CN117187203A - High-stability superoxide dismutase mutant and application thereof - Google Patents

Abstract

The application relates to the field of biological genetic engineering, in particular to a high-stability superoxide dismutase mutant and application thereof. The application discloses a recombinant mutant SOD with high stability, a coding gene and application thereof, wherein 260L in an amino acid sequence of a coding protein of the recombinant mutant SOD is mutated into I and 364V in A based on an SOD sequence of high temperature resistant bacteria Anoxybacillus calidus, so that the activity and the thermal stability of the SOD are improved, the activity is improved by 2 times, the activity is obviously higher than that of the SOD produced by the prior art, the mutant recombinant SOD comprises an amino acid sequence shown as SEQ ID NO.1, and the application of the mutant SOD in preparing superoxide dismutase products is also provided, particularly in industries such as medicine, food, cosmetics and the like.

Description

High-stability superoxide dismutase mutant and application thereof

Technical Field

The application relates to the field of biological genetic engineering, in particular to a high-stability superoxide dismutase mutant and application thereof.

Background

Superoxide dismutase (superoxide dismutase, abbreviated as SOD) is an enzyme capable of catalyzing the conversion of superoxide to oxygen and hydrogen peroxide by disproportionation. It is widely used in various animals, plants and microorganisms, is an important antioxidant and has great significance on cell life activities. Due to the special efficacy of SOD, the SOD has wide application value in the fields of medicine, daily chemical industry, food, agriculture, environmental protection and the like. At present, the clinical application of SOD mainly focuses on anti-inflammatory aspects (mainly on inflammatory patients caused by rheumatoid and radiotherapy), and has certain curative effects on certain autoimmune diseases (such as lupus erythematosus and dermatomyositis), emphysema, cancer, oxygen poisoning and the like; mainly used as food additives and important functional base materials in the food industry; is mainly used as an important function of anti-inflammatory and anti-aging in the cosmetic industry.

The enzymes are classified into four types of Cu/Zn-SOD, mn-SOD, fe-SOD, and Ni-SOD according to the type of metal ions bound. Mn-SOD and Fe-SOD mainly exist in prokaryotes, and the sequence and structure homology of the Mn-SOD and the Fe-SOD are very high and similar in evolution; whereas Cu/Zn-SOD is present in eukaryotes, it is another branch of evolution. The vast majority of the currently developed SOD products are Cu/Zn-SOD, which is firstly separated and extracted from animal blood and liver, and in recent years, plant-derived SOD has been reported in a large number. The SOD of microorganism source, especially the SOD separated from thermophilic bacteria, has better applicability than normal temperature enzyme in chemical industry application due to the characteristics of high stability and good stability, and is more and more paid attention. The thermophilic SOD has the excellent characteristics of extremely high thermal stability, physical and chemical denaturants resistance, has huge application value in industrial and agricultural production, is mainly separated from the nature, has limited raw materials and is difficult to meet the industrial needs. The current methods for producing and processing SOD to improve the thermal stability mainly comprise a genetic engineering method, a research on SOD mimics, chemical modification, enzyme immobilization and the like, but the defects and limitations that the transformation means are complicated in technology, difficult to operate, poor in adaptability, less obvious in effect and the like exist commonly, and the problems seriously affect the industrialization process of thermophilic SOD.

Disclosure of Invention

In view of this, the present application provides highly stable superoxide dismutase mutants and uses thereof. The application provides a recombinant mutant SOD with high stability, a coding gene and application thereof, and has the technical characteristics of remarkably improved mutant enzyme activity, higher protein stability, high stability and the like.

In order to achieve the above object, the present application provides the following technical solutions:

the application provides mutants of high stability superoxide dismutase comprising an L260 and/or V364 site mutation.

In some embodiments of the application, the mutation comprises a mutation at position 260L to I and a mutation at position 364V to a.

In some embodiments of the application, the mutant has:

(I) An amino acid sequence shown as SEQ ID NO. 1; or (b)

(II) a sequence of 1 or more amino acids substituted, deleted, added and/or substituted on the basis of the amino acid sequence shown in (I); or (b)

(III) a sequence having 90% or more homology with the amino acid sequence represented by (I) or (II).

The application also provides nucleic acid molecules encoding the mutants.

The application also provides nucleic acid molecules encoding the mutants having:

(I) A nucleotide sequence shown as SEQ ID NO. 2; or (b)

(II) a nucleotide sequence which encodes the same protein as the nucleotide sequence shown in (I) but which differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (b)

(III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences with the nucleotide sequence shown in (I) or (II), and functionally identical or similar to the nucleotide sequence shown in (I) or (II); or (b)

(IV) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

The application also provides a recombinant expression vector comprising the nucleic acid molecule and a backbone vector.

In some embodiments of the application, the backbone vector comprises pET28a.

The application also provides recombinant bacteria comprising the recombinant expression vector.

In some embodiments of the application, the host of the recombinant bacterium comprises BL21 (DE 3).

The application also provides application of the recombinant bacterium in preparing high-stability superoxide dismutase.

The application also provides a preparation method of the mutant, which comprises the step of preparing the mutant based on the recombinant bacteria.

In some embodiments of the application, the method of making the mutant comprises the steps of:

step 1, inducing the recombinant bacteria to express, centrifugally collecting thalli, ultrasonically crushing, and collecting the crushed supernatant;

step 2, purifying by a nickel column to obtain the crude mutant;

and 3, desalting by a G25 desalting column, and freeze-drying to obtain the mutant.

In some embodiments of the application, the centrifugation to collect the cells comprises collection of the cells at 6000rpm for 5min at 4 ℃.

In some embodiments of the application, the nickel column comprises a Chelating sepharose nickel chelating column.

In some embodiments of the application, the nickel column purified eluate comprises 20mM PB,500mMNaCl and 500mM imidazole, pH7.4.

Use of any of the following for the preparation of a heat stable product:

(I) The mutant; and/or

(II) the mutant prepared by the preparation method.

In some embodiments of the application, the temperature of thermal stabilization comprises 50 ℃ to 100 ℃.

In some embodiments of the application, the temperature of thermal stabilization comprises 80 ℃.

The present application includes, but is not limited to, providing the following benefits:

1. mutant SOD and unmutated SOD have enzyme activities of 40000U/mg and 19000U/mg respectively, so that the enzyme activities are obviously improved after mutation.

2. The highly stable mutant SOD provided by the application has improved activity after being treated at 80 ℃.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a double restriction map of amplified mutant SOD genes;

FIG. 2 is a diagram of purification of a high-stability mutant recombinant SOD protein;

FIG. 3 shows the thermal stability test patterns of the high-stability mutant recombinant SOD and the wild-type SOD, wherein A shows the thermal stability test pattern of the wild-type SOD, and B shows the thermal stability test pattern of the high-stability mutant recombinant SOD.

Detailed Description

The application discloses a high-stability superoxide dismutase mutant and application thereof, and a person skilled in the art can properly improve the technological parameters by referring to the content of the text. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present application. While the methods and applications of this application have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this application, without departing from the spirit or scope of the application.

The highly stable mutant SOD and the coding gene thereof provided by the application utilize a bioinformatics method, based on the SOD sequence of the highly heat-resistant fixed bacterium Anoxybacillus calidus, 260L is mutated into I and 364V is mutated into A, so that the activity and the thermal stability of the SOD are improved, the activity is improved by more than 2 times, the activity is obviously higher than that of the SOD produced in the prior art, and the specific activity of the purified highly stable SOD is 1315U/mg as described in patent document CN 201810105875.6; the specific activity of the Escherichia coli expressed SOD described in CN200510061502.6 was 1100U/mg, and the mutant SOD of the present application had an enzyme activity of 40000U/mg. The mutant protein has low production cost, high yield and high application value, and has wide application prospects in the industries of medicines, foods, cosmetics and the like.

In order to achieve the above object, the present application is achieved by the following technical solutions.

The high-stability recombinant mutant SOD comprises an amino acid sequence shown as SEQ ID NO. 1.

The application relates to a nucleotide sequence for coding high-stability recombinant mutant SOD, which comprises a nucleotide sequence for coding an amino acid sequence shown as SEQ ID NO. 1.

Preferably, the nucleotide sequence is shown as SEQ ID NO. 2.

The recombinant expression vector comprises a nucleotide sequence of an amino acid sequence shown as SEQ ID NO.1 or a nucleotide sequence shown as SEQ ID NO. 2.

The application discloses a recombinant bacterium which comprises the recombinant expression vector.

The application relates to a preparation method of a high-stability recombinant mutant SOD, which comprises the following steps: culturing the recombinant strain, and obtaining superoxide dismutase from the recombinant strain.

The application relates to a purification method of a high-stability recombinant mutant SOD, which comprises the following steps:

a: inducing and expressing the recombinant bacteria, centrifuging bacterial liquid and collecting bacteria, performing ultrasonic crushing, and collecting the crushed supernatant;

b: carrying out nickel column affinity chromatography on the supernatant;

c: g25 desalting column desalting, freeze-drying and preserving.

Preferably, in the purification method of the high-stability recombinant mutant SOD, the concentration of imidazole in the nickel column eluent is 500mmol/L.

The SEQ ID NO.1 sequence, or the nucleotide sequence encoding the amino acid sequence shown as SEQ ID NO.1 or the nucleotide sequence shown as SEQ ID NO.2, or the recombinant expression vector, or the recombinant bacterium, or the preparation method of the high-stability recombinant mutant SOD is applied to the preparation of superoxide dismutase products.

The high-stability superoxide dismutase mutant provided by the application and the raw materials and reagents used in the application of the mutant can be purchased from the market unless specified.

The application is further illustrated by the following examples:

EXAMPLE 1 obtaining mutant highly stable SOD Gene

1. The amino acid sequence SEQ ID NO.5 of the coded protein is based on the SOD sequence of Anoxybacillus calidus by NCBI sequence search analysis:

MDDQTLFAQYAAEVNEWGEQVKQVLELRGASIDGASTLLQFIAEHDGKWTEEAVRELTRLVDDVYAAALRHYAIEAAEWGKQVEHALSMRGAAEDIGLSSLLARIEEHGDEWTEEEIHELQLLVDDVYARAIRLVEPLSDGQEEDLTRQEEVSALPEQEGGNREQMSKGTERSGEHKGDSEQEPVVAAERAEPFIASSTDSPDGEQLHEGDTMDEEWRHNADMTDKERLPEEGVTDGERQRAVSPGKHVLPPLPYSYDALEPHISEEIMRLHHTKHHQSYVDGLNKAERMMAEARRTNNFELLKHWEREAAFNGSGHYLHTIFWHNMHPQGGGEPRGELRAQIERDFGSFAAFRRHFTEAAKSVEGVGWALLVWVPRAHRLEILQTEKHQLMTQWDTIPLLVLDVWEHAYYLQYKNDRGAYIEHWWNVVNWRNVEARFAEARKLRWQPF in which 260L is mutated to I and 364V is mutated to A. The amino acid sequence after mutation is shown as SEQ ID NO. 1:

MDDQTLFAQYAAEVNEWGEQVKQVLELRGASIDGASTLLQFIAEHDGKWTEEAVRELTRLVDDVYAAALRHYAIEAAEWGKQVEHALSMRGAAEDIGLSSLLARIEEHGDEWTEEEIHELQLLVDDVYARAIRLVEPLSDGQEEDLTRQEEVSALPEQEGGNREQMSKGTERSGEHKGDSEQEPVVAAERAEPFIASSTDSPDGEQLHEGDTMDEEWRHNADMTDKERLPEEGVTDGERQRAVSPGKHVLPPLPYSYDAIEPHISEEIMRLHHTKHHQSYVDGLNKAERMMAEARRTNNFELLKHWEREAAFNGSGHYLHTIFWHNMHPQGGGEPRGELRAQIERDFGSFAAFRRHFTEAAKSAEGVGWALLVWVPRAHRLEILQTEKHQLMTQWDTIPLLVLDVWEHAYYLQYKNDRGAYIEHWWNVVNWRNVEARFAEARKLRWQPF. The DNA sequence which can be translated into the sequence of SEQ ID NO.1 is designed according to the amino acid sequence of SEQ ID NO. 1. Actually, the design can be carried out according to the codon preference of the expression bacteria, and the DNA sequence shown as SEQ ID NO.2 is adopted in the embodiment:

ATGGACGATCAAACCCTGTTCGCACAGTACGCAGCCGAGGTGAATGAATGGGGTGAACAGGTCAAACAGGTACTGGAACTGCGCGGCGCATCCATCGACGGCGCGTCTACCCTGCTGCAGTTCATCGCCGAACACGACGGCAAATGGACTGAAGAAGCTGTTCGTGAACTGACCCGTCTGGTGGACGACGTGTATGCAGCTGCACTGCGTCATTATGCCATCGAGGCGGCTGAATGGGGCAAACAGGTTGAGCACGCTCTGTCCATGCGTGGTGCCGCGGAAGACATCGGTCTGTCTTCTCTGCTGGCACGTATCGAGGAACACGGTGACGAGTGGACCGAAGAAGAAATCCACGAACTGCAGCTGCTGGTTGATGATGTGTATGCTCGTGCAATCCGTCTGGTTGAGCCGCTGTCTGATGGTCAGGAGGAGGATCTGACGCGTCAGGAAGAAGTGTCCGCACTGCCAGAACAGGAGGGCGGCAATCGCGAACAGATGAGCAAAGGCACCGAGCGTTCTGGTGAGCATAAAGGCGACAGCGAGCAGGAACCGGTAGTAGCAGCGGAACGCGCTGAGCCGTTTATCGCTAGCAGCACCGATTCCCCGGATGGTGAACAACTGCACGAAGGCGACACTATGGATGAAGAATGGCGCCACAACGCTGATATGACTGATAAAGAACGTCTGCCGGAAGAGGGTGTGACTGACGGCGAACGCCAACGTGCGGTTTCCCCAGGTAAACACGTACTGCCTCCGCTGCCGTACTCCTACGACGCAATCGAACCGCACATCAGCGAAGAAATTATGCGCCTGCACCACACTAAGCACCACCAGTCCTACGTGGACGGTCTGAACAAAGCGGAACGCATGATGGCCGAGGCACGCCGTACTAATAACTTCGAACTGCTGAAGCACTGGGAACGTGAGGCTGCATTCAACGGCTCCGGCCATTATCTGCACACTATCTTCTGGCACAACATGCACCCGCAGGGTGGTGGTGAACCGCGTGGTGAACTGCGCGCGCAGATCGAACGTGATTTCGGCTCTTTCGCCGCATTCCGTCGTCATTTTACCGAGGCAGCAAAGTCTGCAGAAGGTGTCGGTTGGGCTCTGCTGGTTTGGGTGCCGCGTGCACATCGTCTGGAAATTCTGCAGACTGAAAAGCACCAGCTGATGACTCAGTGGGATACTATCCCGCTGCTGGTTCTGGACGTGTGGGAGCACGCGTACTACCTGCAGTACAAAAACGACCGTGGCGCGTATATCGAACACTGGTGGAACGTGGTAAACTGGCGCAACGTAGAAGCCCGCTTCGCAGAGGCTCGTAAACTGCGCTGGCAGCCGTTC

2. artificially synthesizing SEQ ID NO.2, and mutating high-stability SOD gene.

EXAMPLE 2 construction of recombinant vector containing mutant highly stable SOD Gene

Primers were designed according to SEQ ID NO.2, and the cleavage sites (preferably BamHI and EcoRI) were introduced separately, the sequences of which were as follows:

f1: SEQ ID NO.3: CGggatccATGGACGATCAGAC (lowercase BamH I site);

r1: SEQ ID NO.4: CGgaattcTGAACGGTTGCCAAACG (lowercase EcoR I site);

PCR reaction is carried out by taking pET28a vector containing the gene sequence shown in SEQ ID NO.2 as a template and F1 and R1 as primers to obtain a PCR product of the target gene (shown in figure 1).

The specific reaction system and the steps are as follows:

1. the PCR reactions were performed as follows:

template DNA:200ng; F11.mu.L, R11.mu.L; FAST DNA polymerase 1. Mu.L; 10 Xbuffer 5. Mu.L; ddH ₂ 0 was filled to 50. Mu.L.

2. The reaction solution was mixed with vortex shaking.

3. The liquid on the EP tube wall was allowed to flow down by a short rapid centrifugation with a centrifuge.

4. A program was set on the PCR apparatus, and PCR was performed on the PCR apparatus under the following conditions.

95℃，3min；95℃，30s；55℃，45s；72℃，2min；72℃，10min；4℃，2hr。

5. The sample was taken out and stored at 4℃for subsequent gel electrophoresis identification analysis of the PCR results.

6. The PCR product was digested with BamHI and EcoRI, and ligated to an expression vector (preferably pET28 a) that was also digested with BamHI and EcoRI: to the EP tube, 10. Mu.L of Solution I (manufacturer: shanghai) and 3. Mu.L of purified enzyme-digested carrier (manufacturer: shanghai) were added, respectively, to maintain the total volume at 20. Mu.L. And (3) reacting for 30min in a water bath at the temperature of 16 ℃ to obtain a recombinant expression vector pET28a-SOD of the connection product.

EXAMPLE 3 construction of recombinant expression bacteria

First) competent cell preparation

Inoculating DH5 alpha in strain preservation tube to LB plate by streaking method, culturing overnight at 37deg.C, picking single colony, culturing in 20mL LB liquid medium at 37deg.C for 8 hr, transferring to 100mL liquid medium, and continuously culturing to OD ₆₀₀ Centrifuging at 0.4,4 ℃at 5000rpm for 5min, discarding the supernatant, adding 30mL of CaCl pre-cooled at 4 ℃to ₂ (0.1 mol/L) solution, standing at 4deg.C for 30min, centrifuging at 4deg.C for 5min at 5000rpm, discarding supernatant, adding 5mL of CaCl 0.1mol/L ₂ The solution is used for resuspension of thalli, 40 percent of sterile glycerol with equal volume is added, and after uniform mixing, split charging is carried out, and the thalli are preserved at the temperature of minus 80 ℃.

Two) ligation and transformation

1. 10. Mu.L of the recombinant expression vector pET28a-SOD prepared in example 2 was added to an EP tube of 100. Mu.L of competent cells, and the mixture was gently stirred with a gun head and was not beatable.

2. And (3) carrying out ice bath on the EP pipe in the step (1) for 30min, placing the EP pipe in a water area in a constant-temperature water bath at 42 ℃ for 90 seconds after 30min, and carrying out ice bath for 3min after 90 seconds.

3. 1mL of the preheated LB medium was added to the EP tube in step 2, and the mixture was subjected to shaking culture at 37℃for 1 hour.

4. The EP tube in the step 3 is placed in a centrifuge at 4 ℃ and 3000 rotating speed for centrifugation for 10min, part of supernatant is removed, and 400 mu L of bacterial liquid is reserved.

5. And (3) blowing the bacterial liquid in the step (4) by using a gun head, coating 200 mu L of bacterial liquid on a plate, placing the plate in a 37 ℃ incubator for culture after coating, turning over a plate after half an hour (inverting one time), and culturing overnight.

6. And (3) selecting a monoclonal to perform colony PCR identification, sending the monoclonal to a sequencing mechanism to perform sequencing identification (Jin Weizhi organisms), and screening out the monoclonal with correct sequencing to obtain the recombinant expression bacterium BL21-pET28a-SOD capable of expressing the high-stability mutant recombinant SOD.

EXAMPLE 4 inducible expression and purification of recombinant highly stable mutant SOD protein

BL21 (DE 3) with the identified correct vector with pET28a was transferred to a 20mL shake flask and 50. Mu.g/mL Kana antibiotic was added and incubated overnight at 37℃with shaking at 180 rpm.

2. The overnight cultured bacterial liquid is transferred into 200mL LB liquid medium in a ratio of 1:100, and is cultured to OD by shaking at 37 ℃ and 180rpm ₆₀₀ =0.6 to 0.8, 0.2mM IPTG was added in small amounts under fumbling conditions and induced for the corresponding time at the corresponding optimum expression temperature conditions.

3. After the induction was completed, the cells were collected at 6000rpm and 4℃for 5min, and the residual medium was repeatedly washed by adding PBS.

4.12000rpm,4℃for 5min, 5mL Bindingbuffer was added to re-suspend the cells after discarding the supernatant, and 1mmol/L PMSF (protease inhibitor) was added.

5. And placing the sample in an ice-water mixture, and performing ultrasonic crushing until the bacterial liquid is clear and transparent.

Centrifuge at 6.12000rpm,4℃for 30min and transfer the supernatant to a new pre-chilled centrifuge tube.

7. The supernatant and Chelating sepharose nickel chelate column were added to the protein purification tube and mixed well and incubated at 4℃for 2h.

8. The bed was rinsed with 50mL Washingbuffer (MQ solution of 50mM Tris-HCl pH 8.0,300mM NaCl,80mM imidazole final concentration).

9. The protein purification column was loaded with 5mL of eluent in varying proportions to elute the protein, 1 tube was collected per 500 μl, and 10 tubes were collected altogether.

10. 10 mu L of each tube is sucked and added into 100 mu L of coomassie brilliant blue solution prepared in advance, and the protein concentration is primarily judged according to the color shade.

11. Mixing the protein solutions in the collecting tube with high protein content, desalting with G25 desalting column, and preserving at-20deg.C.

12. And taking 20 mu L of the dialyzed protein out as an SDS-PAGE sample, subpackaging the rest protein, and preserving at-80 ℃ for later use.

The results of protein purification are shown in FIG. 2 (in the figure, M is protein Marker;1 is ultrasonic disruption and precipitation; 2 is ultrasonic disruption supernatant; 3 is nickel column flow-through; 4 is eluent 1 (20mM PB,500mMNaCl,50mM imidazole, pH 7.4), 5 is eluent 2 (20mM PB,500mMNaCl,100mM imidazole, pH 7.4), 6 is eluent 3 (20mM PB,500mMNaCl,150mM imidazole, pH 7.4), 7 is eluent 4 (20mM PB,500mMNaCl,300mM imidazole, pH 7.4), 8 is eluent 5 (20mM PB,500mMNaCl,500mM imidazole, pH7.4;9 is eluent 6 (20mM PB,500mMNaCl,600mM imidazole, pH 7.4)), the result shows that eluent 5 has the best eluting effect, the obtained SOD amount is the highest, and other concentration gradient eluent is not suitable for nickel column elution of SOD in the patent.

EXAMPLE 5 concentration and Activity detection of recombinant highly stable mutant SOD protein

The SOD enzyme activity obtained in example 4 was detected according to the GBT5009.171 first method, and the result of the recombinant highly stable mutant SOD protease activity was 40000U/mg for the mutant highly stable strain SOD enzyme activity and 19000U/mg for the unmutated recombinant wild-type SOD enzyme activity. Wherein, the unmutated recombinant wild-type SOD is obtained by expressing and purifying the unmutated recombinant wild-type SOD protein shown as SEQ ID NO.5 by adopting the method mentioned in examples 1-4.

EXAMPLE 6 thermal stability experiment of recombinant highly stable mutant SOD protein

SOD activity was assessed using a total SOD assay (NBT) kit (Beyotime biotechnology co., ltd., china) according to the instructions. After 15min of irradiation at 25 ℃, the absorbance values of the sample and the blank were measured at 560nm wavelength. When the NBT reduction inhibition rate was 50%, the SOD activity in the reaction system was defined as 1 enzyme activity unit. All experiments were performed three times and data are expressed as mean ± SD (n=3).

As a result, the activity of the highly stable recombinant mutant SOD is obviously higher than that of the unmutated wild-type SOD after high-temperature treatment. The thermal stability results are shown in FIG. 3, and the purified recombinant SOD is respectively stored for a certain time (1 h,2h,3h,4h and 5 h) under different temperature conditions (50 ℃,60 ℃,70 ℃,80 ℃,90 ℃,100 ℃), and the SOD enzyme activity is detected by using standard NBT reaction. When the temperature exceeds 50 ℃, the activity of the control SOD begins to be greatly reduced, and after the control SOD is stored for 1h at 50 ℃, the residual activity is only 18 percent, and after the temperature exceeds 50 ℃, the activity of SODh is almost completely lost.

In comparison, the highly stable recombinant mutant SOD has better thermal stability at the temperature lower than 70 ℃ (including 70 ℃), and still retains 60% of the highest activity within 1h when heated to 80 ℃. When the preservation temperature is 50 ℃, the activity of the wild-source human SOD is lost to below 20% after 1 h; when the storage temperature exceeded 60 ℃, the SODh enzyme activity was almost completely lost after 1h (fig. 3). Compared with the control SOD, the thermal stability of the recombinant SOD is greatly improved: the activity loss is not more than 2% when the composition is stored for 5 hours at 50 ℃ or 60 ℃, and the residual activity is kept at 85% when the composition is stored for 5 hours at 70 ℃.

The above description is only of a preferred embodiment of the application, it being noted that the application is not limited to the above examples but many variations are possible. All modifications and variations which would be obvious to a person skilled in the art from this disclosure would be obvious to those skilled in the art without departing from the principles of the application, and these are intended to be included within the scope of the application.

Claims (10)

1. A mutant of highly stable superoxide dismutase comprising a mutation at the L260 and/or V364 site.

2. The mutant of claim 1, wherein the mutation comprises a mutation at position 260 to I and a mutation at position 364 to a.

3. A nucleic acid molecule encoding the mutant according to claim 1 or 2.

4. A nucleic acid molecule encoding the mutant according to claim 1 or 2, having:

(I) A nucleotide sequence shown as SEQ ID NO. 2; or (b)

(II) a nucleotide sequence which encodes the same protein as the nucleotide sequence shown in (I) but which differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (b)

(III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences with the nucleotide sequence shown in (I) or (II), and functionally identical or similar to the nucleotide sequence shown in (I) or (II); or (b)

(IV) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

5. A recombinant expression vector comprising the nucleic acid molecule according to claim 3 or 4 and a backbone vector.

6. A recombinant bacterium comprising the recombinant expression vector according to claim 5.

7. The recombinant bacterium according to claim 6, wherein the recombinant bacterium is used for preparing high-stability superoxide dismutase.

8. A method for the preparation of a mutant according to claim 1 or 2, comprising preparing the mutant based on the recombinant bacterium according to claim 6.

9. A method for preparing a mutant according to claim 1 or 2, comprising the steps of:

step 1, inducing the recombinant bacteria to express according to claim 6, centrifugally collecting thalli, ultrasonically crushing, and collecting the crushed supernatant;

step 2, purifying by a nickel column to obtain the crude mutant;

and 3, desalting by a G25 desalting column, and freeze-drying to obtain the mutant.

10. Use of any of the following for the preparation of a heat stable product:

(I) A mutant according to claim 1 or 2; and/or

(II) mutants obtainable by the process of claim 8 or 9.