CN117230027A - African swine fever virus attenuated strain, preparation method and application thereof - Google Patents
African swine fever virus attenuated strain, preparation method and application thereof Download PDFInfo
- Publication number
- CN117230027A CN117230027A CN202311203922.8A CN202311203922A CN117230027A CN 117230027 A CN117230027 A CN 117230027A CN 202311203922 A CN202311203922 A CN 202311203922A CN 117230027 A CN117230027 A CN 117230027A
- Authority
- CN
- China
- Prior art keywords
- swine fever
- african swine
- fever virus
- gene
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000701386 African swine fever virus Species 0.000 title claims abstract description 128
- 230000002238 attenuated effect Effects 0.000 title claims abstract description 46
- 238000002360 preparation method Methods 0.000 title claims abstract description 8
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 49
- 239000012634 fragment Substances 0.000 claims abstract description 34
- 241000700605 Viruses Species 0.000 claims abstract description 29
- 229960005486 vaccine Drugs 0.000 claims abstract description 23
- 239000003814 drug Substances 0.000 claims abstract description 9
- 101710085469 CD2 homolog Proteins 0.000 claims description 50
- 230000006801 homologous recombination Effects 0.000 claims description 31
- 238000002744 homologous recombination Methods 0.000 claims description 31
- 238000009472 formulation Methods 0.000 claims description 30
- 239000000203 mixture Substances 0.000 claims description 30
- 239000013612 plasmid Substances 0.000 claims description 22
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 claims description 14
- 108700026244 Open Reading Frames Proteins 0.000 claims description 12
- 102000004169 proteins and genes Human genes 0.000 claims description 12
- 230000006798 recombination Effects 0.000 claims description 12
- 238000005215 recombination Methods 0.000 claims description 12
- 238000000034 method Methods 0.000 claims description 10
- 229940031551 inactivated vaccine Drugs 0.000 claims description 9
- 208000000415 potassium-aggravated myotonia Diseases 0.000 claims description 9
- 108020005004 Guide RNA Proteins 0.000 claims description 8
- 239000008187 granular material Substances 0.000 claims description 8
- 239000007788 liquid Substances 0.000 claims description 8
- 238000010353 genetic engineering Methods 0.000 claims description 7
- 229940023143 protein vaccine Drugs 0.000 claims description 7
- 241000282898 Sus scrofa Species 0.000 claims description 6
- 239000004480 active ingredient Substances 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 238000005516 engineering process Methods 0.000 claims description 5
- 108010048367 enhanced green fluorescent protein Proteins 0.000 claims description 4
- 239000004503 fine granule Substances 0.000 claims description 4
- 239000000843 powder Substances 0.000 claims description 4
- 239000003826 tablet Substances 0.000 claims description 4
- 208000015181 infectious disease Diseases 0.000 claims description 3
- 108010054624 red fluorescent protein Proteins 0.000 claims description 3
- 108010077850 Nuclear Localization Signals Proteins 0.000 claims description 2
- 239000002671 adjuvant Substances 0.000 claims description 2
- 238000003306 harvesting Methods 0.000 claims description 2
- 229940124590 live attenuated vaccine Drugs 0.000 claims description 2
- 229940023012 live-attenuated vaccine Drugs 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 claims description 2
- 238000012216 screening Methods 0.000 claims description 2
- 230000002779 inactivation Effects 0.000 claims 1
- 208000007407 African swine fever Diseases 0.000 abstract description 12
- 230000001018 virulence Effects 0.000 abstract description 7
- 231100000636 lethal dose Toxicity 0.000 abstract description 5
- 238000012217 deletion Methods 0.000 abstract description 4
- 230000037430 deletion Effects 0.000 abstract description 4
- 238000010171 animal model Methods 0.000 abstract description 2
- 229940079593 drug Drugs 0.000 abstract 1
- 230000028996 humoral immune response Effects 0.000 abstract 1
- 238000012224 gene deletion Methods 0.000 description 20
- 241001465754 Metazoa Species 0.000 description 12
- 238000010276 construction Methods 0.000 description 10
- 238000011529 RT qPCR Methods 0.000 description 9
- 230000036760 body temperature Effects 0.000 description 8
- 208000024891 symptom Diseases 0.000 description 7
- 238000001514 detection method Methods 0.000 description 5
- 230000000694 effects Effects 0.000 description 5
- 239000000243 solution Substances 0.000 description 5
- 241000282887 Suidae Species 0.000 description 4
- 230000003053 immunization Effects 0.000 description 4
- 238000002649 immunization Methods 0.000 description 4
- 239000000523 sample Substances 0.000 description 4
- 229940031626 subunit vaccine Drugs 0.000 description 4
- 208000020401 Depressive disease Diseases 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000007689 inspection Methods 0.000 description 3
- 201000003102 mental depression Diseases 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 231100000419 toxicity Toxicity 0.000 description 3
- 230000001988 toxicity Effects 0.000 description 3
- 208000022531 anorexia Diseases 0.000 description 2
- 102000036639 antigens Human genes 0.000 description 2
- 108091007433 antigens Proteins 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 206010061428 decreased appetite Diseases 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 230000005847 immunogenicity Effects 0.000 description 2
- 101150057545 p72 gene Proteins 0.000 description 2
- 230000001681 protective effect Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 210000002966 serum Anatomy 0.000 description 2
- 230000004083 survival effect Effects 0.000 description 2
- 238000001890 transfection Methods 0.000 description 2
- 238000002965 ELISA Methods 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 241000255969 Pieris brassicae Species 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 229940031567 attenuated vaccine Drugs 0.000 description 1
- 238000012550 audit Methods 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000002552 dosage form Substances 0.000 description 1
- 230000002900 effect on cell Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 230000017188 evasion or tolerance of host immune response Effects 0.000 description 1
- 238000003209 gene knockout Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000010438 heat treatment Methods 0.000 description 1
- 230000004727 humoral immunity Effects 0.000 description 1
- 230000036039 immunity Effects 0.000 description 1
- 230000000415 inactivating effect Effects 0.000 description 1
- 230000001939 inductive effect Effects 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 239000002054 inoculum Substances 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000007918 intramuscular administration Methods 0.000 description 1
- 238000010255 intramuscular injection Methods 0.000 description 1
- 239000007927 intramuscular injection Substances 0.000 description 1
- 231100000518 lethal Toxicity 0.000 description 1
- 230000001665 lethal effect Effects 0.000 description 1
- 238000007726 management method Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 230000002906 microbiologic effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000004237 neck muscle Anatomy 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 230000030648 nucleus localization Effects 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 230000003950 pathogenic mechanism Effects 0.000 description 1
- 230000007918 pathogenicity Effects 0.000 description 1
- 239000002574 poison Substances 0.000 description 1
- 231100000614 poison Toxicity 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000002035 prolonged effect Effects 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 101150003509 tag gene Proteins 0.000 description 1
- 231100000820 toxicity test Toxicity 0.000 description 1
- 238000002255 vaccination Methods 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application relates to an African swine fever virus attenuated strain, a preparation method thereof and application thereof in preparing medicines (e.g. vaccines) for preventing African swine fever virus infection. The african swine fever virus attenuated strain has a deletion of a137R and CD2V double genes or functional fragments thereof in the genome relative to a wild-type strain; compared with a wild type virus strain, the virulence of the strain is greatly reduced, the strain can induce high-level humoral immune response against African swine fever virus, and can protect experimental animals from being attacked by a lethal dose of African swine fever virus virulent strain, so that the strain has excellent application prospect in the aspect of preventing African swine fever virus infection.
Description
Technical Field
The application belongs to the technical field of bioengineering, and particularly relates to an African swine fever virus attenuated strain, a preparation method and application thereof.
Background
African swine fever (African swine fever, ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (African swine fever virus, ASFV), and is listed as a legal report epidemic by the world animal health Organization (OIE), which is listed as a class of animal epidemic in China. .
However, since basic researches on the functions and immunology of genes and proteins related to African swine fever virus are very limited, no commercial vaccine against African swine fever virus exists in China in terms of prevention and control technology. Research in the past decades has shown that ASFV inactivated vaccines, while capable of inducing antibodies in immunized animals, do not provide effective protection against virulent challenge; compared with an inactivated vaccine, the subunit vaccine can improve the effective antigen content and has higher safety, but the African swine fever subunit vaccine can excite targeted humoral immunity, but has limited effect on cell immunity, and in addition, the subunit vaccine can hardly be used as a subunit vaccine to immunize animals to completely and effectively resist virulent attack, and can be effective only by combining multiple protein antigens.
The gene related to the virulence of the virus is knocked out through a genetic engineering technology, and the construction of the African swine fever gene deletion strain is an effective means for researching the interaction of the virus and an organism, developing a pathogenic mechanism, immune escape and developing a vaccine. In the prior art, construction of I177L, MGF isogenic deletion strains is carried out, however, because better balance is difficult to realize between reducing toxicity and maintaining immunogenicity, the African swine fever vaccine is not approved to be marketed in other countries except for African swine fever attenuated vaccine with I177L deletion marketed in 2022 in Vietnam.
In view of the above, there is a strong need for an african swine fever virus vaccine that has both high safety and sufficient immunoprotection.
The information disclosed in this background section is only for enhancement of understanding of the general background of the application and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.
Disclosure of Invention
Object of the Invention
In view of the above-mentioned drawbacks of the prior art, it is an object of the present application to provide an attenuated strain of african swine fever virus having a greatly reduced virulence and sufficient immunoprotection, a method for its preparation and its use in the preparation of a medicament (in particular a vaccine) for preventing infection by african swine fever virus.
Solution scheme
In order to achieve the purpose of the application, the application provides the following technical scheme:
in a first aspect, the application provides an attenuated strain of african swine fever virus which lacks in its genome the following genes or fragments thereof relative to wild-type african swine fever virus:
(1) A137R gene or a functional fragment thereof; and
(2) CD2V gene or a functional fragment thereof.
In a possible embodiment, the wild-type african swine fever virus is an african swine fever virus type II, preferably selected from the group consisting of: huB2019, pig/CN/HLJ/2018 (GeneBank accession number MK 333180.1), ASFV-SY18, georgia 2008/1, georgia 2007/1, ASFV GZ2018, most preferably HuB 2019.
In a possible embodiment, the A137R gene or a functional fragment thereof is represented by SEQ ID NO: 1:
atggaagcagttcttaccaaactcgaccaggaggaaaaaaaggctctccaaaattttcatcgttgtgcttgggaagaaactaaaaatattataaacgattttcttgaaatccctgaggaacgatgcacctataaattcaactcatacacaaaaaaaatggagcttttatttacccctgaattccacaccgcctggcatgaagttcctgagtgcagagagttcatattaaactttttgagactcatttcgggacatcgagtggtattaaaaggccctacatttgtttttacaaaagagatcaagaatctgggcattcctagtaccatcaatgttgactttcaggccaacattgaaaatatggatgatctacagaagggaaatctcatcggcaagatgaatatcaaagaaggctaa(SEQ ID NO:1)。
in a possible embodiment, the CD2V gene or functional fragment thereof is as shown in SEQ ID No. 2:
atgataatacttatttttttaatattttctaacatagttttaagtattgattattgggttagttttaataaaacaataattttagatagtaatattactaatgataataatgatataaatggagtatcatggaatttttttaataattcttttaatacactagctacatgtggaaaagcaggtaacttttgtgaatgttctaattatagtacatcaatatataatataacaaataattgtagcttaactatttttcctcataatgatgtatttgatacaacatatcaagtagtatggaatcaaataattaattatacaataaaattattaacacctgctactcccccaaatatcacatataattgtactaattttttaataacatgtaaaaaaaataatggaacaaacactaatatatatttaaatataaatgatacttttgttaaatatactaatgaaagtatacttgaatataactggaataatagtaacattaacaattttacagctacatgtataattaataatacaattagtacatctaatgaaacaacacttataaattgtacttatttaacattgtcatctaactatttttatactttttttaaattatattatattccattaagcatcataattgggataacaataagtattcttcttatatccatcataacttttttatctttacgaaaaagaaaaaaacatgttgaagaaatagaaagtccaccacctgaatctaatgaagaagaacaatgtcagcatgatgacaccacttccatacatgaaccatctcccagagaaccattacttcctaagccttacagtcgttatcagtataatacacctatttactacatgcgtccctcaacacaaccactcaacccatttcccttacctaaaccgtgtcctccacccaaaccatgtccgccacccaaaccatgtcctccacctaaaccatgtccttcagctgaatcctattctccacccaaaccactacctagtatcccgctactacccaatatcccgccattatctacccaaaatatttcgcttattcacgtagatagaattatttaa(SEQ ID NO:2)。
in a second aspect, the present application provides a method for preparing an attenuated strain of african swine fever virus as described in the first aspect above, comprising the steps of:
the A137R gene or the fragment thereof and the CD2V gene or the fragment thereof of the wild African swine fever virus are deleted by genetic engineering means.
In a possible embodiment, the genetic engineering means is CRISPR-Cas9 technology in combination with homologous recombination technology, comprising in particular the following steps:
s1) constructing a CRISPR-Cas9 plasmid respectively comprising Guide RNA sequences aiming at a CD2v gene or a functional fragment thereof and an A137R gene or a functional fragment thereof to be knocked out;
s2) constructing homologous recombinant plasmids respectively comprising a homologous recombination frame of a CD2v gene and a homologous recombination frame of an A137R gene; and, a step of, in the first embodiment,
s3) co-transfecting PAM cells with the constructed CRISPR-Cas9 plasmid and the homologous recombinant plasmid, then inoculating wild African swine fever virus strains, and screening to obtain the African swine fever virus attenuated strain which simultaneously lacks the CD2V gene or the functional fragment thereof and the A137R gene or the functional fragment thereof.
Preferably, in the step S1), three Guide RNA sequences aiming at the CD2v gene to be knocked out or the functional fragment thereof are respectively shown as SEQ ID NO. 3, 4 and 5;
and/or three Guide RNA sequences aiming at A137R genes or functional fragments thereof to be knocked out are respectively shown in SEQ ID NO. 6, 7 and 8;
preferably, the CRISPR-Cas9 plasmid is framed by a PX458 vector in which 2 nuclear localization signal sequences are removed.
Preferably, in step S2), the homologous recombination box of the CD2v gene comprises: a 1065bp homologous recombination arm upstream of the CD2v open reading frame, a first Loxp recombination site, a p72 promoter sequence, an enhanced green fluorescent protein, a second Loxp recombination site, and a 974bp homologous recombination arm downstream of the CD2v open reading frame;
and/or, the homologous recombination box of the a137R gene comprises: a 1000bp homologous recombination arm upstream of the A137R open reading frame, a first Loxp recombination site, a p72 promoter sequence, a red fluorescent protein, a second Loxp recombination site, and a 1000bp homologous recombination arm downstream of the A137R open reading frame.
In a third aspect, the present application provides an african swine fever virus-expressing protein which is a protein expressed by an attenuated strain of african swine fever virus as described in the first aspect above, preferably a whole protein expressed thereby.
In a fourth aspect, the application provides the use of an attenuated strain of african swine fever virus as described in the first aspect above or an african swine fever virus expression protein as described in the third aspect above in the manufacture of a medicament for preventing infection by african swine fever virus.
Preferably, the medicament is a vaccine, more preferably an attenuated live vaccine, a whole virus inactivated vaccine or a protein vaccine;
further preferably, the vaccine is in the form of an oral or parenteral formulation;
optionally, the oral formulation is selected from the group consisting of tablets, powders, granules, and oral liquids; further optionally, the granule is a fine granule;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
In a fifth aspect, the present application provides an african swine fever virus attenuated live vaccine comprising the african swine fever virus attenuated strain as described in the first aspect as an active ingredient;
preferably, in the attenuated live vaccine, the virus content of the African swine fever virus attenuated strain is more than or equal to 10TCID 50 /ml；
Preferably, the live attenuated vaccine is in the form of an oral formulation or a parenteral formulation;
optionally, the oral formulation is selected from the group consisting of tablets, powders, granules, and oral liquids; further optionally, the granule is a fine granule;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
In a sixth aspect, the present application provides a method for preparing an african swine fever virus attenuated live vaccine as described in the fifth aspect, comprising the steps of:
1) Inoculating the attenuated strain of African swine fever virus according to the first aspect into primary PAM cells, performing expansion culture, and harvesting virus liquid;
2) The virus content is more than or equal to 10TCID 50 The virus liquid/ml is directly or matched with an adjuvant to prepare the vaccine.
In a seventh aspect, the present application provides an african swine fever virus attenuated strain whole virus inactivated vaccine, which comprises an inactivated whole virus obtained by inactivating the african swine fever virus attenuated strain according to the first aspect as an active ingredient;
preferably, the inactivated vaccine is in the form of a parenteral formulation;
optionally, the parenteral formulation is an injectable or a bolus formulation; .
In an eighth aspect, the present application provides an african swine fever virus attenuated whole protein vaccine comprising an african swine fever virus expression protein as described in the third aspect above as an active ingredient;
preferably, the whole protein vaccine is in the form of a parenteral formulation;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
In a ninth aspect, the present application provides a method of preventing african swine fever virus disease comprising: administering to a subject in need thereof a prophylactically effective amount of an african swine fever virus attenuated strain as described in the first aspect above, or an african swine fever virus expressed protein as described in the third aspect above, or an african swine fever virus attenuated live vaccine as described in the fifth aspect above, or an african swine fever virus attenuated whole virus inactivated vaccine as described in the seventh aspect above, or an african swine fever virus attenuated whole protein vaccine as described in the eighth aspect above.
The "prophylactically effective amount" may be determined according to the judgment of the veterinarian in view of the local african swine fever epidemic situation, the kind of dosage form, the administration method, etc.
Advantageous effects
The application carries out double gene deletion of A137R and CD2v on wild African swine fever virus by a genetic engineering means to construct an attenuated strain of the African swine fever virus; the constructed African swine fever virus attenuated strain has the following advantages:
(1) The toxicity is reduced fully; compared with wild virus, the toxicity is greatly reduced, so that the virus has extremely high safety;
(2) Stable characteristics and good genetic stability, so that the possibility of reverting to wild type viruses is extremely low;
(3) Can induce animals to generate effective immune protection reaction, thereby protecting animals from the attack of the parental african swine fever virus virulent strain with lethal dose;
(4) When constructing the African swine fever virus attenuated strain, a loxp element can be inserted into the genome of the strain, and if necessary, a fluorescent tag gene introduced during gene knockout can be removed.
In view of the above, the African swine fever virus attenuated strain provided by the application is a candidate strain of an African swine fever virus vaccine (especially an attenuated live vaccine) with great potential, and has a good application prospect in the aspect of preventing African swine fever virus infection.
Drawings
One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings. The word "exemplary" is used herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.
FIG. 1 is a schematic diagram showing the construction of ASFV mutant ASFV ΔCD2v/A137R having double gene deletions of A137R and CD2v described in example 1 of the present application.
FIG. 2 shows the results of PCR identification of recombinant virus strains having single gene deletions of CD2v and A137R and double gene deletions of CD2v/A137R described in example 1 of the present application.
FIG. 3 shows qPCR identification results of recombinant strains deleted for CD2v/A137R double gene described in example 1 of the present application; wherein A is the qPCR amplification curve of the p72 gene, B is the qPCR amplification curve of the CD2v gene, and C is the qPCR amplification curve of the A137R gene.
FIG. 4 is a graph showing the survival rate of piglets in ASFV ΔCD2v/A137R vaccinated and control groups described in example 4 of the present application.
FIG. 5 shows the temperature profile (upper panel) and clinical symptom scores (lower panel) of ASFV ΔCD2v/A137R vaccinated and control piglets according to example 4 of the present application after challenge.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the embodiments of the present application more apparent, the technical solutions in the embodiments of the present application will be clearly and completely described below, and it is apparent that the described embodiments are some embodiments of the present application, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.
In addition, numerous specific details are set forth in the following description in order to provide a better illustration of the application. It will be understood by those skilled in the art that the present application may be practiced without some of these specific details. In some embodiments, materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail in order to highlight the gist of the present application.
Throughout the specification and claims, unless explicitly stated otherwise, the term "comprise" or variations thereof such as "comprises" or "comprising", etc. will be understood to include the stated element or component without excluding other elements or components.
Biosafety permissions and african swine fever laboratory activity permissions: according to the biological safety 3-level laboratory (ABSL-3) and the related biological safety requirements of African swine fever, the biological safety management committee of China veterinary medicine inspection institute and the ethical committee of laboratory animal welfare are adopted to audit, the activity permission of the agricultural rural department about developing the high pathogenicity animal pathogenic microorganisms including ASFV is obtained by China veterinary medicine inspection, and the activity permission of the agricultural rural department is recorded, and the related ASFV test activity is developed in the national veterinary microbiological center ABSL-3 laboratory of China veterinary medicine inspection institute, so as to meet the corresponding grade requirements of national biological safety.
EXAMPLE 1 construction and identification of ASFV recombinant strains with single gene deletions of CD2v and A137R and double gene deletions of CD2v/A137R
In this example, based on ASFV HuB2019 strain, CD2v single gene deletion (hereinafter abbreviated as ASFV Δcd2v), a137R single gene deletion (hereinafter abbreviated as ASFV Δa137R) and ASFV recombinant strain (hereinafter abbreviated as ASFV Δcd2v/a 137R) with CD2v and a137R double gene deletion were respectively constructed by CRISPR-Cas9 and homologous recombination and other genetic engineering techniques, and identified.
The construction schematic of the ASFV recombinant strain ASFV delta CD2v/A137R with double gene deletion of CD2v and A137R is shown in figure 1.
1.1 construction of Single Gene or double Gene deletion strains
1.1.1 Construction of CRISPR-Cas9 plasmids
Specifically, the PX458 vector (nanjing kusnezoff biotechnology company) is taken as a skeleton, 2 nuclear localization NLS sequences thereof are removed, and three different guide RNA sequences (see table 1) for CD2v gene and a137R gene are inserted respectively, thereby constructing 3 CRISPR-Cas9 plasmids for CD2v and a137R gene.
TABLE 1 guide RNA sequences for knocking out the CD2v and A137R genes
1.1.2 construction of homologous recombinant plasmids
Specifically, a plasmid pBlueScriptSK-2 (division of biological engineering (Shanghai)) is used as a skeleton, and homologous recombination frames of CD2v and A137R genes are respectively inserted into the skeleton, so that homologous recombination plasmids of the two genes are constructed.
Wherein the homologous recombination cassette for knocking out the CD2v gene comprises: a 1065bp homologous recombination arm upstream of the CD2v open reading frame (see fragment between 72279nt and 73343nt of ASFV MK333180.1 strain in GenBank), a first Loxp recombination site, a p72 promoter sequence (located between 105559nt and 105597nt of the negative strand of the reference strain), an enhanced green fluorescent protein (eGFP), a second Loxp recombination site, and a 974bp homologous recombination arm downstream of the CD2v open reading frame (located between 74443nt and 75416nt of the reference strain); homologous recombination cassettes for knockout of the a137R gene include: a1000 bp homologous recombination arm upstream of the A137R open reading frame (see fragment between 53566nt and 54565nt of ASFV MK333180.1 strain in GenBank), a first Loxp recombination site, a p72 promoter sequence, a red fluorescent protein (mCherry), a second Loxp recombination site, and a 1000bp homologous recombination arm downstream of the A137R open reading frame (located between 54985nt and 55984nt of the above-mentioned reference strain).
1.1.3 transfection of plasmids
Specifically, according to the instructions of lipofectamine 3000 transfection kit produced by Thermo Fisher Scientific, the constructed CRISPR-Cas9 plasmid and the homologous recombination plasmid are transfected together into PAM cells (for the construction of single gene deleted virus strain, the CRISPR-Cas9 plasmid and the homologous recombination plasmid aiming at the single gene can be transfected together into PAM cells; for the construction of double gene deleted virus strain, the CRISPR-Cas9 plasmid and the homologous recombination plasmid aiming at the two genes can be transfected together into PAM cells), and then ASFV HuB2019 strain is inoculated for cell culture; selecting culture holes containing green and/or red fluorescent cells, and carrying out continuous limiting dilution for about 12 generations to obtain the purified recombinant virus strain.
1.2 PCR identification of Single Gene or double Gene deleted strains
Specifically, a pair of primers was designed on the left and right homologous recombination arms of CD2v and A137R (see Table 2), and DNA was extracted from viruses cultured with PAM cells, and PCR amplification and electrophoresis detection were performed according to a conventional method, and the results are shown in FIG. 2.
TABLE 2 primers for detecting deletion strains by ordinary PCR
For ASFV HuB2019 parent strain, amplified CD2v fragment is expected to be 2189bp; for ASFV ΔCD2v and ASFV ΔCD2v/A137R strains, the amplified CD2v fragment is expected to be 1916bp; for ASFV HuB2019 parent strain, the amplified A137R fragment is expected to be 564bp; for ASFV ΔA137R and ASFV ΔCD2v/A137R strains, the amplified A137R fragment is expected to be 963bp.
As can be seen from FIG. 2, PCR identified that ASFV ΔCD2v, ASFV ΔA137R and ASFV ΔCD2v/A137R all amplified single, expected size gene fragments, indicating that: the recombinant virus strains of the single gene deletion of the CD2v and the A137R and the double gene deletion of the CD2v/A137R are successfully and purely constructed.
1.3 qPCR identification of double Gene deleted strains
Specifically, qPCR primers and probes are designed with the aim of amplifying p72, CD2v and A137R genes; DNA was extracted from the CD2v/A137R double gene deletion recombinant virus cultured by PAM cells, and qPCR was performed using primers and probes shown in the table, and the results are shown in FIG. 3.
TABLE 3 primers and probes for qPCR identification of ASFV ΔCD2v/A137R strain
It is expected that the parental strain should be able to detect the three genes p72, CD2v and a137R, whereas the CD2v/a137R double gene deleted strain could detect the p72 gene, but neither CD2v nor a137R gene.
As can be seen from fig. 3, qPCR identification results meet the above expectation, which suggests that: the recombinant virus strain with the CD2v/A137R double gene deletion is successfully constructed.
Example 2 virulence test of CD2v and A137R double Gene deleted ASFV strains
In this example, about 25 days old weaned SPF-line large white piglets (hereinafter referred to as SPF piglets, purchased from Peking SPF pig breeding management center) were inoculated by neck intramuscular injection at an inoculum size of 1ml per pig of 4 pigs, and 10 5 The double gene deletion strain ASFV delta CD2v/A137R of CD2v/A137R with TCID of 50/ml was observed for 28 consecutive days.
The results are shown in Table 4 below.
TABLE 4 safety of ASFV ΔCD2v/A137R strain in SPF piglets
As can be seen from table 4, only a short slight body temperature rise (not exceeding 41 ℃) and mental depression occurred on day 14 during the 28 days of observation, other days of observation were normal and all 4 piglets survived, indicating that: compared with the parent strain, the virulence of the double-gene deletion strain is obviously weakened, and the double-gene deletion strain has better safety.
EXAMPLE 3 immunogenicity detection of CD2v and A137R double Gene deleted ASFV strains
With reference to example 2, 4 piglets were given at 10 5 TCID 50/head, double gene deleted strain ASFV Δcd2v/a137R by neck muscle immunization, ASFV P30 antibody detection kit (purchased from the biotechnology company, beijing, nuo-baitai) was used within 27 days after inoculation, and ASFV P30 specific antibody levels in serum were determined according to the instructions of the kit.
The results are shown in Table 5 below.
TABLE 5 ELISA detection results of ASFV P30-specific antibodies in serum after immunization of animals
Description: the values in the table are the sample S/P values; the calculation method of the S/P value is as follows:
wherein NC represents negative control, PC represents positive control, and the kit is self-contained; and wherein->
The judgment standard is as follows: S/P is more than or equal to 0.4 and positive, S/P is more than 0.4 and more than 0.3 and suspicious, and S/P is less than or equal to 0.3 and negative. The shaded area in the table shows the detection results of the antibody positivity.
Table 5 shows that ASFV-specific antibodies were detectable in 1 piglet starting on day 10 after vaccination, all piglets detected ASFV-specific antibodies by day 18, and antibody levels increased generally with prolonged immunization time during the observation period.
EXAMPLE 4 immune challenge protection test of CD2v and A137R double Gene deleted ASFV strains
First, determining virulence of a parent virulent strain ASFV HuB 2019; specifically, the virulent strain ASFV HuB2019 blood poison is diluted to 1HAD50, 10HAD50 and 100HAD50/ml by PBS gradient, SPF susceptible English white piglets (6 heads of each group, untreated piglets are used as a control group) purchased from the Beijing SPF pig breeding management center are intramuscular injected through the neck according to 1 ml/head pig, the symptoms are continuously observed for 21 days, the anal temperature is measured daily, the body temperature is continuously increased by 41 ℃ for 2 days or more, obvious symptoms such as mental depression, anorexia, camping and lying or dying animals appear, and the position is euthanized.
The results of toxicity tests using body temperature exceeding 41℃as the heating standard are shown in Table 6 below.
TABLE 6 virulence of virulent strain ASFV HuB2019 in SPF pigs
Table 6 shows that piglets of the 100HAD50 vaccinated group die from day 4 to day 9 at 6/6, wherein all but none of the piglets died on day 4 HAD heat, and the body temperature exceeded 41 ℃; the piglets of the 10HAD50 vaccinated group, except that the body temperature of 1 animal is not higher than 41 ℃ and survives, the rest 5/6 animals generate heat which is higher than 41 ℃ and die; while all piglets of the 1.0HAD50 vaccinated group and the control group showed no obvious symptoms and all survived.
In view of the above results, 100HAD was used as follows 50 As a lethal challenge dose, the challenge protective effect of the double gene deletion strain ASFV Δcd2v/a137R was tested.
Specifically, it will be 10 5 3 piglets (numbered 1#, 2#, 4# in fig. 5) after TCID 50/head immunization with the double gene deleted strain ASFV Δcd2v/a137R 28 days and 2 piglets (numbered 13#, 33# in fig. 5) of the control group were challenged with 100HAD50 lethal doses of virulent ASFV HuB2019, respectively, and observed for 21 days, and the results are shown in table 7, fig. 4 and fig. 5.
TABLE 7 protective efficacy of double Gene deleted strain ASFV ΔCD2v/A137R against lethal doses of ASFV HuB2019 in SPF pigs
FIG. 4 shows the survival rates of ASFV ΔCD2v/A137R vaccinated and control groups; it shows that: the piglets of ASFV delta CD2v/A137R vaccinated group all survived during the observation period, while the piglets of the control group died within 10 days; this demonstrates that ASFV delta CD2v/A137R immunized piglets are well immune protected and can resist the attack of a lethal dose of virulent strain ASFV HuB 2019.
FIG. 5 shows changes in body temperature (upper panel) and scores for clinical symptoms after challenge for ASFV ΔCD2v/A137R vaccinated and control groups (lower panel); the results of fig. 5 show that: ASFV delta CD2v/A137R immune group three piglets have no ASF related symptoms, and the body temperature is not higher than 40 ℃; and the two piglets of the control group have ASF symptoms such as body temperature rise exceeding 41 ℃, mental depression, anorexia and the like.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present application, and are not limiting; although the application has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Claims (13)
1. An attenuated strain of african swine fever virus which lacks in the genome the following genes or fragments thereof relative to wild-type african swine fever virus:
(1) A137R gene or a functional fragment thereof; and
(2) CD2V gene or a functional fragment thereof.
2. An attenuated strain of african swine fever virus according to claim 1, wherein the wild-type african swine fever virus is an african swine fever virus type II, preferably selected from: huB2019, pig/CN/HLJ/2018, ASFV-SY18, georgia 2008/1, georgia 2007/1, ASFV GZ2018, most preferably HuB 2019;
and/or the A137R gene or the functional fragment thereof is shown in SEQ ID NO. 1;
and/or the CD2V gene or the functional fragment thereof is shown as SEQ ID NO. 2.
3.A method of preparing an attenuated strain of african swine fever virus according to any one of claims 1-2, comprising the steps of:
the A137R gene or the fragment thereof and the CD2V gene or the fragment thereof of the wild African swine fever virus are deleted by genetic engineering means.
4. The preparation method according to claim 3, wherein the genetic engineering means is CRISPR-Cas9 technology combined with homologous recombination technology, specifically comprising the steps of:
s1) constructing a CRISPR-Cas9 plasmid respectively comprising Guide RNA sequences aiming at a CD2v gene or a functional fragment thereof and an A137R gene or a functional fragment thereof to be knocked out;
s2) constructing homologous recombinant plasmids respectively comprising a homologous recombination frame of a CD2v gene and a homologous recombination frame of an A137R gene; and, a step of, in the first embodiment,
s3) co-transfecting PAM cells with the constructed CRISPR-Cas9 plasmid and the homologous recombinant plasmid, then inoculating wild African swine fever virus strains, and screening to obtain the African swine fever virus attenuated strain which simultaneously lacks the CD2V gene or the functional fragment thereof and the A137R gene or the functional fragment thereof.
5. The method according to claim 4, wherein in step S1), three Guide RNA sequences for the CD2v gene or the functional fragment thereof to be knocked out are shown as SEQ ID NOs 3, 4 and 5, respectively;
and/or three Guide RNA sequences aiming at A137R genes or functional fragments thereof to be knocked out are respectively shown in SEQ ID NO. 6, 7 and 8;
preferably, the CRISPR-Cas9 plasmid is framed by a PX458 vector in which 2 nuclear localization signal sequences are removed.
6. The method according to claim 4 or 5, wherein in step S2), the homologous recombination cassette of the CD2v gene comprises: a 1065bp homologous recombination arm upstream of the CD2v open reading frame, a first Loxp recombination site, a p72 promoter sequence, an enhanced green fluorescent protein, a second Loxp recombination site, and a 974bp homologous recombination arm downstream of the CD2v open reading frame;
and/or, the homologous recombination box of the a137R gene comprises: a 1000bp homologous recombination arm upstream of the A137R open reading frame, a first Loxp recombination site, a p72 promoter sequence, a red fluorescent protein, a second Loxp recombination site, and a 1000bp homologous recombination arm downstream of the A137R open reading frame.
7. An african swine fever virus expressed protein, characterized in that it is a protein expressed by an attenuated strain of african swine fever virus according to claim 1 or 2, preferably a whole protein expressed thereby.
8. Use of an attenuated strain of african swine fever virus according to any one of claims 1-2 or an african swine fever virus expression protein according to claim 7 in the manufacture of a medicament for preventing infection by african swine fever virus.
9. Use according to claim 8, wherein the medicament is a vaccine, preferably an attenuated live vaccine, a whole virus inactivated vaccine or a protein vaccine;
preferably, the vaccine is in the form of an oral or parenteral formulation;
optionally, the oral formulation is selected from the group consisting of tablets, powders, granules, and oral liquids; further optionally, the granule is a fine granule;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
10. An african swine fever virus attenuated live vaccine comprising the african swine fever virus attenuated strain of any one of claims 1-2 as an active ingredient;
preferably, in the attenuated live vaccine, the virus content of the African swine fever virus attenuated strain is more than or equal to 10TCID 50 /ml；
Preferably, the live attenuated vaccine is in the form of an oral formulation or a parenteral formulation;
optionally, the oral formulation is selected from the group consisting of tablets, powders, granules, and oral liquids; further optionally, the granule is a fine granule;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
11. The method for preparing the african swine fever virus attenuated live vaccine according to claim 10, wherein the preparation method comprises the steps of:
1) Inoculating the attenuated strain of the African swine fever virus according to any one of claims 1-2 into primary PAM cells, performing expansion culture, and harvesting virus liquid;
2) The virus content is more than or equal to 10TCID 50 The virus liquid/ml is directly or matched with an adjuvant to prepare the vaccine.
12. An attenuated strain whole virus inactivated vaccine for african swine fever virus, comprising the whole virus inactivated by the inactivation treatment of the attenuated strain of african swine fever virus according to any one of claims 1 to 2 as an active ingredient;
preferably, the inactivated vaccine is in the form of a parenteral formulation;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
13. An african swine fever virus attenuated whole protein vaccine comprising the african swine fever virus expression protein of claim 7 as an active ingredient;
preferably, the whole protein vaccine is in the form of a parenteral formulation;
alternatively, the parenteral formulation is an injectable or a bolus formulation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311203922.8A CN117230027A (en) | 2023-09-18 | 2023-09-18 | African swine fever virus attenuated strain, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311203922.8A CN117230027A (en) | 2023-09-18 | 2023-09-18 | African swine fever virus attenuated strain, preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117230027A true CN117230027A (en) | 2023-12-15 |
Family
ID=89082187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311203922.8A Pending CN117230027A (en) | 2023-09-18 | 2023-09-18 | African swine fever virus attenuated strain, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117230027A (en) |
-
2023
- 2023-09-18 CN CN202311203922.8A patent/CN117230027A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Urbano et al. | African swine fever control and prevention: an update on vaccine development | |
| Tran et al. | African swine fever virus vaccine candidate ASFV‐G‐ΔI177L efficiently protects European and native pig breeds against circulating Vietnamese field strain | |
| CN110093324B (en) | Attenuated African swine fever virus with gene deletion and application thereof as vaccine | |
| De Los Santos et al. | The need for improved vaccines against foot-and-mouth disease | |
| CN104862286B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| Van Den Doel et al. | Recombinant modified vaccinia virus Ankara expressing glycoprotein E2 of Chikungunya virus protects AG129 mice against lethal challenge | |
| CN101633909B (en) | Attenuated live vaccine strain for preventing pig-pig infection breeding and respiratory syndrome | |
| CN108085302B (en) | Foot-and-mouth disease virus temperature sensitive attenuated strain and construction method and application thereof | |
| Iizuka et al. | A single vaccination of nonhuman primates with highly attenuated smallpox vaccine, LC16m8, provides long-term protection against monkeypox | |
| CN104988124A (en) | Genotype VII Newcastle disease virus marker vaccine strain and application thereof | |
| US20180243404A1 (en) | Idna vaccines and methods for using the same | |
| CN104130982A (en) | Recombinant pseudorabies virus, construction method and application thereof | |
| CN114107228B (en) | Construction of attenuated African swine fever virus strain with twelve genes deleted and application of attenuated African swine fever virus strain as vaccine | |
| Boutier et al. | Current knowledge and future prospects of vaccines against cyprinid herpesvirus 3 (CyHV-3) | |
| Xie et al. | Protection evaluation of a five-gene-deleted African swine fever virus vaccine candidate against homologous challenge | |
| EP3922724A1 (en) | Recombinant vector containing african swine fever virus immunogenic protein, recombinant bacteria, and application thereof | |
| Lesbros et al. | Protective efficacy of the calicivirus valency of the leucofeligen vaccine against a virulent heterologous challenge in kittens | |
| CN115851623A (en) | Construction of African swine fever MGF505-2R gene deletion attenuated strain and application of attenuated strain as vaccine | |
| CN114015660B (en) | Construction of ten-gene deleted attenuated African swine fever virus strain and application thereof as vaccine | |
| Adler et al. | A non-transmissible live attenuated SARS-CoV-2 vaccine | |
| AU2020103651A4 (en) | A vaccine composition of porcine pseudorabies virus variant strain, preparation method and application thereof | |
| CN116769735A (en) | Construction method and application of attenuated strain of alphavirus | |
| CN106916832B (en) | O-type foot-and-mouth disease virus recombinant nucleic acid, recombinant vaccine strain, preparation method and application thereof | |
| Hu et al. | Efficacy of Coxsackievirus A2 vaccine candidates correlating to humoral immunity in mice challenged with a mouse-adapted strain | |
| EP3960850A1 (en) | Attenuated african swine fever virus with deleted gene and use of same as vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |