CN117187123A - Water microzyme TLB and application thereof in degrading organic pollutants - Google Patents

Abstract

The invention discloses a water microzyme TLB and application thereof in degrading organic pollutants, the water microzyme TLB is taken from sewage plant sludge, has high-efficiency degradation effect on organic pollutants such as tertiary butyl acetate, acetone, benzene and the like, and can completely convert the pollutants into CO ₂ 、H ₂ Harmless substances such as O, etc., thus being used in industrial waste gas and waterHas wide application prospect in biological purification. The water microzyme TLB can completely degrade the tert-butyl acetate into inorganic matters and cellular biomass, realizes complete mineralization, and has the removal rate of the tert-butyl acetate within 260mg/L as high as 100%.

Description

Water microzyme TLB and application thereof in degrading organic pollutants

Field of the art

The invention relates to a water microzyme TLB and application thereof in degrading organic pollutants such as tertiary butyl acetate and the like.

(II) background art

The tert-butyl acetate is also called tert-butyl acetate, is an organic compound, belongs to aliphatic esters, and is colorless and transparent liquid with ester smell and easy to burn. The tert-butyl acetate is volatile, insoluble in water, and can be mixed with alcohol and ether, and is easily dissolved in some organic solvents such as acetic acid. The synthesis of tert-butyl acetate is generally carried out by reacting tert-butanol with acetic acid or acetic anhydride. The tert-butyl acetate is an excellent solvent for the nitrocellulose, is also a shockproof additive for gasoline, and has wider application.

Tert-butyl acetate is a low-toxicity substance, but is highly volatile and highly fat-soluble, and can accumulate in the body to cause neurotoxicity, and is thus considered as a highly dangerous poison. T-butyl acetate is a neurogenic poison that can lead to nerve fibrosis. Acute inhalation of high-concentration tert-butyl acetate with symptoms of epistaxis, hoarseness, cough, chest distress, headache, dizziness and the like, ocular and skin contact is irritated, and skin rash can be caused by repeated long-term contact. Nausea, vomiting, broncho and gastrointestinal irritation symptoms can occur with oral intake, central respiratory depression occurs in severe cases; humans ingest about 50g can be fatal.

Therefore, efficient degradation of tert-butyl acetate in a research environment is necessary for human health, and no report about achieving efficient degradation by taking tert-butyl acetate as the only carbon source of Aquamicrobium lusatiense is found through literature search.

(III) summary of the invention

The invention aims to provide a strain of organic pollutant degrading bacteria (Aquamicrobium lusatiense) TLB (TLB) such as tert-butyl acetate and the like and application thereof in degrading organic pollutants, wherein the strain can degrade the organic pollutant such as tert-butyl acetate and the like by taking the organic pollutant as a sole carbon source, has mild growth environment and is easy to expand and culture; has stronger removing capability to organic pollutants and can efficiently degrade the organic pollutants. Has important significance for the efficient purification of aliphatic ester pollutants in industrial wastewater and waste gas.

The technical scheme adopted by the invention is as follows:

the invention provides a novel tert-butyl acetate degrading bacterium, namely a microzyme (Aquamicrobium lusatiense) TLB (TLB), which is preserved in China center for type culture Collection, with the preservation number: cctccc NO: m2023953, date of preservation: 2023, 06, address: chinese, university of Wuhan, post code 430072.

The basic characteristics of the water microzyme TLB provided by the invention are as follows: the colony is orange, discoid, spore-free and flagellum-free; the edge is neat, the light is not transmitted, the picking is easy, and the lawn grows along the scribing line; aerobic, gram-positive.

The invention also provides an application of the water microzyme TLB in degrading organic pollutants, wherein the application is that bacterial liquid obtained by expanding the water microzyme TLB or resting cells obtained by centrifuging the bacterial liquid are added into inorganic salt culture solution with pH of 5-9 containing the organic pollutants, and the culture is carried out at 10-20 ℃ and 100-200rpm, so that the degradation of the organic pollutants is realized.

Further, the organic pollutants are tertiary butyl acetate, acetone, benzene and toluene.

Further, in the inorganic salt culture solution, the addition amount of resting cells is 20-80mg/L, preferably 50mg/L, based on the dry weight of the thalli; the bacterial liquid is added in an amount of 0.01-0.1, preferably 0.02, calculated by OD value.

Further, the initial concentration of the organic contaminant in the inorganic salt culture solution is 52-260mg/L, preferably 104mg/L.

Further, the culture conditions were: reaction at 15℃and 160 rpm; the pH of the inorganic salt culture solution is preferably 5-9.

Further, the inorganic salt culture solution comprises the following components: k (K) ₂ HPO ₄ ·3H ₂ O 0.942g/L、KH ₂ PO ₄ 0.234g/L、NaNO ₃ 1.7g/L、NH ₄ Cl 0.98g/L、MgCl ₂ ·6H ₂ O 0.2033g/L、CaCl ₂ ·2H ₂ O 0.011g/L、FeCl ₃ 0.0162g/L, 5ml/L of microelement mother liquor, deionized water as solvent, and pH 7.0; wherein the trace element mother liquor comprises the following components: cuSO ₄ ·5H ₂ O 0.02g/L、FeSO ₄ ·7H ₂ O 1.0g/L、MnSO ₄ ·4H ₂ O 0.1g/L、NaMoO ₄ ·2H ₂ O 0.02g/L、CoCl ₂ ·6H ₂ O 0.02g/L、H ₃ BO ₃ 0.014g/L、ZnSO ₄ ·7H ₂ O0.10 g/L, and deionized water as solvent.

Further, the water microzyme TLB resting cells are prepared according to the following steps:

(1) Slant culture:

inoculating the water microzyme TLB into an inclined plane LB solid culture medium, and culturing for 24-36 h at 30 ℃ to obtain inclined plane thalli; the final concentration composition of the LB solid medium is as follows: 10g/L of NaCl, 10g/L of tryptone, 5g/L of yeast powder, 18-20 g/L of agar, deionized water as a solvent and natural pH value;

(2) And (3) performing expansion culture:

inoculating the slant bacterial cells obtained in the step (1) into an LB liquid culture medium by using an inoculating loop, and culturing at 15 ℃ and 160rpm for 24-36 h to obtain OD ₆₀₀ Bacterial liquid with the concentration of 0.1-0.2, centrifuging, collecting wet bacterial bodies, washing with inorganic salt culture solution, and obtaining the water microzyme TLB resting cells; the final concentration composition of the LB liquid medium is as follows: 10g/L NaCl, 10g/L peptone, 5g/L yeast powder, deionized water as solvent and natural pH value.

Compared with the prior art, the invention has the beneficial effects that:

the water microzyme TLB provided by the invention is taken from sewage plant sludge, has high-efficiency degradation effect on organic pollutants such as tertiary butyl acetate and the like, and can completely convert the pollutants into CO ₂ 、H ₂ Harmless substances such as O and the like have wide application prospects in biological purification of industrial waste gas and wastewater.

The water microzyme TLB of the invention can completely degrade the tertiary butyl acetate into the water microzyme TLBInorganic substance (CO) ₂ 、H ₂ O) and cellular biomass, achieving complete mineralization, and the removal rate of tert-butyl acetate within 260mg/L is up to 100%. In addition, the water microzyme TLB has certain degradation effects on acetone, benzene, toluene and the like.

(IV) description of the drawings

FIG. 1 is a photograph showing colony morphology of strain TLB on LB medium.

FIG. 2 is a transmission electron micrograph of strain TLB.

FIG. 3 is a phylogenetic tree of the strain TLB.

FIG. 4 shows the degradation curves of strain TLB for different concentrations of t-butyl acetate.

FIG. 5 is a degradation curve of strain TLB for 104mg/L t-butyl acetate at different pH.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The inorganic salt culture solution comprises the following components: k (K) ₂ HPO ₄ ·3H ₂ O 0.942g/L、KH ₂ PO ₄ 0.234g/L、NaNO ₃ 1.7g/L、NH ₄ Cl 0.98g/L、MgCl ₂ ·6H ₂ O 0.2033g/L、CaCl ₂ ·2H ₂ O 0.011g/L、FeCl ₃ 0.0162g/L, 5ml/L of microelement mother liquor, deionized water as solvent, and pH 7.0; wherein the trace element mother liquor comprises the following components: cuSO ₄ ·5H ₂ O 0.02g/L、FeSO ₄ ·7H ₂ O 1.0g/L、MnSO ₄ ·4H ₂ O 0.1g/L、NaMoO ₄ ·2H ₂ O 0.02g/L、CoCl ₂ ·6H ₂ O 0.02g/L、H ₃ BO ₃ 0.014g/L、ZnSO ₄ ·7H ₂ O0.10 g/L, and deionized water as solvent.

The final concentration composition of the LB solid medium is as follows: 10g/L of NaCl, 10g/L of tryptone, 5g/L of yeast powder, 18-20 g/L of agar, deionized water as a solvent and natural pH value.

The final concentration composition of the LB liquid medium is as follows: 10g/L NaCl, 10g/L peptone, 5g/L yeast powder, deionized water as solvent and natural pH value.

Example 1: isolation, purification and identification of strain TLB.

1. Isolation and purification of strain TLB.

The bacterial strain TLB is a gram-positive bacterium which is domesticated and separated from activated sludge collected from a municipal sewage treatment plant, and comprises the following specific steps:

adding 50mL of inorganic salt culture solution into 300mL of shaking flask, adding 10mL of activated sludge and 30mg/L of tert-butyl acetate, performing enrichment culture at 15 ℃, taking out 5mL of enrichment solution from the flask into 50mL of fresh inorganic salt culture solution when the concentration of tert-butyl acetate is 50% of the initial concentration, adding the same amount of tert-butyl acetate (30 mg/L), repeating the enrichment process for 5 times, and diluting the final enrichment solution with sterile water in gradient for 10 times ^-5 The diluted bacterial liquid is coated with LB solid medium and cultured for 24 hours at 15 ℃. Single colony is drawn lines and inoculated to LB solid medium, and cultured at 15 ℃ for separation and purification (figure 1). Adding the obtained alternative bacteria into an inorganic salt culture solution, adding 30mg/L of tert-butyl acetate as a unique carbon source and energy source, culturing at 15 ℃ and 160rpm for 36 hours, detecting the degradation rate of the tert-butyl acetate by adopting the method of the embodiment 3, screening to obtain a target strain with the highest degradation rate, and marking the target strain as a strain TLB.

2. Identification of Strain TLB

(1) Strain TLB features: the colony is orange and discoid; the edges are neat, light-tight and easy to pick. The bacterial strain is observed under a transmission electron microscope to be in an elliptic bacillus form, has no flagella and is gram-positive. The morphology was determined by transmission electron microscopy (fig. 2).

(2) Analysis by 16S rRNA sequence

The DNA of the bacterial strain TLB is extracted and purified by adopting an Ezup column type bacterial genome DNA extraction kit, and the DNA is preserved at 4 ℃. The purified DNA was PCR amplified with bacterial universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), respectively, and the PCR reaction procedure was set to 94℃for 4min, then 94℃for 45s,55℃for 45s,72℃for 1min extension, 30 cycles of cycles, and finally 72℃for 10min of repair extension. The PCR product was purified and recovered and then sequenced (Zhejiang Tianke Gaoxin technology development Co., ltd. (original Zhejiang province of microorganisms)), and the 16S rRNA sequencing result (nucleotide sequence shown as SEQ ID NO. 1) was uploaded to NCBI to obtain accession No. OR144353, and at the same time the sequence was Blast-compared with the gene sequence in NCBI database. It was found to belong to the Aquamicrobium genus, having 99% homology with Aquamicrobium lusatiense strain S1, aquamicrobiumdefluvii strain DSM 11603 and Aquamicrobiumaerolatum strain Sa 14. From the results, 10 Aquamicrobium-representative strains were selected, and based on 16S rRNA gene sequence homology, phylogenetic trees were constructed using MEGA7.0 software, as shown in fig. 3. Is identified as Aquamicrobium lusatiense by genetic distance and 16S rRNA sequence comparison.

(3) The strain TLB has the utilization capacity of 63 carbon sources on a Mei Liai GN card.

The metabolic conditions of the strain on 63 different carbon sources (entrusted to Zhejiang Tianke Gao Xin technology development Co., ltd. (the institute of microorganisms of Zhejiang province)) were examined by using a Mei Liai full-automatic identifier. The results of the identification are shown in Table 1. Through the biochemical reaction of the VITEK by a Mei Liai full-automatic identifier, the strain TLB can strongly utilize 10 carbon sources and can not utilize other 53 carbon sources.

TABLE 1 full-automatic identifier VITEK biochemical reaction result of strain TLB Mei Liai (GN card)

And (3) table notes: positive reaction; -: negative reaction

The strain is determined to be Aquamicrobium lusatiense by 16S rRNA sequence analysis and physiological and biochemical experiment identification, named water microzyme (Aquamicrobium lusatiense) TLB is preserved in China center for type culture collection, and the preservation number is as follows: cctccc NO: m2023953, date of preservation: 2023, 06, address: chinese, university of Wuhan, post code 430072.

Example 2: acquisition of Water microzyme TLB resting cells

1. Slant culture:

inoculating the water microzyme TLB into LB liquid culture medium, culturing for 24-36 h at 15 ℃ and 160rpm, drawing activated bacteria on a solid LB flat plate, culturing for 24-36 h at 30 ℃ in an incubator, drawing a single bacterial colony on the flat plate to detect the purity of the bacteria, and preserving the inclined plane of the LB test tube conventionally (4 ℃).

2. Expansion culture

Inoculating the slant thallus in the step 1 into LB liquid culture medium, culturing at 15 ℃ and 160rpm for 24-36 h to obtain OD ₆₀₀ Bacterial liquid with the concentration of 0.1-0.2, centrifuging, collecting wet bacterial bodies, washing with inorganic salt culture solution, and obtaining the water microzyme TLB resting cells.

Example 3: the degradation performance of the water microzyme TLB on the tertiary butyl acetate with different concentrations is detected.

The inorganic salt culture solution is subpackaged in shake flasks with the volume of 300mL, 50mL of each flask is sterilized at 110 ℃ for 40min. And (5) standing for 2d at room temperature after sterilization is finished, and determining the growth of the sterile impurities. Resting cells obtained in example 2 were added to a final concentration of 50mg/L (based on dry cell weight), and tert-butyl acetate was then added as the sole carbon source to give final concentrations of 52, 104, 156, 208, 260mg/L, respectively, and shake flasks were shake-sealed and shake-cultured at 15℃at 160rpm, and a blank without bacteria was made. The residual concentration of tert-butyl acetate in the shake flask was measured at 24h intervals, and the removal rate curves of the strain with respect to the time change of the tert-butyl acetate with different initial concentrations were plotted, and the results are shown in FIG. 4.

Determination of gas chromatography column parameters for t-butyl acetate: HP-INNOWax Polyethylene Glycol (30 m.times.320 μm.times.0.50 μm); column temperature: 120 ℃, column internal pressure: 5.68psi, in-column flow: 0.8mL min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the The temperature of the sample inlet is 210 ℃, the split ratio is 18:1, and carrier gas is carried out: nitrogen gas: carrier gas flow rate: 15.0mL min ^-1 Pressure: 5.68psi; a detector: hydrogen Flame Ionization Detector (FID), 230 ℃, hydrogen flow: 40 mL/min ^-1 Air flow rate: 450 mL/min ^-1 Tail blowing: 45 mL/min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Sample injection amount: 0.8mL.

The results indicate that strain TLB can rapidly degrade all added substrate when the tert-butyl acetate concentration is below 260mg/L.

Example 4: and detecting the degradation performance of the water microzyme TLB on 104mg/L of tert-butyl acetate under different initial pH environments.

With 1mol/L NaOH aqueous solution or 1mol/L H ₂ SO ₄ The inorganic salt culture solution is adjusted to different pH values (4.0, 5.0, 6.0, 7.0, 8.0 and 9.0) by the aqueous solution, and the bacterial solution prepared by the method of the example 2 is connected under the condition that the initial concentration of the tertiary butyl acetate is 104mg/L, so that the initial bacterial solution concentration in each parallel sample is OD ₆₀₀ Calculated as 0.02. Samples were shake cultured at 15℃in a constant temperature shaker at 160rpm and a blank without bacteria was made. The concentration of residual tert-butyl acetate in the shake flask was determined periodically by the method of example 3, and a curve of the removal rate of 104mg/L of tert-butyl acetate over time was plotted for the strain under different pH environments, and the results are shown in FIG. 5. The results show that the water microzyme TLB can degrade tert-butyl acetate at ph=5 and above, and the degradation effect on tert-butyl acetate is worst at pH 4, and is almost difficult to degrade.

Example 5: and detecting degradation performance of the water microzyme TLB on other pollutants.

The inorganic salt culture solution is subpackaged in shake flasks with the volume of 300mL, 50mL of each flask is sterilized at 110 ℃ for 40min. And (5) standing for 2d at room temperature after sterilization is finished, and determining the growth of the sterile impurities. Resting cells obtained in the method of example 2 were added to a final concentration of 50mg/L (calculated on dry cell weight), and then t-butyl acetate, acetone, benzene, toluene, chlorobenzene, dichloromethane and other industrially common contaminants were added as the sole carbon source, and after shaking and sealing, shaking culture was performed at 15℃and 160rpm, and a blank control without bacteria was made. The concentration of residual tert-butyl acetate, acetone, benzene, toluene, chlorobenzene and dichloromethane in the shake flask was measured at regular time.

Determination of gas chromatographic column parameters of t-butyl acetate, acetone, benzene, toluene: HP-INNOWax Polyethylene Glycol (30 m.times.320 μm.times.0.50 μm); column temperature: tertiary butyl acetate and acetone 120 ℃, benzene and toluene 90 ℃, column pressure: 5.68psi, in-column flow: 0.8mL min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Sample inlet temperature 210 ℃, split ratio 18:1, carrier gas: nitrogen gas: carrier gas flow rate: 15.0mL min ^-1 Pressure: 5.68psi; a detector: hydrogen Flame Ionization Detector (FID), 230 ℃, hydrogen flow: 40 mL/min ^-1 Air flow rate: 450 mL/min ^-1 Tail blowing: 45 mL/min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Sample injection amount: 0.8mL. Determination of gas chromatography column parameters of chlorobenzene, dichloromethane: j (J)&W122-5531 capillary chromatographic column (30 m.times.0.25 mm.times.0.1. Mu.m), carrier gas N ₂ (20 mL/min), the temperature of the sample injector is 250 ℃, the temperature program of the GC column box is 50 ℃, the temperature is increased to 80 ℃ at 5 ℃/min, the temperature is increased to 100 ℃ at 20 ℃/min, the sample is kept for 2 min, and the sample injection is performed in a non-split mode (0.5 min).

The results are shown in Table 2. The results show that the strain TLB can rapidly degrade tert-butyl acetate, has a certain degradation effect on acetone, benzene and toluene, but has little degradation effect on chlorobenzene and dichloromethane.

TABLE 2 degradation effects of Water microzyme TLB on different pollutants

Note that: "+" indicates the degree of degradation, more indicates easier degradation, and "-" indicates inability to degrade

Although the present invention has been described with reference to the above embodiments, it should be understood that the invention is not limited to the embodiments described above, but is capable of modification and variation without departing from the spirit and scope of the present invention.

Claims (8)

1. Microzyme (Aquamicrobium lusatiense) TLB, deposited in chinese collection for typical cultures, accession number: cctccc NO: m2023953, date of preservation: 2023, 06, address: chinese, university of Wuhan, post code 430072.

2. Use of the water microzyme TLB of claim 1, for degrading organic contaminants.

3. The use according to claim 2, wherein the use is to add a bacterial liquid obtained by expanding culture of a water microzyme TLB or resting cells obtained by centrifuging the bacterial liquid into an inorganic salt culture solution with a pH of 5-9 containing organic pollutants, and culture the cells at 10-20 ℃ and 100-200rpm to degrade the organic pollutants.

4. The use according to claim 3, wherein the organic contaminant is t-butyl acetate, acetone, benzene, toluene.

5. The use according to claim 3, wherein the amount of resting cells added in the inorganic salt culture broth is 20-80mg/L based on dry weight of the cells; the addition amount of the bacterial liquid is 0.01-0.1 calculated by OD value; the initial concentration of the organic pollutants is 52-260mg/L.

6. The use according to claim 3, wherein the culture conditions are: the reaction was carried out at 15℃and 160 rpm.

7. The use according to claim 3, wherein the mineral salts broth consists of: k (K) ₂ HPO ₄ ·3H ₂ O0.942g/L、KH ₂ PO ₄ 0.234g/L、NaNO ₃ 1.7g/L、NH ₄ Cl 0.98g/L、MgCl ₂ ·6H ₂ O 0.2033g/L、CaCl ₂ ·2H ₂ O 0.011g/L、FeCl ₃ 0.0162g/L, 5ml/L of microelement mother liquor, deionized water as solvent, and pH 7.0; wherein the trace element mother liquor groupThe method comprises the following steps: cuSO ₄ ·5H ₂ O 0.02g/L、FeSO ₄ ·7H ₂ O 1.0g/L、MnSO ₄ ·4H ₂ O 0.1g/L、NaMoO ₄ ·2H ₂ O 0.02g/L、CoCl ₂ ·6H ₂ O 0.02g/L、H ₃ BO ₃ 0.014g/L、ZnSO ₄ ·7H ₂ O0.10 g/L, and deionized water as solvent.

8. The use of claim 3, wherein the aqua microzyme TLB resting cells are prepared by:

(1) Slant culture:

inoculating the water microzyme TLB into an inclined plane LB solid culture medium, and culturing for 24-36 h at 30 ℃ to obtain inclined plane thalli; the final concentration composition of the LB solid medium is as follows: 10g/L of NaCl, 10g/L of tryptone, 5g/L of yeast powder, 18-20 g/L of agar, deionized water as a solvent and natural pH value;

(2) And (3) performing expansion culture:

inoculating the slant bacterial cells obtained in the step (1) into an LB liquid culture medium by using an inoculating loop, and culturing at 15 ℃ and 160rpm for 24-36 h to obtain OD ₆₀₀ Bacterial liquid with the concentration of 0.1-0.2, centrifuging, collecting wet bacterial bodies, washing with inorganic salt culture solution, and obtaining the water microzyme TLB resting cells; the final concentration composition of the LB liquid medium is as follows: 10g/L NaCl, 10g/L peptone, 5g/L yeast powder, deionized water as solvent and natural pH value.