme:

in one aspect, the invention provides a method for simultaneously detecting CRISPR off-target effects and chromosomal translocations, the method comprising inserting a dsODN sequence into genomic DNA, fragmenting the genomic DNA, and circularizing the DNA fragment into which the dsODN sequence was inserted, to construct a sequencing library comprising a positive library and a negative library, wherein the dsODN sequence comprises a universal sequencing primer 1-endonuclease recognition site-universal sequencing primer 2.

In some embodiments, the method further comprises the step of ligating hairpin linkers on the DNA fragments, the hairpin linkers being attached at both ends of the DNA fragments, providing complementary sequences for intramolecular cyclization of the DNA such that the cyclization efficiency is greater than the direct blunt-ended cyclization efficiency.

In some embodiments, the method comprises the steps of:

a. inserting dsODN sequences into cell genomic DNA at target and off-target sites by CRISPR gene editing techniques;

b. extracting genomic DNA of the cells, and fragmenting and repairing tail ends of the genomic DNA;

c. ligating hairpin junctions to the fragmented and end-repaired genomic DNA;

d. digesting the unligated adaptor and genomic DNA;

e. enzymatic treatment of the hairpin-linked DNA, cleavage of the stem-loop structure of the linker, exposing the cohesive end;

f. enzymatically ligating the DNA obtained in step e to circularize it;

g. enzymatically digesting the non-circular DNA;

h. opening a loop by using enzyme, and performing two rounds of PCR, wherein the first round of PCR is used for reducing nonspecific reaction, and the second round of PCR is performed by adopting an Illumina universal sequencing primer so as to obtain a sequencing library;

i. and (5) performing library quality inspection and sequencing, and performing belief analysis to obtain off-target effect and chromosome translocation information.

In the invention, the primer sequence of the first round of PCR is Illumina Truseq Read sequence plus partial sequence of Sbf I endonuclease cleavage site cleavage, the Tm value of the primer is higher than that of the single Illumina Truseq Read sequence, so the annealing temperature is higher during PCR, and the non-specific binding can be well reduced by adopting touchdown PCR, false positive in the PCR process is removed, and the sequence of the real off-target site is enriched.

In some embodiments, the nucleotide sequence of the dsODN is set forth in SEQ ID NO. 1 and SEQ ID NO. 2.

In some embodiments, the dsODN is an annealed dsODN.

In some embodiments, genomic DNA is fragmented to a length in the range of 200-500bp.

In some embodiments, the hairpin linker is an annealed hairpin linker.

In some embodiments, the ligation hairpin junctions are performed by a T4 DNA ligase.

In some embodiments, digesting the unligated adaptor and genomic DNA fragment is performed using exonuclease i and Lambda exonuclease.

In some embodiments, the hairpin linker has a sequence as set forth in SEQ ID NO. 3.

In some embodiments, the hairpin adaptor-ligated DNA is treated with a USER enzyme and a T4 polynucleotide kinase.

In some embodiments, the DNA obtained in step e is ligated using T4 DNA ligase to circularize it.

In some embodiments, the non-circular DNA is digested with Plasmid-Safe ATP-Dependent DNase/ATP Dependent DNase.

In some embodiments, sbfI-HF endonuclease is used for ring opening.

In some embodiments, the first round of PCR and the second round of PCR are both touchdown PCR.

In the invention, the design of the dsODN is the core of the whole Genuine-seq invention, and unknown genomic DNA sequences connected with the dsODN left and right are obtained by PCR through known Illumina Truseq Read sequences as primers, so that off-target sites are deduced; hairpin linkers are key to the cyclization step, as blunt-ended cyclization is generally less efficient, and the yield of the cyclized product can be increased by generating a sticky end through the hairpin linker for cyclization, thereby increasing the detection rate of off-target sites.

sgrnas are a single-stranded RNA that targets the genome at the target sequence (on-target), which forms a complex with Cas9 protein, brings Cas9 protein to the target site, and cleaves genomic DNA, creating a double-strand break, where dsODN is integrated into the genome by cell repair. Due to the large base sequence of genomic DNA, a targeting sequence that is highly similar to that at the target sequence, i.e., an off-target site, is easily present. And Genuine-seq is a method of detecting off-target sites. If the genomic target or off-target sites are close in three dimensions, cas9, after cleaving these sites, cells can readily interconnect these sites, thus causing chromosomal translocation. When multiple different sgrnas are working simultaneously, chromosomal translocations occur with a greater probability. While the Genuine-seq can detect chromosomal translocation.

The invention relates to a method for simultaneously detecting CRISPR off-target effect and chromosome translocation without bias in vivo, which is carried out according to the following steps:

step one: cell transfection

Culturing HEK293T cells, transfecting 600ng of spCas9/sgRNA plasmid and 50ng of annealed functional dsODN into the HEK293T cells, and collecting cells after 3 days of transfection to extract genome DNA;

step two: genuine-seq library construction

1) Genomic DNA fragmentation and end repair

Fragmenting genome DNA and repairing the tail end by adopting enzyme, wherein the length of the genome DNA is 200-500bp;

the fragmentation and end repair reaction system is as follows:

500ng of genomic DNA	1μL
		Smearase mixed enzyme	10μL
Enzyme-free water	49μL
		Total volume of	60μL

After being prepared according to the system, the components are fully and uniformly mixed, and after centrifugation, the components are subjected to fragmentation and end repair reactions, and the procedures are as follows: reacting at 30 ℃ for 12min, reacting at 72 ℃ for 20min, and immediately performing the next step after the temperature is reduced to 4 ℃;

2) Joint connection

And (3) connecting a joint with a reaction system:

1) Is a DNA of (2)	60μL
		Connection enhancer	30μL
T4 DNA ligase	5μL
		Hairpin joint	3.5μL
Enzyme-free water	1.5μL
		Total volume of	100μL

The above-mentioned joint connection reaction system is placed in PCR tube, and placed on PCR instrument, and reacted according to the following joint connection reaction procedure: purifying with magnetic beads at 20deg.C for 40min, and eluting;

3) Digestion of adaptor and unligated fragments

Digestion reaction system:

the digestion reaction system is placed in a PCR tube and placed on a PCR instrument to react according to the following digestion reaction program: reacting at 37deg.C for 60min, reacting at 75deg.C for 10min, cooling to 4deg.C, purifying with magnetic beads, and eluting;

4) Joint opening

The joint opens the reaction system:

3) Is a DNA of (2)	40μL
		T4 DNA ligase buffer	5μL
USER enzyme	3μL
		T4 polynucleotide kinase	2μL
Total volume of	50μL

The above-mentioned linker opening reaction system was placed in a PCR tube and placed on a PCR instrument, and reacted according to the following linker opening reaction procedure: reacting at 37 ℃ for 60min, reacting at 65 ℃ for 10min, cooling to 4 ℃, and then carrying out the next step;

5) Cyclization

Cyclization reaction system:

4) Is a DNA of (2)	50μL
		T4 DNA ligase buffer	30μL
T4 DNA ligase	10μL
		Enzyme-free water	210μL
Total volume of	300μL

The cyclization reaction system was placed in a PCR tube and placed on a PCR instrument, and reacted according to the following cyclization reaction procedure: reacting for 16h at 16 ℃, reducing the temperature to 4 ℃, then purifying by using magnetic beads, and eluting;

6) Digestion of uncyclized fragments

Digestion reaction system:

5) Is a DNA of (2)	38μL
		Plasmid-Safe Reaction Buffer	5μL
Plasmid-Safe ATP-Dependent DNase	5μL
		ATP	2μL
Total volume of	50μL

The digestion reaction system is placed in a PCR tube and placed on a PCR instrument to react according to the following digestion reaction program: reacting at 37deg.C for 60min, reacting at 70deg.C for 30min, cooling to 4deg.C, purifying with magnetic beads, and eluting;

7) Endonuclease ring opening

Ring opening reaction system:

6) Is a DNA of (2)	9.5μL
		rCutSmart buffer	1μL
SbfI-HF endonuclease	1μL
		Total volume of	11.5μL

The ring-opening reaction system is placed in a PCR tube and placed on a PCR instrument to react according to the following ring-opening reaction program: reacting at 37 ℃ for 60min, reacting at 80 ℃ for 20min, cooling to 4 ℃, and then carrying out the next step;

8) First PCR

PCR reaction system:

7) Is a DNA of (2)	11.5μL
		Ultima Amplification Mix	15μL
Upstream primer P5_R1	1μL
		Downstream primer P7_R1	1μL
TMAC(0.5M)	1.5μL
		Total volume of	30μL

The PCR reaction system is placed in a PCR tube and placed on a PCR instrument, and the reaction is carried out according to the following PCR reaction program:

purifying by using magnetic beads after the reaction is completed, and eluting;

9) Second PCR

PCR reaction system:

8) Is a DNA of (2)	11.5μL
		Ultima Amplification Mix	15μL
Upstream Index primer P5_R2	1μL
		Downstream Index primer P7_R2	1μL
TMAC(0.5M)	1.5μL
		Total volume of	30μL

The PCR reaction system is placed in a PCR tube and placed on a PCR instrument, and the reaction is carried out according to the following PCR reaction program:

namely, the method for constructing the Genuine-seq library by the functional dsODN is completed.

Further, the magnetic bead purification is carried out, and the elution is carried out by adopting 120 mu L of 1.2 XDNA sorting magnetic beads, and TE buffer solution is adopted for elution.

Further, the TE buffer is 10mM Tris-HCl without EDTA.

Further, the DNA fragmentation and end repair are completed by using a DNA library-building kit of the next holy one-step method.

Further, the linker ligation is accomplished using the following holy "one-step" DNA library kit.

Further, the hairpin linker sequence is 5'-Pho-CGGTGGACCGATGATCUATCGGTCCACCG T-3' (SEQ ID NO: 3);

further, the design principle of the P5_R1 primer is dsODN Truseq Read sequence plus SbfI cleavage sequence.

Further, the P5_R1 primer is 5'-TGCAGGACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 4);

further, the design principle of the P7_R1 primer is dsODN Truseq Read sequence plus SbfI cleavage sequence.

Further, the P7_R1 primer is 5'-TGCAGGGACGTGTGCTCTTCCGATCT-3' (SEQ ID NO: 5).

Further, the design principle of the P5_R2 primer is an illuminap5+index 5+truseq Read 1 sequence.

Further, the sequence of the P5_R2 primer is as follows:

further, the design principle of the P7_R2 primer is an illuminap7+index 7+truseq Read2 sequence.

Further, the sequence of the P7_R2 primer is as follows:

further, the PCR reaction is completed by adopting a DNA library construction kit of next holy one-step method.

In the next step, the kit for constructing the DNA library by the 'one-step method' has low cost compared with the NEB library constructing kit, and contains genome DNA fragmentation and end repair enzyme, T4 DNA ligase and high-fidelity PCR enzyme required by library construction.

Definition of the definition

DSB: double-stranded DNA breaks, particularly those caused by CRISPR-Cas9 cleavage, are specified herein.

dsODN: an oligonucleotide duplex, formed by annealing two complementary oligonucleotides.

Functional dsODN: oligonucleotide double-stranded with a certain function, such as dsODN for off-target detection in GUIDE-seq, and dsODN for off-target and chromosomal translocation detection in Genuine-seq.

Positive library: the dsODN in the GUIDE-seq has directionality, and only one side can be subjected to PCR reaction, and the PCR reaction is performed by taking the adaptor as an upstream primer and the dsODN as a downstream primer, thus obtaining a positive library.

Negative library: the dsODN in the GUIDE-seq has directionality, and only one side can be subjected to PCR reaction, the dsODN is used as an upstream primer, the adaptor is used as a downstream primer, and the negative library is obtained by performing PCR.

Chromosome translocation: the change in the position of the chromosomal fragment is referred to as translocation, and is specifically referred to herein as a change in chromosomal position caused by CRISPR/Cas9 cleavage of the genome.

CRISPR off-target: the off-target effect of CRISPR means that all cleavage events that occur with the exception of the genome targeting sequence of CRISPR are off-target.

Lambda exonuclease: is a 5 '. Fwdarw.3' exonuclease acting specifically on DNA, and can digest 5 '-phosphorylated double-stranded DNA selectively along 5'. Fwdarw.3 ', and has low enzymatic cleavage activity on single-stranded DNA and 5' -non-phosphorylated modified DNA, and can not initiate digestion at the nicks or nicks of DNA.

Exonuclease I: has an exonuclease activity of hydrolyzing single-stranded DNA in the 3 '. Fwdarw.5' direction. It is capable of gradually releasing the 5 '-monophosphate of deoxyribonucleic acid, leaving the 5' -end dinucleotide intact.

Hairpin joint: hairpin linkers (Hairpin adapters) are Hairpin structure linkers comprising uracil, which can reduce linker dimers, thereby improving the efficiency of linker ligation to the ends of DNA fragments. In the present invention, the hairpin linker, after cleaving the U base by the USER enzyme, produces a complementary cohesive end, which effects intramolecular cyclization of the DNA fragment by the action of the T4 DNA ligase.

USER enzyme: the USER enzyme recognizes U bases in DNA and glycosylates, cleaving the glycosylated U bases from the nucleic acid strand, forming a site of absence of bases in the nucleic acid strand, where the second strand is cleaved and degraded.

T4 polynucleotide kinase: t4 PNK (T4 polynucleotide kinase) is a phosphodiesterase which acts primarily on double-and single-stranded breaks of DNA and RNA, phosphorylating its ends. In DNA ligation operations, T4 PNK is typically used as an enzyme for end repair, phosphorylating DNA ends, thereby increasing the ligation rate and efficiency of DNA molecules.

Plasmid-Safe ATP-Dependent DNase: the Plasmid-Safe ATP-Dependent DNase can digest linear double-stranded DNA into deoxynucleotides under the condition of weak alkaline pH value. It is less efficient for circular or linear single stranded DNA and is inactive for nicked or closed-loop double stranded DNA or supercoiled DNA.

sbfI-HF endonucleases: the SbfI restriction enzyme can recognize CCTGCA GG locus, and the cutting effect in the cutting buffer solution at 37 ℃ is optimal. High-fidelity (HF) restriction enzymes have the same specificity as the native enzyme, but have been engineered to significantly reduce asterisk activity and use a uniform buffer (rCutSmart buffer).

Illumina Truseq Read 1 sequence: truSeq Read 1 is a universal sequencing primer for Illumina second generation sequencing to identify the sequence to be tested.

Sbf I enzyme: the SbfI restriction enzyme can recognize CCTGCA GG locus, and the cutting effect in the cutting buffer solution at 37 ℃ is optimal.

Illumina Truseq Read2 sequence: truseq Read2 is the second-stage sequencing primer, and double-ended sequencing can be achieved by introducing two-stage sequencing primers, thereby achieving determination of longer sequences.

And (3) terminal repair: genomic DNA is randomly broken into DNA fragments of tight length, which are then end-repaired and an adenine (a) tail is added to the 3' end. The purpose of end repair is to repair damaged or incomplete DNA ends into 5' phosphorylated blunt-ended DNA for blunt-ended DNA ligation. The A base of the DNA fragment 3 'after end repair will be linked to the T base of the 5' hairpin linker.

Smearase mixed enzyme: the Smearase mixed enzyme is a new generation enzyme digestion reagent designed for a high throughput sequencing platform. The Smearase mixed enzyme adopts high-quality fragmenting enzyme, has stable enzyme cutting effect and low preference, can effectively reduce the time and cost of fragmenting, gets rid of complicated ultrasonic steps, and ensures that the fragmenting process is simpler and more efficient. And the Smearase mixed enzyme also comprises Klenow fragmenting enzyme and Taq DNA polymerase which are required by end repair, so that the fragmentation and the end repair are carried out simultaneously.

index5: because of the large throughput of illuminea sequencing, a number of labels are made on the library, resembling barcodes, each sample having a specific barcode whose sequence is called index, so that simultaneous sequencing of multiple samples can be achieved, index5 being the first barcode.

index7: index7 is the second segment of the barcode, and sequencing of more samples can be achieved by introducing two segments of the barcode.

Illumina P5: illumina P5 is a sequencing primer that reads index 5.

Illumina P7: illumina P7 is a sequencing primer that reads index 7.

Landing PCR: the TouchDown PCR improves the specificity of the reaction by optimizing the annealing temperature in the reaction system, and the basic principle is as follows: according to the Tm values of the primers, a series of annealing temperatures from high to low are set, the initial selected annealing temperature is higher than the estimated Tm value (the initial temperature of the annealing temperature is about 15 ℃ higher than the calculated Tm), each (or n) cycles is reduced by 1 ℃ (or n ℃) annealing temperature, the annealing temperature gradually decreases to the Tm value along with the cycle, and finally the annealing temperature is lower than the Tm value to reach a lower annealing temperature. Finally, about 10 cycles were performed at this annealing temperature.

Advantageous effects

Compared with the prior art, the invention has the following technical effects:

compared with the existing widely used off-target detection method, the method has lower sample initial quantity and has operability for detecting primary cells and precious clinical specimens which are difficult to culture. The invention is treated by steps of hairpin joint connection, exonuclease digestion, cyclization, exonuclease digestion, two-round touchdown PCR and the like, so that DSB possibly existing in genome background signals is removed as much as possible, false positive sites in a sequencing result are effectively reduced, and the specificity of off-target detection is improved. The invention does not distinguish between the positive library and the negative library, and the positive library and the negative library are cyclized and then built in one library, so that the library building step is reduced, and the difficulty of data analysis is reduced. Most importantly, the invention can detect chromosome translocation without bias besides detecting off-target sites of CRISPR in vivo.

Drawings

FIG. 1 is a schematic diagram of the Genuine-seq library-building method of the present invention. When exogenous dsODN is near the CRISPR-cut genome, the cell will insert and integrate the dsODN into the editing site via a non-homologous end-linked repair pathway. Genomic DNA was collected fragmented and end repaired, and hairpin junctions were ligated. Hairpin junctions were opened using the USER enzyme and genomic DNA fragments were circularized using T4 DNA ligase. SbfI ring opening, the first round of PCR reduces non-specificity, and the second round of PCR obtains complete library structure.

FIG. 2 is an agarose gel electrophoresis of HEK293T cell VEGFA site2 site Genuine-seq library construction in example 1. The figure illustrates that the final DNA band size distribution of the pool is between 200bp and 500bp.

FIG. 3 is a map of off-target sites of human HEK293T cells at VEGFA site2 using the Genuine-seq method of example 1. The figure illustrates that the method of the invention accurately detects the off-target site of CRISPR at the VEGFA site2 site in HEK293T cells. Each row of the figure is a target site of the VEGFA site2 site, the sites indicated by triangles in the figure are on-target sites, and the rest are off-target sites. The number of Reads represents the number of times that the site appears in the library, with a greater number of Reads representing a greater probability of gene editing occurring at the site.

FIG. 4 is a chromosome map of the detection of the VEGFA site2 site of human HEK293T cells using the Genuine-seq method in example 1. The figure illustrates that the method of the invention accurately detects the chromosomal translocation information of CRISPR at the VEGFA site2 site in HEK293T cells. The figure demonstrates that after gene editing of VEGFA site2 sites, chromosomal translocation occurs between many sites, including at the target site and the off-target site, and at the off-target site and the off-target site.

Detailed Description

The present invention will be further described in detail below with reference to specific embodiments and with reference to the accompanying drawings, in order to make the objects, technical solutions and advantages of the present invention more apparent.

The invention relates to a method for detecting CRISPR off-target effect and chromosome translocation in vivo in the whole genome range, wherein a schematic diagram of a Genuine-seq database building method is shown in figure 1, and the method specifically comprises the following steps of:

1. transfecting a Cas9-sgRNA plasmid constructed by a molecular cloning technology into HEK293T cells, and collecting the cells until the third day;

2. collecting 4-8X 10 ⁶ The individual cells are put into a centrifuge tube, centrifuged, the culture medium is discarded, washed once by PBS, centrifuged again, the PBS is discarded, and the genome DNA is extracted by using a cell/tissue genome extraction kit;

3. fragmenting the genome DNA extracted in the second step into fragments with the length of 200-500bp and repairing the tail ends at the same time;

4. step three, connecting the DNA with the hairpin joint, then adopting exonuclease to digest the unconnected joint and DNA, purifying the magnetic beads and eluting;

5. treating the DNA connected with the hairpin joint by using USER enzyme and T4 polynucleotide kinase, and cutting the stem-loop structure of the joint to expose the sticky end;

6. connecting the DNA in the step five by using a T4 DNA ligase molecule, cyclizing the DNA, purifying and eluting magnetic beads, digesting the DNA which is not cyclized by using exonuclease, and purifying and eluting the magnetic beads;

7. the endonuclease SbfI-HF is subjected to ring opening, and then a first round of PCR is carried out to reduce non-specific binding;

8. performing a second round of PCR by using the sequencing primer, recovering PCR amplification products to obtain a library to be on-machine, and further performing library quality inspection and sequencing;

the dsODN, hairpin and PCR primers of the invention were synthesized by Shanghai chemical company, inc., and purified by HPLC. The enzyme-free water used in the subsequent experiments was DEPC treated water (Productivity, B300592) and autoclaved.

The design principle of hairpin joints is that intramolecular annealing produces stem-loop structures.

Preparing a 2×annealing buffer: 20mM Tris,pH 7.5, 100mM NaCl,2mM EDTA. The dsODN and hairpin linker were annealed as follows:

dsODN annealing system

2μg/μL dsODN_1	25μL
		2μg/μL dsODN_2	25μL
Annealing buffer 2×	50μL
		Total volume of	100μL

Hairpin joint annealing system

100 mu M hairpin joint	15μL
		Annealing buffer 2×	50μL
Enzyme-free water	35μL

Annealing procedure: 95 ℃ for 5min; -0.1 ℃/s cooling to 25 ℃;

a500 ng/. Mu.L dsODN and 15. Mu.M hairpin were prepared and stored at-20 ℃.

The advantageous effects of the invention are further illustrated below by means of specific examples.

Example 1: detecting off-target and chromosome translocation of the HEK293T cell VEGFA site2 site by a gene-seq method;

target sequence+pam: GAGGCGGGGTGGAGGGGGTC +GGG (SEQ ID NO: 16)

The implementation process comprises the following steps:

1. the dsodn_1 and dsodn_2 were synthesized by the Productivity company, dissolved to a concentration of 2. Mu.g/. Mu.L with 10mM Tris-HCl, and the following system was prepared in a 200. Mu.L PCR tube, the annealing procedure was carried out at 95℃for 5min, -0.1 ℃/s cooling to 25℃to prepare 500 ng/. Mu.L of dsODN for later use, and the dsODN was dispensed and stored at-20 ℃.

2μg/μL dsODN_1	25μL
		2μg/μL dsODN_2	25μL
Annealing buffer 2×	50μL
		Total volume of	100μL

2. HEK293T cell transfection: cell culture 24 well plates were seeded 1X 10 per well ⁵ After 24h transfection of individual cells, the system was 600ng U6-sgRNA _{VEGFA site2} CMV-SpCas9-P2A-EGFP plasmid (large by molecular cloningThe enterobacteria are transformed and extracted, and reference is Ran, F.A.; hsu, p.d.; wright, j.; agarwala, v.; scott, d.a.; zhang, F., genome engineering using the CRISPR-Cas9 system, nat. Protoc.2013,8 (11), 2281-2308), 50ng dsODN, 1.2. Mu.L JetPRIME transfection reagent (Polyplus, 101000027), were mixed in 50. Mu.L JetPRIME buffer with transfection reagent, incubated at room temperature for 10min and then dropped into 24 well plates at 37℃in 5% CO ₂ Culturing.

3. Three days later, HEK293T cells were collected, and genomic DNA was extracted using a bomaide tissue/cell genomic DNA rapid extraction kit (beijing bomaide, DL 107), and the genomic DNA concentration was measured with quebt 4.0.

4. The genome DNA fragmentation and end repair are completed by adopting a DNA library construction kit (the following holy organism, 12204ES 96) with the size of 200-500bp, 500ng genome DNA is taken, 10 mu L of Smearase Mix (the Smearase Mix is a component in the library construction kit) is taken, and the enzyme-free water is supplemented to 60 mu L; reacting at 30 ℃ for 12min, reacting at 72 ℃ for 20min, and cooling to 4 ℃.

5. The hairpin joint is synthesized by the manufacturing company, 10mM Tris-HCl is used for dissolving until the concentration is 100 mu M, a system is configured in a 200 mu L PCR tube, the annealing procedure is carried out for 5min at 95 ℃, the temperature is reduced to 25 ℃ at-0.1 ℃ per second, the hairpin joint with the working concentration of 15 mu M is prepared for standby, and the hairpin joint is packaged and stored at-20 ℃.

100 mu M hairpin joint	15μL
		Annealing buffer 2×	50μL
Enzyme-free water	35μL
		Total volume of	100μL

6. The annealed hairpin joint is connected with fragmented and end-repaired genome DNA by adopting a DNA library-building kit of a next holy one-step method, a following system is configured in a 200 mu L PCR tube, the reaction procedure is carried out for 40min at 20 ℃, and the temperature is reduced to 4 ℃.

7. Magnetic bead purification of DNA fragment, next holy DNA sorting magnetic beads (next holy organism, 12601ES 56) were equilibrated for about 30min at room temperature. Preparing 80% ethanol. To 100. Mu.L of DNA was added 40. Mu.L of the sorting beads and 60. Mu.L of the SPRI solution (SPRI solution formulation 20%PEG 8000+2.5M NaCl+10mM Tris-HCl+1mM EDTA+0.05%Tween 20,pH 8.0@25 deg.C) and mixed well. Incubate at room temperature for 5min. The PCR tube was briefly centrifuged and placed in a magnetic rack, after which the solution was clarified (about 5 min) and the supernatant removed. The PCR tube was always in the magnetic rack, the beads were rinsed with 200. Mu.L of 80% ethanol, incubated at room temperature for 30s, and the supernatant was removed. The above procedure was repeated for a total of two rinses. Finally, the residual liquid was sucked off using a 10. Mu.L small tip. The PCR tube was always in the magnetic rack and the beads were dried by uncapping until cracks had just occurred (about 5 min). The PCR tube was taken out of the magnetic rack, and an appropriate amount of 41. Mu.L of enzyme-free water was added thereto, followed by mixing and standing at room temperature for 5 minutes. The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid. After the solution was clear (about 5 min), 40 μl of supernatant was carefully transferred to a clean PCR tube.

8. The unligated linker and DNA fragment were digested with the Lambda exonuclease (NEB, M0293S) and exonuclease I (NEB, M0262L) of NEB, and the following system was placed in a 200. Mu.L PCR tube, and the reaction procedure was carried out at 37℃for 60min, at 75℃for 10min, and cooled to 4 ℃.

Exonuclease I reaction buffer (10×)	5μL
		Lambda exonuclease (5U/. Mu.L)	4μL
Exonuclease I (20U/. Mu.L)	1μL
		Purified DNA	40μL
Total volume of	50μL

9. The magnetic beads were purified and the next holy DNA was equilibrated at room temperature for about 30min. Preparing 80% ethanol. To the 50. Mu.L of DNA, 60. Mu.L of the magnetic beads were added and mixed. Incubate at room temperature for 5min. The PCR tube was briefly centrifuged and placed in a magnetic rack, after which the solution was clarified (about 5 min) and the supernatant removed. The PCR tube was always in the magnetic rack, the beads were rinsed with 200. Mu.L of 80% ethanol, incubated at room temperature for 30s, and the supernatant was removed. The above procedure was repeated for a total of two rinses. Finally, the residual liquid was sucked off using a 10. Mu.L small tip. The PCR tube was always in the magnetic rack and the beads were dried by uncapping until cracks had just occurred (about 5 min). The PCR tube was taken out of the magnetic rack, and an appropriate amount of 41. Mu.L of enzyme-free water was added thereto, followed by mixing and standing at room temperature for 5 minutes. The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid. After the solution was clear (about 5 min), 40 μl of supernatant was carefully transferred to a clean PCR tube.

10. The hairpin was opened using NEB' S USER enzyme (NEB, M5505L) and T4 polynucleotide kinase (NEB, M0201S), and the following system was placed in a 200. Mu.L PCR tube, and the reaction procedure was carried out at 37℃for 60min, at 65℃for 10min, and cooled to 4 ℃.

11. The following system was prepared in a 200. Mu.L PCR tube using the following St. Fast T4 DNA ligase (St. Of the next, 10299ES 42) to circularize the DNA fragment intramolecular, and the reaction was carried out at 16℃for 16 hours, and the temperature was lowered to 4 ℃.

12. The circularized DNA was purified by magnetic beads, which equilibrated at room temperature for about 30min. Preparing 80% ethanol. To the 300. Mu.L of DNA, 60. Mu.L of the sorting beads and 300. Mu.L of the SPRI solution were added and mixed. Incubate at room temperature for 5min. The PCR tube was briefly centrifuged and placed in a magnetic rack, after which the solution was clarified (about 5 min) and the supernatant removed. The PCR tube was always in the magnetic rack, 400. Mu.L of 80% ethanol was added to rinse the beads, incubated at room temperature for 30s, and the supernatant was removed. The above procedure was repeated for a total of two rinses. Finally, the residual liquid was sucked off using a 10. Mu.L small tip. The PCR tube was always in the magnetic rack and the beads were dried by uncapping until cracks had just occurred (about 5 min). The PCR tube was taken out of the magnetic rack, and an appropriate amount of 39. Mu.L of enzyme-free water was added thereto, followed by mixing and standing at room temperature for 5 minutes. The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid. After the solution was clear (about 5 min), 38 μl of supernatant was carefully transferred to a clean PCR tube.

13. The uncycled DNA fragment was removed using Plasmid-Safe ATP-Dependent DNase/ATP Dependent DNase (Lucigen, NC 9046399) and the following system was placed in a 200. Mu.L PCR tube, reacted at 37℃for 60min,70℃for 30min, and cooled to 4 ℃.

Plasmid-Safe reaction buffer (10X)	5μL
		ATP(25mM)	2μL
Plasmid-Safe ATP-Dependent DNase(10U/μL)	5μL
		Purified DNA	38μL
Total volume of	50μL

14. The magnetic beads purify the circularized DNA, and the next step of DNA sorting is equilibrated for about 30min at room temperature. Preparing 80% ethanol. To the 50. Mu.L of DNA, 60. Mu.L of the magnetic beads were added and mixed. Incubate at room temperature for 5min. The PCR tube was briefly centrifuged and placed in a magnetic rack, after which the solution was clarified (about 5 min) and the supernatant removed. The PCR tube was always in the magnetic rack, the beads were rinsed with 200. Mu.L of 80% ethanol, incubated at room temperature for 30s, and the supernatant was removed. The above procedure was repeated for a total of two rinses. Finally, the residual liquid was sucked off using a 10. Mu.L small tip. The PCR tube was always in the magnetic rack and the beads were dried by uncapping until cracks had just occurred (about 5 min). The PCR tube was taken out of the magnetic rack, and a proper amount of 18. Mu.L of enzyme-free water was added thereto, followed by mixing and standing at room temperature for 5 minutes. The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid. After the solution was clear (about 5 min), 10 μl of supernatant was carefully transferred to a clean PCR tube.

15. The Sbf I-HF endonuclease (NEB, R3642L) of NEB is used for ring opening, the following system is configured in a 200 mu LPCR tube, the reaction procedure is carried out for 60min at 37 ℃, the reaction is carried out for 20min at 80 ℃, and the temperature is reduced to 4 ℃.

rCutSmart buffer (10×)	1μL
		SbfI-HF(20U/μL)	1μL
Purified DNA	9.5μL
		Total volume of	11.5μL

16. The first round PCR primers P5_R1 and P7_R1 were synthesized by the Productivity company, dissolved to a concentration of 10. Mu.M with 10mM Tris-HCl, and the first round PCR was performed using the following system and procedure in a 200. Mu.LPCR tube using the following "one-step" DNA library kit:

PCR system

2×Ultima Amplification Mix	15μL
		P5_R1(10μM)	1μL
P7_R1(10μM)	1μL
		TMAC(0.5M)	1.5μL
SbfI-HF digestion products	11.5μL
		Total volume of	30μL

PCR program

17. The magnetic beads purify the circularized DNA, and the next step of DNA sorting is equilibrated for about 30min at room temperature. Preparing 80% ethanol. To the 30. Mu.L of DNA, 36. Mu.L of the magnetic beads were added and mixed. Incubate at room temperature for 5min. The PCR tube was briefly centrifuged and placed in a magnetic rack, after which the solution was clarified (about 5 min) and the supernatant removed. The PCR tube was always in the magnetic rack, the beads were rinsed with 200. Mu.L of 80% ethanol, incubated at room temperature for 30s, and the supernatant was removed. The above procedure was repeated for a total of two rinses. Finally, the residual liquid was sucked off using a 10. Mu.L small tip. The PCR tube was always in the magnetic rack and the beads were dried by uncapping until cracks had just occurred (about 5 min). The PCR tube was taken out of the magnetic rack, and a proper amount of 12. Mu.L of enzyme-free water was added thereto, followed by mixing and standing at room temperature for 5 minutes. The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid. After the solution was clear (about 5 min), 12 μl of supernatant was carefully transferred to a clean PCR tube.

18. The second round PCR primers P5_R2 and P7_R2 were synthesized by the Productivity company, dissolved to a concentration of 10. Mu.M with 10mM Tris-HCl, and the second round PCR was performed using the following system and procedure in a 200. Mu.LPCR tube using the following "one-step" DNA library kit:

PCR system

2×Ultima Amplification Mix	15μL
		P5_R2(10μM)	1μL
P7_R2(10μM)	1μL
		TMAC(0.5M)	1.5μL
First round PCR purification of products	11.5μL
		Total volume of	30μL

PCR program

19. The products of the second round of PCR were subjected to agarose gel electrophoresis, cut out DNA fragments ranging from 200-500bp, and the DNA was recovered by the protocol using GeneJET PCR Purification Kit (Thermo Scientific, K0692), library quality inspection and high throughput sequencing, as shown in FIG. 2. FIG. 3 is the off-target site of VEGFA site2 in HEK293T cells obtained by the Genuine-seq pooling method. FIG. 4 is chromosomal translocation of HEK293T cell VEGFA site2 by the Genuin-seq banking method.

Thus, the invention provides a method for detecting CRISPR off-target effect and chromosome translocation simultaneously without bias in vivo. The method has high sensitivity (only a low initial quantity of 500ng genome and a small PCR cycle number are needed to realize off-target detection in the whole genome range), more comprehensive off-target detection (off-target effect caused by mutation, insertion and deletion can be detected), high specificity (non-specific amplification in the library building process is reduced through two rounds of PCR enrichment), low false positive rate (amplification of false positive products can be reduced through two rounds of touchdown PCR), and no bias (the no bias refers to that chromosomes at two ends of chromosome translocation are random, not amplified by specific sequences, possibly translocation at a target site and an off-target site, and also possibly translocation at the off-target site) is proposed for the first time, and the application range is wide.

Sequence(s)

Nucleotide sequence of SEQ ID NO. 1dsODN_1

5’Pho-AGATCGGAAGAGCGTCGTGTCCTGCAGGGACGTGTGCTC TTCCGAT*C*T-3’

Pho is a phosphate modification, a phosphorothioate modification

Nucleotide sequence of SEQ ID NO. 2dsODN_2

5’Pho-AGATCGGAAGAGCACACGTCCCTGCAGGACACGACGCTC TTCCGAT*C*T-3’

Pho is a phosphate modification, a phosphorothioate modification

SEQ ID NO. 3 hairpin linker sequence

5’-Pho-CGGTGGACCGATGATCUATCGGTCCACCG*T-3’

SEQ ID NO. 4P5_R1 primer

5’-TGCAGGACACGACGCTCTTCCGATCT-3’

SEQ ID NO. 5P7_R1 primer

5’-TGCAGGGACGTGTGCTCTTCCGATCT-3’

SEQ ID NO. 6P5_R2_1 primer sequence

AATGATACGGCGACCACCGAGATCTACACTAGATCGCACACTCT TTCCCTACACGACGCTCTTCCGATCT

SEQ ID NO 7P5_R2_2 primer sequence

AATGATACGGCGACCACCGAGATCTACACCTCTCTATACACTCTT TCCCTACACGACGCTCTTCCGATCT

SEQ ID NO. 8P5_R2_3 primer sequence

AATGATACGGCGACCACCGAGATCTACACTATCCTCTACACTCTT TCCCTACACGACGCTCTTCCGATCT

SEQ ID NO. 9P5_R2_4 primer sequence

AATGATACGGCGACCACCGAGATCTACACAGAGTAGAACACTCT TTCCCTACACGACGCTCTTCCGATCT

SEQ ID NO. 10P5_R2_5 primer sequence

AATGATACGGCGACCACCGAGATCTACACGTAAGGAGACACTCT TTCCCTACACGACGCTCTTCCGATCT

SEQ ID NO. 11P7_R2_1 primer sequence

CAAGCAGAAGACGGCATACGAGATTGGCTCAGGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCT

SEQ ID NO. 12P7_R2_2 primer sequence

CAAGCAGAAGACGGCATACGAGATTATGCCAGGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCT

SEQ ID NO. 13P7_R2_3 primer sequence

CAAGCAGAAGACGGCATACGAGATTCAGATTCGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCT

SEQ ID NO. 14P7_R2_4 primer sequence

CAAGCAGAAGACGGCATACGAGATTAGTCTTGGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCT

SEQ ID NO. 15P7_R2_5 primer sequence

CAAGCAGAAGACGGCATACGAGATTTCAGCTCGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCT

SEQ ID NO 16 target sequence+PAM

GAGGCGGGGTGGAGGGGGTCGGG

SEQ ID NO:17U6-sgRNA _{VEGFA site2} Nucleotide sequence of-CMV-SpCas 9-P2A-EGFP plasmid

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttga

ctgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaatt

atgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaagga

cgaaacaccgGAGGCGGGGTGGAGGGGGTCgttttagagctagaaatagcaagttaaaataa

ggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttgttttagagctagaaatagcaagttaaa

ataaggctagtccgtttttagcgcgtgcgccaattctgcagacaaatggctctagaggtacccgttacataacttac

ggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggact

ttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagt

acgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttc

ctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctcc

ccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggg

gggggggggcgcgcgccgggggggggggggggggggggggggggggggggggcgaggcggagag

gtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggc

cctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccccgctccgcc

gccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggccct

tctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaat

tacctggagcacctgcctgaaatcactttttttcaggttggaccggtgccaccatggactataaggaccacgacgg

agactacaaggatcatgatattgattacaaagacgatgacgataagatggccccaaagaagaagcggaaggtc

ggtatccacggagtcccagcagccgacaagaagtacagcatcggcctggacatcggcaccaactctgtgggct

gggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcac

agcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaa

gagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacga

gatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcac

gagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacc

tgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgat

caagttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatc

cagctggtgcagacctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggcc

atcctgtctgccagactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaag

aatggcctgttcggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggcc

gaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggc

gaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatcctgagagt

gaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcaccaccaggacct

gaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaaga

acggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcccatcctgga

aaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggacct

tcgacaacggcagcatcccccaccagatccacctgggagagctgcacgccattctgcggcggcaggaagattt

ttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggcc

ctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaaaccatcaccccctggaact

tcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacct

gcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaa

gtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtggac

ctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgctt

cgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaa

ttatcaaggacaaggacttcctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgaca

ctgtttgaggacagagagatgatcgaggaacggctgaaaacctatgcccacctgttcgacgacaaagtgatgaa

gcagctgaagcggcggagatacaccggctggggcaggctgagccggaagctgatcaacggcatccgggac

aagcagtccggcaagacaatcctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatc

cacgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtccggccagggcgatagcctgcac

gagcacattgccaatctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggac

gagctcgtgaaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagac

cacccagaagggacagaagaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggc

agccagatcctgaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgc

agaatgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatc

gtgcctcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggc

aagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgcc

aagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataag

gccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcc

cggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaagc

tggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgcccacgacg

cctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggc

gactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaa

gtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcg

gcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcg

gaaagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaaga

gtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacgg

cggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaa

ctgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactt

tctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagct

ggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccct

ccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcag

aaacagctgtttgtggaacagcacaagcactacctggacgagatcatcgagcagatcagcgagttctccaagag

agtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagcaccgggataagcccatcaga

gagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagcccctgccgccttcaagtactttgaca

ccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggacgccaccctgatccaccagagcatca

ccggcctgtacgagacacggatcgacctgtctcagctgggaggcgacaaaaggccggcggccacgaaaaag

gccggccaggcaaaaaagaaaaaggaattcggcagtggagagggcagaggaagtctgctaacatgcggtga

cgtcgaggagaatcctggcccagtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcga

gctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggca

agctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacc

tacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccga

aggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttc

gagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggg

gcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaag

gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacc

cccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagac

cccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacg

agctgtacaaggaattctaactagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttg

cccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat

cgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattggga

agagaatagcaggcatgctggggagcggccgcaggaacccctagtgatggagttggccactccctctctgcgc

gctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtg

agcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtattttctccttacgcatctgtgcggtatttca

caccgcatacgtcaaagcaaccatagtacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttac

gcgcagcgtgaccgctacacttgccagcgccttagcgcccgctcctttcgctttcttcccttcctttctcgccacgtt

cgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgacc

ccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg

gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaactctatctcgggctattcttttgattt

ataagggattttgccgatttcggtctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaa

atattaacgtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacac

ccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgt

ctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatac

gcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcgg

aacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaata

atattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgt

ttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcga

actggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaag

ttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctca

gaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt

gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaac

cgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccatacca

aacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactact

tactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggc

ccttccggctggctggtttattgctgataaatctggagccggtgagcgtggaagccgcggtatcattgcagcactg

gggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaa

tagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatacttta

gattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaa

cgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgc

gtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactc

tttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccac

cacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg

ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg

gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatga

gaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggag

agcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttg

agcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggt

tcctggccttttgctggccttttgctcacatgt

The foregoing description of the embodiments has been provided for the purpose of illustrating the general principles of the invention, and is not meant to limit the invention thereto, but to limit the invention thereto, and any modifications, equivalents, improvements and equivalents thereof may be made without departing from the spirit and principles of the invention.

Claims (10)

1. A method for simultaneously detecting CRISPR off-target effects and chromosomal translocations, the method comprising inserting a dsODN sequence into genomic DNA, fragmenting the genomic DNA, and circularizing the DNA fragments into which the dsODN sequence was inserted, creating a sequencing library comprising a positive library and a negative library, wherein the dsODN sequence comprises a universal sequencing primer 1-endonuclease recognition site-universal sequencing primer 2.

2. The method of claim 1, further comprising the step of ligating hairpin linkers to the DNA fragments, said hairpin linkers being attached at both ends of the DNA fragments to provide complementary sequences for intramolecular cyclization of the DNA such that the cyclization efficiency is greater than the direct blunt-ended cyclization efficiency.

3. The method according to claim 2, characterized in that it comprises the steps of:

a. inserting dsODN sequences into cell genomic DNA at target and off-target sites by CRISPR gene editing techniques;

b. extracting genomic DNA of the cells, and fragmenting and repairing tail ends of the genomic DNA;

c. ligating hairpin linkers to the fragmented and end repaired genomic DNA, preferably by T4 DNA ligase;

d. digesting the unligated adaptor and genomic DNA, preferably, digesting the unligated adaptor and genomic DNA fragment using exonuclease I and Lambda exonuclease;

e. enzymatic treatment of the hairpin adaptor-ligated DNA, cleavage of the adaptor stem loop structure, exposing the sticky ends, preferably treatment of the hairpin adaptor-ligated DNA with a USER enzyme and a T4 polynucleotide kinase;

f. enzymatically ligating the DNA obtained in step e to circularize it, preferably by ligating the DNA obtained in step e with T4 DNA ligase;

g. enzymatic digestion of non-circular DNA, preferably, non-circular DNA with Plasmid-Safe ATP-Dependent DNase/ATP Dependent DNase;

h. opening the loop by using enzyme, preferably SbfI-HF endonuclease, and performing two rounds of PCR, wherein the first round of PCR is used for reducing nonspecific reaction, and the second round of PCR is performed by using Illumina universal sequencing primer to obtain a sequencing library;

i. and (5) performing library quality inspection and sequencing, and performing belief analysis to obtain off-target effect and chromosome translocation information.

4. The method of claim 3, wherein the dsODN consists of a Illumina Truseq Read sequence, an Sbf i cleavage site and a Illumina Truseq Read sequence, preferably the nucleotide sequences of the dsODN are set forth in SEQ ID No. 1 and SEQ ID No. 2.

5. The method of claim 3, wherein the dsODN is an annealed dsODN.

6. A method according to claim 3, characterized in that the genomic DNA is fragmented to a length in the range of 200-500bp.

7. A method according to claim 3, wherein the hairpin linker is an annealed hairpin linker.

8. The method of claim 3 or 7, wherein the hairpin linker has a sequence as set forth in SEQ ID NO. 3.

9. The method of claim 4, wherein the primer sequence of the first round of PCR is Illumina Truseq Read sequence plus a partial sequence of the cleavage site of the Sbf I endonuclease such that the Tm of the primer of the first round of PCR is higher than the Tm of the sequence Illumina Truseq Read alone, thereby reducing non-specific binding, removing false positives during PCR, and enriching for true off-target site sequences.

10. A method according to claim 3, wherein the first and second rounds of PCR are both drop PCR.