CN117210559A - Ovarian cancer related gene methylation detection composition and application thereof - Google Patents

Abstract

The invention provides a gene methylation detection composition related to ovarian cancer and application thereof. Through extensive and intensive research, the combination of HOXA9, SHOX2 and RASSF1A, SEPTIN9 has high clinical guidance significance in the diagnosis of ovarian cancer, and provides reference basis for the diagnosis of ovarian cancer.

Description

Ovarian cancer related gene methylation detection composition and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a gene methylation detection composition related to ovarian cancer and application thereof.

Background

The incidence of ovarian cancer is third among all gynaecological malignancies, but the mortality rate is highest. Ovarian cancer is a malignant tumor of ovarian tumor, and refers to malignant tumor growing on ovary, wherein 90% -95% of ovarian primary cancers, and 5% -10% of ovarian primary cancers at other positions are transferred to the ovary. Ovarian cancer has a high heterogeneity, about 90% of which are epithelial ovarian cancers, of which about 70% are serous and have a poor prognosis. The survival rate of early stage (stage I) ovarian cancer patients in 5 years exceeds 90%, however, early stage ovarian cancer has no obvious clinical symptoms, most patients are difficult to find in time in early stage, more than 70% of ovarian cancer is found in late stage, and the survival rate of 5 years is less than 70%. Ovarian cancer is a significant challenge in early detection of ovarian cancer due to its strong heterogeneity, rapid progression, and lack of suitable early detection methods. Therefore, the search for a reliable early detection marker for ovarian cancer has great significance.

Currently, serum carbohydrate antigen 125 (carbohydrate antigen, ca 125) is the most widely used marker for diagnosis and recurrence monitoring of epithelial ovarian cancer in clinic. However, in patients with early stage ovarian cancer, the sensitivity is less than 50%, the specificity is not high, and detection of CA125 alone is not suitable for early diagnosis of epithelial ovarian cancer. The clinical ovarian cancer diagnosis combination with higher application prospect is the detection of human epididymal protein 4 (human epididymis protein, HE4) combined with CA125, but is only approved by the FDA of the United states medical administration as only approved for the recurrence or progress monitoring of ovarian cancer. About 2/3 of patients with ovarian cancer are accompanied with ascites and/or hydrothorax, and the occurrence of hydrothorax and ascites not only indicates that the cancer is widely spread and difficult to treat, but also is extremely easy to cause misdiagnosis, so that the treatment is delayed. Samples that may be used for early diagnosis of ovarian cancer include body fluids such as plasma, peritoneal fluid, ovarian cyst fluid, and surgical tissue samples.

The hydrothorax and ascites (including peritoneal flushing liquid) cytology plays an important role in the diagnosis of ovarian tumor, not only is the basis for ovarian cancer staging, but also has important significance in the diagnosis, treatment, monitoring and prognosis judgment of ovarian cancer. Ascites cytology began to be used for gynecological tumor management in 1956, and the international gynaecology and obstetrics consortium (FIGO) began to use ascites cytology to stage ovarian cancer in 1975, but currently, the ovarian cancer adopts a stage system revised in FIGO2014, wherein one of stage ia and stage ib stage criteria is "no malignant tumor cells in ascites" and one of stage criteria in stage ic is "malignant tumor cells in ascites". Because the early stage of the ovarian cancer has no specific symptoms, 70% of patients are in the late stage when they visit the doctor, many patients have ascites, and some cases take the ascites as the first symptom, at this time, the ascites cytology can be clearly diagnosed as early as possible, so that a clinician can make a treatment scheme for the patients as early as possible and apply effective treatment. During the course of treatment, the treatment can also be monitored by ascites cytology. In addition, ascites cytology also aids the clinician in judging patient prognosis. The intra-operative abdominal water is typically dissected from the abdominal cavity by the clinician during surgery, and is obtained before any investigation. If ascites is found, even if the amount is small, sucking out and adding anticoagulant for immediate inspection; if no obvious ascites is found, the sterilized warm normal saline mixed with anticoagulant is used for flushing the abdominal cavity, especially the areas which are easy to be planted with tumor cells, such as uterine rectum concave, and the like, and flushing fluid is sucked out by a needle cylinder and immediately sent for inspection. Before the operation is finished and the abdominal cavity is closed, the abdominal cavity is flushed again to carry out the inspection on the abdominal cavity flushing fluid so as to observe whether overflowing tumor cells exist after the tumor is resected. Non-surgical ascites is generally sampled by a clinician by abdominal cavity puncture according to the specific illness state of a patient, and then anticoagulant is added for examination. After receiving the sample in the pathology department or cell room, the centrifugally enriched cells are directly smeared or liquid-based cell smears are prepared, and after fixed staining, the cytopathologist reads the diagnostic report results. However, traditional cytological diagnosis mainly relies on pathologists to search cancer cells under a microscope, has low diagnosis sensitivity, and cannot meet the requirements of clinical diagnosis. In recent years, along with the development of technology and the progress of medicine, new medical technology is continuously emerging, and besides immunohistochemical examination, molecular biology technology is also applied to ascites/peritoneal irrigation liquid cytology, so that diagnosis is more accurate, and better pathological support is provided for diagnosis and treatment of ovarian cancer patients.

Gastrointestinal response is an early symptom of ovarian cancer. Women in climacteric period often feel abdominal distention and inappetence, and the gastrointestinal tract diseases are not found by examination of gastroenterology, so that women should go to gynecology in time for diagnosis. Because the ovarian tumor can cause surrounding ligaments to be pressed and pulled, and ascites is stimulated, gastrointestinal symptoms often occur. About 2/3 of patients with ovarian cancer are accompanied with ascites and/or hydrothorax, and the occurrence of hydrothorax and ascites not only indicates that the cancer is widely spread and difficult to treat, but also is extremely easy to cause misdiagnosis, so that the treatment is delayed. Digestive system tumors including gastric cancer, intestinal cancer, liver cancer, pancreatic cancer, bile duct cancer and the like are also main malignant tumors which cause hydrothorax and ascites. Therefore, for patients with highly suspected ovarian cancer and hydrothorax and ascites, the clinical urgent need is to improve the detection sensitivity of hydrothorax and ascites, give clear diagnosis, and further clinically hope to make differential diagnosis with digestive system tumors besides clear malignant diagnosis of ovarian cancer.

In recent years, with the progress of radical surgery and the development of chemotherapy schemes, the curative effect of ovarian cancer is improved compared with that of prior ovarian cancer, but primary or secondary chemotherapy resistance of ovarian cancer cells often leads to chemotherapy failure, which is a key link for causing recurrence, metastasis and high mortality of ovarian cancer, and severely restricts the improvement of survival rate of ovarian cancer patients. In order to improve prognosis in ovarian cancer patients, new markers that can predict chemotherapy resistance early and new therapeutic strategies to overcome resistance are needed. Studies show that abnormal DNA methylation is related to the acquired resistance of ovarian cancer platinum drugs, and the demethylated drugs can restore the sensitivity of ovarian cancer chemotherapy drug-resistant patients to the platinum drugs, improve the prognosis of the patients and are potential targets for ovarian cancer treatment. Currently, DNA methyltransferase inhibitors (DNMT inhibitors), also known as demethylating agents, decitabine and azacitidine, are commonly used in domestic clinical practice. After the two are phosphorylated, they can be directly doped into DNA to inhibit DNA methylation transferase and induce DNA hypomethylation, cell differentiation or apoptosis so as to play the role of resisting tumor. The existing demethylation medicine is mainly applied to primary and secondary myelodysplastic syndromes of primary treatment and secondary treatment, and has not yet been applied to the mature aspect of ovarian cancer treatment. Secondly, the use of demethylated drugs has no definite target, and the overall effective rate is only 40-60%. A judging method and a basis for selectively treating ovarian cancer according to the drug resistance situation are also urgently needed clinically, and if a clear target spot which can be applied to the use of the demethylated drug is found, the clinical treatment efficacy of the demethylated drug can be improved.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, an object of the present invention is to provide a composition for detecting ovarian cancer related gene methylation and use thereof, which are useful for solving the problem that the prior art lacks an effective means for detecting ovarian cancer.

In one aspect the invention provides the use of a combination of four genes HOXA9, SHOX2, RASSF1A, SEPTIN9 for the preparation of an ovarian cancer diagnostic reagent for detecting the degree of methylation of said four genes.

Further, the sample detected by the diagnostic reagent is any one of hydrothorax, ascites, peritoneal irrigation fluid and tissue sample of an ovarian disease patient of an organism. The ovarian disease patient tissue sample may be an ovarian cyst fluid, or other ovarian tissue sample.

Further, the use specifically includes at least one of:

a) If any of the genes HOXA9, SHOX2 and RASSF1A of the sample is positive in methylation, the possibility of ovarian malignancy is increased, and the patient is suggested to be subjected to further clinical examination in time.

b) If SEPTIN9 methylation detection is positive, non-ovarian cancer is indicated.

Further, the use specifically includes at least one of:

c) If RASSF1A methylation detection is positive, the combined use of demethylating drugs is suggested to restore the chemotherapy sensitivity of ovarian cancer platinum drugs;

d) If SEPTIN9 is positive, HOXA9 is negative, the digestive system tumor is indicated, and if SEPTIN9 is negative, HOXA9 is positive, the ovarian cancer is indicated.

In another aspect, the invention provides an ovarian cancer diagnostic reagent comprising SHOX2, RASSF1A, SEPTIN9, and HOXA9 tetragenic methylation detection reagent. The reagent is used for detecting the methylation degree of the tetragene. The sample detected by the diagnostic reagent is any one of hydrothorax, ascites, peritoneal flushing fluid, ovarian cyst effusion or ovarian tissue sample of a living body.

Further, the methylation detection reagent comprises a SHOX2 gene detection primer, a RASSF1A gene detection primer, a HOXA9 gene detection primer and a SEPTIN9 gene detection primer.

Further, the SHOX2 gene detection primers are shown in SEQ ID No.3 and SEQ ID No.4, the RASSF1A gene detection primers are shown in SEQ ID No.1 and SEQ ID No.2, the HOXA9 gene detection primers are shown in SEQ ID No.5 and SEQ ID No.6, and the SEPTIN9 gene detection primers are shown in SEQ ID No.7 and SEQ ID No. 8.

Further, the methylation detection reagent further comprises a SHOX2 gene detection probe, a RASSF1A gene detection probe, a SEPTIN9 gene detection probe and a HOXA9 gene detection probe, and two ends of each probe are respectively connected with a fluorescence report/quenching group.

Further, the nucleotide sequence of the SHOX2 gene detection probe is shown as SEQ ID No.10, the nucleotide sequence of the RASSF1A gene detection probe is shown as SEQ ID No.9, the nucleotide sequence of the HOXA9 gene detection probe is shown as SEQ ID No.11, and the nucleotide sequence of the SEPTIN9 gene detection probe is shown as SEQ ID No.12.

Further, the methylation detection reagent further comprises one or more of the following reagents: RASSF1A positive control, SHOX2 positive control, HOXA9 positive control, SEPTIN9 positive control, RASSF1A negative control, SHOX2 negative control, HOXA9 negative control, SEPTIN9 negative control, bisulphite, or PCR reaction solution, enzyme cocktail.

As described above, the ovarian cancer-related gene methylation detection composition and the use thereof of the present invention have the following beneficial effects:

the invention achieves the aims of auxiliary diagnosis of ovarian cancer, differential diagnosis of digestive system tumors, especially gastrointestinal tumors and target detection as a demethylating drug through detection of methylation levels of RASSF1A, SHOX, HOXA9 and SEPTIN9 four genes. The method is quick and effective, and has better sensitivity and specificity.

Drawings

FIG. 1 shows the expression of SEPTIN9 gene methylation in cancerous, paracancerous, benign lesions.

FIG. 2 shows the expression of HOXA9 gene methylation in cancerous, paracancerous, and benign lesions.

FIG. 3 shows the expression of RASSF1A gene methylation in cancerous, paracancerous, benign lesions.

FIG. 4 shows the expression of SHOX2 gene methylation in cancerous, paracancerous, and benign lesions.

Detailed Description

DNA methylation (DNA methylation) is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. By DNA methylation is meant covalent bonding of a methyl group at the cytosine carbon number 5 of a genomic CpG dinucleotide under the action of a DNA methyltransferase. Numerous studies have shown that DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression. The genome of diseased tissue cells has been extensively modified for DNA methylation at the pre-cancerous stage prior to malignant tumor development, as compared to normal tissue cells. Therefore, compared with DNA mutation, DNA methylation modification is the earliest event of tumorigenesis, has higher sensitivity and specificity, and is more suitable for being used as a diagnostic marker.

There are 5 different transcripts for the Ras-related region family 1 (RASSF 1) gene: RASSF 1A-E, with RASSF1A being most common. The RASSF1A gene has a total length of 1 873bp, contains an open reading frame of 340 amino acids, encodes a protein polypeptide with a relative molecular mass of 388 000, and has an N-terminal highly homologous with a cysteine-rich diglyceride or fluoroester binding region, so that the RASSF1A gene is also called a protein kinase C conserved region. The research shows that the RASSF1A promoter region has abnormal methylation and expression deletion in various tumor tissues, which suggests that the RASSF1A plays an important role in various tumorigenesis and development as an oncogene. The mechanism by which RASSF1A functions as an oncogene is currently unknown.

SHOX2, known as Short Stature Homobox, is a member of the family of homeobox genes, which are translated as "short homeobox genes", whose gene expression regulation is closely related to organ development. This gene is a member of the family of homology encoding proteins comprising the 60 amino acid residues of the represented DNA binding domain. Homologous genes have been broadly characterized as being involved in patterning transcriptional regulation in two invertebrate and vertebrate species. Some human genetic diseases are caused by human homologous genetic aberrations. This trace represents a pseudoorthologous gene believed to be responsible for idiopathic short stature, which is associated with the short stature phenotype in patients with turner's syndrome.

The HOXA9 gene is a member of the family of Homeobox (HOX) genes, whose encoded products are important transcriptional regulators, playing an important role in controlling embryonic development and regulating cellular differentiation. Recent studies have found that abnormal expression of the HOXA9 gene is closely associated with various tumors such as acute leukemia, glioblastoma, ovarian cancer, lung cancer, breast cancer, etc. HOXA9 has a dual role (pro-or anti-cancer effect) by being involved in the proliferation, apoptosis or differentiation process of tumor cells at different types of tumors or at different stages of tumors.

Septin is a family of conserved framework protein genes with GTPase activity, widely distributed in all eukaryotes except plants, and is involved in cell division. In humans, it consists of 14 family members, designated Septin 1-14, respectively, where Septin9 is located at 17q25.3, contains 17 exons, encodes Septin9 protein, which has multiple subtypes (e.g., septin 9-vl, v2, v3, v 4), and has structural similarity between subtypes, consisting of centrally located P-loop GTP binding domains, variable N-and C-terminal domains, associated with cell functions such as chromosome segregation, DNA repair, migration, apoptosis, etc. The study found that Septin9 was directly related to the occurrence of tumors and its expression and function were not identical in different tumors. Herein, methods for detecting DNA Methylation are well known in the art, such as bisulfite-conversion-based PCR (e.g., methylation-specific PCR (MSP)), DNA sequencing (e.g., bisulfite sequencing (Bisulfite sequencing, BS), whole genome Methylation sequencing (white-genome bisulfitesequencing, WGBS), simplified Methylation sequencing (Reduced Representation Bisulfite Sequencing, RRBS)), chip, methylation-sensitive restriction enzyme analysis (methyl-Sensitive DependentRestriction Enzymes), fluorescent quantitation, methylation-sensitive High-resolution melting curve (methyl-sensitivity High-resolution Melting, MS-HRM), chip-based Methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry). In one or more embodiments, detecting includes detecting any strand at a gene or site.

Thus, the present invention relates to reagents for detecting DNA methylation. Reagents used in the above-described methods for detecting DNA methylation are well known in the art. In addition, in the detection method involving DNA amplification, the reagents for detecting DNA methylation include primers. The primer sequences are methylation specific or non-specific. Preferably, the sequence of the primer comprises a non-methylation specific blocking sequence (Blocker). Blocking sequences can increase the specificity of methylation detection.

For example, when using fluorescent quantitative PCR, reagents for detecting DNA methylation may also include probes. The 5 'end of the sequence of the probe is marked with a fluorescent report group, and the 3' end is marked with a quenching group. Typically, the reaction solution for PCR contains Taq DNA polymerase, PCR buffer, dNTPs, mg2+. Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase. Illustratively, the final Mg2+ concentration is 1.0-10.0mM; the concentration of each primer is 200-700nM; the concentration of each probe is 100-400nM; the PCR reaction conditions are that the reaction is pre-denatured for 5min at 95 ℃; denaturation at 95℃for 15s, annealing at 60℃for 1min,45 cycles.

Methods for calculating methylation levels are known in the art. Illustratively, in embodiments in which methylation is detected by PCR, the methylation level = 2- Δct sample to be detected/2- Δct positive standard x 100, where Δct = Ct gene of interest-Ct reference gene. Alternatively, in embodiments in which methylation is detected by sequencing, methylation level = number of methylated bases/total number of bases.

As used herein, a "DNA" or "DNA molecule" is a deoxyribonucleic acid. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). DNA forms include cDNA, genomic DNA, fragmented DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded.

As used herein, "uracil" or "U" is a component of RNA. "RNA" or "RNA molecule" is ribonucleic acid. RNA is a long-chain molecule formed by condensation of ribonucleotides via phosphodiester bonds. The base of RNA is mainly 4, namely adenine (A), guanine (G), cytosine (C) and uracil (U). In base pairing of RNA, U replaces the position of T in DNA, i.e., A and U are hydrogen-bonded, and G and C are hydrogen-bonded.

In a specific embodiment, aThe methylation detection method comprises the following steps: (1) sample preparation: comprises DNA extraction and quality inspection; (2) DNA transformation: performing bisulfite conversion on the DNA obtained in the step (1), and converting unmethylated cytosine (C) into uracil (U); the methylated cytosines are not altered after conversion; (3) preparation of a reaction mixture: the method comprises a PCR reaction solution, a primer mixture and a probe mixture; (4) preparation of PCR mixture: adding the bisulfite converted template DNA of step (2) and a positive standard, negative control or non-template control (NTC) to step (3); (5) PCR reaction: PCR reaction was performed and fluorescence was collected. The PCR reaction liquid comprises the following components: taq DNA polymerase, PCR buffer (buffer), dNTPs, mg ²⁺ The method comprises the steps of carrying out a first treatment on the surface of the Taq DNA polymerase is a hot start Taq DNA polymerase; mg of ²⁺ The final concentration is 1.0-10.0mM. The primer mixture is a mixture of the primers of the genes to be amplified, wherein the final concentration of each primer is 200-700nM. The probe mixture is a mixture of the gene probes to be amplified, wherein the final concentration of each probe is 100-400nM.

Other advantages and effects of the present invention will become apparent to those skilled in the art from the following disclosure, which describes the embodiments of the present invention with reference to specific examples. The invention may be practiced or carried out in other embodiments that depart from the specific details, and the details of the present description may be modified or varied from the spirit and scope of the present invention. It should be understood that the process equipment or devices not specifically identified in the examples below are all conventional in the art. Furthermore, it is to be understood that the reference to one or more method steps in this disclosure does not exclude the presence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise indicated; it should also be understood that the combined connection between one or more devices/means mentioned in the present invention does not exclude that other devices/means may also be present before and after the combined device/means or that other devices/means may also be interposed between these two explicitly mentioned devices/means, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the method steps is merely a convenient tool for identifying the method steps and is not intended to limit the order of arrangement of the method steps or to limit the scope of the invention in which the invention may be practiced, as such changes or modifications in their relative relationships may be regarded as within the scope of the invention without substantial modification to the technical matter.

Method

1. Early sample processing

1. Pretreatment of a tissue paraffin section sample:

1.1 placing 2-3 paraffin sections into a centrifuge tube, adding 1mL of dimethylbenzene, closing a tube cover, and vortex shaking for 10s.

1.2 Centrifuge at 12000rpm for 2min, carefully aspirate the supernatant, and care was taken not to aspirate the pellet.

1.3 adding 1mL absolute ethyl alcohol, and mixing by vortex oscillation. Centrifuge at 12000rpm for 2min, carefully aspirate the supernatant, and care was taken not to aspirate the pellet.

1.4 opening the tube lid, incubating at room temperature or 37℃for 10min until no ethanol remains.

1.5 adding 180. Mu.L of lysis buffer 1, re-suspending the precipitate, adding 20. Mu.L of proteinase K, and mixing by vortex shaking

1.6 Incubate at 56℃for 1 hour until the sample is completely dissolved.

1.7 Incubate at 90℃for 1 hour. The solution on the tube wall was collected to the bottom of the tube by brief centrifugation.

1.8 200. Mu.L lysis buffer 2 was added and thoroughly mixed by vortexing. 200 μl of absolute ethanol was added and thoroughly mixed by vortex shaking. The solution on the tube wall was collected to the bottom of the tube by brief centrifugation.

1.9 transferring all the solution obtained in 1.8 into an adsorption column, centrifuging at 12000rpm for 1min, pouring out the waste liquid in the collecting pipe, and putting the adsorption column back into the collecting pipe.

2. Pretreatment of alveolar lavage fluid, hydrothorax and ascites samples:

2.1 transfer samples to 15mL centrifuge tubes (slightly different sample types with 10mL alveolar lavage fluid and 5mL hydrothorax) and centrifuge at 2000rpm for 5min, discard supernatant and resuspend cell pellet with residual fluid (100-200. Mu.L).

2.2 transfer the above liquid to a 1.5mLEP tube, centrifuge at 2000rpm for 5min, and discard the supernatant.

2.3 200. Mu.L lysis buffer 1 was added and shaken until the sample was thoroughly suspended.

2.4 to the sample, 20. Mu.L proteinase K, 200. Mu.L lysis buffer 2 were added sequentially and vortexed well.

2.5 Incubating in a metal bath at 56 ℃ for 10min, and uniformly mixing every 2-3 min.

2.6, briefly centrifuging, adding 200 mu L absolute ethyl alcohol, fully mixing by vortex vibration, and briefly centrifuging.

2.7 transfer the liquid in the EP tube to the adsorption column of the collection tube, taking care that the gun head does not contact the filter membrane to avoid poking. 2. Washing, eluting and quantifying the nucleic acid sample on the adsorption column

Centrifuging at 1.12000rpm for 1min, pouring out the waste liquid in the collecting pipe, and putting the adsorption column back into the collecting pipe.

2. To the column, 500. Mu.L of rinse buffer 1 was added, and the mixture was centrifuged at 12000rpm for 1min, and the waste liquid in the collection tube was poured out.

3. To the adsorption column, 500. Mu.L of rinse buffer 2, 12000rpm,1min was added and the collection tube was emptied of waste liquid.

4. Repeating the step 3 for one time to improve the purity of the DNA.

5.12000rpm for 2min (this step is intended to remove residual ethanol which inhibits PCR amplification, this step is not omitted), a new 1.5ml EP tube is prepared, the adsorption column is placed into the EP tube, the collection tube is discarded, and the adsorption column is left standing for 5min at room temperature with the lid open.

6. And (3) suspending 50 mu L of elution buffer solution in the middle of the filter membrane of the adsorption column, and standing for 5min at room temperature. The DNA solution was collected by centrifugation at 12000rpm for 1 min.

7. A new reagent (Orient/Qubit kit) for detecting the DNA concentration is prepared from an EP tube, and a corresponding reagent (199. Mu.L buffer+1. Mu.L dye per person) is prepared according to the number of samples, and vortex oscillation is carried out.

8. The prepared 199. Mu.L of the reagent and 1. Mu.L of DNA were placed in a 0.5ml dispensing tube with the kit, gently shaken, gently swirled, and protected from light for 3min.

9. The DNA concentration was measured using a Qubit or Orient Fluo-100 fluorometer and should be greater than 10 ng/. Mu.L. (if DNA concentration <10 ng/. Mu.L, re-extraction is recommended). If the measured DNA concentration is outside the detection range (above 100 ng/. Mu.L), 2. Mu.L of DNA stock solution and 8. Mu.L of eluent are taken, vortexed, centrifuged instantaneously and the concentration is re-measured.

10. Samples were normalized by diluting the sample DNA to 10 ng/. Mu.L with the eluate. (10 ng/. Mu.L of DNA, 20. Mu.L are required for the subsequent sulfite modification step)

3. Bisulphite modified DNA:

1. processing the number of DNA samples as required, and preparing a PCR reaction tube; 130 mu L of CT conversion reagent is added into each PCR reaction tube, then 20 mu L of DNA sample is added in sequence, marking is carried out, slight shaking is carried out, and short centrifugation is carried out;

2. placing the PCR reaction tube on a reaction plate of a PCR instrument, covering a hot cover, and setting a reaction program according to the following steps

98℃，8min

64℃，3.5h

4℃，forever

3. According to the number of DNA samples to be processed, a purification column and a collection tube (the kit is self-contained), the sample number is marked on the purification column, and the purification column is placed in the collection tube.

4. 600. Mu.L of binding buffer was added to the purification column.

5. The whole product of the reaction of step 2 was transferred to a purification column (containing 600. Mu.L of binding buffer), capped, inverted several times (more than 10 times) and the samples were mixed. Then centrifuged at 12,000rpm for 30s and the liquid in the collection tube is poured off.

6. 100. Mu.L of the washing solution was added to the purification column, and the mixture was centrifuged at 12,000rpm for 30s.

7. 200. Mu.L of the desulfonation solution was added to the purification column and incubated at room temperature for 20min (at which time the PCR kit could be removed from-20℃and thawed at room temperature), and centrifuged at 12,000rpm for 30s.

8. 200. Mu.L of the washing solution was added to the purification column, centrifuged at 12,000rpm for 30s, 200. Mu.L of the washing solution was further added, centrifuged at 12,000rpm for 30s, the waste solution was poured, and centrifuged at 12,000rpm for 1min.

9. The purification column was placed in a new 1.5ml EP tube (labeled) and 20. Mu.L of the eluate was added directly to the purification column matrix (which had to be added to the matrix), and the DNA was eluted by centrifugation at 12,000rpm for 30 s.

4. PCR amplification

1. And taking out the DNA of the sample to be tested after sulfite modification.

2. Thawing the kit at room temperature for 30min, taking out the PCR reaction liquid and the DNA polymerase from the kit, shaking and uniformly mixing the PCR reaction liquid for 20s (full shaking), and then carrying out short centrifugation together with the enzyme.

Remarks: the enzyme needs to be placed at a low temperature, is prepared at present, and does not need to vibrate.

3. Preparing a PCR reaction solution: according to the number of detection specimens (number of specimens+negative and positive quality control), a PCR mixed solution and a PCR reaction solution are prepared according to the following reagent proportion: 0.3 (one person). Adding the components into a new EP tube according to the proportion, mixing the components evenly in a reverse way, and performing instantaneous centrifugation.

4. The PCR reaction tubes were placed on a PCR tube rack in order, 15. Mu.L of the prepared PCR reaction solution was added to the PCR reaction tube at each well, 5. Mu.L of DNA sample was added thereto, the reaction tube cap was carefully covered, and labeling was performed (labeling on handles at both ends of the tube cap).

5. And (3) performing instantaneous centrifugation, removing bubbles in the reaction system, and placing the PCR reaction tube into an instrument.

6. Opening an instrument setting window, and setting PCR amplification and signal collection programs.

a) The first stage: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 95 ℃,15 seconds, 60 ℃ for 30 seconds, 5 cycles;

c) And a third stage: 95 ℃,15 seconds, 57 ℃, 30 seconds, 40 cycles;

signal collection: FAM, VIC (or HEX) and CY5 signals were collected at 57℃in the third stage.

7. And saving the file and running the program.

EXAMPLE 1 screening of methylation diagnostic indicators of ovarian cancer

Screening for an indication of high methylation in ovarian cancer tissue, no expression in paracancerous tissue or low expression relative to the center of the cancer, and no methylation should be present in benign lesions. The specific screening method is as follows:

10 ovarian cancers and 10 paired paracancerous tissue samples were provided by a secondary hospital affiliated with the university of Huaxi medical science, and 7 gene methylation assays were performed on 10 benign ovarian cancer tissue samples, the results of which are shown in Table 1:

TABLE 1 methylation detection results of 7 genes in ovarian cancer tissue, paracancerous tissue, and benign lesions

* Noct: the abbreviation "no Ct" indicates that the PCR detection curve does not jump at all, and the sample has no target detection object

The results show that:

1. HOXA9, SHOX2 methylation has high clinical value in detection of ovarian cancer, diagnostic sensitivity in ovarian cancer tissue samples is 90% and 70%, no gene methylation is detected in benign lesions; the diagnostic sensitivity of RASSF1A in ovarian cancer tissue samples was 20% and no methylation of its gene was detected in benign lesions; SEPTIN9 does not jump at all in ovarian benign and malignant samples, being "Noct", whereas p16 has a tail in PCR amplification curves in cancerous, paracancerous and benign lesions samples.

2. HOXA9, SHOX2, RASSF1A detected methylation positive samples in paracancerous tissues, with reduced intensity of methylation in paracancerous tissues compared to their paired cancerous tissue samples (data not shown), indicating that changes in methylation of these three indicators are cancer specific, and also indicate that changes in molecular methylation are earlier than morphological.

3. 8 HOXA9, SHOX2, RASSF1A methylation assays alone or in combination with positive paracancerous tissue, 7 found small numbers of cancer cells by re-examining pathology readouts.

However, a plurality of researches show that RASSF1A methylation is closely related to strong invasive metastasis of tumors, and the latest researches show that the RASSF1A methylation can also be used as an important target point for demethylating drugs; SEPTIN9 was used as a methylation index with very good sensitivity for diagnosis of gastrointestinal tumors, but was "Noct" with no jump at all in all the ovarian benign and malignant samples examined in this experiment.

In summary, methylation of four indexes of RASSF1A, SHOX, HOXA9 and SEPTIN9 is finally determined through screening and used as a marker for diagnosing ovarian cancer, and the methylation diagnosis kit for ovarian cancer is constructed. The value of the four-index joint detection is as follows:

1) If any gene of the sample HOXA9, SHOX2 and RASSF1A is positive in methylation, the possibility of the ovarian malignant lesions is increased, and the patient is suggested to be subjected to further clinical examination in time for clear diagnosis;

2) If the sample SEPTIN9 methylation detection is positive, non-ovarian cancer and gastrointestinal tumor are highly likely to occur.

EXAMPLE 2 construction and use of ovarian cancer methylation diagnostic kit

Through experiments, the selection genes RASSF1A, SHOX2, HOXA9 and SEPTIN9 are finally determined to serve as detection targets and are used for related diagnosis of ovarian cancer.

1. Kit (named Oncomee) 4) The composition is as follows:

a) RASSF1A, SHOX2, HOXA9 and SEPTIN9 gene methylation detection reaction solutions;

forward primer for RASSF1A (SEQ ID No. 1): CGGGGTTCGTTTTGTGGTTTC;

reverse primer for RASSF1A (SEQ ID No. 2): CCGATTAAATCCGTACTTCG;

forward primer for SHOX2 (SEQ ID No. 3): TTGTTTTTGGGTTCGGGTT;

reverse primer for SHOX2 (SEQ ID No. 4): CATAACGTAAACGCCTATACTCG;

forward primer for HOXA9 (SEQ ID No. 5): GGTATATCGTAGCGGGTATAGC;

reverse primer for HOXA9 (SEQ ID No. 6): AACTTCCAATCCAAAACGACG;

forward primer for SEPTIN9 (SEQ ID No. 7): GCGTTTTTTCGTCGTTGTT;

reverse primer for SEPTIN9 (SEQ ID No. 8): CGCGTTAACCGCGAAATC;

b) RASSF1A, SHOX, HOXA9, SEPTIN9 positive quality control;

c) A negative quality control product;

d) A PCR polymerase;

e) A bisulphite salt;

f) And (3) probe:

the probe nucleotide sequence (SEQ ID No. 9) for RASSF1A is TCGCGTTTGTTAGCGTTTAAAGT;

a probe nucleotide sequence (SEQ ID No. 10) for SHOX2 ATCGAACAAACGAAACGAAAATTACC;

a probe nucleotide sequence (SEQ ID No. 11) directed against HOXA9 (TTCGTCGCGTGTATTGGGTTTTAC);

a probe nucleotide sequence (SEQ ID No. 12) directed against SEPTIN9 (TCGCGCGATTCGTTGTTT);

g) Reference gene

β-actin

AC-Forward primer (SEQ ID No. 13): AAGATAGTGTTGTGGGTGTAGGT

AC-reverse primer (SEQ ID No. 14): TACTTAATACACACTCCAAAACCG

AC-Probe (SEQ ID No. 15): ACACCAACCTCATAACCTTATCACAC

2. Method for using kit

See in particular the methods section above. Wherein,PCR conditions:

a) The first stage: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 95 ℃,15 seconds, 60 ℃ for 30 seconds, 5 cycles;

c) And a third stage: 95 ℃,15 seconds, 57 ℃, 30 seconds, 40 cycles;

signal collection: FAM, VIC (or HEX) and CY5 signals were collected at 57℃in the third stage. Wherein FAM is the probe fluorescence signal for detecting RASSF1A, SEPTIN, VIC is the probe fluorescence signal for SHOX2 and HOXA9, and CY5 is the probe fluorescence signal for internal reference detection.

3. Judgment of results of respective detection indexes

SEPTIN9 is not expressed in all benign and malignant ovarian cells; the cutoff value is set to Δct=9.0 within the index PCR stable detection range;

HOXA9 has very low methylation degree in benign lesions, has very good index specificity, and the cutoff value is set to be deltact=9.0 in the index PCR stable detection range;

the RASSF1A has very low methylation degree in benign lesions, the index specificity is very good, and the cutoff value is set to be delta CT=9.0 in the index PCR stable detection range;

SHOX2 has very low methylation in benign lesions, very good index specificity, and a cutoff value is set within an index PCR stable detection range Δct=9.0.

4. Judging the detection result of the kit:

1) If any gene of the sample HOXA9, SHOX2 and RASSF1A is positive in methylation, the possibility of ovarian malignant lesions is increased, and the patient is suggested to be subjected to further clinical examination in time;

2) SEPTIN9 methylation detected positively, suggesting non-ovarian cancer;

3) The RASSF1A methylation detection is positive, which indicates that the combination of demethylating drugs can be used for restoring the chemotherapy sensitivity of ovarian cancer platinum drugs;

4) SEPTIN9 (+), HOXA9 (-) suggested gastrointestinal tumors, while SEPTIN9 (-), HOXA9 (+) suggested ovarian cancer.

Example 3 diagnostic cut-off, sensitivity and specificity of ovarian cancer methylation diagnostic kit for tissue samples

1. Establishing a cut-off value of each index judgment by using an ovarian tissue sample

An accessory second hospital at university of Huaxi medical science provides 140 ovarian cancer tissue samples of different pathological types, including: 50 cases of serous adenocarcinomas, 30 cases of mucinous adenocarcinomas, 30 cases of endometrioid carcinomas and 30 cases of clear cell carcinomas. 40 benign ovarian tissue samples were also provided as controls. The 180 tissue samples were all subjected to methylation detection of four indexes of HOXA9, SHOX2 and RASSF1A, SEPTIN, and the results are shown in Table 2 and FIGS. 1-4.

The experimental results show that:

as in fig. 1, septin9 is not expressed in all ovarian benign and malignant cells; the cutoff value is set to Δct=9.0 within the index PCR stable detection range;

as shown in fig. 2, hoxa9 has very low methylation degree in benign lesions, and has very good index specificity, and the cutoff value is set within the stable detection range of index PCR, Δct=9.0;

as shown in fig. 3, rassf1a has very low methylation degree in benign lesions, and has very good index specificity, and the cutoff value is set within the stable detection range of the index PCR, Δct=9.0;

As shown in fig. 4, the degree of methylation of shox2 in benign lesions is very low, the index specificity is very good, and the cutoff value is set within the stable detection range of index PCR, Δct=9.0.

2. Sensitivity of detection index

TABLE 2 detection of tetragenic methylation in tissue samples of different pathological types of ovarian cancer

The experimental results show that:

the sensitivity of detection of HOXA9 and RASSF1A, SHOX2 in the ovarian cancer tissue samples was 87%, 45% and 39%, respectively. HOXA9 has very high diagnostic sensitivity to ovarian cancer, especially to mucinous adenocarcinoma, endometrial carcinoma and clear cell carcinoma, but has diagnostic sensitivity to serous ovarian cancer of the most common pathological type of ovarian cancer of only 64%, RASSF1A, SHOX has good complementation to detection of serous ovarian cancer (out of 18 HOXA9 negative serous gonadal cancer samples, RASSF1A was found to be positive for 4 cases alone, SHOX2 was found to be positive for 2 cases alone, RASSF1A and SHOX2 were double positive for 4 cases (data not shown)). The sensitivity of detection of serous ovarian cancer by combining HOXA9 and RASSF1A, SHOX2 three-gene methylation is improved to 84% from 64% positive to HOXA 9.

The sensitivity of detection of HOXA9 and RASSF1A, SHOX in the ovarian benign tissue samples is 5%, 0% and 0%, respectively, which shows that the detection specificity of the indexes on ovarian cancer is very good and is 95%, 100% and 100% respectively.

SEPTIN9 was not detected in both 140 ovarian cancer tissue samples and 40 benign lesions, indicating that ovarian tissue was characterized as negative for SEPTIN9 methylation.

Example 4 one of the clinical applications of the kit: improving diagnostic sensitivity of ovarian cancer small puncture biopsy sample

The secondary hospital affiliated to the university of Huaxi medical science provided 15 clinical definitive diagnosis of ovarian cancer surgical specimens and paired small biopsy specimens (pathology cytology of the large surgical biopsy specimens were both definitive diagnosis of ovarian cancer, 9 small biopsies were not seen with cancer cells or 6 specimens were seen with no abnormal shape, malignancy were not excluded), and four gene methylation assays were performed on all tissue specimens, with the results shown in Table 3.

Table 3 ovarian cancer surgical samples and paired puncture biopsy sample tetragenic methylation detection

*3 genes are combined (+). HOXA9, SHOX2 and RASSF1A, and any methylation detection positive of the genes is "3 genes are combined" methylation detection positive.

The above experiments show that:

the "3 genes combined" test 15 cases of ovarian cancer large biopsy samples are 14 cases positive, and the "3 genes combined" test 15 cases of small biopsy samples are negative or 11 cases positive in cytology diagnosis. All ovarian cancer samples were negative for SEPTIN9 methylation detection.

The combined detection of HOXA9, SHOX2 and RASSF1A three genes can obviously improve the diagnosis sensitivity of small puncture samples of ovarian cancer biopsies, 15 cases of small puncture samples of ovarian cancer biopsies (the cytological diagnosis sensitivity is 0%) with negative or abnormal diagnosis of the existing cell morphology, 11 cases of combined detection of three genes are positive, and the diagnosis sensitivity is 73.3%.

Example 5 second clinical application of kit: detection of 4 gene methylation in thoracoabdominal sample improves diagnosis sensitivity of ovarian cancer and differential diagnosis of tumor with digestive system

97 cases of malignant hydrothorax and ascites samples are provided by Hebei province tumor hospitals, wherein 50 cases of ovarian cancers are initiated, 33 cases of gastrointestinal tumors are initiated, and 14 cases of digestive system tumors such as hepatobiliary pancreas are initiated. While hospitals provided 40 benign hydrothorax and ascites samples as controls. All 137 cases of hydrothorax and ascites samples were subjected to pathological cytological diagnosis and simultaneously subjected to joint detection of 4-gene methylation, and the detection results are shown in table 4:

TABLE 4 detection of tetragenic methylation in hydrothorax and ascites samples

*4 genes are combined (+). HOXA9, SHOX2 and RASSF1A, SEPTIN, and any methylation detection positive of the four genes is a methylation detection positive of the 4 genes.

Experimental detection results show that the sensitivity of the cytological diagnosis of hydrothorax and ascites caused by ovarian cancer is only 14%, but the sensitivity of the combined detection of 4-gene methylation is improved to 86%. The sensitivity of HOXA9 and RASSF1A, SHOX2 in the 4 gene in ovarian cancer diagnosis is 70%, 18% and 36%, respectively, while the positive rate of SEPTIN9 in ovarian cancer is 0%.

The sensitivity of the cytological diagnosis of hydrothorax and ascites caused by digestive system tumor is 14.9%, and the sensitivity of the combined detection of 4 gene methylation is improved to 93.6%. The sensitivity of SEPTIN9 diagnosis of digestive system tumor in 4 gene is 70.2%, while the methylation diagnosis sensitivity of RASSF1A, SHOX is 23.4% and 46.8%, and the methylation detection positive rate of HOXA9 in digestive system tumor is only 8.5%.

Methylation positive 2 were co-detected in 40 benign hydrothorax and ascites samples, of which 1 was SHOX2 positive and 1 was HOXA9 positive. The specificity of the combined detection of the 4 genes on the malignant hydrothorax and ascites detection is 95%.

On the one hand, the hydrothorax and ascites 4 gene methylation combined detection can timely determine the properties of a sample, namely benign and malignant identification, on the other hand, the 4 gene combined detection can have a certain prompt effect on differential diagnosis of ovarian cancer and digestive system tumors, and when HOXA9 methylation positive points to malignant ovarian cancer and SEPTIN9 methylation positive points to malignant digestive system tumors.

Example 6 third clinical application of kit: abdominal cavity flushing fluid 4 gene methylation detection

The tumor hospital in Shanghai city provided 42 cases of intra-operative peritoneal irrigation solutions, 19 of which were later diagnosed with no lymph node metastasis, and 23 tumors had developed lymph node metastasis. The collected intra-operative abdominal cavity washes were simultaneously subjected to a combination of cytological diagnosis and 4-gene methylation (HOXA 9, SHOX2, RASSF1A, SEPTIN 9) and the results are shown in table 5:

TABLE 5 four gene methylation test results of peritoneal irrigation solution for ovarian cancer surgery

The test result of the experiment shows that the sensitivity of the cytological test in the abdominal cavity flushing fluid of the patient with the lymph node metastasis is only 39.1%, and the sensitivity of the combined detection of 4 gene methylation is 87%. Among 19 patients whose clinical diagnosis did not develop lymph node metastasis, no cancer cells were detected by cytology in the peritoneal wash, but 2 patients were found to be methylation positive by 4 gene methylation detection.

Close follow-up observations were made in later stages for 2 patients diagnosed with morphological pathology as no lymph node metastasis but methylation positive. 1 patient received chemotherapy after operation, and peritoneal effusion appeared in 3 months of follow-up, and both the cytology detection of peritoneal effusion and the methylation detection of 4 genes were positive. Based on this test, the physician adjusts the dose and course of his chemotherapy. In another 1 patient, stage I ovarian cancer was diagnosed post-operatively, and no lymph node metastasis was observed, so that no chemotherapy was performed. The patients developed ascites after 6 months post-operation, and were positive in cytology and methylation detection, followed by clinical chemotherapy.

The cytology detection of the abscission of the abdominal cavity flushing fluid in the ovarian cancer operation is very important for judging early detection of the tumor abdominal cavity implantation, and the detection result directly influences the later treatment scheme. The 4-gene methylation joint detection can greatly improve the diagnosis sensitivity of malignant peritoneal irrigation solution, and has very high clinical application value.

Fourth of the clinical applications of the kit of example 7: diagnosis of ovarian cancer secondary to gastrointestinal tumor

The tumor hospital in Hebei province sends 1 sample of peritoneal irrigation solution for ovarian cancer patients. The detection of tetragenic methylation is SHOX2 (+), SEPTIN9 (+), RASSF1A (-), HOXA9 (-). SEPTIN9 (+) highly suggested that patients were likely primary gastrointestinal tumors, not ovarian primary (HOXA 9 (-)) based on methylation detection results. The patient is further diagnosed by imaging, and the ovarian metastasis of the primary colorectal cancer is confirmed.

The gene methylation detection index is expressed in various tumors, but the specific methylation index still has certain tissue organ specificity, and has a certain prompting effect on clinical tumor tissue traceability. The gastrointestinal tumor has the characteristics of SEPTIN9 (+), HOXA9 (-), and the ovarian cancer has the characteristics of SEPTIN9 (-), HOXA9 (+), so the detection of SEPTIN9 combined with HOXA9 has certain differential diagnosis value on the ovarian cancer and digestive system tumor, in particular to the gastrointestinal tumor.

Example 8 fifth clinical application of kit: RASSF1A as target spot for use of demethylated drug decitabine

Clinical trials of low-dose decitabine combined with carboplatin for treating recurrent platinum drug-resistant ovarian cancer patients were carried out in a sixth-people hospital affiliated with the university of double denier at Shanghai. The experiment is carried out on 12 patients with chemotherapy resistant ovarian cancer, the patients are subjected to intravenous drip low dose (10 mg/m 2) of decitabine, the carboplatin is used on the 8 th day for 5 days, and the result shows that 5 patients in 12 patients are effective in treatment, wherein the 1 patient has no progress and has a survival time of 17 months.

Patients were subjected to clinical experiments, after the group is put into the clinical experiments, 10ml venous blood was extracted before the use of the demethylated drug, 4-gene methylation detection was performed by separating free DNA, 11 cases of positive blood methylation detection were performed on 12 patients, and the overall positive rate was 92%. Of these, RASSF1A detected positive 4 cases, the positive rate was 33.3%. Later observations indicated that 5 patients who were therapeutically effective were all RASSF1A positive and 4 were RASSF1A positive. Research results show that blood RASSF1A methylation detection is carried out on patients with recurrent platinum drug-resistant ovarian cancer treated by carboplatin, and the patients with positive detection adopt decitabine combined carboplatin treatment, so that the sensitivity of the patients with recurrent platinum drug-resistant ovarian cancer to platinum chemotherapeutic drugs can be recovered, and the clinical effect is remarkable.

In conclusion, the invention finds that the RASSF1A, SHOX, HOXA9 and SEPTIN9 methylation combined detection has higher clinical value in ovarian detection.

The above examples are provided to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, many modifications and variations of the methods and compositions of the invention set forth herein will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the present invention.

Sequence listing

<110> Shanghai perspective life technologies and technologies Co., ltd

<120> an ovarian cancer-related gene methylation detection composition and use thereof

<130> 22F006

<141> 2022-05-31

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

cggggttcgt tttgtggttt c 21

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ccgattaaat ccgtacttcg 20

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ttgtttttgg gttcgggtt 19

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cataacgtaa acgcctatac tcg 23

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggtatatcgt agcgggtata gc 22

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

aacttccaat ccaaaacgac g 21

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gcgttttttc gtcgttgtt 19

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cgcgttaacc gcgaaatc 18

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tcgcgtttgt tagcgtttaa agt 23

<210> 10

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

atcgaacaaa cgaaacgaaa attacc 26

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ttcgtcgcgt gtattgggtt ttac 24

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tcgcgcgatt cgttgttt 18

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

aagatagtgt tgtgggtgta ggt 23

<210> 14

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tacttaatac acactccaaa accg 24

<210> 15

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

acaccaacct cataacctta tcacac 26

Claims (10)

1. Use of a combination of the four hoxa9, SHOX2, RASSF1A, SEPTIN9 genes for the preparation of an ovarian cancer diagnostic reagent for detecting the degree of methylation of the four genes.
2. 2. The use according to claim 1, wherein the sample to be detected by the diagnostic reagent is selected from any one of hydrothorax, ascites, peritoneal irrigation fluid, tissue sample of a patient with ovarian disease.
3. 3. Use according to claim 1, characterized in that it comprises in particular at least one of the following:

   a) If any gene of the sample HOXA9, SHOX2 and RASSF1A is positive in methylation, the possibility of ovarian malignant lesions is increased, and the patient is suggested to be subjected to further clinical examination in time;

   b) If SEPTIN9 methylation detection is positive, non-ovarian carcinoma tumors are suggested.
4. 4. Use according to claim 3, characterized in that it comprises in particular at least one of the following:

   c) If RASSF1A methylation detection is positive, the combined use of demethylating drugs is suggested to restore the chemotherapy sensitivity of ovarian cancer platinum drugs;

   d) If SEPTIN9 is positive, HOXA9 is negative, the digestive system tumor is indicated, and if SEPTIN9 is negative, HOXA9 is positive, the ovarian cancer is indicated.
5. 5. An ovarian cancer diagnostic reagent, comprising SHOX2, RASSF1A, SEPTIN9, and HOXA9 tetragenic methylation detection reagent.
6. 6. The diagnostic reagent according to claim 5, wherein the methylation detection reagent comprises SHOX2 gene detection primer, RASSF1A gene detection primer, SEPTIN9 gene detection primer, and HOXA9 gene detection primer.
7. 7. The diagnostic reagent according to claim 6, wherein the SHOX2 gene detection primer is shown in SEQ ID No.3 and SEQ ID No.4, the RASSF1A gene detection primer is shown in SEQ ID No.1 and SEQ ID No.2, the SEPTIN9 gene detection primer is shown in SEQ ID No.7 and SEQ ID No.8, and the HOXA9 gene detection primer is shown in SEQ ID No.5 and SEQ ID No. 6.
8. 8. The diagnostic reagent according to claim 5, wherein the methylation detection reagent further comprises a SHOX2 gene detection probe, a RASSF1A gene detection probe, a SEPTIN9 gene detection probe, and a HOXA9 gene detection probe, each of which has a fluorescent reporter/quencher group attached to each end.
9. 9. The diagnostic reagent according to claim 8, wherein the nucleotide sequence of the SHOX2 gene detection probe is shown in SEQ ID No.10, the nucleotide sequence of the RASSF1A gene detection probe is shown in SEQ ID No.9, the nucleotide sequence of the HOXA9 gene detection probe is shown in SEQ ID No.11, and the nucleotide sequence of the SEPTIN9 gene detection probe is shown in SEQ ID No. 12.
10. 10. The diagnostic reagent of claim 5, wherein the methylation detection reagent further comprises one or more of the following reagents: RASSF1A positive control, SHOX2 positive control, HOXA9 positive control, SEPTIN9 positive control, RASSF1A negative control, SHOX2 negative control, SEPTIN9 negative control, HOXA9 negative control, bisulfite, or PCR reaction solution, enzyme cocktail.