CN117222669A - Humanized antibodies to iRhom2 - Google Patents

Abstract

The present application relates to humanized antibodies, or target binding fragments or derivatives thereof that retain the ability to bind to a target, which bind to human iRhom 2.

Description

Humanized antibodies to iRhom2

Technical Field

The present application relates to humanized antibodies against iRhom 2.

Background

ADAM metallopeptidase domain 17 (ADAM 17) (NCBI reference of human ADAM 17: NP-003174), also known as TACE (tumor necrosis factor-alpha converting enzyme), is an enzyme belonging to the ADAM protein family of desmin and metalloproteases. It is a 824 amino acid polypeptide.

ADAM17 is understood to be involved in cell surface treatment of tumor necrosis factor-alpha (TNF-alpha) and is derived from the intracellular membrane of the reverse golgi network. This process, also known as "shedding", involves cleavage and release of the soluble extracellular domain from a membrane-bound preprotein (e.g., pro-TNF- α), and is of known physiological importance. ADAM17 is the first identified "abscisse" and is also understood to play a role in the release of various membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

Cloning of the TNF- α gene revealed that it encodes a 26kDa type II transmembrane pro-polypeptide that inserts into the cell membrane during translocation in the endoplasmic reticulum. On the cell surface, pro-TNF- α is biologically active and is capable of inducing an immune response through near-secretory intercellular signaling. However, pro-TNF- α can be proteolytically cleaved at its Ala76-Val77 amide bond, which releases the soluble 17kDa extracellular domain (ectodomain) from the pro-TNF- α molecule. The soluble extracellular domain is a cytokine commonly known as TNF- α, which is critical in paracrine signaling of the molecule. The proteolytic release of soluble TNF- α is catalyzed by ADAM 17.

ADAM17 also regulates MAP kinase signaling pathways by modulating cleavage of EGFR ligand amphiregulin in the breast. ADAM17 is important for activating several ligands for EGFR, TGF alpha, AREG, EREG, HB-EGF, epigen. In addition, ADAM17 plays a role in the shedding of L-selectin, a cell adhesion molecule.

Recently, ADAM17 was found to be a key mediator of the development of radiation resistance. Radiation therapy has also been shown to activate ADAM17 in non-small cell lung cancer, which results in multiple survival factor shedding, growth factor pathway activation, and radiation therapy-induced therapeutic resistance.

ADAM17 has been the focus of attention as a therapeutic target molecule, as it appears to be a critical factor in the release of various pathogenic and non-pathogenic factors including TNF alpha. For this reason, different attempts have been made to develop inhibitors of ADAM 17.

However, to date, such inhibitors have not proven clinically successful.

It is therefore an object of the present invention to provide a novel method allowing control, regulation, reduction or inhibition of ADAM17 activity.

It is another object of the present invention to provide a novel method that allows for the treatment of inflammatory diseases.

These and other objects are solved by the features of the independent claims. The dependent claims disclose embodiments of the invention which may be preferred in particular cases. Also, the present specification discloses further embodiments of the invention that may be preferred in certain circumstances.

Disclosure of Invention

The invention provides, inter alia, humanized antibodies that bind to human iRhom 2. In one embodiment, these antibodies inhibit and/or reduce TACE/ADAM17 activity when bound to human iRhom 2.

Drawings

FIG. 1 provides the results of antibody affinity assays by FACS (fluorescence opportunity cell sorting) Stockchard analysis on populations of genetically engineered mouse L929 cells expressing T7-tagged Full Length (FL) wild-type (WT) human iRhom2 (ectopic expression by L929-2041-hiR2-FL-WT-T7 (SEQ ID NO 49)). These results indicate that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02, and 42-B-04 bind L929-2041-hiR2-FL-WT-T7 cells with KD values in the sub-nanomolar to low nanomolar range.

FIG. 2a depicts the results of FACS analysis of a population of genetically engineered Mouse Embryonic Fibroblasts (MEFs), showing that T7-tagged variants of the full-length wild-type of human and mouse iRhom2 expressed ectopically by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO 49) and MEF-DKO-miR2-FL-WT-T7 (SEQ ID NO 51) cells, respectively, are located on the surface of these cells. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 2B shows the results of FACS analysis for determining mouse cross-reactivity of the antibodies of the invention, indicating that humanized antibody 16-B-03, which is a representative example of the antibodies of the invention, clearly recognizes the human iRhom2 variant ectopically expressed by MEF-DKO-hiR2-FL-WT-T7, but does not recognize the mouse iRhom2 variant ectopically expressed by MEF-DKO-miR2-FL-WT-T7 cells, and thus does not cross-react with mouse iRhom 2. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 3a depicts the results of FACS analysis of a population of genetically engineered MEFs, showing that T7-tagged variants of the full-length wild-type human iRhom1 ectopic expressed by MEF-DKO-hiR1-FL-WT-T7 (SEQ ID NO 50) and the full-length wild-type human iRhom2 ectopic expressed by MEF-DKO-hiR-FL-WT-T7 (SEQ ID NO 49) cells are located on the surface of these cells, respectively. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 3B shows the results of FACS analysis for determining the specificity of the antibodies of the invention, indicating that humanized antibody 16-B-0, which is a representative example of the antibodies of the invention, contrasts with the human iRhom2 variant ectopically expressed by MEF-DKO-hiR2-FL-WT-T7 (SEQ ID NO 49) cells-does not recognize the closely related human iRhom1 variant ectopically expressed by MEF-DKO-hiR1-FL-WT-T7 (SEQ ID NO 50), and is therefore specific for human iRhom 2. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 4a depicts the results of FACS analysis of a population of genetically engineered MEFs, showing that the T7-tagged form of the full-length wild-type rhesus iRhom1 expressed ectopically by MEF-DKO-rhesus-iR 1-FL-WT-T7 (uniProt identifier: F6ZPC 8) cells and the T7-tagged form of the full-length wild-type rhesus iRhom2 expressed ectopically by MEF-DKO-rhesus-iR 2-FL-WT-T7 (uniProt identifier: F6Y4X 6) cells, respectively, are located on the surface of these cells. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 4B shows the results of FACS analysis for determining the cross-reactivity of the antibodies of the invention with rhesus monkeys, indicating that humanized antibodies 16-B-03, which are representative examples of the antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 clearly recognize rhesus monkey iRhom2 variants ectopic expressed by MEF-DKO-rhesus monkey-iR 2-FL-WT-T7, but do not recognize rhesus monkey iRhom1 variants ectopic expressed by MEF-DKO-rhesus monkey-iR 1-FL-WT-T7 cells, and thus cross-react with rhesus monkey iRhom2, but do not bind to rhesus monkey iRhom 1. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 5a depicts the results of FACS analysis of a genetically engineered MEF population, showing that the T7-tagged form of the full-length wild-type cynomolgus monkey irom 1 expressed ectopically by MEF-DKO-cynomolgus monkey-iR 1-FL-WT-T7 (uniProt identifier: A0A2K5TX 07) cells and the T7-tagged form of the full-length wild-type cynomolgus monkey irom 2 expressed ectopically by MEF-DKO-cynomolgus monkey-iR 2-FL-WT-T7 (uniProt identifier: A0A2K5TX 07) cells, respectively, are located on the surface of these cells. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 5B shows the results of FACS analysis for determining the cross-reactivity of the antibodies of the invention with cynomolgus monkeys, indicating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 clearly recognize cynomolgus monkey iRhom2 variants ex-expressed by MEF-DKO-cynomolgus monkey-iR 2-FL-WT-T7, but do not recognize cynomolgus monkey iRhom1 variants ex-expressed by MEF-DKO-cynomolgus monkey-iR 2-FL-WT-T7 cells, and thus cross-react with cynomolgus monkey iRhom2, but do not bind to cynomolgus monkey iRhom1 variants. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 6a depicts the results of FACS analysis of a genetically engineered MEF population, showing that the T7-tagged form of the full-length wild-type of dog irom 1 expressed ectopically by MEF-DKO-dog-iR 1-FL-WT-T7 (UniProt identifier: A0A5F4CNN 3) and the T7-tagged form of the full-length wild-type of dog irom 2 expressed ectopically by MEF-DKO-dog-iR 2-FL-WT-T7 (UniProt identifier: Q00M 95) are located on the surface of these cells, respectively. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 6B shows the results of FACS analysis for determining the cross-reactivity of the antibodies of the present invention with dogs, indicating that humanized antibodies 16-B-03, which are representative examples of the antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, clearly recognize the variant of canine iRhom2 ectopic expressed by MEF-DKO-canine-iR 2-FL-WT-T7, but do not recognize the variant of canine iRhom1 ectopic expressed by MEF-DKO-canine-iR 1-FL-WT-T7 cells, and thus cross-react with canine iRhom2, but do not bind to canine iRhom 1. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 7a depicts the results of FACS analysis of a genetically engineered MEF population, showing that the T7-tagged form of the full-length wild-type rabbit iRhom1 expressed ectopically by MEF-DKO-rabbit-iR 1-FL-WT-T7 (UniProt identifier: B8K 128) cells and the T7-tagged form of the full-length wild-type rabbit iRhom2 expressed ectopically by MEF-DKO-rabbit-iR 2-FL-WT-T7 (UniProt identifier: G1T7M 2) cells, respectively, are located on the surface of these cells. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 7B shows the results of FACS analysis for determining the cross-reactivity of the antibodies of the present invention with rabbits, indicating that humanized antibodies 16-B-03, which are representative examples of the antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, clearly recognize the rabbit iRhom2 variant ectopically expressed by MEF-DKO-rabbit-iR 2-FL-WT-T7, but do not recognize the rabbit iRhom1 variant ectopically expressed by MEF-DKO-rabbit-iR 1-FL-WT-T7 cells, and thus cross-react with rabbit iRhom2, but do not bind to rabbit iRhom 1. Dyeing: gray = secondary antibody only; black = antibody 16-B-03

FIG. 8a shows the results of a TNFα release assay demonstrating that the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention interfere with LPS-induced TNFα shedding in THP-1 cells. The data illustrate the effect of the test sample in absolute numbers of tnfα released.

FIG. 8b is the result depicted in FIG. 8a and illustrates the effect of the test agent on TNFα release as a percent of inhibition.

FIG. 9a shows the results of a TNFα release assay demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 interfere with PMA-induced TNFα shedding in U937 cells. The data illustrate the effect of the test sample in absolute numbers of tnfα released.

FIG. 9b is the result depicted in FIG. 9a and illustrates the effect of the test agent on TNFα release as a percent of inhibition.

FIG. 10a shows the results of an IL-6R release assay, demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention interfere with PMA-induced IL-6R shedding in THP-1 cells. The data illustrate the effect of the test sample in absolute terms of IL-6R released.

FIG. 10b is the result depicted in FIG. 10a and illustrates the effect of the test agent on IL-6R release in percent inhibition.

FIG. 11a shows the results of an IL-6R release assay, demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention interfere with PMA-induced IL-6R shedding in U937 cells. The data illustrate the effect of the test sample in absolute terms of IL-6R released.

FIG. 11b is the result depicted in FIG. 11a and illustrates the effect of the test agent on IL-6R release in percent inhibition.

FIG. 12a shows the results of HB-EGF release assay demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention interfere with PMA-induced HB-EGF shedding in THP-1 cells. The data demonstrate the effect of the test sample in terms of absolute numbers of HB-EGF released.

FIG. 12b is the result described in FIG. 12a and illustrates the effect of the test article on HB-EGF release in percent inhibition.

FIG. 13a shows the results of HB-EGF release assay demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 interfere with PMA-induced HB-EGF shedding in U937 cells. The data demonstrate the effect of the test sample in terms of absolute numbers of HB-EGF released.

FIG. 13b is the result described in FIG. 13a and illustrates the effect of the test article on HB-EGF release in percent inhibition.

FIG. 14a shows the results of a TGF-alpha release assay, demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention interfere with PMA-induced TGF-alpha shedding in PC3 cells. The data demonstrate the effect of the test sample in absolute numbers of tgfα released.

FIG. 14b is the result depicted in FIG. 14a and illustrates the effect of the test agent on TGF-alpha release in percent inhibition.

FIG. 15 shows the results of a FACS analysis for determining the specificity of the antibodies of the present invention, indicating that humanized antibody 42-B-02, which is a representative example of the antibodies of the present invention, binds to RPMI-8226 (left panel) and THP-1 cells (middle panel), both of which endogenously express iRhom2, but not to RH-30 cells that do not endogenously express iRhom2 (right panel), and thus specifically recognizes endogenous human iRhom2. The antibodies analyzed were produced in CHO cells by transient expression of the corresponding heavy/kappa light chain pairs. Dyeing: gray = secondary antibody only; black = humanized antibody 42-B-02

Figure 16a depicts the results of FACS analysis of MEF populations with single amino acid substitutions or deletions within the large extracellular loops (AA 502 to AA594 of human iRhom 2), which were genetically engineered for epitope determination. The data shows that-similar to the T7-tagged variant of the full-length wild-type human iRhom2 ectopic expressed by MEF-DKO-hiR 2-FL-WT-T7-the T7-tagged human iRhom2 variant hiR-FL-K536A ectopic expressed by MEF-DKO-hiR-FL-K536A-T7 cells is also located on the surface of these cells. Dyeing: gray = secondary antibody only; black = anti-T7 antibody

FIG. 16b shows the results of a TGF-alpha release assay (abscission assay) showing that all 137 human iRhom2 variants with single amino acid substitutions or deletions within the large extracellular loop (AA 502 to AA594 of human iRhom 2) are functionally active, except for human iRhom2 variants hiR2-FL-C516A, hiR2-FL-F523A, hiR2-FL-C549A, hiR2-FL-D552A, hiR2-FL-C556A, hiR-FL-P559A, hiR2-FL-W567A, hiR2-FL-W574A and hiR2-FL-C577A, and that PMA stimulated abscission of TGF-alpha can be supported to varying degrees, indicating that these variants are most likely to be folded correctly.

FIG. 17a depicts the results of FACS analysis of epitope determination for antibodies of the present invention. The entire panel of all 128 human iRhom2 variants with single amino acid substitutions or deletions within the large extracellular loop (AA 502 to AA594 of human iRhom 2) shows exemplarily analytical data for MEF-DKO-hiR2-FL-K536A-T7 cells that ectopically express human iRhom2 variant hiR-FL-K536A. The data indicate that the single amino acid leucine 536 in human iRhom2 is strongly attenuated by substitution with alanine and thus contributes to binding to humanized antibody 42-B-02, which is a representative example of an antibody of the invention. Dyeing: gray = secondary antibody only; black = humanized antibody 42-B-02

Figure 17b summarizes the results of FACS analysis of all antibodies of the invention over the entire panel of 128 engineered functional MEF populations with single amino acid substitutions or deletions for ectopic expression of human iRhom2 variants within a large extracellular loop (AA 502 to AA594 of human iRhom 2). The data reveal the pattern of correlation of amino acid positions associated with iRhom2 binding of the antibodies of the invention.

Fig. 18a shows the results of a tnfα release assay, indicating that all antibodies of the invention interfere with LPS-induced tnfα shedding in human Peripheral Blood Mononuclear Cells (PBMCs) isolated from healthy donors. The data illustrate the effect of the test sample in absolute numbers of tnfα released. The humanized antibodies analyzed were generated in CHO cells from the transient expression of the corresponding heavy chain/kappa light chain pairs.

FIG. 18b is the result depicted in FIG. 18a and illustrates the effect of the test agent on TNFα release as a percent of inhibition.

FIG. 19a shows the results of an IL-6R release assay, demonstrating that all antibodies of the invention interfere with PMA-induced IL-6R shedding in human Peripheral Blood Mononuclear Cells (PBMC) isolated from healthy donors. The data illustrate the effect of the test sample in absolute terms of IL-6R released. The humanized antibodies analyzed were generated in CHO cells from the transient expression of the corresponding heavy chain/kappa light chain pairs.

FIG. 19b is the result depicted in FIG. 19a and illustrates the effect of the test agent on IL-6R release in percent inhibition.

FIG. 20a shows the results of HB-EGF release assay, indicating that all antibodies of the invention interfere with PMA-induced HB-EGF shedding in human Peripheral Blood Mononuclear Cells (PBMC) isolated from healthy donors. The data demonstrate the effect of the test sample in terms of absolute numbers of HB-EGF released. The humanized antibodies analyzed were generated in CHO cells from the transient expression of the corresponding heavy chain/kappa light chain pairs.

FIG. 20b is the result described in FIG. 20a and illustrates the effect of the test article on HB-EGF release in percent inhibition.

FIG. 21a shows the results of an in vivo septic shock model in genetically humanized mice, demonstrating that humanized antibody 42-B-02, which is a representative example of an antibody of the invention, interferes with LPS-induced TNF alpha shedding in genetically humanized mice. The data illustrate the effect of the test sample in absolute numbers of tnfα released. The humanized antibodies analyzed were generated from transient expression of the corresponding heavy/kappa light chain pairs in CHO cells.

Figure 21b is the results described in figure 21a and illustrates the effect of the test article on tnfα release as a percentage compared to the buffer treated control animals (set to 100%).

Detailed Description

According to one aspect of the present invention there is provided a humanized antibody that binds iRhom2, or a target binding fragment or derivative thereof that retains target binding capacity, which

a) Comprising a set of three heavy chain Complementarity Determining Regions (CDRs) and three light chain Complementarity Determining Regions (CDRs) contained in one of the following heavy chain/light chain variable domain sequence pairs:

SEQ ID NOs 1 and 5;

SEQ ID NOs 9 and 13;

SEQ ID NOs 17 and 21;

SEQ ID NOs 25 and 29;

SEQ ID NOs 33 and 37 or

SEQ ID NOs 41 and 45,

b) Comprising a set of three heavy chain Complementarity Determining Regions (CDRs) and three light chain Complementarity Determining Regions (CDRs) selected from the group consisting of

SEQ ID NOs 2, 3, 4, 6, 7 and 8,

SEQ ID NOs 10, 11, 12, 14, 15 and 16,

SEQ ID NOs 18, 19, 20, 22, 23 and 24,

SEQ ID NOs 26, 27, 28, 30, 31 and 32,

SEQ ID NOs 34, 35, 36, 38, 39 and 40, or

SEQ ID NOs 42, 43, 44, 46, 47 and 48,

c) A set of heavy/light chain Complementarity Determining Regions (CDRs) comprising b), provided that at least one of the CDRs has at most 3 amino acid substitutions relative to the corresponding SEQ ID NO, and/or

d) A heavy/light chain Complementarity Determining Region (CDR) set comprising b) or c), provided that at least one of the CDRs has ≡66% sequence identity to the corresponding CDR comprised in SEQ ID NO.

CDRs are embedded within a suitable protein framework, preferably a variable domain framework, in order to be able to bind to human iRhom 2.

In one embodiment, the CDRs are determined according to the definition of Kabat, chothia or MacCallum, preferably wherein the CDRs are determined according to the numbering described in table 1.

Methods for the production and/or selection of humanized mabs are known in the art. For example, US6331415 by Genentech describes the production of chimeric antibodies, while US6548640 by the medical research committee describes CDR grafting techniques, and US5859205 by Celltech describes the production of humanized antibodies.

Humanized antibodies are antibodies in which the complementarity determining regions are derived from a parent antibody taken from a non-human species and grafted into the framework (at least the variable domain) of a human antibody, such as IgG1, igG2 or IgG 4. Humanized antibodies bind to the same target as the parent antibody, but have reduced immunogenicity (e.g., HAMA reactions) due to their transplantation into the human framework. To this end, humanized antibodies are structurally different from their parent (e.g., murine) antibodies.

In humanization, the step of grafting CDRs into the human framework is typically preceded by an affinity maturation step to again acquire the affinity lost during the grafting process. This process further modifies the sequence of the human antibody, including its CDRs.

In one embodiment, the CDRs are embedded in a suitable protein framework so as to be able to inhibit or reduce TACE/ADAM17 activity.

Inactive diamond-shaped protein family member 2 (iRhom 2) is a protein encoded by the RHBDF2 gene in humans. It is a transmembrane protein consisting of approximately 850 amino acids with seven transmembrane domains.

iRhom2 has different isoforms. Experiments performed herein were established with the isoforms defined by NCBI reference np_ 078875.4. However, the teachings can be switched to other isoforms of iRhom2, as shown in the following table, without limitation:

mRNA	proteins	Name of the name
			NM_024599.5	NP_078875.4	Inactive diamond-shaped protein 2 transcript variant 1/isoform 1
NM_001005498.3	NP_001005498.2	Inactive diamond-shaped protein 2 transcript variant 2/isoform 2

As used herein, the term "inhibit and/or reduce TACE/ADAM17 activity" refers to describe the effect caused by an antibody or fragment that blocks or reduces TACE/ADAM17 activity, as measured, for example, in a corresponding shedding assay (see, e.g., fig. 8 and example 6).

ADAM metallopeptidase domain 17 (ADAM 17), also known as TACE (tumor necrosis factor-alpha converting enzyme), is an enzyme belonging to the ADAM protein family of desmin and metalloproteases. ADAM17 is understood to be involved in the processing of tumor necrosis factor-alpha (TNF-alpha) at the cell surface and is derived from the intracellular membrane of the reverse golgi network. This process, also known as "shedding", involves cleavage and release of the soluble extracellular domain from a membrane-bound preprotein (e.g., pro-TNF- α), and is of known physiological importance. ADAM17 is the first identified "abscisse" and is also understood to play a role in the release of various membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes.

Cloning of the TNF- α gene revealed that it encodes a 26kDa type II transmembrane pro-polypeptide that inserts into the cell membrane during maturation. On the cell surface, pro-TNF- α is biologically active and is capable of inducing an immune response via near-secretory intercellular signaling. However, pro-TNF- α can be proteolytically cleaved at its Ala76-Val77 amide bond, which releases the soluble 17kDa extracellular domain (ectodomain) from the pro-TNF- α molecule. The soluble extracellular domain is a cytokine commonly known as TNF- α, which is critical in paracrine signaling of the molecule. The proteolytic release of soluble TNF- α is catalyzed by ADAM 17.

Recently, ADAM17 was found to be a key mediator of resistance to radiotherapy. It has also been shown that radiotherapy activates ADAM17 in non-small cell lung cancer, which results in multiple survival factor shedding, growth factor pathway activation, and radiotherapy-induced therapeutic resistance.

ADAM17 can also regulate MAP kinase signaling pathways by modulating shedding of EGFR ligand amphiregulin in the breast. ADAM17 also plays a role in the shedding of L-selectin, a cell adhesion molecule.

As used herein, the term "CDR" or "complementarity determining region" is intended to mean a discontinuous antigen binding site found within the variable regions of both heavy and light chain polypeptides. These specific regions are described by Kabat et al (1977), kabat et al (1991), chothia et al (1987) and maccalum et al (1996), wherein the definition includes overlapping or subsets of amino acid residues when compared to each other. However, the application of definition refers to the CDRs of an antibody or grafted antibody or variant thereof being intended to be within the scope of the terms defined and used herein. Amino acid residues comprising CDRs defined by each of the above cited references are shown as alignment in table 1 below.

	Kabat	Chothia	MacCallum
				VH CDR1	31-35	26-32	30-35
VH CDR2	50-65	53-55	47-58
				VH CDR3	95-102	96-101	93-101
VL CDR1	24-34	26-32	30-36
				VL CDR2	50-56	50-52	46-55
VL CDR3	89-97	91-96	89-96

Table 1: CDR definition

As used herein, the term "framework" when used in reference to an antibody variable domain is entered to mean all amino acid residues outside of the CDR regions within the antibody variable domain. Thus, the variable domain framework is between about 100-120 amino acids in length, but only those outside of the CDR are meant.

As used herein, the term "capable of binding to target X" is understood to mean that the corresponding binding domain is at 10 ^-4 Or less K _D Binds to the target. K (K) _D Is the equilibrium dissociation constant between an antibody or fragment and its antigen, i.e., k _off /k _on Is a ratio of (2). K (K) _D Inversely proportional to affinity. K (K) _D The value relates to the concentration of the antibody or fragment (the amount of antibody or fragment required for a particular experiment), so K _D The lower the value (lower the concentration), the higher the affinity of the binding domain. The following table shows typical K of monoclonal antibodies _D Range.

Table 2: k (K) _D And mole value

Preferably, the antibody or fragment has at most 2 amino acid substitutions, and more preferably at most 1 amino acid substitution.

Preferably, at least one of the CDRs of the antibody or fragment has ≡67% to the corresponding SEQ ID NO; more than or equal to 68 percent; more than or equal to 69 percent; more than or equal to 70 percent; more than or equal to 71 percent; more than or equal to 72 percent; more than or equal to 73 percent; more than or equal to 74 percent; more than or equal to 75 percent; more than or equal to 76 percent; more than or equal to 77 percent; more than or equal to 78 percent; more than or equal to 79 percent; more than or equal to 80 percent; more than or equal to 81 percent; not less than 82%; more than or equal to 83 percent; more than or equal to 84 percent; more than or equal to 85 percent; more than or equal to 86 percent; not less than 87%; more than or equal to 88 percent; more than or equal to 89 percent; more than or equal to 90 percent; more than or equal to 91 percent; not less than 92%; more than or equal to 93 percent; more than or equal to 94 percent; more than or equal to 95 percent; not less than 96%; more than or equal to 97 percent; more than or equal to 98 percent; 99% and most preferably 100% sequence identity.

As used herein, a "percentage of sequence identity" is determined by comparing two optimally aligned biological sequences (amino acid sequences or polynucleotide sequences) over a comparison window, wherein the portion of the corresponding sequence in the comparison window may contain additions or deletions (i.e., gaps) as compared to a reference sequence that does not include additions or deletions, for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in the two sequences where the same nucleobase or amino acid residue occurs to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window and multiplying the result by 100 to obtain the percentage of sequence identity.

In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "percent identity" refers to two or more sequences or subsequences that are the same sequence. When compared and aligned over a comparison window or designated region to obtain maximum correspondence, two sequences are "substantially identical" if they have a designated percentage of identical amino acid residues or nucleotides (i.e., at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity over the entire sequence of the reference sequence when either over the designated region or not designated), as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. The present disclosure provides polypeptides substantially identical to the polypeptides exemplified herein. For amino acid sequences, the identity or substantial identity may be present over a region of at least 5, 10, 15, or 20 amino acids in length, optionally at least about 25, 30, 35, 40, 50, 75, or 100 amino acids in length, optionally at least about 150, 200, or 250 amino acids in length, or over the full length reference sequence. For shorter amino acid sequences, e.g., amino acid sequences of 20 or less amino acids, substantial identity exists when one or both amino acid residues are conservatively substituted, as defined herein.

Preferably, at least one of the CDRs is modified by a CDR sequence comprising

Affinity maturation

Reduction of immunogenicity

Affinity maturation is a process that increases the affinity of a given antibody in vitro. In vitro affinity maturation is based on the principle of mutation and screening, as is the natural counterpart. It has been successfully used to optimize antibodies, antibody fragments or other peptide molecules such as antibody mimics. Random mutations within the CDRs were introduced using radiation, chemical mutagens or error-prone PCR. Furthermore, genetic diversity can be increased by strand shuffling. Two or three rounds of mutation and screening using phage display and the like display methods typically result in antibody fragments with affinities in the low nanomolar range. For principle, see Eylenstein et al (2016) or US20050169925A1, the contents of which are incorporated herein by reference for all purposes.

The engineered antibodies contain mouse sequence-derived CDR regions that have been grafted into sequence-derived V regions along with any required framework back mutations. Thus, when a humanized antibody is administered to a patient, the CDRs themselves can elicit an immunogenic response. Methods of reducing immunogenicity caused by CDRs are disclosed in Harding et al ((2010), or US2014227251A1, the contents of which are incorporated herein by reference for all purposes.

According to one embodiment of the invention, the antibody or fragment comprises

a) The heavy chain/light chain variable domain (HCVD/LCVD) pair shown in the following SEQ ID NO pair:

1 and 5;

9 and 13;

17 and 21;

25 and 29;

33 and 37 and/or

41 and 45

b) a) heavy chain/light chain variable domain (HCVD/LCVD) pair, provided that

HCVD has a sequence identity of > 80% with the corresponding SEQ ID NO, and/or

LCVD has a sequence identity of > 80% with the corresponding SEQ ID NO,

c) a) or b) with the proviso that at least one of HCVD or LCVD has at most 10 amino acid substitutions relative to the corresponding SEQ ID NO,

the antibody or fragment is still capable of binding to human iRhom2 and/or inhibiting or reducing TACE/ADAM17 activity.

When referring to an antibody or heavy or light chain thereof, "variable domain" is intended to mean a portion of an antibody that confers antigen binding to a molecule and is not a constant region. The term is intended to include functional fragments that retain a portion of the overall binding function of the entire variable region. Variable region binding fragments include, for example, functional fragments such as Fab, F (ab) ₂ Fv, single chain Fv (scfv), and the like. Such functional fragments are well known to those skilled in the art. Thus, the use of these terms in describing a functional fragment of a heterogeneous variable region is intended to correspond to the definitions known to those skilled in the art. Such terms are described, for example, in Huston et al (1993) or Pluckthun and Skerra (1990).

HCVD and/or LCVD and corresponding SEQ ID NO have more than or equal to 81%; not less than 82%; more than or equal to 83 percent; more than or equal to 84 percent; more than or equal to 85 percent; more than or equal to 86 percent; not less than 87%; more than or equal to 88 percent; more than or equal to 89 percent; more than or equal to 90 percent; more than or equal to 91 percent; not less than 92%; more than or equal to 93 percent; more than or equal to 94 percent; more than or equal to 95 percent; not less than 96%; more than or equal to 97 percent; more than or equal to 98 percent; 99% or more; or most preferably 100% sequence identity.

According to one embodiment of the invention, the at least one amino acid substitution is a conservative amino acid substitution.

As used herein, "conservative amino acid substitutions" have less effect on antibody function than non-conservative substitutions. Although there are many ways of amino acid classification, they are generally classified into 6 major categories based on their structure and the general chemical characteristics of their R groups.

In some embodiments, a "conservative amino acid substitution" is a substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. For example, the art defines families of amino acid residues with similar side chains. These families include amino acids with the following:

basic side chains (e.g., lysine, arginine, histidine),

acidic side chains (e.g., aspartic acid, glutamic acid),

uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine),

Nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan),

beta branched side chains (e.g., threonine, valine, isoleucine) and

aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

Other conservative amino acid substitutions may also occur across a family of amino acid side chains, such as when asparagine is substituted for aspartic acid to alter the charge of the peptide. Conservative changes may further include substitutions of chemically homologous unnatural amino acids (i.e., synthetic unnatural hydrophobic amino acids for leucine, synthetic unnatural aromatic amino acids for tryptophan).

According to one embodiment of the invention, the antibody or fragment has at least one of the following:

target binding affinity to human iRhom2 > 50% compared to an antibody or fragment according to any one of the preceding claims, and/or,

an inhibitory or reducing effect of an antibody or fragment according to any one of the preceding claims on TACE/ADAM17 activity of ≡50%.

As used herein, the term "binding affinity" is intended to mean the strength of the binding interaction and thus includes both the actual binding affinity and apparent binding affinity. The actual binding affinity is the ratio of association rate to dissociation rate. Thus, imparting or optimizing binding affinity includes altering either or both of these components to achieve a desired binding affinity level. Apparent affinity may include, for example, affinity for interaction. For example, a bivalent heteromeric variable region binding fragment exhibits altered or optimized binding affinity due to its valence state.

Suitable methods for measuring affinity of binding agents are achieved by Surface Plasmon Resonance (SPR). The method is based on phenomena that occur when a surface plasmon wave is excited at a metal/liquid interface. Light is directed to and reflected from the side of the surface not in contact with the sample, and SPR causes a decrease in reflected light intensity at a specific combination of angle and wavelength. The biomolecule-binding events cause changes in the refractive index of the surface layer, which are detected as changes in the SPR signal. The binding event may be a binding association or dissociation between the receptor-ligand pair. The change in refractive index can be measured substantially instantaneously, thus allowing the determination of the individual components of the affinity constant. More specifically, the method enables accurate measurement of association rate (k _on ) Dissociation rate (k) _off )。

k _on And k _off Measurement of values may be advantageous because they may identify altered variable regions or optimized variable regions that are more therapeutically effective. For example, an altered variable region or heteromeric binding fragment thereof may be more effective because it has a higher k than a variable region and heteromeric binding fragment having similar binding affinity _on Values. Due to having a higher k _on Molecules of the value can specifically bind and inhibit their targets at a faster rate, thus imparting increased potency. Similarly, the molecule of the invention is more efficient because it has a lower k than a molecule with similar binding affinity _on Values. It can be observed that the use of a higher k _off The observed efficacy of a molecule of value increases because once bound, the molecule will dissociate from its target more slowly. Although described with respect to altered variable regions and optimized variable regions of the invention (including heteromeric variable region binding fragments thereof), the methods described above for measuring association and dissociation rates can be applied to essentially any antibody or fragment thereof to identify more effective binding agents for therapeutic or diagnostic purposes.

Another suitable method for measuring affinity of binding agents is by surface via FACS/scatchard analysis. The corresponding description is given in particular in example 1.

Methods for measuring affinity (including association and dissociation rates) using surface plasmon resonance are well known in the art and can be found, for example, in Jonsson and Malmquist (1992) and Wu et al (1998). Furthermore, one device known in the art for measuring binding interactions is the BIAcore 2000 instrument, which is commercially available through Pharmacia Biosensor (Uppsala, sweden).

Preferably, the target binding affinity is greater than or equal to 51%, > 52%, > 53%, > 54%, > 55%, > 56%, > 57%, > 58%, > 59%, > 60%, > 61%, > 62%, > 63%, > 64%, > 65%, > 66%, > 67%, > 68%, > 69%, > 70%, > 71%, > 72%, > 73%, > 74%, > 75%, > 76%, > 77%, > 78%, > 80%, > 81%, > 82%, > 83%, > 84%, > 85%, > 86%, > 87%, > 88%, > 89%, > 90%, > 91%, > 92%, > 96%, > 93%, > 96%, > 99% and more preferably is greater than or equal to 95%.

As used herein, quantification of inhibition or reduction of TACE/ADAM17 activity compared to a reference binding agent is determined by suitable methods to determine tnfα shedding effects, as described in fig. 8 and example 6.

According to another aspect of the present invention there is provided a humanized antibody which binds to human iRhom2 and competes with the following for binding to human iRhom2

a) With antibodies according to the description above, and/or

b) Selected from clone 16-B-03;16-B-05;16-B-07;23-B-04;42-B-02; and/or 42-B-04.

According to another aspect of the invention there is provided a humanised antibody which binds to substantially the same, or the same, region on human iRhom2 as:

a) Antibodies according to the above description, and/or

b) Selected from clone 16-B-03;16-B-05;16-B-07;23-B-04;42-B-02; and/or 42-B-04.

Clone 16-B-03 was identified in the sequence listing herein; 16-B-05;16-B-07;23-B-04;42-B-02; and 42-B-04.

As used herein, the term "region" should be understood to mean an extracellular region, a domain, a subdomain, or a secondary structure (e.g., a loop), or preferably an epitope.

Regarding the form or structure of such antibodies or fragments, the same preferred embodiments as described above apply. In one embodiment, the antibody or fragment is a monoclonal antibody, or a target binding fragment or derivative thereof that retains the ability to bind a target, or an antibody mimetic.

As used herein, the term "competitive binding" is one of the antibodies defined with reference to the above sequences, meaning that the actual antibody or fragment exhibits activity in that the antibody or fragment defined by the sequence binds to the same target, or target epitope, or domain or subdomain, and is a variant of the latter. The efficiency of the binding (e.g., kinetic or thermodynamic) may be the same as or greater than or less than the efficiency of the latter. For example, the equilibrium binding constants of two antibodies to a substrate may be different.

Such binding competition can be suitably measured using competitive binding assays. Such assays are disclosed in Finco et al 2011, the contents of which are incorporated herein by reference for the purpose of implementation, and their meanings for interpreting the patent claims are disclosed in Deng et al 2018, the contents of which are incorporated herein by reference for the purpose of implementation.

To test this property, suitable epitope mapping techniques are available, including in particular

X-ray co-crystallography and cryogenic electron microscopy (cryo-EM)

Array-based oligopeptide scanning

Site-directed mutagenesis mapping

High throughput shotgun mutagenesis epitope mapping

Hydrogen-deuterium exchange

Cross-linking coupled mass spectrometry

These methods are disclosed and discussed in Banik et al (2010) and DeLister (1999), the contents of which are incorporated herein by reference for all purposes.

According to one embodiment, the antibody or fragment, when bound to human iRhom2, binds at least in the region of loop 1 of human iRhom 2. Loop 1 of iRhom2 comprises amino acid residues 474-660 of SEQ ID NO 49.

In another embodiment, the antibody or fragment does not bind to a membrane proximal domain (JMD) located on the N-terminal side of loop 1.

According to one embodiment of the invention, inhibition or reduction of TACE/ADAM17 activity is caused by an antibody or fragment interfering with iRhom2 mediated activation of TACE/ADAM17 or interaction of TACE/ADAM17 with other proteins including substrate molecules.

According to one embodiment of the invention, the antibody or fragment inhibits or reduces induced TNFa shedding upon binding to human iRhom 2.

According to one embodiment of the invention, the antibody or fragment inhibits or reduces induced IL-6R shedding upon binding to human iRhom 2.

According to one embodiment of the invention, the antibody or fragment inhibits or reduces the induced HB-EGF shedding upon binding to human iRhom 2.

As used herein, tumor necrosis factor alpha (tnfα) shedding or release refers to the process by which membrane-anchored tumor necrosis factor alpha (mTNF alpha/pro-tnfα) is released into the environment after cleavage to become soluble tnfα (stnfα or simply tnfα). This process is triggered in particular by TACE/ADAM 17.

Interleukin 6 receptor (IL-6R) release or shedding refers to the process of proteolytic cleavage of membrane-bound IL-6R by TACE/ADAM17 at a proteolytic site near its transmembrane domain on the cell surface to produce soluble IL-6R.

The release or shedding of heparin-binding EGF-like growth factor (HB-EGF) refers to a cleavage process that generates a soluble form of HB-EGF and leaves it free from the cell surface. Heparin-binding EGF-like growth factor, an epidermal growth factor with affinity for heparin, acts as a membrane-anchored mitogenic and chemotactic glycoprotein synthesis. HB-EGF was first identified in conditioned medium of human macrophage-like cells and was a 87 amino acid glycoprotein exhibiting highly regulated gene expression.

Suitable assays for determining tnfα shedding effects are described, for example, in fig. 8 and example 6. Suitable assay methods for determining the release or shedding of IL-6R and/or HB-EGF are described, for example, in FIG. 10 and example 8 or in FIG. 12 and example 10, respectively.

According to one embodiment of the invention, the human iRhom2 to which the antibody or fragment binds comprises

a) The amino acid sequence shown in SEQ ID NO 49, or

b) An amino acid sequence having at least 80% sequence identity to SEQ ID NO 49, provided that said sequence retains iRhom2 activity.

In some embodiments, human irom 2 comprises an amino acid sequence having greater than or equal to 81%, preferably greater than or equal to 82%, more preferably greater than or equal to 83%, > or equal to 84%, > or equal to 85%, > or equal to 86%, > or equal to 87%, > or equal to 88%, > or equal to 89%, > or equal to 90%, > or equal to 91%, > or equal to 92%, > or equal to 93%, > or equal to 94%, > or equal to 95%, > or equal to 96%, > or equal to 97%, > or equal to 98%, or most preferably greater than or equal to 99% sequence identity with SEQ ID NO 49.

SEQ ID NO 49 shows the amino acid sequence of the inactive diamond-shaped protein 2 (iRhom 2) isoform 1[ homo sapiens ] obtainable from NCBI reference NP-078875.4. Generally, there are different iRhom2 variants and isoforms. Likewise, mutants comprising conservative or silent amino acid substitutions are or may be present which retain full or at least substantial iRhom2 activity. These isoforms, variants and mutants are covered by the above-specified range of identity, however, this means that non-active variants and mutants that are dysfunctional are not included.

According to one embodiment of the invention, the antibody or fragment is a monoclonal antibody, or a target binding fragment or derivative thereof that retains the ability to bind a target.

According to one embodiment of the invention, the antibody or fragment according to the invention is in at least one form selected from the group consisting of: igG, scFv, fab or (Fab) 2.

As used herein, the term "monoclonal antibody (mAb)" shall refer to an antibody composition having a homogeneous population of antibodies, i.e., an antibody composition having a homogeneous population comprising whole immunoglobulins, or fragments or derivatives thereof that retain target binding capacity.

Particularly preferably, such antibodies are IgG antibodies, or fragments or derivatives thereof that retain the ability to bind a target. Immunoglobulin G (IgG) is a type of antibody. IgG accounts for about 75% of human serum antibodies, the most common type of antibody in the blood circulation. IgG molecules are produced and released by plasma B cells. Each IgG has two antigen binding sites.

IgG antibodies are macromolecules consisting of four peptide chains with a molecular weight of about 150 kDa. It contains two identical gamma heavy chains of about 50kDa and two identical light chains of about 25kDa and is therefore a tetrameric quaternary structure. The two heavy chains are linked to each other and to the light chain by disulfide bonds. The resulting tetramer has two identical halves which together form a Y-shape. Each end of the fork contains one and the same antigen binding site. The Fc region of IgG has a highly conserved N-glycosylation site. The N-polysaccharide linked to this site is mainly a complex core fucosyl double antenna structure. In addition, small amounts of these N-glycans also have bisecting GlcNAc and alpha-2, 6-linked sialic acid residues.

Four subclasses of IgG exist in humans (IgG 1, 2, 3 and 4), named in the order of their abundance in serum (IgG 1 is most abundant).

As used herein, the term "fragment" shall mean a fragment of such an antibody that retains the ability to target binding, e.g.,

CDRs (complementarity determining regions),

the region of high variation(s),

a variable region (Fv),

IgG or IgM heavy chain (composed of VH, CH1, hinge, CH2 and CH3 regions),

IgG or IgM light chain (composed of VL and CL regions) and/or

Fab and/or F (ab) ₂ 。

As used herein, the term "derivative" shall mean a protein construct that differs in structure from the general antibody concept but still has some structural relationship, e.g., scFv, fab, and/or F (ab) ₂ And bi-, tri-or higher specific antibody constructs, and which also protectLeaving the target binding capacity. All of these items will be explained below.

Other antibody derivatives known to those of skill in the art are diabodies, camelid antibodies, nanobodies, domain antibodies, bivalent homodimers with two chains consisting of scFvs, igA (two IgG structures linked by a J chain and a secretory component), shark antibodies, antibodies consisting of a new world primate framework plus CDRs from a non-new world primate, dimer constructs comprising ch3+vl+vh, and antibody conjugates (e.g., antibodies or fragments or derivatives linked to toxins, cytokines, radioisotopes or markers). These types are well described in the literature and can be used by those skilled in the art based on the present disclosure without further increasing the inventive activity.

&Methods for producing hybridoma cells are disclosed in Milstein (1975).

Methods for the production and/or screening of fully human mAbs are known in the art. These may involve the use of transgenic animals immunized with the corresponding protein or peptide, or the use of suitable display techniques such as yeast display, phage display, B cell display or ribosome display, wherein antibodies in the library are screened against human iRhom2 in the stationary phase.

In vitro antibody libraries are disclosed in MorphoSys U.S. Pat. No. 3,3779 and MRC/Scripps/Stratagene U.S. Pat. No. 6248516. Phage display technology is disclosed, for example, in US5223409 to Dyax. Transgenic mammalian platforms are described, for example, in EP1480515A2 to Taconicartemis.

IgG, igM, scFv, fab and/or F (ab) ₂ Are forms of antibodies well known to those skilled in the art. Related enabling techniques are available from the corresponding textbook.

As used herein, the term "Fab" refers to IgG/IgM fragments comprising antigen binding regions, said fragments comprising one constant domain and one variable domain from each heavy and light chain of an antibody.

As described hereinBy the term "F (ab) ₂ "relates to an IgG/IgM fragment comprising two Fab fragments linked to each other by a disulfide bond.

As used herein, the term "scFv" refers to a single chain variable fragment, which is a fusion of the variable regions of the heavy and light chains of an immunoglobulin, joined together with a short linker, typically serine (S) or glycine (G). Such chimeric molecules retain the original immunoglobulin specificity despite the removal of the constant region and the introduction of the linker peptide.

Modified antibody forms are, for example, bispecific or trispecific antibody constructs, antibody-based fusion proteins, immunoconjugates, etc. These types are well described in the literature and can be used by those skilled in the art of the present disclosure without further added inventive activity.

As used herein, the term "antibody mimetic" refers to an organic molecule, most commonly a protein that specifically binds to a target protein, similar to an antibody but structurally unrelated to an antibody. The antibody mimetic is typically an artificial peptide or protein having a molar mass of about 3 to 20 kDa. This definition covers, inter alia, affibody molecules, affilin, affimer, affinin, alphabody, anticalin, avimer, DARPin, fynomer, kunitz domain peptides, monobodies and nanomaterials.

In one or more embodiments, the antibody or fragment is an isolated antibody, or a target binding fragment or derivative thereof that retains the ability to bind a target, or an isolated antibody mimetic.

In one or more embodiments, the antibody is an engineered or recombinant antibody, or a target binding fragment or derivative thereof that retains the ability to bind a target, or an engineered or recombinant antibody mimetic.

According to one embodiment of the invention, the antibody or fragment is an antibody in the form of at least one selected from the group consisting of: igG, scFv, fab or (Fab) ₂ 。

According to one embodiment of the invention, the antibody or fragment does not cross-react with human iRhom 1. The sequence of human iRhom1 is disclosed herein as SEQ ID NO 50.

According to another aspect of the invention there is provided a nucleic acid encoding at least one strand of a binding agent according to the above description.

In one embodiment, a nucleic acid, or a pair of nucleic acids, encoding the heavy and light chains, respectively, of a binding agent is provided, in the case of a monoclonal antibody having a heteromeric structure of at least one light chain and one heavy chain.

Such nucleic acids may also be used for pharmaceutical purposes. The nucleic acid may be an RNA molecule, or an RNA derivative comprising, for example, a modified nucleotide such as pseudouridine (ψ) or N-1 methyl pseudouridine (m 1 ψ) to provide stability and reduce immunogenicity (see, e.g., US8278036 and US9428535, the contents of which are incorporated herein for the purposes of implementation). In another embodiment, the RNA comprises selecting the most GC-rich codons to provide stability and reduce immunogenicity (see, e.g., EP1392341, the contents of which are incorporated herein for purposes of implementation). mRNA can be delivered, for example, in suitable liposomes and contain specific sequences or modified uridine nucleotides to avoid immune responses and/or to improve folding and translation efficiency, sometimes containing cap modifications at the 5 'and/or 3' ends to target them to specific cell types. In several embodiments, the corresponding RNA sequence is selected from SEQ ID NO 100 to SEQ ID NO 147. See table below to find out which RNA encodes which antibody sequence.

Likewise, the nucleic acid may be a DNA molecule. In such cases, the molecule may be a cDNA, e.g., an attenuated, non-pathogenic virus, optionally integrated into a suitable vector, or provided as one or more plasmids. Such plasmids may be administered to a patient, for example, by electroporation means, as described in patent EP3397337B1, the contents of which are incorporated herein for the purpose of achieving this. In several embodiments, the corresponding DNA sequence is selected from SEQ ID NO 52 to SEQ ID NO 99. See table below to find which cDNA encodes which antibody sequence.

Generally, due to the degeneracy of the genetic code, there are a large number of different nucleic acids with codes for such chains. The person skilled in the art is well able to determine whether a given nucleic acid fulfils the above criteria. On the other hand, the person skilled in the art is fully able to reverse engineer a suitable nucleic acid encoding it from a given amino acid sequence based on a codon usage table. For this purpose, software tools such as "reverse translation" provided by the online tool "sequence operation suite" (https:// www.bioinformatics.org/sms2/rev_trans. Html) may be used. Thus, there are many alternative DNA and RNA sequences encoding the claimed protein sequences. Such alternative sequences should be considered to be within the scope of the present invention.

According to another aspect of the present invention there is provided an antibody or fragment or nucleic acid according to the above description (in preparation) for use in therapy

The inflammatory condition is diagnosed and is a patient diagnosed with an inflammatory condition,

suffering from inflammatory conditions or

At risk of developing inflammatory conditions

Or for the prevention of such conditions.

To diagnose an inflammatory condition, the patient is subjected to a physical examination and is also asked a medical history. Professionals may seek joint inflammation, joint stiffness, and joint loss. Furthermore, professionals may require X-ray and/or blood tests to detect inflammatory markers, as compared to healthy controls, such as, for example, serum hs-CRP, IL-6, TNF- α and IL-10, erythrocyte sedimentation rate, plasma viscosity, fibrinogen and/or ferritin.

According to another aspect of the present invention there is provided a pharmaceutical composition comprising an antibody or fragment or nucleic acid according to the above description, and optionally one or more pharmaceutically acceptable excipients.

According to another aspect of the invention there is provided a combination comprising (i) an antibody or fragment or nucleic acid according to the above description and (ii) one or more therapeutically active compounds.

According to another aspect of the present invention there is provided a method for treating or preventing an inflammatory condition, the method comprising administering to a human or animal subject (i) an antibody or fragment according to the above description, (ii) a nucleic acid according to the above description, (iii) a pharmaceutical composition according to the above description or (iv) a combination according to the above description, in a therapeutically sufficient dose.

According to another aspect of the present invention there is provided a therapeutic kit comprising:

a) An antibody or fragment according to the above description, a nucleic acid according to the above description, a pharmaceutical composition according to the above description or a combination according to the above description,

b) A device for administering said antibody, nucleic acid, pharmaceutical composition or composition, and

c) Instructions for use.

Examples

While the invention has been illustrated and described in detail in the drawings and foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive; the invention is not limited to the disclosed embodiments. Other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention, from a study of the drawings, the disclosure, and the appended claims. In the claims, the word "comprising" does not exclude other elements or steps, and the indefinite article "a" or "an" does not exclude a plurality. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims shall not be construed as limiting the scope.

All amino acid sequences disclosed herein are shown from N-terminus to C-terminus; all nucleic acid sequences disclosed herein are shown as 5'- > 3'.

General methods for antibody humanization

Humanization by CDR grafting is a proven successful technique to obtain antibodies from mice, other xenogeneic species or hybridomas and reduce potential immunogenicity while retaining the binding and functional activity of the parent antibody. Typically, starting from chimeric antibodies, the aim is to remove foreign Framework Regions (FR) in the variable domains that can elicit an immune response. The solution to this problem is to "graft" the Complementarity Determining Regions (CDRs) of a murine antibody onto the human acceptor framework.

However, performing only CDR grafting can result in a significant reduction or complete loss of binding affinity, as a set of support framework residues in the Vernier zone are important for maintaining the conformation of the CDRs. This problem can be solved by reintroducing the mouse residues into the human frame; such substitutions are commonly referred to as reverse mutations.

Since the most important property of therapeutic antibodies is activity, it is very important that the substitutions proposed during humanization do not affect the affinity or stability of the antibody. Over the last 20 years, a great deal of information has been collected with the advancement of protein modeling about: information on humanization and grafting of CDRs; the biophysical properties of the antibody, the conformation of the CDR loops, and the frame (enabling accurate humanization of antibodies with retained binding affinity and stability).

The humanization procedure was performed as follows:

1) Identification of parent antibody domains and regions

2) Identification of Critical position and potential post-translational modification (PTM)

Antibodies Fv have a number of key positions that constitute the VH/VL interchain interface, or are responsible for the canonical structure of a discrete set of 5 of the CDRs that have been defined: these positions should be considered in detail before a substitution is made for them.

Post-translational modifications (PTMs) can cause problems in the development of therapeutic proteins, such as increased heterogeneity, reduced biological activity, reduced stability, immunogenicity, fragmentation and aggregation. The potential impact of PTM depends on its location and in some cases on solvent exposure. The following potential PTM sequences were analyzed: aspartic acid deamidation, aspartic acid isomerisation, free cysteine sulfhydryl groups, N-glycosylation, oxidation of methionine and tryptophan.

3) Based on sequence analysis and key positions, the best acceptor human germline sequence was selected for each strand.

Based on the alignment with the parent antibody sequence of the human germline, the best matching entry was identified. The identification of the best human germline as a receptor is based on the following ordered criteria:

sequence identity across the entire V gene (framework+CDR)

Identical or compatible inter-chain interface residues

Support of loops with parent CDR canonical conformation

4) Construction of a 3D structural model of the Fv region of a parent mouse

5) After a careful examination of the molecular model, a preliminary evaluation was made of the likelihood of displacing each location. The positions are classified as neutral contribution positions or key positions. Single mutations that disrupt potential PTMs were also identified.

6) CDR grafting is performed by analyzing the different positions between the parent and acceptor sequences. All substitutions in the neutral position were made.

For the design phase of humanized antibodies, the procedure is more precisely defined as germline-substitution of the corresponding human amino acid for the amino acid in the parental framework that differs from the selected receptor.

7) Combinations of different humanized VH and VL forms were prepared, purified and tested for binding and bioactivity.

8) The best humanized heavy and light chain combinations between the different forms were screened by evaluating the following criteria:

a) The humanized form produced in mammalian cells (HEK 293 or preferably CHO) is taken as the transient expression level of human IgG1/Kapa (compared to chimeric forms). Tissue culture supernatants from transfected cells were used prior to harvest for purification using ELISA or for measurement by protein a using an Octet label-free detection system.

b) Binding capacity compared to chimeric human IgG1/Kapa format (chimeric means the combination of parental murine VH and VL fused to human constant region with human constant region) (EC 50 by ELISA or FACS; or preferably by Kd of Biacore or Ocete).

c) The biological activity of the humanized form in a related in vitro cell assay compared to the biological activity of a reference chimeric antibody.

d) Cross-reactivity (in vitro binding activity) with related orthologous gene sequence species.

e) Determination of biophysical properties of humanized forms compared to chimeric forms:

SEC-HPLC profile to determine the level of high molecular weight aggregates,

SDS-PAGE under non-reducing and reducing conditions,

use of micro cal ^TM VP capillary DSC systems were analyzed by Differential Scanning Calorimetry (DSC) to determine Tm for Fab, CH2, and CH 3.

General methods for antibody production

To produce recombinant antibody material, target DNA sequences are designed, optimized, and synthesized. The complete sequence was subcloned into the expression vector and a transfection-grade plasmid was maximally prepared for CHO cell expression. CHO cells were grown in CHO TF expression medium (Xell AG, germany) and transfected with recombinant plasmids encoding the target proteins. Cell culture supernatants collected on day 11 post-transfection were used for purification. The liquid cell culture broth was centrifuged and filtered. The filtered cell culture supernatant was applied to a Mab Select Prism A (Thermo Fisher, USA) affinity purification column at an appropriate flow rate. After washing and elution with the appropriate buffer, the eluted fractions are combined and buffer exchanged into the final formulation buffer. The purified proteins were subjected to molecular weight and purity measurements by SDS-PAGE analysis.

Example 1: affinity assay of humanized antibodies of the invention

In this study, affinity measurements were performed on the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention by performing an indirect FACS scatchard analysis on a mouse cell line of L920-2041-hiR2-FL-WT-T7 cells, a human iRhom 2-expressing cell line.

Production of L929-2041-hiR2-FL-WT-T7

To generate a cellular system for comparable and reliable binding assays for antibodies, L929 (NCTC clone 929) mouse fibroblasts (ATCC, USA) were genetically modified to knock out the mouse iRhom2 gene. The resulting L929 mouse iRhom2 knockout cell line was then infected with a different human iRhom2 construct to obtain a cell line derivative stably expressing a different human iRhom2 protein, which allows for binding analysis of different iRhom2 in the same genetic background.

Briefly, at Thermo Fisher Scientific GeneArt GmbH, regensburg, germany synthesized the mmrbdf2.3 IVT gRNA (AAGCATGCTATCCTGTCGC). The day after inoculation in 24-well plates, L929 parental cells were transfected with the gRNA/GenerArt Platinium Cas9 nuclease (Thermo Fisher Scientific, USA) mixture using Lipofectamine CRISPRMAX transfection reagent (Thermo Fisher Scientific, USA) according to Geneart CRISPR nuclease mRNA user guide (Thermo Fisher Scientific, USA). 3 days after transfection, cells were lysed and DNA extracted for amplification of specific PCR products using the mRhbdf2.3 fwd (TCAATGAGCTCTTTATGGGGCA)/mRhbdf2.3 rev (AAGGTCTCCATCCCCTCAGGTC) 5 primer pair (Thermo Fisher Scientific, USA). For screening of positive wells, the GeneArt genomic cleavage detection kit (Thermo Fisher Scientific, USA) was applied to those samples with a significant single band of the correct size in an Invitrogen 2% e-Gel size Select agarose Gel (Thermo Fisher Scientific, USA). Cleavage analysis PCR products were also analyzed on Invitrogen 2% E-Gel Size Select agarose Gel. Two rounds of subsequent subcloning were performed on the identified polyclonal L929 population using a cleavage detection kit for identification of positive subclones using limiting dilution techniques. Thus, the most promising positive subclone identified in the first round was designated 1029 and further subclones in the second round were designated 2041 to obtain the final clone. The monoclonal cell population derived from this subclone was designated L929-2041 and used for subsequent infection with human iRhom2 construct hiR2-FL-WT-T7 (according to the procedure described in example 3) to generate the cell line L929-2041-hiR2-FL-WT-T7.

FACS scatchard analysis of L929-2041-hiR2-FL-T7

Briefly, L929-2041-hiR2-FL-T7 was harvested with PBS containing 10mM EDTA, washed, and resuspended in FASC buffer (PBS, 3% FBS,0.05% sodium azide) at about 3X10 per well ⁵ Individual cells were seeded in Nunc U-shaped 96-well plates (Thermo Fisher Scientific, USA). To pellet the cells and remove the supernatant, the plates were incubated at 1,500rpm and 4 DEG CCentrifuge for 3 min. For the first staining, cells were resuspended in 100. Mu.l of FACS buffer alone (control) per well or serial two-fold dilution (22 total concentrations) of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 in FACS buffer at an initial concentration of 160. Mu.g/ml and incubated on ice for 1 hour. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany). The corresponding KD values for each antibody of the invention were calculated using Prism8 software (GraphPad Sowtware, USA).

FIG. 1 shows representative results of this study, demonstrating that humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 bind KD values in the sub-nanomolar to low nanomolar range with L929-2041-hiR2-FL-T7 cells.

Example 2: generation of iRhom 1/2-/-double knockout mouse embryo fibroblasts

For various purposes, in the specific binding studies described in some of the examples below, a cellular system is required that expresses specific levels of the iRhom variant of interest in the absence of any endogenous iRhom1 or iRhom2 protein. To this end, mouse Embryonic Fibroblasts (MEFs) from Double Knockout (DKO) mice homozygous negative for both mouse iRhom1 and mouse iRhom2 (iRhom 1/2-/-) were established. This example describes a mouse strain for the establishment of an iRhom1/2-/-DKO MEF and the generation of an immortalized iRhom1/2-/-DKO MEF cell line.

Mouse strain for establishing iRhom1/2-/-DKO MEF

Briefly, rhbdf2tm1b (KOMP) Wtsi mouse strain (C57 BL/6N-Rhbdf2tm1b (KOMP) Wtsi) of C57BL/6N background was obtained from a knockout mouse project (KOMP) repository at Davis division, university of California, U.S. where Rhbdf2 is an alternate name for iRhom 2. Heterozygous male Rhbdf2tm1b mice were mated with 129Sv/J genetic background wild-type female mice to produce heterozygous offspring of mixed genetic background (129 Sv/J-C57 BL/6N). These heterozygous mice were mated to each other to generate male and female progeny that were homozygous for the Rhbdf2 gene (Rhbdf 2-/-mice, 129Sv/J-C57 BL/6N) deletion. The resulting homozygous Rhbdf2 knockout mouse population was further amplified by breeding of Rhbdf-/-male and female mice to generate a sufficient number of mice. Homozygous Rhbdf 2-/-mice were viable and fertility, with no apparent spontaneous pathological phenotype.

Rhbdf1 knockout mice were obtained from the European conditional mouse mutagenesis program (EUCOMM) of the International Union of knockout mice (IKBC). The production of these animals is described in Li et al PNAS,2015, doi:10.1073/pnas.1505509112. Homozygous Rhbdf 1-/-mice were viable and fertility, with no apparent spontaneous pathological phenotype.

For production of DKO mice of Rhbdf1 and Rhbdf2 (Rhbdf 1/2-/-mice), rhbdf 1-/-mice were mated with Rhbdf 2-/-mice to produce Rhbdf1+/-Rhbdf2 +/-double heterozygous mice. These heterozygous mice were mated with Rhbdf 2-/-mice to produce Rhbdf1+/-Rhbdf 2-/-animals, which were mated with each other to produce E14.5 embryos (Rhbdf 1/2-/-DKO embryos) lacking the Rhbdf gene at the expected Mendelian ratio (1/4 of all embryos) for E13.5 Rhbdf1/2-/-DKO MEF production as described below.

Production of immortalized iRhom1/2-/-DKO MEF mouse cell lines

Briefly, pregnant Rhbdf1+/-Rhbdf 2-/-female mice were sacrificed at E13.5. The uterine horn was removed into a vessel with ice-cold PBS. Using fine-tipped forceps, embryos are released from the maternal tissue and each embryo is removed from the placenta. Then cutting off each embryo by a sharp surgical knife, and completely cutting off organs such as liver, heart, lung, intestine and the like. The 0.5mm tail sections were removed and transferred to 1.5ml Eppendorf tubes for genomic DNA isolation and subsequent PCR genotyping to confirm the correct genotype of the embryo. Thereafter, the remaining embryonic tissue was washed once with PBS and transferred to a tissue culture dish containing 2mL of 0.25% trypsin/EDTA. Tissue was thoroughly minced with two sterile scalpels and the trypsin/cell mixture was incubated for 15 minutes at 37 ℃. Trypsin was stopped by adding growth medium containing FCS. To generate a single cell suspension, the mixture was pipetted up and down, first five times with a 10mL serum pipette, then five times with a 5mL serum pipette, and finally several times with a flame polished pasteur pipette to further dissociate any remaining cell clusters. Cells obtained from one embryo were then plated on two 10cm tissue culture plates. The next day, the medium was replaced with fresh medium and the cells were grown until they reached 90% confluence. Finally, the cells are expanded and stored for later use.

For immortalization of primary Rhbdf1/2-/-DKO-MEFs, cells were transduced with a retrovirus system using the pMSCV expression system (Clontech, USA). Briefly, pMSCV-Zeo-SV40 was generated as follows: the sequences encoding puromycin resistance were removed from the plasmid pMSCV-puro (Clontech, USA) and replaced with the sequences conferring Zeocin resistance from the pcDNA3.1 (+) Zeo vector (Thermo Fisher Scientific, USA). The retroviral packaging cell line GP2-293 (Clontech, USA) was used in combination with the envelope vectors pVSV-G (Clontech, USA) and the pMSCV-Zeo-SV40 plasmid to produce a retrovirus encoding the SV40 large T antigen. Viruses were filtered and added to primary Rhbdf1/2-/-DKO MEFs plated at 50% confluence for 24 hours. Thereafter, the transduced Rhbdf1/2-/-DKO-MEF was allowed to grow in growth medium without selection pressure for 24 hours and then transferred to growth medium containing 100. Mu.g/ml Zeocin. Cells were passaged at confluence and stored for later use after 10 passages.

Example 3: assessment of mouse Cross-reactivity of humanized antibodies of the invention

Next, the target recognition of the humanized antibodies of the invention was tested with a labeled form of human iRhom2 recombinant immortalized iRhom1/2-/-DKO MEF. In addition, the iRhom1/2-/-DKO MEF of the mouse iRhom2 in the form of stable expression markers was generated to determine the cross-reactivity of 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the humanized antibodies of the present invention with the homologous gene sequences of the mouse iRhom 2.

Production of iRhom1/2-/-DKO MEFs stably expressing T7-tagged human or mouse iRhom2

Briefly, on day 1, phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8X10 per well ⁵ Individual cells were inoculated in standard growth medium on 6-well tissue culture plates (Greiner, germany) and incubated at 37 ℃ with 5% CO ₂ The lower part was kept overnight. On day 2, the medium was replaced with fresh medium supplemented with chloroquine ((Sigma-Aldrich, USA) at a final concentration of 25. Mu.M cells were transfected with 2. Mu.g/ml of pMSCV (Clontech, USA) empty vector, pMSCV-hiR-FL-WT-T7 encoding the full-length wild-type human irom 2 with 3 consecutive copies of the T7 epitope (MASMTGGQQMG) C-terminally tagged or pMSCV-miR2-FL-WT-T7 encoding the full-length wild-type mouse irom 2 with 3 consecutive copies of the T7 epitope C-terminally tagged and maintained at 37℃at 5% CO using the calcium phosphate method ₂ And (3) downwards. After 7 hours, the transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were incubated at 37℃with 5% CO ₂ Incubate overnight to allow virus production. At the same time, immortalized irom 1/2-/-DKO MEFs as target cells for retroviral infection were grown at 1X10 per well ⁵ Individual cells were inoculated in standard growth medium (Greiner, germany) on 6-well tissue culture plates and incubated at 37 ℃ with 5% CO ₂ The lower part was kept overnight. On day 3, supernatants of Phoenix-ECO cells releasing pMSCV, pMSCV-hiR2-FL-WT-T7 or pMSCV-miR2-FL-WT-T7 syngeneic virus were collected, filtered with 0.45 μm CA filter and supplemented with 4. Mu.g/ml polybrene (Sigma-Aldrich, USA). After removal of the medium from the immortalized iRhom1/2-/-DKO MEF, the medium was incubated at 37℃with 5% CO ₂ The supernatant containing virus was added to the target cells for 4 hours for the first infection. At the same time, phoenix-ECO cells were re-incubated with fresh medium, after a further 4 hours, filtered and used again for a second infection of the corresponding target cell population in the presence of 4. Mu.g/ml polybrene. Likewise, a third infection cycle was performed, but overnight. On day 4, fresh standard was usedThe growth medium replaces the cell supernatant containing the virus. From day 5, cells were grown in the presence of 2mg/ml geneticin (G418, thermo Fisher Scientific, USA) to screen for immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, human iRhom2 full-length wild-type MEF-DKO-hiR2-FL-WT-T7 cells stably expressing C-terminal markers with 3 consecutive copies of T7 epitopes, and human iRhom2 full-length wild-type MEF-DKO-hiR 2-FL-T7 cells stably expressing C-terminal markers with 3 consecutive copies of T7 epitopes. After proliferation, the cells are stored for later use.

FACS analysis for test System validation and antibody characterization

Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-hiR2-FL-WT-T7 cells and MEF-DKO-miR2-FL-WT-T7 cells were harvested with 10mM EDTA in PBS, washed and resuspended in FACS buffer (PBS, 3% FBS,0.05% sodium azide) and at about 3X10 per well ⁵ Individual cells were seeded in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA). To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500rpm at 4℃for 3 minutes. For the first staining, cells were resuspended in 100. Mu.l of FACS buffer alone per well (control), mouse monoclonal anti-T7 IgG in 3. Mu.g/ml FACS buffer (Merck Millipore, USA) or humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 in 3. Mu.g/ml FACS buffer and incubated for 1 hour on ice. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining of the anti-T7 staining described previously, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. For the second staining of the foregoing staining with the humanized antibodies of the present invention, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150. Mu.l per well FACS buffer and using BD AccuriTM C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 2a &2b show representative results of this experiment. Co-incubation with anti-T7-labeled antibodies (fig. 2a, black) resulted in very little background staining of MEF-DKO-EV control cells compared to control samples incubated with either anti-mouse IgG or anti-human IgG secondary antibody alone (2 a &2b, grey). In contrast, binding analysis of anti-T7-labeled antibodies to MEF-DKO-hiR2-FL-WT-T7 (fig. 2a, middle) and MEF-DKO-miR2-FL-WT-T7 (fig. 2a, right) cells revealed a stronger increase in relative fluorescence intensity, indicating that both ectopically expressed human and mouse iRhom2 variants were located on the surface of these genetically engineered cell populations, thus validating them as suitable test systems for characterizing the antibodies of the invention. Incubating these cell populations with humanized antibody 16-B-03 as a representative example of the humanized antibody of the invention (fig. 2B, black) did not result in background staining of MEF-DKO-EV control cells at all (fig. 2B, left), a strong shift in relative fluorescence intensity on MEF-DKO-hiR2-FL-WT-T7 cells (similar to that observed with anti-T7 labeled antibodies) indicated that humanized antibody 16-B-03 of the invention bound strongly to human iRhom2 variants (fig. 2B, middle). In contrast, no significant binding of the humanized antibody 16-B-03 of the invention to MEF-DKO-miR2-FL-WT-T7 cells was detected (fig. 2B, right), providing evidence that the mouse iRhom2 variant was not recognized by the humanized antibody 16-B-03 of the invention, whose presence on the cell surface was confirmed with the anti-T7 labeled antibody body (fig. 2a, right). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the invention, indicating that none of these humanized antibodies of the invention cross-reacted with mouse iRhom 2.

Example 4: assessment of binding specificity of humanized antibodies of the invention

Because of the sequence homology of human iRhom2 protein to its closely related family members human iRhom1 (see NCBI reference sequence np_078875.4 for human iRhom2, NCBI reference sequence np_071895.3 for human iRhom1, amino acid sequence identity of human iRhom2 to extracellular loops 1, 2, 3 and C-terminal tails of human iRhom1 was calculated to be 67.4%, 100.00%, 80.00% and 63.64%, respectively), the binding specificity of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 for human iRhom2 to human iRhom1 was evaluated in the next step. For this purpose, the human iRhom1/2-/-DKO MEF was generated in the form of a stable expression marker.

Production of iRhom1/2-/-DKO MEFs stably expressing T7-tagged human iRhom1

Briefly, on day 1, phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8X10 per well ⁵ Individual cells were inoculated in standard growth medium on six well tissue culture plates (Greiner, germany) and incubated at 37 ℃, 5% co ₂ The lower part was kept overnight. On day 2, the medium was replaced with fresh medium supplemented with chloroquine (Sigma-Aldrich, USA) at a final concentration of 25. Mu.M. Using the calcium phosphate method, cells were transfected with 2. Mu.g/ml of pMSCV-hiR1-FL-WT-T7 (SEQ ID NO 50) encoding the full-length wild-type human iRhom1 marked with 3 consecutive copies of the C-terminal of the T7 epitope and maintained at 37℃at 5% CO ₂ And (3) downwards. After 7 hours, transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were incubated at 37℃with 5% CO ₂ Incubate overnight to allow virus production. At the same time, immortalized irom 1/2-/-DKO MEFs as target cells for retroviral infection were grown at 1X10 per well ⁵ Individual cells were inoculated in standard growth medium on 6-well tissue culture plates (Greiner, germany) and also at 37 ℃, 5% co ₂ The lower part was kept overnight. On day 3, the supernatant of Phoenix-ECO cells releasing pMSCV-hiR1-FL-WT-T7 isotropic (ecotropic) virus was collected, filtered with 0.45 μm CA filter and supplemented with 4. Mu.g/ml polybrene (Sigma-Aldrich, USA). After removal of the medium from the immortalized iRhom1/2-/-DKO MEF, the medium was incubated at 37℃with 5% CO ₂ These supernatants were then added to target cells for 4 hours for the first infection. At the same time, phoenix-ECO cells were re-incubated with fresh medium, after a further 4 hours, filtered and used for a second infection of the corresponding target cell population also in the presence of 4. Mu.g/ml polybrene. Likewise, a third infection cycle was performed, but overnight. On day 4, the virus-containing medium was replaced with fresh standard growth medium Cell supernatant. From day 5, cells were grown in the presence of 2mg/ml geneticin (G418, thermo Fisher Scientific, USA) to screen for immortalized MEF-DKO-hiR-FL-WT-T7 stably expressing human iRhom 1C-terminally tagged with 3 consecutive copies of the T7 epitope. After proliferation, the cells are stored for later use.

FACS analysis for test System validation and antibody characterization

Briefly, MEF-DKO-hiR1-FL-WT-T7 cells were harvested with PBS containing 10mM EDTA, washed and resuspended in FACS buffer (PBS, 3% FBS,0.05% sodium azide), and approximately 3X10 per well, except for immortalized MEF-DKO-EV control cells and MEF-DKO-hiR2-FL-WT-T7 cells (described in example 3) ⁵ Individual cells were seeded in Nunc U-bottom 96-well plates. To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500rpm at 4℃for 3 minutes. For the first staining, cells were resuspended in 100. Mu.l of FACS buffer alone per well (control), mouse monoclonal anti-T7 IgG in 3. Mu.g/ml FACS buffer (Merck Millipore, USA) or humanized antibodies of the invention 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 also in 3. Mu.g/ml FACS buffer and incubated for 1 hour on ice. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining of the anti-T7 staining described previously, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. For the second staining of the foregoing staining with the humanized antibodies of the present invention, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 3a &3b show representative results of these analyses. The stronger increase in relative fluorescence intensity obtained for the anti-T7 labeled antibody against MEF-DKO-hiR-FL-WT-T7 (FIG. 3a, middle) compared to staining of MEF-DKO-EV control cells (FIG. 3a, left; equivalent to FIG. 2a, left) and MEF-DKO-hiR2-FL-WT-T7 (FIG. 3a, right; equivalent to FIG. 2a, middle), indicates that similar to the human iRhom2 variant, the human iRhom1 variant is also located on the surface of the genetically engineered cell population, thus validating it as a suitable test system for characterizing the antibodies of the invention. In this context, although binding of antibody 16-B-03 to human iRhom2 variants expressed on MEF-DKO-hiR2-FL-WT-T7 cells (fig. 3B, right; equivalent to fig. 2B, middle) has been shown in example 3 as a representative example of humanized antibodies of the invention, no significant binding of humanized antibody 16-B-03 to MEF-DKO-hiR1-FL-WT-T7 cells was detected, providing evidence that human iRhom1 variants were not recognized by humanized antibody 16-B-03 of the invention, the presence of which human iRhom1 variants on the cell surface was verified with anti-T7 labeled antibodies (fig. 3a, middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the invention, indicating that none of these humanized antibodies of the invention cross-reacted with human iRhom 1.

Example 5: assessment of the Cross-reactivity of antibodies of the invention with different species

Next, a rhesus monkey, cynomolgus monkey, dog or rabbit irom 2 irom 1/2-/-DKO MEF was generated in the form of stable expression markers to determine the cross-reactivity of the antibodies of the invention with the corresponding homologous gene sequences of irom 2. Generating rhesus monkey, cynomolgus monkey, stable expression marker form the iRhom1/2-/-DKO MEF of the dog or rabbit iRhom1 to confirm the specificity of iRhom2 with iRhom1 of these species.

Production of irom 1/2-/-DKO MEFs stably expressing T7-tagged rhesus, cynomolgus, dog or rabbit irom 2

Briefly, on day 1, phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8X10 per well ⁵ Individual cells were seeded in standard growth medium on 6-well tissue culture plates and incubated at 37℃with 5% CO ₂ The lower part was kept overnight. On day 2, the medium was supplemented with chloroquine ((S) at a final concentration of 25 μmigma-Aldrich, USA). Cells were transfected with 2 μg/ml of pMSCV (Clontech, USA) empty vector, encoding rhesus monkey irom 2 full length wild type pMSCV-rhesus monkey-iR 2-FL-WT-T7 marked with 3 consecutive copies of the T7 epitope C-terminus, encoding cynomolgus monkey irom 2 full length wild type pMSCV-cynomolgus monkey-iR 2-FL-WT-T7 marked with 3 consecutive copies of the T7 epitope C-terminus, encoding dog irom 2 full length wild type pMSCV-dog-iR 2-FL-WT-T7 marked with 3 consecutive copies of the T7 epitope C-terminus, or encoding rabbit irom 2 full length wild type pMSCV-rabbit-iR 2-FL-WT-T7 marked with 3 consecutive copies of the T7 epitope C-terminus, respectively, using the calcium phosphate method, and maintained at 37℃under 5% CO 2. After 7 hours, transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were incubated at 37℃with 5% CO ₂ Incubate overnight to allow virus production. At the same time, immortalized irom 1/2-/-DKO MEFs as target cells for retroviral infection were grown at 1X10 per well ⁵ Individual cells were inoculated in standard growth medium on 6-well tissue culture plates (Greiner, germany) and also at 37 ℃, 5% CO ₂ The lower part was kept overnight. On day 3, supernatants of Phoenix-ECO cells releasing pMSCV, pMSCV-rhesus-iR 2-FL-WT-T7, pMSCV-cynomolgus monkey-iR 2-FL-WT-T7, pMSCV-dog-iR 2-FL-WT-T7 or pMSCV-rabbit-iR 2-FL-WT-T7 isotropic virus, respectively, were collected, filtered with 0.45 μm CA filter and supplemented with 4. Mu.g/ml polybrene (Sigma-Aldrich, USA). After removal of the medium from the immortalized iRhom1/2-/-DKO MEF, the medium was incubated at 37℃with 5% CO ₂ The virus-containing supernatant was then added to the target cells for 4 hours for the first infection. At the same time, phoenix-ECO cells were re-incubated with fresh medium, after a further 4 hours, filtered and used for a second infection of the corresponding target cell population also in the presence of 4. Mu.g/ml polybrene. Likewise, a third infection cycle was performed, but overnight. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5, cells were grown in the presence of 2mg/ml geneticin (G418, thermo Fisher Scientific, USA) to screen for immortalized MEF-DKO-EV control cells stably infected with pMSCV empty vector, rhesus monkeys stably expressing C-terminally tagged with 3 consecutive copies of the T7 epitope The full-length wild-type pMSCV-rhesus-iR 2-FL-WT-T7 cells of iRhom2, the C-terminally labeled cynomolgus monkey-iR 2-FL-WT-T7 cells stably expressing T7 epitopes with 3 consecutive copies, the C-terminally labeled canine iRhom2 full-length wild-type pMSCV-dog-iR 2-FL-WT-T7 cells stably expressing T7 epitopes with 3 consecutive copies, or the C-terminally labeled canine iRhom2 full-length wild-type pMSCV-rabbit-iR 2-FL-WT-T7 cells stably expressing T7 epitopes with 3 consecutive copies. After proliferation, the cells are stored for later use. At the same time, the rhesus, cynomolgus, dog or rabbit irom 1/2-/-DKO MEFs were generated in a similar manner in the form of stable expression markers.

FACS analysis for test System validation and antibody characterization

Briefly, immortalized MEF-DKO-EV control cells, MEF-DKO-rhesus-iR 2-FL-WT-T7 cells, MEF-DKO-cynomolgus-iR 2-FL-WT-T7 cells, MEF-DKO-dog-iR 2-FL-WT-T7 cells and their corresponding iRhom1 counterparts were harvested with 10mM EDTAPBS, washed and resuspended in FACS buffer (PBS, 3% FBS,0.05% sodium azide) and assayed 3X10 per well ⁵ Individual cells were seeded in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA). To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500rpm at 4℃for 3 minutes. For the first staining, cells were resuspended in 100 μl of (separate) FACS buffer per well (control), mouse monoclonal anti-T7 IgG in 3 μg/ml FACS buffer (Merck Millipore, USA) or antibodies of the invention also in 3 μg/ml FACS buffer and incubated on ice for 1 hour. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining of the anti-T7 staining described previously, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. For the second staining of the foregoing staining with the humanized antibodies of the invention, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 in FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. The panel is then assembled Centrifuge at 1,500rpm and 4℃for 3 minutes and wash three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 4a &4b show representative results of cross-reactivity analysis on rhesus monkeys. The stronger increase in relative fluorescence intensity obtained for anti-T7 marker antibodies versus MEF-DKO-rhesus-iR 1-FL-WT-T7 and MEF-DKO-rhesus-iR 2-FL-WT-T7 (fig. 4a, right) compared to staining of MEF-DKO-EV control cells (fig. 4a, left; equivalent to fig. 2a, left), MEF-DKO-rhesus-iR 1-FL-WT-T7 (fig. 4a, middle) and MEF-DKO-rhesus-iR 2-FL-WT-T7, indicates that the rhesus irom 1 and 2 variants are also located on the surface of the population of genetically engineered cells, thus confirming that they are suitable test systems for characterizing the antibodies of the invention. In contrast to the non-significant binding of MEF-DKO-rhesus-iR 1-FL-WT-T7 (fig. 4B, middle), it was detected that antibody 16-B-03, which is a humanized antibody of the invention, binds significantly to rhesus iRhom2 variants expressed on MEF-DKO-rhesus-iR 2-FL-WT-T7 cells (fig. 4B, right). This provides evidence that rhesus iRhom2 variants are specifically recognized by the humanized antibody 16-B-03 of the invention, whereas rhesus iRhom1 is not recognized, its presence on the cell surface is verified with an anti-T7 marker antibody (fig. 4a, middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognized rhesus monkey iRhom2, but not rhesus monkey iRhom1.

Fig. 5a &5b show representative results of cross-reactivity analysis on cynomolgus monkeys. The stronger increase in relative fluorescence intensity obtained for anti-T7 marker antibodies versus MEF-DKO-cynomolgus monkey-iR 1-FL-WT-T7 (fig. 5a, left; equivalent to fig. 2a, left), MEF-DKO-cynomolgus monkey-iR 1-FL-WT-T7 (fig. 5a, middle) and MEF-DKO-cynomolgus monkey-iR 2-FL-WT-T7 (fig. 5a, right) compared to staining of MEF-DKO-EV control cells (fig. 5a, left; equivalent to fig. 2a, left), the cynomolgus monkey-iR 1-FL-WT-T7 (fig. 5a, middle), thus confirming that cynomolgus monkey irom 1 and 2 variants are also located on the surface of the genetically engineered cell population, and thus a suitable test system for characterizing the antibodies of the invention. In contrast to the non-significant binding of MEF-DKO-rhesus-iR 1-FL-WT-T7 cells (fig. 5B, middle), significant binding of antibody 16-B-03 as a humanized antibody of the invention to the cynomolgus monkey irom 2 variant expressed on MEF-DKO-cynomolgus monkey-iR 2-FL-WT-T7 cells (fig. 5B, right) was detected. This provides evidence that cynomolgus monkey irom 2 variants are specifically recognized by the humanized antibodies 16-B-03 of the invention, compared to the lack of recognition of cynomolgus monkey irom 1, whose presence on the cell surface was verified with an anti-T7 marker antibody (fig. 5a, middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognized cynomolgus monkey iRhom2, but did not recognize cynomolgus monkey iRhom1.

Fig. 6a &6b show representative results of cross-reactivity analysis for dogs. The stronger increase in relative fluorescence intensity obtained for the anti-T7 marker antibodies on MEF-DKO-dog-iR 1-FL-WT-T7 and MEF-DKO-dog-iR 2-FL-WT-T7 (fig. 3a, middle) compared to staining of MEF-DKO-EV control cells (fig. 6a, left; equivalent to fig. 2a, left), MEF-DKO-dog-iR 1-FL-WT-T7 (fig. 6a, middle) and MEF-DKO-dog-iR 2-FL-WT-T7, indicated that, similar to the human iRhom1 and 2 variants, the dog iRhom1 and 2 variants were also located on the surface of the population of genetically engineered cells, thus confirming that they are suitable test systems for characterizing the antibodies of the invention. In contrast to the non-significant binding of MEF-DKO-dog-iR 1-FL-WT-T7 cells (FIG. 6B, middle), it was detected that antibody 16-B-03, which is a humanized antibody of the invention, significantly bound to the dog iRhom2 variant expressed on MEF-DKO-dog-iR 2-FL-WT-T7 cells (FIG. 6B, right). This provides evidence that the dog iRhom2 variant is specifically recognized by the humanized antibody 16-B-03 of the invention, as compared to the lack of recognition of dog iRhom1 whose presence on the cell surface was verified with an anti-T7 marker antibody (fig. 6a, middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognized dog iRhom2, but not dog iRhom1.

Fig. 7a &7b show representative results of cross-reactivity analysis on rabbits. The stronger increase in relative fluorescence intensity obtained for anti-T7 marker antibodies versus MEF-DKO-rabbit-iR 1-FL-WT-T7 compared to staining of MEF-DKO-EV control cells (FIG. 7a, left; equivalent to FIG. 2a, left), MEF-DKO-rabbit-iR 1-FL-WT-T7 (FIG. 7a, middle) and MEF-DKO-rabbit-iR 2-FL-WT-T7 (FIG. 7a, right) demonstrated similar to human iRhom1 and 2 variants, rabbit iRhom1 and 2 variants were also located on the surface of the population of genetically engineered cells, confirming that they are suitable test systems for characterizing the antibodies of the invention. In contrast to the non-significant binding of MEF-DKO-rabbit-iR 1-FL-WT-T7 cells (FIG. 7B, middle), it was detected that antibody 16-B-03, which is a humanized antibody of the invention, binds significantly to the constant rabbit iRhom2 variant expressed on MEF-DKO-rabbit-iR 2-FL-WT-T7 cells (FIG. 7B, right). This provides evidence that rabbit iRhom2 variants are specifically recognized by the humanized antibodies 16-B-03 of the invention, as compared to the lack of recognition of rabbit iRhom1 whose presence on the cell surface was verified with an anti-T7 marker antibody (fig. 7a, middle). Similar results were obtained with the humanized antibodies 16-B-05, 16-B-07, 23-B-04, 42-B-02, 42-B-04 of the present invention, indicating that all of these humanized antibodies of the present invention recognized rabbit iRhom2, but not rabbit iRhom1.

Example 6: analysis of the inhibitory Effect of the antibodies of the invention on LPS-induced in vitro shedding of TNF alpha

In the following study, ELISA-based TNFα release assays were performed to verify the inhibitory effect of the humanized antibodies of the invention on LPS-induced endogenous TNFα release from human THP-1 monocytes.

The ELISA-based TNFα release assay used in this example is described below.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were coated overnight with 100 μl of mouse anti-human TGF-alpha capture antibody per well (provided as part of DuoSet ELISA kit) in 4 μg/ml TBS at 4deg.C. On day 2, the capture antibody solution was removed and +.>The panels were at room temperatureThe wells were blocked with 300. Mu.l TBS, 1% BSA for 1-2 hours. At the same time, 80. Mu.l of 20,000 THP-1 (American Type Culture Collection, USA) cells in normal growth medium were seeded into each well of a Greiner CELLSTAR V-shaped bottom 96-well plate (Greiner Bio One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bambusa (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 15. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml of humanized antibody of the invention (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl/well of 300ng/ml LPS (Sigma-Aldrich, USA) (final concentration 50 ng/ml) in growth medium for 2 hours. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is taken up from +.>Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human tnfα protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, 50ng/ml biotinylated goat anti-human tnfα detection antibody in 100 μl TBS was added to each well and the plates were incubated at room temperature for 2 hours, with direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

Figure 8 shows representative results of this experiment, demonstrating the effect of the test agent on LPS-induced tnfα release from THP-1 cells in absolute numbers (figure 8 a) and percent inhibition (figure 8 b). Although batimastat (BB 94), a small molecule inhibitor of metalloproteases, served as a positive control and produced a strong inhibition of LPS-induced tnfα release, the presence of IgG isotype control had no significant effect on tnfα shedding. In contrast, equivalent concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention inhibited LPS-induced TNF alpha release from THP-1 cells by 75.1%, 78.7%, 77.2%, 77.6%, 75.2% and 76.1%, respectively.

Example 7: analysis of the inhibition effect of the antibodies of the invention on PMA-induced in vitro shedding of TNFalpha

In contrast to example 6, the inhibitory effect of the antibodies of the invention on LPS-induced endogenous TNFα release from human THP-1 was tested and this analysis was performed to confirm the inhibitory effect of the antibodies of the invention on PMA-induced endogenous TNFα release from human monocyte U-937 cells.

The ELISA-based tnfα release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken 96-well plates (Thermo Fisher Scientific, USA) were coated overnight with 100 μl of mouse anti-human TGF-alpha capture antibody per well (provided as part of DuoSet ELISA kit) in 4 μg/ml TBS at 4deg.C. On day 2, the capture antibody solution was removed and +.>Plates were blocked with 300 μl TBS, 1% BSA per well for 1-2 hours at room temperature. Simultaneously, 80. Mu.l of 75,000U-937 (European Collection of Authenticated Cell Cultures, UK) cells in normal growth medium were seeded into each well of a Greiner CELLSTAR V-shaped bottom 96-well plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bamstat (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 50. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 10. Mu.g/ml in the resulting 100. Mu.l sample volume) or 16.66. Mu.g/ml of antibody of the invention (final concentration 3.33. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20. Mu.l per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 1 hour in growth medium. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is taken up from +.>Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human tnfα protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, 100 μl of biotinylated goat anti-human tnfα detection antibody at a concentration of 50ng/ml TBS was added to each well, and the plate was incubated at room temperature for 2 hours, with light from direct irradiation. With each well 350 on a 96-head plate washer (Tecan Group, switzerland)Mu.l TBS-T (Carl Roth, germany) were washed 4 times and after careful removal of all buffer traces after the fourth cycle 100. Mu.l streptavidin-AP (R) diluted 1:10,000 with TBS was used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl AttoPhos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

FIG. 9 shows representative results of this experiment, demonstrating the effect of the test sample on PMA-induced U-937 cells to release TNF alpha (absolute number (FIG. 9 a) and percent inhibition (FIG. 9 b)). Although batimastat (BB 94), a small molecule inhibitor of metalloproteases, served as a positive control and produced a strong inhibition of PMA-induced tnfα release, the presence of IgG isotype control had no significant effect on tnfα shedding. In contrast, the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced TNFα release from U-937 cells by 89.8%, 89.0%, 90.3%, 77.2%, 85.0% and 87.9%, respectively.

Example 8: analysis of the inhibition effect of the antibodies of the invention on PMA-induced shedding of interleukin 6 receptor (IL-6R) in vitro

In the following study, ELISA-based IL-6R release assays were performed to analyze the PMA-induced inhibitory effect of the antibodies of the invention on endogenous IL-6R release from THP-1 monocytes.

The ELISA-based IL-6R release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were incubated with 100. Mu.l of mouse anti-human IL-6R capture antibody per well (as part of DuoSet ELISA kit) in 2. Mu.g/ml TBS at 4 ℃ Provided) was coated overnight. On day 2, the capture antibody solution was removed and +.>Plates were blocked with 300 μl TBS, 1% BSA per well for 1-2 hours at room temperature. Simultaneously, 80. Mu.l of 40,000 THP-1 (American Type Culture Collection, USA) cells in normal growth medium were seeded in each well of a Greiner CELLSTAR V-shaped bottom 96-well plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bambusa (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 15. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml of antibody of the invention (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20. Mu.l per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 1 hour in growth medium. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is taken up from +. >Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, 100 ul of 100ng/ml biotinylated goat anti-human IL-6R detection antibody in TBS (provided as part of DuoSet ELISA kit) was added per well and the plate was subjected to direct light shieldingIncubate for 2 hours at room temperature. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

Figures 10a &10b show representative results of this experiment to demonstrate the effect of the test article on PMA-induced IL-6R release from THP-1 cells in absolute numbers (figure 10 a) and percent inhibition (figure 10 b). Although batimastat (BB 94), which is a small molecule inhibitor of metalloproteases, served as a positive control and produced a strong inhibition of PMA-induced IL-6R release, the presence of the IgG isotype control had no significant effect on IL-6R shedding. In contrast, equal concentrations of humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention inhibited PMA-induced IL-6R release from THP-1 cells by 75.6%, 74.0%, 75.6%, 70.1%, 68.5% and 71.6%, respectively.

Example 9: analysis of the inhibition effect of the antibodies of the invention on PMA-induced shedding of interleukin 6 receptor (IL-6R) in vitro

Complementary to example 8 above, an ELISA-based IL-6R release assay was performed to confirm the inhibitory effect of the antibodies of the invention on PMA-induced endogenous IL-6R release from human U-937 cells.

The ELISA-based IL-6R release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken96 well plate (Thermo Fisher Scienti)fic, USA) was coated overnight with 100. Mu.l of mouse anti-human IL-6R capture antibody per well (provided as part of DuoSet ELISA kit) in 2. Mu.g/ml TBS at 4 ℃. On day 2, the capture antibody solution was removed and +. >Plates were blocked with 300 μl TBS, 1% BSA per well for 1-2 hours at room temperature. Simultaneously, 80. Mu.l of 75,000U-937 (European Collection of Authenticated Cell Cultures, UK) cells in normal growth medium were seeded into each well of a Greiner CELLSTAR V-shaped bottom 96-well plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bamstat (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 50. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 10. Mu.g/ml in the resulting 100. Mu.l sample volume) or 16.66. Mu.g/ml of antibody of the invention (final concentration 3.33. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20. Mu.l per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 1 hour in growth medium. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is taken up from +. >Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, each hole100ng/ml biotinylated goat anti-human IL-6R detection antibody in 100 μl TBS (provided as part of DuoSet ELISA kit) was added and the plates incubated for 2 hours at room temperature, in the absence of direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

FIG. 11 shows representative results of this experiment, demonstrating the effect of the test article on PMA-induced IL-6R release from U-937 cells in absolute numbers (FIG. 11 a) and percent inhibition (FIG. 11 b). Although batimastat (BB 94), which is a small molecule inhibitor of metalloproteases, served as a positive control and produced a strong inhibition of PMA-induced IL-6R release, the presence of the IgG isotype control had no significant effect on IL-6R shedding. In contrast, the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced IL-6R release from U-937 cells by 79.6%, 81.7%, 77.5%, 77.8%, 78.3% and 82.4%, respectively.

Example 10: analysis of the inhibition effect of the antibodies of the invention on PMA-induced shedding of heparin-binding EGF-like growth factor (HB-EGF) in vitro

In the following study, ELISA-based HB-EGF release assays were performed to analyze the inhibitory effect of the antibodies of the present invention on PMA-induced endogenous HB-EGF release from human THP-1 monocytes.

The ELISA-based HB-EGF release assay used in this example will be described below.

Briefly, on day 1, nunc black is takenA96-well plate (Thermo Fisher Scientific, USA) was coated overnight with 100. Mu.l of rat anti-human HB-EGF capture antibody per well (provided as part of DuoSet ELISA kit) in 2. Mu.g/ml TBS at 4 ℃. Mu.l of 40,000 THP-1 (American Type Culture Collection, USA) cells in normal growth medium were seeded in each well of a Greiner CELLSTAR V-shaped bottom 96-well plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bambusa (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 15. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml of antibody of the invention (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 24 hours in growth medium. On day 2, the capture antibody solution was removed and +.>Plates were blocked with 300 μl TBS, 1% BSA per well for 1-2 hours at room temperature. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is taken up from +.>Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS was immediately added toIn each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100. Mu.l of recombinant human HB-EGF eggs will be diluted with TBS at defined concentrations White (provided as part of the DuoSet ELISA kit) was added to the plates as a standard reference. Thereafter, the plates were incubated at room temperature for 2 hours. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 50ng/ml biotinylated goat anti-human HB-EGF detection antibody in 100 μl TBS (provided as part of the DuoSet ELISA kit) was added per well, and the plates were incubated for 2 hours at room temperature, with direct light. After washing 4 times with 350. Mu.l per well TBS-T (Carl Roth, germany) on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l of streptavidin-AP (R) diluted 1:10,000 in TBS was used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

FIG. 12 shows representative results of this experiment, demonstrating the effect of the test article on PMA-induced HB-EGF release from THP-1 cells in absolute numbers (FIG. 12 a) and percent inhibition (FIG. 12 b). Although batimastat (BB 94), which is a small molecule inhibitor of metalloproteases, was used as a positive control and resulted in a strong inhibition of PMA-induced HB-EGF release, the presence of the IgG isotype control had no significant effect on HB-EGF shedding. In contrast, equal concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from THP-1 cells by 80.2%, 83.0%, 80.5%, 84.4%, 81.2% and 86.2%, respectively.

Example 11: analysis of the inhibitory Effect of the antibodies of the invention on PMA-induced in vitro shedding of HB-EGF

Complementary to example 10 above, ELISA-based HB-EGF release assays were performed to confirm the inhibitory effect of the antibodies of the invention on PMA-induced endogenous HB-EGF release from human U-937 cells.

The ELISA-based HB-EGF release assay used in this example was the same as described in example 10, except that U-937 (European Collection of Authenticated Cell Cultures, UK) cells (80,000 cells/well) were used instead of THP-1 (American Type Culture Collection, USA) cells.

FIG. 13 shows representative results of this experiment, demonstrating the effect of the test article on PMA-induced HB-EGF release from U-937 cells in absolute numbers (FIG. 13 a) and percent inhibition (FIG. 13 b). Although batimastat (BB 94), which is a small molecule inhibitor of metalloproteases, was used as a positive control and resulted in a strong inhibition of LPS-induced HB-EGF release, the presence of the IgG isotype control had little significant effect on HB-EGF shedding. In contrast, equal concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from U-937 cells by 99.2%, 99.7%, 99.2%, 99.5%, 98.8% and 99.4%, respectively.

Example 12: analysis of the inhibition effect of the antibodies of the invention on PMA-induced shedding of transforming growth factor alpha (TGF alpha) in vitro

In the following study, ELISA-based tgfα release assays were performed to analyze the inhibitory effect of the antibodies of the invention on PMA-induced release of endogenous tgfα from human PC3 prostate cancer cells.

The ELISA-based TGF-alpha release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were coated overnight with 100 μl of goat anti-human TGF-alpha capture antibody per well (provided as part of DuoSet ELISA kit) in 0.4 μg/ml TBS at 4deg.C. Mu.l of 80,000 PC3 (European Collection of Authenticated Cell Cultures, UK) cells in normal growth medium were seeded into each well of an F-bottom 96-well cell culture plate (Corning, USA) and incubated at 37℃with 5% CO ₂ Incubation underOvernight. On day 2, the capture antibody solution was removed andplates were blocked with 300 μl TBS, 1% BSA per well for 1-2 hours at room temperature. At the same time, cells were washed once with PBS and at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l OptiMEM per well in 80. Mu.l OptiMEM medium supplemented with 50. Mu.M Bambusa (BB 94, abcam, UK) as positive control (final concentration in the resulting 100. Mu.l sample volume was 10. Mu.M), 50. Mu.g/ml human IgG antibody (BioLegend, USA) as isotype control (final concentration in the resulting 100. Mu.l sample volume was 10. Mu.g/ml) or 50. Mu.g/ml antibody of the invention (final concentration in the resulting 100. Mu.l sample volume was 10. Mu.g/ml). In the case of the stimulation control, 20 μl of OptiMEM medium without test sample was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 2 hours in OptiMEM. At the same time, the blocking buffer is taken up from +.>Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 20. Mu.l of TBS were immediately added to +. >In each well of the plate, then 80 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human tnfα protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, 37.5ng/ml biotinylated goat anti-human tgfα detection antibody (provided as part of the DuoSet ELISA kit) in 100 μl TBS was added per well and the plates incubated for 2 hours at room temperature, in the absence of direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all traces of buffer after the fourth cycle, the buffer will be used in TBS at 1:10,0100 μl of streptavidin-AP (R) diluted in 00&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

Fig. 14 shows representative results of this experiment, indicating the effect of the test agent on PMA-induced tgfα release from PC3 cells in absolute numbers (fig. 14 a) and percent inhibition (fig. 14 b). Although batimastat (BB 94), a small molecule inhibitor of metalloprotease, served as a positive control and resulted in 90.7% PMA-induced tnfα release, the presence of IgG isotype control had no inhibitory effect on tnfα shedding. In the presence of equal concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04, only very modest effects on TGF alpha shedding were detected, with 15.9%, 23.8%, 3.3%, 21.3%, 6.4% and 19.5% inhibition of PMA-induced TGF alpha release from PC3 cells, respectively.

Example 13: assessment of binding specificity of antibodies of the invention in endogenous iRhom2 expressing cell lines

In this study, a binding specificity analysis was performed on humanized antibody 42-B-02, which is a representative example of the antibody of the present invention, in a cell line endogenously expressing iRhom 2. This study was performed on RPMI-8226 cells (a human B lymphocyte line that endogenously expresses iRhom2 but endogenously negative for iRhom 1), on THP-1 cells (a human monocyte line endogenously expresses iRhom2 and iRhom 1), and on RH-30 cells (a human fibroblast line endogenously negative for iRhom2 but endogenously expresses iRhom 1).

Briefly, human RPMI-8226 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, germany), THP-1 cells (American Type Culture Collection,USA) and RH-30 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen, germany), washed and resuspended in FACS buffer (PBS, 3% fbs, 0.05% sodium azide) and at about 2x10 per well ⁵ Individual cells were seeded in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA). To pellet cells and remove supernatant, plates were run at 1,500rpm and 4 ^℃ Centrifuge for 3 min. For the first staining, cells were resuspended in 100 μl of FACS buffer alone (control) or 3 μg/ml of the antibody of the invention in FACS buffer per well and incubated on ice for 1 hour. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 15 shows representative results of this study. Co-incubation of RPMI-8226 and THP-1 cells, both endogenously expressing iRhom2, with humanized antibody 42-B-02, a representative example of an antibody of the invention, resulted in a strong change in the relative fluorescence intensity of the two cell lines compared to control samples incubated with only the second antibody, indicating that humanized antibody 42-B-02 of the invention binds strongly to two human cell lines endogenously positive for iRhom 2. In contrast, it was detected that the humanized antibody 42-B-02 (right, black), which is a representative example of the antibody of the invention, did not bind to RH-30 cells (which did not express iRhom 2), providing evidence that endogenously expressed iRhom2 was specifically recognized by the humanized antibody 42-B-02 of the invention.

Example 14: epitope mapping of antibodies of the invention based on single amino acid substitutions or deletions in the large extracellular loop

Several methods are now available for mapping epitopes recognized by antibodies, including X-ray co-crystallography, array-based oligopeptide scanning, hydrogen-deuterium exchange or cross-linked coupled mass spectrometry. Genetic methods such as site-directed mutagenesis or high-throughput shotgun mutagenesis allow epitope mapping with single amino acid resolution. However, amino acid substitutions at random positions of the protein or substitutions of unrelated amino acids risk causing conformational changes and/or loss of function of the protein, thus possibly leading to misunderstanding whether the substituted amino acids contribute to the antibody epitope. One elegant and widely accepted way to circumvent these risks is to replace individual amino acids of a given protein with homologous amino acids of a structurally related protein (i.e., ortholog or closely related family member), provided that these related proteins are not recognized by the antibody of interest. As previously mentioned, this is true for all humanized anti-human iRhom2 antibodies of the invention, as they have been demonstrated to cross-react with neither the mouse ortholog (example 3) nor bind to the closely related family member human iRhom1 (example 4). Furthermore, substitution of a single amino acid of a given protein with alanine represents a widely used method of mapping epitopes.

Thus, in a method of identifying single amino acids that are conducive to binding to antibodies of the invention, a set of plasmids of 137 personal iRhom2 variants were designed that have single amino acid substitutions that are mouse iRhom 2-related, human iRhom 1-related, or alanine. These 137 substitutions reflect amino acids in the large extracellular loop 1 (AA 502 to AA594 of human iRhom 2), which are different in human iRhom2 than in mouse iRhom2, which are different in human iRhom2 than in human iRhom1, or wherein the corresponding amino acids in human iRhom2 are substituted with alanine. Instead of the amino acid of human iRhom2, an amino acid of the corresponding position of mouse iRhom2 or human iRhom1 is introduced, or an amino acid of human iRhom2 is replaced with alanine. In case that the corresponding amino acid is not present in the mouse iRhom2 or the human iRhom1, deleting the corresponding amino acid of the human iRhom2, resulting in the formation of variants 2-FL-Q502R-T7, 2-FL-N503A-T7, 2-FL-D504A-T7, 2-FL-H505R-T7, 2-FL-H505A-T7, 2-FL-S506A-T7, 2-FL-G507A-T7, 2-FL-C508A-T7, 2-FL-I509V-T7, 2-FL-I509A-T7, 2-FL-Q510A-T7, 2-FL-T511A-T7, 2-FL-Q512L-T7, 2-FL-Q512S-T7, 2-FL-Q512A-T7, 2-FL-R513K-T7, 2-FL-R513E-T7 2-FL-R513A-T7, 2-FL-K514E-T7, 2-FL-K514A-T7, 2-FL-D515E-T7, 2-FL-D515A-T7, 2-FL-C516A-T7, 2-FL-S517A-T7, 2-FL-E518S-T7, 2-FL-E518A-T7, 2-FL-T519A-T7, 2-FL-L520A-T7, 2-FL-A521S-T7, 2-FL-T522V-T7, 2-FL-T522A-T7, 2-FL-F523W-T7, 2-FL-F523A-T7, 2-FL-V524A-T7, 2-FL-K525A-T7, 2-FL-W526A-T7, 2-FL-Q527P-T7, 2-FL-Q527A-T7, 2-FL-D528N-T7, 2-FL-D528I-T7, 2-FL-D528A-T7, 2-FL-D529H-T7, 2-FL-D529A-T7, 2-FL-T530P-T7, 2-FL-T530A-T7, 2-FL-G531S-T7, 2-FL-G531A-T7, 2-FL-P532A-T7, 2-FL-P533A-T7, 2-FL-M534S-T7, 2-FL-M534A-T7 2-FL-D535- -T7, 2-FL-D535A-T7, 2-FL-K536- -T7, 2-FL-K536A-T7, 2-FL-S537E-T7, 2-FL-S537A-T7, 2-FL-D538L-T7, 2-FL-D538A-T7, 2-FL-L539A-T7, 2-FL-G540S-T7, 2-FL-G540A-T7, 2-FL-Q541H-T7, 2-FL-Q541A-T7, 2-FL-K542A-T7, 2-FL-R543Q-T7, 2-FL-R543A-T7, 2-FL-T544P-T7, 2-FL-T544Q-T7, 2-FL-T544A-T7, 2-FL-S545F-T7, 2-FL-S545A-T7, 2-FL-G546A-T7, 2-FL-A547V-T7, 2-FL-A547S-T7, 2-FL-V548A-T7, 2-FL-C549A-T7, 2-FL-H550A-T7, 2-FL-Q551A-T7, 2-FL-D552A-T7, 2-FL-P553A-T7, 2-FL-R554A-T7, 2-FL-T555V-T7, 2-FL-T555A-T7, 2-FL-C556A-T7, 2-FL-E557D-T7, 2-FL-E557A-T7, 2-FL-E558A-T7, 2-FL-E5A-T7 2-FL-P559A-T7, 2-FL-A560S-T7, 2-FL-S561A-T7, 2-FL-S562E-T7, 2-FL-S562A-T7, 2-FL-G563D-T7, 2-FL-G563A-T7, 2-FL-A564P-T7, 2-FL-A564S-T7, 2-FL-H565A-T7, 2-FL-I566E-T7, 2-FL-I566A-T7, 2-FL-W567A-T7, 2-FL-P A-T7, 2-FL-D569E-T7, 2-FL-D569A-T7, 2-FL-D570A-T7, 2-FL-I571A-T7, hiR2-FL-T572A-T7, hiR2-FL-K573A-T7, hiR2-FL-W574A-T7, hiR2-FL-P575A-T7, hiR2-FL-I576A-T7, hiR-FL-C577A-T7, hiR-FL-T578A-T7, hiR2-FL-E579K-T7, hiR2-FL-E579A-T7, hiR-FL-Q580N-T7, hiR-FL-Q580A-T7, hiR-FL-A581S-T7, hiR-FL-R582A-T7, hiR-FL-S583G-T7, hiR-FL-S583A-T7, hiR2-FL-N584A-T7, hiR2-FL-H585A-T7, hiR2-FL-T586A-T7, hiR2-FL-G587N-T7, hiR2-FL-G587A-T7, hiR2-FL-F588H-T7, hiR2-FL-F588A-T7, hiR2-FL-L589P-T7, hiR2-FL-L589A-T7, hiR2-FL-H590A-T7, hiR2-FL-M591A-T7, hiR2-FL-D592A-T7, hiR2-FL-C593A-T7, and hiR2-FL-E594V-T7.

This example describes the generation of iRhom1/2-/-DKO-MEF populations expressing 137 single amino acid substitution or deletion variants, as well as their characterization in terms of cell surface localization and functional activity as an indicator of proper protein conformation. Subsequently, binding assays of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention were described over the entire panel of 137 engineered MEFs expressing human iRhom2 variants with single amino acid substitutions or deletions.

Stable expression of 137T 7-tagged variants of human iRhom2 with single amino acid substitutions or deletions of iRhom 1- Generation of 2-/-DKO MEFs

Briefly, on day 1, phoenix-ECO cells (American Type Culture Collection, USA) were plated at 8X10 per well ⁵ Individual cells were seeded in standard growth medium on 6-well tissue culture plates and incubated at 37 ℃ with 5% CO ₂ The lower part was kept overnight. On day 2, the medium was replaced with fresh medium supplemented with chloroquine ((Sigma-Aldrich, USA) at a final concentration of 25. Mu.M, human iRhom2 full-length single amino acid substitution of pMSCV-hiR2-FL-Q502R-T7, pMSCV-hiR2-FL-N503A-T7, pMSCV-hiR-FL-D504A-T7, pMSCV-hiR-FL-H505R-T7, pMSCV-hiR2-FL-H505A-T7, pMSCV-hiR2-FL-S506A-T7, pMSCV-hiR2-FL-G507A-T7, pMSCV-hiR2-FL-C508A-T7, pMSCV-hiR-FL-I507V-T7, pMSCV-hiR-FL-I509A-T7, pMSCV-hiR-FL-I-T7, pMSCV-hiR-FL-S506A-T7, human iRhom2 full-length single amino acid with 2 μg/ml encoding 3 consecutive copies of the T7 epitope (MASMTGGQQMG) marked at the C-terminus pMSCV-hiR2-FL-Q510A-T7, pMSCV-hiR2-FL-T511A-T7, pMSCV-hiR2-FL-Q512L-T7, pMSCV-hiR-FL-Q512S-T7, pMSCV-hiR-FL-Q512A-T7, pMSCV-hiR-R513K-T7, pMSCV-hiR-FL-R513E-T7, pMSCV-hiR-FL-513A-T7, pMSCV-hiR2-FL-K514E-T7, pMSCV-hiR-FL-K514A-T7, pMSCV-hiR-FL-D515E-T7, pMSCV-hiR-FL-D515A-T7, pMSCV-hiR-FL-C516A-T7, pMSCV-hiR2-FL-S517A-T7, pMSCV-hiR2-FL-E518S-T7, pMSCV-hiR2-FL-E518A- T7、pMSCV-hiR2-FL-T519A-T7、pMSCV-hiR2-FL-L520A-T7、pMSCV-hiR2-FL-A521S-T7、pMSCV-hiR2-FL-T522V-T7、pMSCV-hiR2-FL-T522A-T7、pMSCV-hiR2-FL-F523W-T7、pMSCV-hiR2-FL-F523A-T7、pMSCV-hiR2-FL-V524A-T7、pMSCV-hiR2-FL-K525A-T7、pMSCV-hiR2-FL-W526A-T7、pMSCV-hiR2-FL-Q527P-T7、pMSCV-hiR2-FL-Q527A-T7、pMSCV-hiR2-FL-D528N-T7、pMSCV-hiR2-FL-D528I-T7、pMSCV-hiR2-FL-D528A-T7、pMSCV-hiR2-FL-D529H-T7、pMSCV-hiR2-FL-D529A-T7、pMSCV-hiR2-FL-T530P-T7、pMSCV-hiR2-FL-T530A-T7、pMSCV-hiR2-FL-G531S-T7、pMSCV-hiR2-FL-G531A-T7、pMSCV-hiR2-FL-P532A-T7、pMSCV-hiR2-FL-P533--T7、pMSCV-hiR2-FL-P533A-T7、pMSCV-hiR2-FL-M534S-T7、pMSCV-hiR2-FL-M534--T7、pMSCV-hiR2-FL-M534A-T7、pMSCV-hiR2-FL-D535--T7、pMSCV-hiR2-FL-D535A-T7、pMSCV-hiR2-FL-K536--T7、pMSCV-hiR2-FL-K536A-T7、pMSCV-hiR2-FL-S537E-T7、pMSCV-hiR2-FL-S537A-T7、pMSCV-hiR2-FL-D538L-T7、pMSCV-hiR2-FL-D538A-T7、pMSCV-hiR2-FL-L539A-T7、pMSCV-hiR2-FL-G540S-T7、pMSCV-hiR2-FL-G540A-T7、pMSCV-hiR2-FL-Q541H-T7、pMSCV-hiR2-FL-Q541A-T7、pMSCV-hiR2-FL-K542A-T7、pMSCV-hiR2-FL-R543Q-T7、pMSCV-hiR2-FL-R543A-T7、pMSCV-hiR2-FL-T544P-T7、pMSCV-hiR2-FL-T544Q-T7、pMSCV-hiR2-FL-T544A-T7、pMSCV-hiR2-FL-S545F-T7、pMSCV-hiR2-FL-S545A-T7、pMSCV-hiR2-FL-G546A-T7、pMSCV-hiR2-FL-A547V-T7、pMSCV-hiR2-FL-A547S-T7、pMSCV-hiR2-FL-V548A-T7、pMSCV-hiR2-FL-C549A-T7、pMSCV-hiR2-FL-H550A-T7、pMSCV-hiR2-FL-Q551A-T7、pMSCV-hiR2-FL-D552A-T7、pMSCV-hiR2-FL-P553A-T7、pMSCV-hiR2-FL-R554A-T7、pMSCV-hiR2-FL-T555V-T7、pMSCV-hiR2-FL-T555A-T7、pMSCV-hiR2-FL-C556A-T7、pMSCV-hiR2-FL-E557D-T7、pMSCV-hiR2-FL-E557A-T7、pMSCV-hiR2-FL-E558A-T7、pMSCV-hiR2-FL-P559A-T7、pMSCV-hiR2-FL-A560S-T7、pMSCV-hiR2-FL-S561A-T7、pMSCV-hiR2-FL-S562E-T7、pMSCV-hiR2-FL-S562A-T7、pMSCV-hiR2-FL-G563D-T7、pMSCV-hiR2-FL-G563A-T7、pMSCV-hiR2-FL-A564P-T7、pMSCV-hiR2-FL-A564S-T7、pMSCV-hiR2-FL-H565A-T7、pMSCV-hiR2-FL-I566E-T7、pMSCV-hiR2-FL-I566A-T7、pMSCV-hiR2-FL-W567A-T7、pMSCV-hiR2-FL-P568A-T7、pMSCV-hiR2-FL-D569E-T7、pMSCV-hiR2-FL-D569A-T7、pMSCV-hiR2-FL-D570A-T7、pMSCV-hiR2-FL-I571A-T7, pMSCV-hiR-FL-T572A-T7, pMSCV-hiR-FL-K573A-T7, pMSCV-hiR-FL-W574A-T7, pMSCV-hiR-FL-P575A-T7, pMSCV-hiR-FL-I576A-T7, pMSCV-hiR-FL-C577A-T7, pMSCV-hiR2-FL-T578A-T7, pMSCV-hiR-FL-E579K-T7, pMSCV-hiR2-FL-E579A-T7, pMSCV-hiR-FL-Q580N-T7, pMSCV-hiR-FL-Q580A-T7, pMSCV-hiR-FL-A581S-T7, pMSCV-hiR-FL-R A-T582 pMSCV-hiR2-FL-S583G-T7, pMSCV-hiR2-FL-S583A-T7, pMSCV-hiR2-FL-N584A-T7, pMSCV-hiR2-FL-H585A-T7, pMSCV-hiR2-FL-T586A-T7, pMSCV-hiR2-FL-G587N-T7, pMSCV-hiR2-FL-G587A-T7, pMSCV-hiR-FL-F588H-T7, pMSCV-hiR2-FL-F588A-T7, pMSCV-hiR2-FL-L589P-T7, pMSCV-hiR2-FL-L589A-T7, pMSCV-hiR-FL-H590A-T7, pMSCV-hiR-FL-M591A-T7, pMSCV-hiR-FL-F582-F587, pMSCV-hiR A-F582-F585A-T7, cells were transfected with pMSCV-hiR2-FL-C593A-T7 and pMSCV-hiR-FL-E594V-T7 and maintained at 37 ^℃ 、5％CO ₂ And (3) downwards. After 7 hours, transfection was stopped by replacing the cell supernatant with standard growth medium lacking chloroquine and the cells were incubated at 37℃with 5% CO ₂ Incubate overnight to allow virus production. At the same time, immortalized irom 1/2-/-DKO MEFs as target cells for retroviral infection were grown at 1X10 per well ⁵ Individual cells were inoculated in standard growth medium on 6-well tissue culture plates (Greiner, germany) and also at 37 ℃, 5% CO ₂ The lower part was kept overnight. On the day 3 of the time period, collection release pMSCV-hiR2-FL-Q502R-T7, pMSCV-hiR2-FL-N503A-T7, pMSCV-hiR2-FL-D504A-T7, pMSCV-hiR2-FL-H505R-T7, pMSCV-hiR-FL-H505A-T7, pMSCV-hiR2-FL-S506A-T7, pMSCV-hiR2-FL-G507A-T7, pMSCV-hiR-FL-C508A-T7, pMSCV-hiR2-FL-I509V-T7, pMSCV-hiR-FL-I509A-T7, pMSCV-hiR2-FL-Q510A-T7, pMSCV-hiR 2-FL-511A-T7, pMSCV-hiR-FL-Q512L-T7, pMSCV-hiR-FL-C508A-T7, pMSCV-35B-L-Q512S pMSCV-hiR2-FL-Q512A-T7, pMSCV-hiR2-FL-R513K-T7, pMSCV-hiR2-FL-R513E-T7, pMSCV-hiR2-FL-R513A-T7, pMSCV-hiR-FL-K514E-T7, pMSCV-hiR2-FL-K514A-T7, pMSCV-hiR2-FL-D515E-T7, pMSCV-hiR-FL-D515A-T7, pMSCV-hiR-FL-C516A-T7, pMSCV-hiR-FL-S517A-T7, pMSCV-hiR-FL-E518S-T7, pMSCV-hiR-E518A-T7, pMSCV-hiR-FL-T519A-T7, pMSCV-hiR-FL-L520A-T7, pMSCV-hiR-FL-L7, pMSCV-hiR2-FL-A521S-T7, pMSCV-hiR2-FL-T522V-T7, pMSCV-hiR2-FL-T522A-T7, pMSCV-hiR2-FL-F523W-T7、pMSCV-hiR2-FL-F523A-T7、pMSCV-hiR2-FL-V524A-T7、pMSCV-hiR2-FL-K525A-T7、pMSCV-hiR2-FL-W526A-T7、pMSCV-hiR2-FL-Q527P-T7、pMSCV-hiR2-FL-Q527A-T7、pMSCV-hiR2-FL-D528N-T7、pMSCV-hiR2-FL-D528I-T7、pMSCV-hiR2-FL-D528A-T7、pMSCV-hiR2-FL-D529H-T7、pMSCV-hiR2-FL-D529A-T7、pMSCV-hiR2-FL-T530P-T7、pMSCV-hiR2-FL-T530A-T7、pMSCV-hiR2-FL-G531S-T7、pMSCV-hiR2-FL-G531A-T7、pMSCV-hiR2-FL-P532A-T7、pMSCV-hiR2-FL-P533--T7、pMSCV-hiR2-FL-P533A-T7、pMSCV-hiR2-FL-M534S-T7、pMSCV-hiR2-FL-M534--T7、pMSCV-hiR2-FL-M534A-T7、pMSCV-hiR2-FL-D535--T7、pMSCV-hiR2-FL-D535A-T7、pMSCV-hiR2-FL-K536--T7、pMSCV-hiR2-FL-K536A-T7、pMSCV-hiR2-FL-S537E-T7、pMSCV-hiR2-FL-S537A-T7、pMSCV-hiR2-FL-D538L-T7、pMSCV-hiR2-FL-D538A-T7、pMSCV-hiR2-FL-L539A-T7、pMSCV-hiR2-FL-G540S-T7、pMSCV-hiR2-FL-G540A-T7、pMSCV-hiR2-FL-Q541H-T7、pMSCV-hiR2-FL-Q541A-T7、pMSCV-hiR2-FL-K542A-T7、pMSCV-hiR2-FL-R543Q-T7、pMSCV-hiR2-FL-R543A-T7、pMSCV-hiR2-FL-T544P-T7、pMSCV-hiR2-FL-T544Q-T7、pMSCV-hiR2-FL-T544A-T7、pMSCV-hiR2-FL-S545F-T7、pMSCV-hiR2-FL-S545A-T7、pMSCV-hiR2-FL-G546A-T7、pMSCV-hiR2-FL-A547V-T7、pMSCV-hiR2-FL-A547S-T7、pMSCV-hiR2-FL-V548A-T7、pMSCV-hiR2-FL-C549A-T7、pMSCV-hiR2-FL-H550A-T7、pMSCV-hiR2-FL-Q551A-T7、pMSCV-hiR2-FL-D552A-T7、pMSCV-hiR2-FL-P553A-T7、pMSCV-hiR2-FL-R554A-T7、pMSCV-hiR2-FL-T555V-T7、pMSCV-hiR2-FL-T555A-T7、pMSCV-hiR2-FL-C556A-T7、pMSCV-hiR2-FL-E557D-T7、pMSCV-hiR2-FL-E557A-T7、pMSCV-hiR2-FL-E558A-T7、pMSCV-hiR2-FL-P559A-T7、pMSCV-hiR2-FL-A560S-T7、pMSCV-hiR2-FL-S561A-T7、pMSCV-hiR2-FL-S562E-T7、pMSCV-hiR2-FL-S562A-T7、pMSCV-hiR2-FL-G563D-T7、pMSCV-hiR2-FL-G563A-T7、pMSCV-hiR2-FL-A564P-T7、pMSCV-hiR2-FL-A564S-T7、pMSCV-hiR2-FL-H565A-T7、pMSCV-hiR2-FL-I566E-T7、pMSCV-hiR2-FL-I566A-T7、pMSCV-hiR2-FL-W567A-T7、pMSCV-hiR2-FL-P568A-T7、pMSCV-hiR2-FL-D569E-T7、pMSCV-hiR2-FL-D569A-T7、pMSCV-hiR2-FL-D570A-T7、pMSCV-hiR2-FL-I571A-T7、pMSCV-hiR2-FL-T572A-T7、pMSCV-hiR2-FL-K573A-T7、pMSCV-hiR2-FL-W574A-T7、pMSCV-hiR2-FL-P575A-T7、pMSCV-hiR2-FL-I576A-T7、pMSCV-hiR-FL-C577A-T7, pMSCV-hiR-FL-T578A-T7, pMSCV-hiR2-FL-E579K-T7, pMSCV-hiR-FL-E579A-T7, pMSCV-hiR-FL-Q580N-T7, pMSCV-hiR2-FL-Q580A-T7, pMSCV-hiR-FL-A581S-T7, pMSCV-hiR2-FL-R582A-T7, pMSCV-hiR2-FL-S583G-T7, pMSCV-hiR2-FL-S583A-T7, pMSCV-hiR2-FL-N584A-T7, pMSCV-hiR-FL-H585A-T7, pMSCV-hiR-FL-T586A-T7 supernatant of Phoenix-ECO cells of pMSCV-hiR2-FL-G587N-T7, pMSCV-hiR2-FL-G587A-T7, pMSCV-hiR2-FL-F588H-T7, pMSCV-hiR2-FL-F588A-T7, pMSCV-hiR-FL-L589P-T7, pMSCV-hiR2-FL-L589A-T7, pMSCV-hiR2-FL-H590A-T7, pMSCV-hiR-FL-M591A-T7, pMSCV-hiR-FL-D592A-T7, pMSCV-hiR-FL-C593A-T7 and pMSCV-hiR2-FL-E594V-T7 homotopic virus, filtered through a 0.45 μm CA filter and supplemented with 4. Mu.g/ml polybrene (Sigma-Aldrich, USA). After removal of the medium from the immortalized iRhom1/2-/-DKO MEF, the medium was incubated at 37℃with 5% CO ₂ These supernatants were then added to target cells for 4 hours for the first infection. At the same time, phoenix-ECO cells were re-incubated with fresh medium, after a further 4 hours, filtered and used to again perform a second infection of the corresponding target cell population in the presence of 4. Mu.g/ml polybrene. Likewise, a third round of infection was performed, but overnight. On day 4, the virus-containing cell supernatant was replaced with fresh standard growth medium. From day 5, cells were isolated in 2mg/ml geneticin (G418, thermo Fisher Scientific, USA) were grown in the presence of human iRhom2 full-length single amino acid substitution MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR-FL-H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR-FL-S506A-T7, MEF-DKO-hiR-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7 MEF-DKO-hiR-FL-I509V-T7, MEF-DKO-hiR2-FL-I509A-T7, MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR-FL-R513K-T7, MEF-DKO-hiR-FL-R513E-T7, MEF-DKO-hiR-FL-R513A-T7, MEF-O-hiR-FL-K514E-T7, MEF-hiR 2-FL-K514A-T7, MEF-F-35, MEF-DKO-hiR2-FL-D515E-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DK O-hiR2-FL-S517A-T7、MEF-DKO-hiR2-FL-E518S-T7、MEF-DKO-hiR2-FL-E518A-T7、MEF-DKO-hiR2-FL-T519A-T7、MEF-DKO-hiR2-FL-L520A-T7、MEF-DKO-hiR2-FL-A521S-T7、MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR-FL-H565A-T7, MEF-DKO-hiR2-FL-I566E-T7, MEF-DKO-hiR2-FL-I566A-T7, MEF-DKO-hiR2-FL-W567A-T7, MEF-DKO-hiR 2-FL-P-A-T7, MEF-DKO-hiR-FL-D569E-T7, MEF-DKO-hiR2-FL-D569A-T7, MEF-DKO-hiR2-FL-D570A-T7, MEF-DKO-hiR-FL-I571A-T7, MEF-DKO-hiR-FL-T572A-T7, MEF-DKO-hiR-FL-K-573A-T7, MEF-hiR-FL-W574A-T7, MEF-35A-35 MEF-DKO-hiR2-FL-P575A-T7, MEF-DKO-hiR2-FL-I576A-T7, MEF-DKO-hiR-FL-C577A-T7, MEF-DKO-hiR-FL-T7, MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-hiR2-FL-E579A-T7, MEF-DKO-hiR-FL-Q580N-T7, MEF-DKO-hiR-FL-Q580A-T7, MEF-DKO-hiR-FL-A581S-T7, MEF-DKO-hiR-FL-R582A-T7, MEF-DKO-hiR-FL-S583G-T7, MEF-DKO-hiR-FL-S583A-T7, MEF-DKO-F-L-R-35A-F-R-35, MEF-DKO-hiR-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR-FL-T586A-T7, MEF-DKO-hiR-FL-G587N-T7, MEF-DKO-hiR-FL-G587A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR-FL-L589A-T7, MEF-O-hiR-FL-H590A-T7, MEF-hiR-FL-M591A-T7, MEF-O-hiR-FL-D592A-F-588H-T7, MEF-F-hiR A-FL-D592A-F67 and MEF-5932E cells 594F-F. After proliferation, the cells are stored for later use.

FACS analysis validated by test system

In short, the process is carried out, immortalized MEF-DKO-hiR2-FL-WT-T7 cells were harvested with PBS containing 10mM EDTA and MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR-FL-N503A-T7, MEF-DKO-hiR-FL-D504A-T7, MEF-DKO-hiR-FL-H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR-FL-S506A-T7, MEF-DKO-hiR-FL-G507A-T7, MEF-DKO-hiR-FL-C508A-T7, MEF-O-hiR-FL-I509V-T7, MEF-O-hiR-FL-I509A-T7, MEF-DKO-hiR-FL-G507A-T7 MEF-DKO-hiR2-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR-FL-R513K-T7, MEF-DKO-hiR 2-FL-513E-T7, MEF-DKO-hiR-FL-R513A-T7, MEF-DKO-hiR-FL-K514E-T7, MEF-DKO-hiR2-FL-K514A-T7, MEF-O-hiR-FL-D515E-T7, MEF-DKO-hiR-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR-FL-L520A-T7, MEF-DKO-hiR2-FL-A521S-T7、MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7、MEF-DKO-hiR2-FL-D569E-T7, MEF-DKO-hiR2-FL-D569A-T7, MEF-DKO-hiR2-FL-D570A-T7, MEF-DKO-hiR2-FL-I571A-T7, MEF-DKO-hiR-FL-T572A-T7, MEF-DKO-hiR2-FL-K573A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR-FL-P7, MEF-DKO-hiR-FL-I576A-T7, MEF-DKO-hiR2-FL-C577A-T7, MEF-O-hiR-FL-578A-T7, MEF-DKO-hiR-FL-E579K-T7 MEF-DKO-hiR2-FL-E579A-T7, MEF-DKO-hiR2-FL-Q580N-T7, MEF-DKO-hiR-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-DKO-hiR-FL-N584A-T7, MEF-DKO-hiR-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-hiR-FL-G587N-T7, MEF-DKO-792-FL-G5842A-587, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR-FL-H590A-T7, MEF-DKO-hiR-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells were washed and resuspended in FACS buffer (PBS, 3% FBS,0.05% sodium azide) at about 1X10 per well ⁵ Individual cells were seeded in NuncU-bottom 96-well plates (Thermo Fisher Scientific, USA). To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500rpm at 4℃for 3 minutes. For the first staining, cells were resuspended in 100 μl of FACS buffer alone (control) or 3 μg/ml mouse monoclonal anti-T7 IgG in FACS buffer (Merck Millipore, USA) per well and incubated for 1 hour on ice. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-mouse IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 16A shows representative results of this experiment, illustratively against human iRhom2 variant hiR-FL-K536A-T7. Binding analysis of anti-T7-labeled antibody (black) and anti-mouse IgG secondary antibody (gray) to MEF-DKO-hiR2-FL-WT-T7 (left) and MEF-DKO-hiR2-FL-K536A-T7 cells (right) revealed a stronger increase in relative fluorescence intensity. This shows that, similar to the wild type human iRhom2 (left), the human iRhom2 variant hiR-FL-K536A-T7 was also well expressed and located on the surface of these cells (right). Acquisition in MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR2-FL-N503A-T7, MEF-DKO-hiR2-FL-D504A-T7, MEF-DKO-hiR-FL-H505R-T7, MEF-DKO-hiR-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR-FL-G507A-T7, MEF-DKO-hiR-FL-C508A-T7, MEF-DKO-hiR-FL-I509V-T7, MEF-DKO-hiR-FL-I509A-T7, MEF-DKO-hiR-FL-Q510A-T7, MEF-DKO-hiR-FL-G507A-T7 MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR2-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR2-FL-R513K-T7, MEF-DKO-hiR2-FL-R513E-T7, MEF-DKO-hiR 2-FL-513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR-FL-K514A-T7, MEF-DKO-hiR2-FL-D515E-T7, MEF-O-hiR-FL-D515A-T7, MEF-DKO-hiR-FL-C516A-T7, MEF-DKO-hiR-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR2-FL-T519A-T7, MEF-DKO-hiR2-FL-L520A-T7, MEF-DKO-hiR-FL-A521S-T7, MEF-DKO-hiR2-FL-T522V-T7, MEF-DKO-hiR 2-FL-T523A-T7, MEF-DKO-hiR-FL-523W-T7, MEF-hiR-FL-F-A-T7, MEF-O-hiR-FL-V524A-T7, MEF-hiR-FL-K525A-T7, MEF-DKO-hiR-F-K525A-T7 MEF-DKO-hiR2-FL-W526A-T7, MEF-DKO-hiR2-FL-Q527P-T7, MEF-DKO-hiR-FL-Q527A-T7, MEF-DKO-hiR-FL-D528N-T7, MEF-DKO-hiR-FL-D528I-T7, MEF-DKO-hiR-FL-D528A-T7, MEF-DKO-hiR-FL-D529H-T7, MEF-DKO-hiR-FL-D529A-T7, MEF-DKO-hiR-FL-T530P-T7, MEF-DKO-hiR-FL-T530A-T7, MEF-O-hiR-FL-G531S 7, MEF-hiR-FL-G531A-T7, MEF-DKO-hiR, MEF-DKO-hiR2-FL-P532A-T7, MEF-DKO-hiR 2-FL-P533-T7, MEF-DKO-hiR2-FL-P533A-T7, MEF-DKO-hiR-FL-M534S-T7, MEF-DKO-hiR 2-FL-M534-T7, MEF-DKO-hiR2-FL-M534A-T7, MEF-DKO-hiR 2-FL-D535-T7, MEF-DKO-hiR-FL-D535A-T7, MEF-DKO-hiR-FL-K536-T7, MEF-DKO-hiR-FL-K536A-T7, MEF-DKO-hiR-FL-537E-T7, MEF-hiR-FL-S537A-T7 MEF-DKO-hiR2-FL-D538L-T7, MEF-DKO-hiR2-FL-D538A-T7, MEF-DKO-hiR2-FL-L539A-T7, MEF-DKO-hiR-FL-G540S-T7, MEF-DKO-hiR2-FL-G540A-T7, MEF-DKO-hiR-FL-Q541H-T7, MEF-DKO-hiR-FL-Q541A-T7, MEF-DKO-hiR-FL-K542A-T7, MEF-DKO-hiR-FL-R543Q-T7, MEF-DKO-hiR-FL-R543A-T7, MEF-hiR-FL-T7, MEF-DKO-R543A-FL-T7, MEF-DKO-hiR-FL-T544Q-T7, MEF-DKO-hiR2-FL-T544A-T7, MEF-DKO-hiR2-FL-S545F-T7, MEF-DKO-hiR-FL-S545A-T7, MEF-DKO-hiR-FL-G546A-T7, MEF-DKO-hiR-FL-A547V-T7, MEF-DKO-hiR-FL-A547S-T7, MEF-DKO-hiR2-FL-V548A-T7, MEF-DKO-hiR-FL-C549A-T7, MEF-DKO-hiR-FL-H550A-T7, MEF-O-hiR-FL-Q-A-T7, MEF-hiR-FL-D552A-T7 MEF-DKO-hiR2-FL-P553A-T7, MEF-DKO-hiR2-FL-R554A-T7, MEF-DKO-hiR-FL-T555V-T7, MEF-DKO-hiR-FL-T555A-T7, MEF-DKO-hiR-FL-C556A-T7, MEF-DKO-hiR-FL-E557D-T7, MEF-DKO-hiR2-FL-E557A-T7, MEF-DKO-hiR-FL-E558A-T7, MEF-DKO-hiR-FL-P559A-T7, MEF-DKO-hiR-FL-560S-T7, MEF-DKO-hiR-FL-S561A-T7, MEF-hiR-FL-S7, MEF-S35E-T7, MEF-DKO-hiR-FL-S562A-T7, MEF-DKO-hiR2-FL-G563D-T7, MEF-DKO-hiR2-FL-G563A-T7, MEF-DKO-hiR-FL-A564P-T7, MEF-DKO-hiR2-FL-A564S-T7, MEF-DKO-hiR2-FL-H565A-T7, MEF-DKO-hiR2-FL-I566E-T7, MEF-DKO-hiR2-FL-I566A-T7, MEF-DKO-hiR-FL-W567A-T7, MEF-DKO-hiR-FL-P568A-T7, MEF-hiR-FL-D569E-T7, MEF-O-hiR-FL-D569A-T7, MEF-35-FL-D569A-T7 MEF-DKO-hiR2-FL-D570A-T7, MEF-DKO-hiR2-FL-I571A-T7, MEF-DKO-hiR-FL-T572A-T7, MEF-DKO-hiR-FL-K573A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-P575A-T7, MEF-DKO-hiR-FL-I576A-T7, MEF-DKO-hiR-FL-C577A-T7, MEF-DKO-hiR-FL-578A-T7, MEF-DKO-hiR-FL-E579K-T7, MEF-DKO-hiR-FL-E579A-T7, MEF-DKO-hiR-FL-Q580-N7, MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR-FL-S583A-T7, MEF-DKO-hiR2-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-DKO-hiR2-FL-T586A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-hiR-FL-F588H-T7 similar results for expression and localization of full-length single amino acid substitutions of human irom 2 expressed on MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR-FL-H590A-T7, MEF-DKO-hiR-FL-M591A-T7, MEF-DKO-hiR-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-DKO-hiR2-FL-E594V-T7 cells.

TGF alpha ELISA verified by test system

To test all 137 human iRhom2 variants with single amino acid substitutions or deletions, tgfα shedding ELISA assays were performed on the corresponding MEF-DKO cell lines stably expressing these variants (generated as described in the examples above). To demonstrate the functionality of all variants as indicators (which are correctly folded), PMA-induced release of nuclear-affected tgfα was assessed. Since the cells used in this assay are rescue variants of iRhom 1/2-/-double knockout mouse embryo fibroblasts (described in example 2) that are rescued by corresponding human iRhom2 variants with single amino acid substitutions or deletions, stably expressed iRhom2 variants are the only iRhom proteins expressed in these cells and are therefore the only iRhom that contributes to shed tgfα in these cells.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were coated overnight at 4 ℃ with 400ng/ml mouse anti-human tgfα antibody (provided as part of the DuoSet ELISA kit) in 100 μl TBS per well. Using a 4D-Nucleofector system (Lonza, switzerland), hTGFα -FL-WT construct used in pcDNA3.1 vector backbone electroporation MEF-DKO-hiR2-FL-Q502R-T7, MEF-DKO-hiR-FL-N503A-T7, MEF-DKO-hiR-FL-D504A-T7, MEF-DKO-hiR2-FL-H505R-T7, MEF-DKO-hiR2-FL-H505A-T7, MEF-DKO-hiR2-FL-S506A-T7, MEF-DKO-hiR2-FL-G507A-T7, MEF-DKO-hiR2-FL-C508A-T7, MEF-DKO-hiR-FL-I509V-T7, MEF-DKO-hiR-FL-I509A-T7 MEF-DKO-hiR-FL-Q510A-T7, MEF-DKO-hiR2-FL-T511A-T7, MEF-DKO-hiR2-FL-Q512L-T7, MEF-DKO-hiR-FL-Q512S-T7, MEF-DKO-hiR2-FL-Q512A-T7, MEF-DKO-hiR-FL-R513K-T7, MEF-DKO-hiR-FL-513E-T7, MEF-DKO-hiR-FL-R513A-T7, MEF-DKO-hiR2-FL-K514E-T7, MEF-DKO-hiR-FL-K514A-T7, MEF-O-hiR-FL-D515E-T7, MEF-DKO-hiR2-FL-D515A-T7, MEF-DKO-hiR2-FL-C516A-T7, MEF-DKO-hiR2-FL-S517A-T7, MEF-DKO-hiR2-FL-E518S-T7, MEF-DKO-hiR2-FL-E518A-T7, MEF-DKO-hiR-FL-T7, MEF-DKO-hiR2-FL -L520A-T7、MEF-DKO-hiR2-FL-A521S-T7、MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535-T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536-T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR2-FL-C549A-T7、MEF-DKO-hiR2-FL-H550A-T7、MEF-DKO-hiR2-FL-Q551A-T7、MEF-DKO-hiR2-FL-D552A-T7、MEF-DKO-hiR2-FL-P553A-T7、MEF-DKO-hiR2-FL-R554A-T7、MEF-DKO-hiR2-FL-T555V-T7、MEF-DKO-hiR2-FL-T555A-T7、MEF-DKO-hiR2-FL-C556A-T7、MEF-DKO-hiR2-FL-E557D-T7、MEF-DKO-hiR2-FL-E557A-T7、MEF-DKO-hiR2-FL-E558A-T7、MEF-DKO-hiR2-FL-P559A-T7、MEF-DKO-hiR2-FL-A560S-T7、MEF-DKO-hiR2-FL-S561A-T7、MEF-DKO-hiR2-FL-S562E-T7、MEF-DKO-hiR2-FL-S562A-T7、MEF-DKO-hiR2-FL-G563D-T7、MEF-DKO-hiR2-FL-G563A-T7、MEF-DKO-hiR2-FL-A564P-T7、MEF-DKO-hiR2-FL-A564S-T7、MEF-DKO-hiR2-FL-H565A-T7、MEF-DKO-hiR2-FL-I566E-T7、MEF-DKO-hiR2-FL-I566A-T7、MEF-DKO-hiR2-FL-W567A-T7、MEF-DKO-hiR2-FL-P568A-T7, MEF-DKO-hiR2-FL-D569E-T7, MEF-DKO-hiR2-FL-D569A-T7, MEF-DKO-hiR2-FL-D570A-T7, MEF-DKO-hiR-FL-I571A-T7, MEF-DKO-hiR-FL-T572A-T7, MEF-DKO-hiR2-FL-K573A-T7, MEF-DKO-hiR-FL-W574A-T7, MEF-DKO-hiR-FL-P575A-T7, MEF-DKO-hiR-FL-I576A-T7, MEF-DKO-hiR-FL-C577A-T7, MEF-DKO-hiR-FL-T578A-T7 MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-hiR2-FL-E579A-T7, MEF-DKO-hiR-FL-Q580N-T7, MEF-DKO-hiR-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR2-FL-R582A-T7, MEF-DKO-hiR-FL-S583G-T7, MEF-DKO-hiR-FL-S583A-T7, MEF-DKO-hiR-FL-N584A-T7, MEF-DKO-hiR2-FL-H585A-T7, MEF-hiR-FL-T586A-T7, MEF-DKO-792-FL-G587, MEF-792-FL-G587, MEF-DKO-hiR2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR2-FL-L589P-T7, MEF-DKO-hiR2-FL-L589A-T7, MEF-DKO-hiR-FL-H590A-T7, MEF-DKO-hiR-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-DKO-hiR2-FL-C593A-T7 and MEF-O-hiR 2-FL-E594V-T7 cells were then plated with approximately 33,000 MEF-DKO cells carrying the human iRhom2 variant with single amino acid substitution or deletion in a 96-shaped bottom plate (Thermo Fisher Scientific. Mu.L medium grown in each well of USL.3256). On day 2, the capture antibody solution was removed and +. >Plates were blocked with 300 μl TBS/well, 1% BSA for at least 1 hour at room temperature. Meanwhile, cells were washed once with PBS, after which 80 μl of optmem medium (Thermo Fisher Scientific, USA) was added per well.

Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl of PMA per well (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 1 hour. Mu.l of OptiMEM medium was added to unstimulated control cells. Thereafter, the 96-well plate was centrifuged to pellet the cells. At the same time, the blocking buffer is removed fromPlates were removed and washed 4 with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washerAnd twice. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. Thereafter, 37.5ng/ml biotinylated goat anti-human tgfα detection antibody (provided as part of the DuoSet ELISA kit) in 100 μl TBS was added per well and the plates incubated for 2 hours at room temperature, in the absence of direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used &Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After a further round of washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl of AttoPhos substrate solution (Promega, USA) per well was added to incubate for 1 hour at room temperature in the dark. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

Fig. 16b shows the results of these tgfα release assays, indicating that 128 of all 137 individual iRhom2 variants with single amino acid substitutions or deletions are functionally active, as tgfα shedding can be induced with PMA, indicating that these variants are properly folded compared to the empty vector electroporation (Mock) negative control population, where PMA-induced tgfα shedding is not detected. Human iRhom2 variants hiR2-FL-C516A-T7, hiR2-FL-F523A-T7, hiR2-FL-C549A-T7, hiR2-FL-D552A-T7, hiR2-FL-C556A-T7, hiR-FL-P559A-T7, hiR2-FL-W567A-T7, hiR-FL-W574A-T7 and hiR2-FL-C577A-T7 show no or little functionality and are therefore not subjected to further analysis.

Characterization of the purified antibodies of the invention for FACS analysis of epitope mapping

Briefly, immortalized MEF-DKO-hiR-FL-Q502R-T7, MEF-DKO-hiR-FL-N503A-T7, MEF-DKO-17-with PBS containing 10mM EDTAhiR2-FL-D504A-T7、MEF-DKO-hiR2-FL-H505R-T7、MEF-DKO-hiR2-FL-H505A-T7、MEF-DKO-hiR2-FL-S506A-T7、MEF-DKO-hiR2-FL-G507A-T7、MEF-DKO-hiR2-FL-C508A-T7、MEF-DKO-hiR2-FL-I509V-T7、MEF-DKO-hiR2-FL-I509A-T7、MEF-DKO-hiR2-FL-Q510A-T7、MEF-DKO-hiR2-FL-T511A-T7、MEF-DKO-hiR2-FL-Q512L-T7、MEF-DKO-hiR2-FL-Q512S-T7、MEF-DKO-hiR2-FL-Q512A-T7、MEF-DKO-hiR2-FL-R513K-T7、MEF-DKO-hiR2-FL-R513E-T7、MEF-DKO-hiR2-FL-R513A-T7、MEF-DKO-hiR2-FL-K514E-T7、MEF-DKO-hiR2-FL-K514A-T7、MEF-DKO-hiR2-FL-D515E-T7、MEF-DKO-hiR2-FL-D515A-T7、MEF-DKO-hiR2-FL-C516A-T7、MEF-DKO-hiR2-FL-S517A-T7、MEF-DKO-hiR2-FL-E518S-T7、MEF-DKO-hiR2-FL-E518A-T7、MEF-DKO-hiR2-FL-T519A-T7、MEF-DKO-hiR2-FL-L520A-T7、MEF-DKO-hiR2-FL-A521S-T7、MEF-DKO-hiR2-FL-T522V-T7、MEF-DKO-hiR2-FL-T522A-T7、MEF-DKO-hiR2-FL-F523W-T7、MEF-DKO-hiR2-FL-F523A-T7、MEF-DKO-hiR2-FL-V524A-T7、MEF-DKO-hiR2-FL-K525A-T7、MEF-DKO-hiR2-FL-W526A-T7、MEF-DKO-hiR2-FL-Q527P-T7、MEF-DKO-hiR2-FL-Q527A-T7、MEF-DKO-hiR2-FL-D528N-T7、MEF-DKO-hiR2-FL-D528I-T7、MEF-DKO-hiR2-FL-D528A-T7、MEF-DKO-hiR2-FL-D529H-T7、MEF-DKO-hiR2-FL-D529A-T7、MEF-DKO-hiR2-FL-T530P-T7、MEF-DKO-hiR2-FL-T530A-T7、MEF-DKO-hiR2-FL-G531S-T7、MEF-DKO-hiR2-FL-G531A-T7、MEF-DKO-hiR2-FL-P532A-T7、MEF-DKO-hiR2-FL-P533--T7、MEF-DKO-hiR2-FL-P533A-T7、MEF-DKO-hiR2-FL-M534S-T7、MEF-DKO-hiR2-FL-M534--T7、MEF-DKO-hiR2-FL-M534A-T7、MEF-DKO-hiR2-FL-D535--T7、MEF-DKO-hiR2-FL-D535A-T7、MEF-DKO-hiR2-FL-K536--T7、MEF-DKO-hiR2-FL-K536A-T7、MEF-DKO-hiR2-FL-S537E-T7、MEF-DKO-hiR2-FL-S537A-T7、MEF-DKO-hiR2-FL-D538L-T7、MEF-DKO-hiR2-FL-D538A-T7、MEF-DKO-hiR2-FL-L539A-T7、MEF-DKO-hiR2-FL-G540S-T7、MEF-DKO-hiR2-FL-G540A-T7、MEF-DKO-hiR2-FL-Q541H-T7、MEF-DKO-hiR2-FL-Q541A-T7、MEF-DKO-hiR2-FL-K542A-T7、MEF-DKO-hiR2-FL-R543Q-T7、MEF-DKO-hiR2-FL-R543A-T7、MEF-DKO-hiR2-FL-T544P-T7、MEF-DKO-hiR2-FL-T544Q-T7、MEF-DKO-hiR2-FL-T544A-T7、MEF-DKO-hiR2-FL-S545F-T7、MEF-DKO-hiR2-FL-S545A-T7、MEF-DKO-hiR2-FL-G546A-T7、MEF-DKO-hiR2-FL-A547V-T7、MEF-DKO-hiR2-FL-A547S-T7、MEF-DKO-hiR2-FL-V548A-T7、MEF-DKO-hiR-FL-C549A-T7, MEF-DKO-hiR-FL-H550A-T7, MEF-DKO-hiR-FL-Q551A-T7, MEF-DKO-hiR-FL-D552A-T7, MEF-DKO-hiR-FL-P553A-T7, MEF-DKO-hiR-FL-R554A-T7 MEF-DKO-hiR2-FL-T555V-T7, MEF-DKO-hiR2-FL-T555A-T7, MEF-DKO-hiR-FL-C556A-T7, MEF-DKO-hiR-FL-E557D-T7, MEF-DKO-hiR-FL-E557A-T7, MEF-DKO-hiR-FL-E558A-T7 MEF-DKO-hiR2-FL-P559A-T7, MEF-DKO-hiR2-FL-A560S-T7, MEF-DKO-hiR-FL-S561A-T7, MEF-DKO-hiR-FL-S562E-T7, MEF-DKO-hiR2-FL-S562A-T7, MEF-DKO-hiR-FL-G563D-T7, MEF-DKO-hiR2-FL-G563A-T7, MEF-DKO-hiR-FL-A564P-T7, MEF-DKO-hiR-FL-A S-T7, MEF-DKO-hiR-FL-H565A-T7, MEF-DKO-hiR-FL-I E-T7, MEF-hiR-FL-I566A-T7, MEF-DKO-hiR-FL-W567A-T7, MEF-DKO-hiR2-FL-P568A-T7, MEF-DKO-hiR2-FL-D569E-T7, MEF-DKO-hiR-FL-D569A-T7, MEF-DKO-hiR-FL-D570A-T7, MEF-DKO-hiR-FL-I571A-T7, MEF-DKO-hiR-FL-T572A-T7, MEF-DKO-hiR2-FL-K573A-T7, MEF-DKO-hiR2-FL-W574A-T7, MEF-DKO-hiR2-FL-P575A-T7, MEF-hiR-FL-I576A-T7, MEF-hiR-FL-577A-C577A MEF-DKO-hiR2-FL-T578A-T7, MEF-DKO-hiR2-FL-E579K-T7, MEF-DKO-hiR2-FL-E579A-T7, MEF-DKO-hiR-FL-Q580N-T7, MEF-DKO-hiR2-FL-Q580A-T7, MEF-DKO-hiR2-FL-A581S-T7, MEF-DKO-hiR-FL 582A-T7, MEF-DKO-hiR2-FL-S583G-T7, MEF-DKO-hiR2-FL-S583A-T7, MEF-hiR-FL-N584A-T7, MEF-hiR-FL-H585A-T7, MEF-hiR-FL-T585A-T7, MEF-DKO-hiR2-FL-G587N-T7, MEF-DKO-hiR2-FL-G587A-T7, MEF-DKO-hiR2-FL-F588H-T7, MEF-DKO-hiR2-FL-F588A-T7, MEF-DKO-hiR-FL-L589P-T7, MEF-DKO-hiR-FL-L589A-T7, MEF-DKO-hiR2-FL-H590A-T7, MEF-DKO-hiR2-FL-M591A-T7, MEF-DKO-hiR2-FL-D592A-T7, MEF-O-hiR 2-FL-C593A-T7 and MEF-DKO-hiR-FL-E594V-T7 cells were washed and resuspended in FACS buffer (3.05% PBS) and resuspended in about 10% sodium FBS 1.10% per well ⁵ Individual cells were seeded in Nunc U-bottom 96-well plates (Thermo Fisher Scientific, USA). To pellet the cells and remove the supernatant, the plates were centrifuged at 1,500rpm at 4℃for 3 minutes. For the first staining, cells were resuspended in 100. Mu.l of FACS buffer alone (control) or 3. Mu.g/ml of humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B in FACS buffer per well-02 and 42-B-04 and incubated on ice for 1 hour. After this, the plates were centrifuged at 1,500rpm and 4℃for 3 minutes and washed twice with 200. Mu.l of FACS buffer per well. For the second staining, cells were centrifuged and resuspended in 100 μl per well of PE conjugated goat anti-human IgG F (ab') 2 detection fragment (Dianova, germany) diluted 1:100 with FACS buffer. The cell suspension was incubated on ice for 1 hour in the dark. Plates were then centrifuged at 1,500rpm and 4℃for 3 minutes and washed three times with 200 μl of FACS buffer per well. Finally, the cells were resuspended in 150 μl of FACS buffer per well and analyzed using a BD accuri (tm) C6 Plus flow cytometer (Becton Dickinson, germany).

Fig. 17a shows representative results of this experiment. Illustratively, data for analysis of cells expressing human iRhom1 variant hiR2-FL-K536A-T7 are shown for the entire panel of 128 functional human iRhom2 variants with single amino acid substitutions or deletions. Binding assays of MEF-DKO-hiR2-FL-WT-T7 cells (left) and MEF-DKO-hiR-FL-K536A-T7 cells (right) with humanized antibody 42-B-02 as a representative example of an antibody of the invention (black) and anti-mouse IgG secondary antibody (gray) showed that substitution of the single amino acid lysine 536 of human iRhom2 was strongly compromised by substitution with alanine and thus contributed to binding of humanized antibody 42-B-02 of the invention (right). Binding to MEF-DKO-hiR2-FL-WT-T7 cells (left) was used as a positive control for humanized antibody 42-B-02.

FIG. 17B (as an extension of FIG. 17 a) summarizes the results of FACS analysis of a population of 128 engineered functional MEFs expressing human iRhom2 variants with single amino acid substitutions or deletions using the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the present invention. The binding of each antibody to the wild type human iRhom2 was considered to be 100% binding. Light gray cells (and labeled with "1") indicate a 30-59% decrease in antibody binding to any variant, respectively, gray cells (labeled with "2") indicate a 60-95% impairment of binding, and dark gray cells (labeled with "3") highlight a loss of binding of > 95%. These data reveal the pattern of amino acid positions associated with the binding of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 of the invention.

Example 15: analysis of the inhibitory Effect of the antibodies of the invention on LPS-induced shedding of TNF alpha in vitro in primary human material from healthy donors

In the following study, ELISA-based tnfα release assays were performed to analyze the inhibitory effect of the antibodies of the invention on LPS-induced endogenous tnfα release from primary human material obtained from healthy donors using Peripheral Blood Mononuclear Cells (PBMCs).

The ELISA-based tnfα release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were coated overnight with 100 μl of mouse anti-human TGF-alpha capture antibody per well (provided as part of DuoSet ELISA kit) in 4 μg/ml TBS at 4deg.C. On day 2, the capture antibody solution was removed and +.>Plates were blocked with 300 μl TBS, 1% BSA per well for 3 hours at room temperature. Simultaneously, 80 μl of 20,000PBMC (20,000PBMC) cells from healthy donors in normal growth medium were seeded into each well of a Greiner CELLSTAR V-bottom 96-well plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bamstat (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 15. Mu.g/ml human IgG 1. Kappa. Antibody (BioLegend, USA) as isotype control (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml antibody of the invention (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl of 0,06ng/ml LPS (Sigma-Aldrich, USA) per well for 2 hours in growth medium. After that, the 96-well plate is centrifuged to settleAnd (3) a starch cell. At the same time, the blocking buffer is taken up from +.>Plates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human tnfα protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Thereafter, 100 μl of biotinylated goat anti-human tnfα detection antibody (provided as part of the DuoSet ELISA kit) of TBS at a concentration of 50ng/ml was added to each well, and the plates were incubated for 2 hours at room temperature, in the absence of direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used&Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

Figure 18 shows representative results of this experiment, demonstrating the effect of the test on LPS-induced tgfα release from PBMCs from healthy populations, in absolute numbers (figure 18 a) and percent inhibition (figure 18 b). Although batimastat (BB 94), a small molecule inhibitor of metalloprotease, served as a positive control and resulted in 98.9% inhibition of LPS-induced tnfα release, the presence of IgG isotype control had no significant effect on tnfα shedding. In contrast, equal concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited LPS-induced TNF alpha release from PBMC from healthy donors by 74.2%, 73.5%, 72.8%, 59.4%, 64.3% and 68.5%, respectively.

Example 16: analysis of the inhibition effect of the antibodies of the invention on PMA-induced IL-6R shedding in vitro in primary human material from healthy donors

In the following study, ELISA-based IL-6R release assays were performed to analyze the inhibitory effect of the antibodies of the invention on PMA-induced endogenous IL-6R release from primary human material obtained from healthy donors using Peripheral Blood Mononuclear Cells (PBMCs).

The ELISA-based IL-6R release assay used in this example will be described below.

Briefly, on day 1, nunc black is taken96-well plates (Thermo Fisher Scientific, USA) were coated overnight at 4 ℃ with 2 μg/ml mouse anti-human tgfα capture antibody (provided as part of the DuoSet ELISA kit) in 100 μl TBS per well.

Mu.l of 40,000 PBMC (STEMCELL Technologies, canada) cells from healthy donors in normal growth medium were seeded into each well of a Greiner CELLSTAR V-shaped bottom 96-well cell culture plate (Greiner Bio-One, germany) and incubated at 37℃with 5% CO ₂ The cells were pre-incubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bambusa (BB 94, abcam, UK) as positive control (final concentration 10. Mu.M in the resulting 100. Mu.l sample volume), 15. Mu.g/ml of human IgG antibody (BioLegend, USA) as isotype control (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml of the antibody of the invention (final concentration 3. Mu.g/ml in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 24 hours in growth medium.

On day 2, the capture antibody solution was removed and thePlates were blocked with 300 μl TBS/well, 1% BSA for 2 hours at room temperature.

At the same time, 96-well plates were centrifuged to pellet the cells. At the same time, the blocking buffer is removed fromPlates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. In addition, 100 μl of recombinant human IL-6R protein (provided as part of the DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Plates were incubated for 2 hours at room temperature. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl of 100ng/ml TBS biotinylated goat anti-human IL-6R detection antibody (provided as part of the DuoSet ELISA kit) per well was added and the plates were incubated at room temperature for 2 hours with direct light. After washing 4 times with 350. Mu.l TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100. Mu.l streptavidin-AP (R) diluted with TBS at 1:10,000 will be used &Dsystems, USA) was added to each well and the plates were incubated at room temperature for 30 minutes, again against direct light. After washing 4 times with 350 μl tbs-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attophos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Using an infinite M1000 (Tecan Group, switzerland) microplate reader, at an excitation wavelength of 435nm and a hair of 555nmFluorescence from each well is collected at the wavelength of the emission.

Figure 19 shows representative results of this experiment, demonstrating the effect of the test article on PMA-induced IL-6R release of IL-6R from PBMCs from healthy donors, in absolute numbers (figure 19 a) and percent inhibition (figure 19 b). Although batimastat (BB 94), a small molecule inhibitor of metalloprotease, served as a positive control and resulted in 96.2% inhibition of PMA-induced IL-6R release, the presence of IgG isotype control had no significant effect on IL-6R shedding. In contrast, equal concentrations of the humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced IL-6R release from PBMC from healthy donors by 75.0%, 79.0%, 75.4%, 64.6%, 73.4% and 78.4%, respectively.

Example 17: analysis of the inhibition effect of the antibodies of the invention on PMA-induced shedding of HB-EGF in vitro in primary human material from healthy donors

In the following study, ELISA-based HB-EGF release assays were performed to analyze the inhibitory effect of the antibodies of the invention on PMA-induced release of endogenous HB-EGF from primary human material obtained from healthy donors using Peripheral Blood Mononuclear Cells (PBMC).

The ELISA-based HB-EGF release assay used in this example will be described below.

Briefly, on day 1, nunc black is takenA96-well plate (Thermo Fisher Scientific, USA) was coated overnight at 4℃with 100. Mu.l of mouse anti-human HB-EGF capture antibody in 2. Mu.g/ml TBS per well (provided as part of DuoSet ELISA kit).

80 μl of 80,000 PBMC (STEMCELL Technologies, canada) cells from healthy donors in normal growth medium were seeded into each well of Greiner CELLSTAR V-shaped bottom 96-well cell culture plate (Greiner Bio-One, germany) and incubated at 37deg.C, 5% CO ₂ The cells were preincubated for 30 min with 20. Mu.l of standard growth medium per well supplemented with 50. Mu.M of Bambusa (BB 94, abcam, UK) as positive control (in the resulting 100. Mu.l sample volume) The final concentration of (2) was 10. Mu.M), 15. Mu.g/ml human IgG antibody (BioLegend, USA) as isotype control (3. Mu.g/ml final concentration in the resulting 100. Mu.l sample volume) or 15. Mu.g/ml antibody of the invention (3. Mu.g/ml final concentration in the resulting 100. Mu.l sample volume). In the case of the stimulated control, 20 μl of standard growth medium without test article was added. Subsequently, at 37℃5% CO ₂ Cells (except for those of the unstimulated control) were stimulated with 20 μl per well of 150ng/ml PMA (Sigma-Aldrich, USA) (final concentration 25 ng/ml) for 24 hours in growth medium. On day 2, the capture antibody solution was removed and thePlates were blocked with 300 μl TBS/well, 1% BSA for 2 hours at room temperature.

At the same time, 96-well plates were centrifuged to pellet the cells. At the same time, the blocking buffer is removed fromPlates were removed and washed 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer. To avoid drying out, 30. Mu.l of TBS were immediately added to +.>In each well of the plate, then 70 μl of cell-free supernatant was transferred per sample. Furthermore, 100 μl of recombinant human HB-EGF protein (provided as part of DuoSet ELISA kit) diluted with TBS at defined concentrations was added to the plates as a standard reference. Plates were incubated for 2 hours at room temperature. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl of biotinylated goat anti-human HB-EGF detection antibody in 50ng/ml TBS (provided as part of DuoSet ELISA kit) per well was added, and the plates were incubated at room temperature for 2 hours, in the absence of direct light.

After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl of streptavidin-AP (R & D Systems, USA) diluted with TBS at 1:10,000 was added to each well and direct light was again avoided and the plates were incubated for 30 minutes at room temperature. After washing 4 times with 350 μl TBS-T (Carl Roth, germany) per well on a further round of 96-head plate washer (Tecan Group, switzerland) and careful removal of all buffer traces after the fourth cycle, 100 μl attospos substrate solution (Promega, USA) per well was added for incubation in the dark at room temperature for 1 hour. Fluorescence was collected for each well using an infinite M1000 (Tecan Group, switzerland) microplate reader at an excitation wavelength of 435nm and an emission wavelength of 555 nm.

FIG. 20 shows representative results of this experiment, demonstrating the effect of the test article on PMA-induced HB-EGF release from PBMC from healthy donors in absolute numbers (FIG. 20 a) and percent inhibition (FIG. 20 b). Although batimastat (BB 94) as a small molecule inhibitor of metalloprotease was used as a positive control and its 100.0% inhibited PMA-induced HB-EGF release, the presence of the IgG isotype control had no significant effect on HB-EGF shedding. In contrast, equal concentrations of humanized antibodies 16-B-03, 16-B-05, 16-B-07, 23-B-04, 42-B-02 and 42-B-04 inhibited PMA-induced HB-EGF release from PBMC from healthy donors by 69.7%, 74.8%, 66.5%, 49.6%, 59.2% and 66.7%, respectively.

Example 18: analysis of the inhibitory Effect of the antibodies of the invention on LPS-induced shedding of TNF alpha in vivo

In the following study, ELISA-based tnfα release assays were performed in an septic shock mouse model to verify the inhibitory effect of the antibodies of the invention on LPS-induced endogenous tnfα release. Experiments were performed using genetically humanized mice in which part of the mouse genomic iRhom2DNA (exons encoding antibody binding sites) was replaced by the corresponding human genomic DNA sequence. All animal experiments were approved by institutional animal care and use committee of special surgical hospitals and wilkannel doctors' colleges.

On day 1, a group of mice was injected with the antibody of the present invention at a concentration of 250. Mu.g/kg in 200. Mu.L PBS. The second group was injected with the same volume of PBS alone (200. Mu.l PBS per mouse). After 1h, all mice were given per mouseMice were injected with LPS (Sigma, USA) at a concentration of 50. Mu.g/200. Mu.L (250 ng/. Mu.L). All mice were closely monitored and CO was inhaled after 2 hours ₂ It was euthanized. Blood was removed from the chest cavity and centrifuged at 4000g for 10min at room temperature to remove cells and debris. The clear serum was transferred to a new tube and subsequently diluted 1:10 with PBS for ELISA measurement.

For measuring tnfα release, a mouse tnfα uncoated ELISA kit (Invitrogen, USA) was used. Briefly, on day 1,96-well plates (Corning, USA) were coated overnight with 100 μl of anti-mouse TGF-alpha capture antibody per well (provided as part of ELISA kit) in PBS at 4deg.C at 1:250. On day 2, the capture antibody solution was removed and washed +.with 250 μl per well of 0.05% PBS-Tween (Boston Bio, USA) using a Nunc Immunowsh plate washer (VWR, USA)>96-well plates were 3 times and plates were blocked with 150 μl ELISA/ELISPOT dilution (1X) (provided as part of the kit) for 1 hour. Then, from->Blocking buffer was removed from the plates and washed with 250 μl of 0.05% PBS-Tween (Boston Bio, USA) per well using a Nunc Immunowash plate washer (VWR, USA)>96-well plates 3 times. Immediately thereafter, 20 μl of biotinylated anti-mouse TNFα detection antibody (provided as part of ELISA kit) was added to all wells in ELISA/ELISPOT dilutions at a final dilution of 1:250. Then, 80 μl of clear serum diluted 1:10 or 80 μl of standard reference of recombinant mouse TNFα protein diluted in ELISA/ELISPOT dilutions at defined concentrations was added to the plates. Samples, standards and detection antibodies were incubated for 2h at room temperature. In a Nunc Immunowsh plate washer (VWR, USA) with 250 μl per well After 3 washes of 0.05% pbs-tween (Boston Bio, USA) and careful removal of all buffer traces after the third cycle, 100 μl of streptavidin-horseradish peroxidase conjugate (provided as part of the ELISA kit) diluted 1:100 in ELISA/ELISPOT diluent was added to each well and the plate was incubated for 30 minutes at room temperature. After a further round of washing 3 times with 250 μl of 0.05% PBS-Tween per well using a Nunc Immunowash plate washer (VWR, USA) and careful removal of all buffer traces after the third cycle, 100 μl TMB substrate solution (BD, USA) per well was added for 15 minutes of incubation. The color reaction was stopped by adding 100 μl of 2N sulfuric acid (Sigma, USA) and ELISA plates were read using a Multiscan Titertek plate reader (VWR, USA) at a wavelength of 450 nm.

Figure 21 shows representative results of this experiment, demonstrating the effect of the test sample on LPS-induced tnfα release in serum of genetically humanized mice, in absolute numbers (figure 21 a) and percent release (figure 21 b). In contrast to LPS-induced tnfα release in serum of genetically humanized mice (set to 100%), humanized antibody 42-B-02, which is a representative example of the antibody of the present invention, resulted in an LPS-induced release of tnfα of 17.3% in serum of genetically humanized mice.

Reference to the literature

·G.&Milstein、C.(1975):Continuous cultures of fused cells secreting antibody of predefined specificity.In:Nature.Bd.256,S.495–497.Jonsson and Malmquist,Advances in Biosensors,2:291-336(1992)

Wu et al, pr.Natl.Acad.Sci.USA,95:6037-6042 (1998)

·Banik,SSR；Doranz,BJ(2010).“Mapping complex antibody epitopes”.Genetic Engineering&Biotechnology News.3(2):25-8

·DeLisser,HM(1999).Epitope mapping.Methods Mol Biol.96.pp.11–20

Finco et al Comparison of competitive ligand-binding assay and bioassay formats for the measurement of neutralizing antibodies to protein therapeutics J Pharm Biomed Anal 20111025; 54 (2):351-8.

Deng et al Enhancing antibody patent protection using epitope mapping information MAbs.2018Feb-Mar;10 (2):204-209

Huston et al, cell Biophysics,22:189-224 (1993);

·Plückthun and Skerra、Meth.Enzymol.,178:497-515(1989)and in Day、E.D.、Advanced Immun℃hemistry,Second Ed.,Wiley-Liss,Inc.,New York,N.Y.(1990)

·Harding、The immunogenicity of humanized and fully human antibodies.MAbs.2010May-Jun；2(3):256–265.

eylenstein et al Molecular basis of in vitro affinity maturation and functional evolution of a neutralizing anti-human GM-CSF anti-body, mAbs, 8:1, 176-186 (2016)

Kabat et al, J.biol. Chem.252, 6609-6616 (1977) and Kabat et al, sequences of protein of immunological Interest (1991)

Chothia et al, J.mol. Biol.196:901-917 (1987)

MacCallum et al, J.mol. Biol.262:732-745 (1996)

Paul Baran et al, biol chem.2013May 24;288 (21):14756-14768.

Sequence(s)

The following sequences form part of the present disclosure. The application also provides an electronic sequence table compatible with WIPOST 25. For the avoidance of doubt, if there is a difference between the sequences in the following table and the electronic sequence listing, the order in the table should be considered correct.

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

Claims (20)

1. Humanized antibody that binds iRhom2, or target binding fragment or derivative thereof that retains target binding capacity, which

a) Comprising a set of three heavy chain Complementarity Determining Regions (CDRs) and three light chain Complementarity Determining Regions (CDRs) contained in one of the following heavy chain/light chain variable domain sequence pairs:

SEQ ID NOs 1 and 5;

SEQ ID NOs 9 and 13;

SEQ ID NOs 17 and 21;

SEQ ID NOs 25 and 29;

SEQ ID NOs 33 and 37 or

SEQ ID NOs 41 and 45,

b) Comprising a set of three heavy chain Complementarity Determining Regions (CDRs) and three light chain Complementarity Determining Regions (CDRs) selected from the group consisting of SEQ ID NOs 2, 3, 4, 6, 7 and 8,

SEQ ID NOs 10, 11, 12, 14, 15 and 16,

SEQ ID NOs 18, 19, 20, 22, 23 and 24,

SEQ ID NOs 26, 27, 28, 30, 31 and 32,

SEQ ID NOs 34, 35, 36, 38, 39 and 40, or

SEQ ID NOs 42, 43, 44, 46, 47 and 48,

c) A set of heavy/light chain Complementarity Determining Regions (CDRs) comprising b), provided that at least one of said CDRs has at most 3 amino acid substitutions relative to the corresponding SEQ ID NO, and/or

d) A set of heavy/light chain Complementarity Determining Regions (CDRs) comprising b) or c), provided that at least one of said CDRs has > 66% sequence identity with the corresponding CDR comprised in said SEQ ID NO,

Wherein the CDRs are embedded within a suitable protein framework, preferably a variable domain framework, in order to be able to bind to human iRhom 2.

2. The antibody or fragment of claim 1, wherein the CDRs are determined according to the definition of Kabat, chothia or MacCallum, preferably wherein the CDRs are determined according to the numbering set forth in table 1.

3. The antibody or fragment of any one of claims 1-2, comprising

a) The heavy chain/light chain variable domain (HCVD/LCVD) pair shown in the following SEQ ID NO pair:

1 and 5;

9 and 13;

17 and 21;

25 and 29;

33 and 37 and/or

41 and 45

b) a) heavy chain/light chain variable domain (HCVD/LCVD) pair, provided that

The HCVD has a sequence identity of > 80% with the corresponding SEQ ID NO, and/or

Said LCVD has a sequence identity of > 80% with the corresponding SEQ ID NO,

c) a) or b) with the proviso that at least one of HCVD or LCVD has at most 10 amino acid substitutions relative to the corresponding SEQ ID NO,

the antibody or fragment is still capable of binding to human iRhom2 and/or inhibiting or reducing TACE/ADAM17 activity.

4. The antibody or fragment of any one of claims 1-3, wherein at least one amino acid substitution is a conservative amino acid substitution.

5. The antibody or fragment of any one of the preceding claims, having at least one of the following:

target binding affinity to human iRhom2 > 50% compared to an antibody or fragment according to any one of the preceding claims, and/or

An inhibitory or reducing effect of ≡50% on TACE/ADAM17 activity of an antibody or fragment according to any one of the preceding claims.

6. A humanized antibody that binds to human iRhom2 and competes with the following for binding to human iRhom 2:

a) The antibody of any one of claims 1-5, or

b) Selected from clone 16-B-03;16-B-05;16-B-07;23-B-04;42-B-02; and/or 42-B-04.

7. A humanized antibody that binds to substantially the same, or identical, region on human iRhom2 as:

a) The antibody of any one of claims 1-5, or

b) Selected from clone 16-B-03;16-B-05;16-B-07;23-B-04;42-B-02; and/or 42-B-04.

8. The antibody or fragment of any one of the preceding claims, which, when bound to human iRhom2, binds at least in the region of loop 1 of human iRhom 2.

9. The antibody or fragment of any one of the preceding claims, wherein inhibition or reduction of TACE/ADAM17 activity is caused by interfering with iRhom 2-mediated TACE/ADAM17 activation.

10. The antibody or fragment of any one of the preceding claims, which when bound to human iRhom2,

inhibit or reduce induced TNFalpha shedding, and/or

Inhibit or reduce induced IL-6R shedding, and/or

Inhibit or reduce the induced HB-EGF shedding.

11. The antibody or fragment of any one of the preceding claims, wherein the human iRhom2 to which the antibody or fragment binds comprises

a) The amino acid sequence shown in SEQ ID NO 49, or

b) An amino acid sequence having at least 80% sequence identity to SEQ ID NO 49, provided that said sequence retains iRhom2 activity.

12. The antibody or fragment of any one of the preceding claims, which is a monoclonal antibody, or a target binding fragment or derivative thereof that retains the ability to bind a target.

13. The antibody or fragment of any one of the preceding claims, which is in at least one form selected from the group consisting of: igG, scFv, fab, or (Fab) 2.

14. The antibody or fragment of any one of the preceding claims, which does not cross-react with human iRhom 1.

15. A nucleic acid encoding at least one strand of an antibody or fragment according to any one of the preceding claims.

16. An antibody or fragment according to any one of claims 1-14 or a nucleic acid according to claim 15 (in preparation) for use in therapy

The inflammatory condition is diagnosed and is a patient diagnosed with an inflammatory condition,

suffering from inflammatory conditions or

Human or animal subjects at risk of developing inflammatory conditions or for use (in medicine) in the prevention of such conditions.

17. A pharmaceutical composition comprising an antibody or fragment according to any one of claims 1-14 or a nucleic acid according to claim 15, and optionally one or more pharmaceutically acceptable excipients.

18. A combination comprising (i) an antibody or fragment according to any one of claims 1-14 or a nucleic acid according to claim 15, or a pharmaceutical composition according to claim 17 and (ii) one or more therapeutically active compounds.

19. A method for treating or preventing an inflammatory condition, the method comprising administering the antibody or fragment of any one of claims 1-14, the nucleic acid of claim 15, the pharmaceutical composition of claim 17, or the combination of claim 18 to a human or animal subject at a therapeutically sufficient dose.

20. A therapeutic kit comprising:

a) The antibody or fragment of any one of claims 1-14, the nucleic acid of claim 15, the pharmaceutical composition of claim 17, or the combination of claim 18,

b) A device for applying said composition, composition or combination, and

c) Instructions for use.