CN117165471A - Leuconostoc mesenteroides producing broad-spectrum antibacterial peptide and application thereof - Google Patents

Abstract

The invention relates to the field of animal breeding, and in particular discloses an antibacterial peptide, a preparation method thereof and application thereof in an animal feed additive. The antibacterial peptide is derived from leuconostoc mesenteroides. The antibacterial peptide produced by the strain has remarkable inhibition effect on various gram-positive bacteria, gram-negative bacteria and fungi, and is high-temperature resistant and acid-base resistant. The antibacterial peptide produced by the invention can be widely applied to the livestock industry and the feed industry, can obviously inhibit the growth and reproduction of bacteria, has no chemical residue, no toxic or side effect and no risk of environmental pollution, and has wide application prospect.

Description

Leuconostoc mesenteroides producing broad-spectrum antibacterial peptide and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to leuconostoc mesenteroides for producing broad-spectrum antibacterial peptides and application thereof.

Background

With the ever-increasing quality of life and global economy integration, food safety has become a worldwide challenge and a globally important public health issue. Animal food safety has become a focus of worldwide attention, with the problem of antibiotic residues being one of the important factors affecting the safety of milk and meat products. In recent years, due to excessive use of antibiotics in animal production process, animal organism is disordered, intestinal microecology balance is destroyed, and animal organism self resistance is reduced, and meanwhile, a large amount of antibiotic residues are caused in animal products and environment, so that the drug resistance of pathogenic bacteria is enhanced, and human health is endangered. At present, antibiotics are subject to being eliminated or disabled in the feed industry. The swiss began to limit the use of some antibiotics as feed additives as early as 1986, and the european union completely banned the use of antibiotics as feed additives in feed in 2006. In 2020, antibiotics are prohibited from being added into the feed. Thus, the cultivation industry and the feed industry are seriously affected. Therefore, the development of a safe and efficient novel feed additive to replace traditional antibiotics is of great importance.

The antibacterial peptide (Antimicrobial peptides, AMP) is a small molecular polypeptide with biological activity which is induced in organisms, has the molecular weight of about 2000-7000, is composed of 20-60 amino acid residues, and is an important component of the natural immune defense system of organisms. The mechanism of action of antimicrobial peptides is different from antibiotics, which generally kill bacteria by acting on specific targets of the bacteria, while most antimicrobial peptides kill bacteria by physically adsorbing and rapidly penetrating and disrupting the bacterial membrane. Antimicrobial peptides can also act on microbial biosynthesis processes such as cell wall synthesis, DNA, proteins, and protein folding, among others. The antibacterial ability of the antibacterial peptide is broader than that of antibiotics. In addition, the antibacterial peptide is easy to be hydrolyzed by protease, and is not easy to remain in an animal body, so that the antibacterial peptide is not easy to generate drug resistance. The antibacterial peptide has high biological activity, is green, has no residue, is not easy to generate drug-resistant pathogenic bacteria, and is a suitable feed additive in animal production. The antibacterial peptide is extracted from plants, insects and other materials, and industrialization is difficult to form due to the limitation of extraction raw materials, complex extraction process and high cost. As the antimicrobial peptide produced by the microorganism has the obvious advantages of low cost, no toxicity, short period and the like, the research of the antimicrobial peptide produced by the microorganism is started in recent years. The acquisition of high-activity antibacterial peptides by microbial fermentation is a production technology with important prospects. In addition, researches have reported that lactobacillus source broad-spectrum antibacterial peptides are widely applied to food fermentation and preservation. However, the application research of the compound feed additive in the aspect of animal feed additives is still rarely reported.

Disclosure of Invention

The invention provides a novel antibacterial animal feed additive, a preparation method and application thereof, solves the problems of bacterial drug resistance, drug resistance transmission and the like caused by feeding antibiotics in animal breeding industry, and further enriches the types and the application of natural antibacterial substances and feed additives. In order to achieve the above purpose, the invention adopts the following technical scheme:

the invention provides a leuconostoc mesenteroides (Leuconostoc mesenteroides) capable of producing antimicrobial peptides with broad-spectrum antibacterial activity, wherein the leuconostoc mesenteroides are preserved in China center for type culture collection, and the preservation number is as follows: CCTCC NO: M20231423, the preservation date is 2023, 8, 10 days.

The leuconostoc mesenteroides is separated from homemade pickle and is named as MCW02. The bacterial gram staining is positive, grows in MRS solid culture medium, and the bacterial colony is an opaque white round micro-bacterial colony with smooth surface, neat edge and 1-2 mm diameter.

The leuconostoc mesenteroides MCW02 can produce broad-spectrum antibacterial peptide MCW02-AMP, wherein the amino acid sequence of the antibacterial peptide is as follows: LHRLCGSPSIPLSFNLAVVLPRRNT.

The bacterial strain MCW02 has better heat stability of antibacterial peptide in metabolites, and the antibacterial activity is almost unchanged after being treated for 1h at 25-100 ℃. The acid-base stability is strong, the antibacterial activity is almost unchanged between pH 4 and 9, and the antibacterial activity is reduced between pH 2 and 4 and between pH 10 and 12, but the antibacterial activity is still maintained.

The bacterial strain MCW02 has strong antibacterial effect on antibacterial peptide in metabolites thereof, and fermentation liquor of the bacterial strain MCW02 can inhibit gram-positive bacteria and has strong inhibition effect on various gram-negative bacteria at the same time: has stronger inhibition effect on staphylococcus aureus, escherichia coli, salmonella, klebsiella pneumoniae, bacillus cereus, pseudomonas aeruginosa and other bacteria; can also inhibit filamentous fungi such as Penicillium, trichoderma, aspergillus niger, aspergillus oryzae, etc. Meanwhile, the broad-spectrum antibacterial activity of the antibacterial peptide produced by the invention is not limited to the pathogenic bacteria species.

Advantageous effects

The broad-spectrum antibacterial peptide produced by the strain MCW02 can be used for solving the problems of bacterial drug resistance, drug resistance transmission and the like caused by feed antibiotics in animal breeding industry, and further enriches the types of natural antibacterial substances and feed additives. The invention verifies the antibacterial effect of the broad-spectrum antibacterial peptide produced by the strain MCW02 as a functional antibacterial feed additive through a plate inhibition zone method.

The invention can realize antibacterial effect in conventional compound feed without adding antibiotics by using bacterial strain MCW02 to generate broad-spectrum antibacterial peptide. Thus, not only the increase of the feed cost is avoided, but also the problem of drug residue is solved. The use of antibiotics has been limited worldwide, resulting in challenges in feed formulation. Therefore, the technology innovation of animal husbandry is enhanced, and the production efficiency and quality are improved, so that the technology innovation is an important task at present. The broad-spectrum antibacterial peptide has wide market demands, and is predicted to be an optimal substitute for antibiotics in future cultivation.

The invention adopts leuconostoc mesenteroides to produce the broad-spectrum antibacterial peptide, has short production period and low cost, is not limited by raw materials, and can be produced in a large scale and industrialized mode, thus having obvious advantages compared with the antibacterial peptide from animals and plants.

Drawings

FIG. 1 shows a gel electrophoresis diagram of PCR amplification products, namely Marker, MCW02 and MCW02 in sequence from left to right.

FIG. 2 constructs a phylogenetic tree of strain MCW02 based on the 16S rDNA gene sequence.

FIG. 3 is a graph showing the results of measurement of the thermostability of the antimicrobial peptide in the fermentation broth of Leuconostoc mesenteroides MCW02.

FIG. 4 shows the results of the determination of the acid-base stability of the antimicrobial peptide of the leuconostoc mesenteroides MCW02 fermentation broth.

Detailed Description

The invention is described below by means of specific embodiments. The following embodiments are illustrative only and do not limit the scope of the invention. The technical means involved in the present invention are all methods well known to those skilled in the art. Various changes or modifications may be made in the ingredients and amounts of materials used in the embodiments without departing from the spirit and scope of the invention, and such changes or modifications are intended to be included within the scope of the invention.

Example 1 screening and identification of Strain MCW02

Sampling from domestic kimchi (pickled cabbage). And (3) carrying out aseptic crushing treatment on 15g of pickle, then vibrating and uniformly mixing in normal saline, and taking supernatant to mark on an MRS solid flat plate for constant-temperature culture at 37 ℃ for 36-48 h. And observed in time.

Taking out the plate with the colony and selecting a gradient plate with obvious single colony, selecting colonies with different colony morphologies from the gradient plate, carrying out secondary streaking on the MRS solid culture medium plate, inverting the plate, and culturing for 36-48 h at 37 ℃. The above steps were repeated until a purified single colony was obtained.

Selecting single bacterial colony, placing in MRS liquid culture medium, standing at 37deg.C for culturing for 24 hr, centrifuging to obtain supernatant, and screening bacterial strain producing antibacterial substance by solid agar perforation antibacterial method with Staphylococcus aureus and Escherichia coli as indicator bacteria under the condition of eliminating interference of organic acid, hydrogen peroxide, etc.

Gram staining of the bacterial strain producing the antibacterial substance is positive; the catalase test was negative. The colony is in opaque milky white round micro colony with neat edge, which grows in MRS solid culture medium. These characteristics are identical to typical lactic acid bacteria colony characteristics. From these strains, 5 strains with a zone of inhibition of 15mm or more in diameter were selected and designated as MCW01, MCW02, MCW03, MCW04, and MCW05. These 5 strains were identified by glucan formation assay (table 1) and carbohydrate fermentation assay (table 2).

The glucan formation assay method was as follows: colonies were selected from MRS solid medium, streaked on dextran production medium, and then cultured at 30℃for 24-72 hours. The colony was observed for the formation of water drops and a viscous lawn. If so, a positive reaction is indicated, i.e. glucan is produced; if not, a negative reaction is indicated.

The identification result of the glucan generation test shows that: 2 strains can produce glucan using sucrose. Among the genus Leuconostoc, only Leuconostoc mesenteroides can produce dextran from sucrose, forming a viscous lawn on the medium, and other species do not possess this feature. Based on this characteristic, 2 strains MCW02 and MCW04 were further subjected to a carbohydrate fermentation test.

The carbohydrate fermentation test method is as follows: the activated cultures were inoculated into fermentation media containing different carbohydrates and then incubated at 30℃for 24-72 h. If the culture medium turns yellow, which means that the carbohydrate is metabolized to produce acid, a positive reaction is judged; otherwise, the negative reaction is judged.

The results of the carbohydrate fermentation test showed that: only the strain MCW02 can utilize three sugars of galactose, maltose and ribose, so that the strain MCW02 is primarily determined to be leuconostoc mesenteroides through the identification of gram stain, catalase experiment, glucan generation experiment and carbohydrate fermentation experiment.

TABLE 1 identification of dextran production assay

Strain	MCW01	MCW02	MCW03	MCW04	MCW05
						Glucan production	-	+	-	+	-

Note that: + represents the formation of a viscous lawn; -representing that no viscous lawn is produced.

TABLE 2 results of biochemical identification of carbohydrate fermentation

Carbohydrates	MCW02	LBC04
			Salicylic acid sweet	+	+
Galactose	+	+
			Ribose	+	-
Maltose	+	+
			Fructose	+	+
Sucrose	+	+
			Cellobiose	+	+
Sorbitol	-	-

Note that: + represents the use of carbohydrates to produce acid, a yellow positive reaction; -representing a negative reaction.

In order to more accurately and effectively identify the strain MCW02, a 16S rDNA sequence analysis technology in molecular biology is adopted for identification besides the traditional physiological and biochemical identification method.

Bacterial strain MCW02 is inoculated in MRS liquid culture medium, after being cultured for 24 hours at 37 ℃, bacterial cells are collected by centrifugation at 12000r/min for 1min, and total DNA is extracted from the bacterial cells according to the specification of a DNA extraction kit. PCR amplification was performed using the 16S rDNA gene primer sequences 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGGCTACCTTGTTACGACTT-3'), and the 5uLPCR product was subjected to 1% agarose gel electrophoresis, the result of which is shown in FIG. 1.

The PCR product was recovered using Invitrogen PCR product purification recovery kit and 16S rRNA complete sequence sequencing was performed by Guangdong Meiger Gene technologies Co. The 16S rDNA sequence of the strain MCW02 is 1443bp, and the sequencing result is shown as SEQ ID NO. 1.

SEQ ID NO.1：

CCCAGTCATCTGTCCTGCCTTAGACGGCTCCTTCCTAAAAGGTTAGGCCACCGGC

TTTGGGCATTACAAACTCCCATGGTGTGACGGGCGGTGTGTACAAGACCCGGGAACG

TATTCACCGCGGCGTGCTGATCCGCGATTACTAGCGATTCCGACTTCATGTAGTCGAGT

TGCAGACTACAATCCGAACTGAGACGTACTTTAAGAGATTAGCTCACCCTCGCGGGTT

GGCAACTCGTTGTATACGCCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATG

ATGATCTGACGTCGTCCCCGCCTTCCTCCGGTTTGTCACCGGCAGTCTCGCTAGAGTG

CCCATCTGAATGCTGGCAACTAACAATAAGGGTTGCGCTCGTTGCGGGACTTAACCCA

ACATCTCACGACACGAGCTGACGACGACCATGCACCACCTGTCACTTTGTCTCCGAA

GAGAACACTTCTATCTCTAAAAGCTTCAAAGGATGTCAAGACCTGGTAAGGTTCTTCG

CGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTT

GAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAACACTTAATGCGTTAGCTTCGGC

ACTAAGAGGCGGAAACCTCCTAACACCTAGTGTTCATCGTTTACGGTGTGGACTACCA

GGGTATCTAATCCTGTTTGCTACCCACACTTTCGAGCCTCAACGTCAGTTGCAGTCCA

GTAAGCCGCCTTCGCCACTGGTGTTCTTCCATATATCTACGCATTCCACCGCTACACAT

GGAGTTCCACTTACCTCTACTGCACTCAAGTTAACCAGTTTCCAATGCCATTCCGGAG

TTGAGCTCCGGGCTTTCACATCAGACTTAATAAACCGTCTGCGCTCGCTTTACGCCCA

ATAAATCCGGATAACGCTCGGGACATACGTATTACCGCGGCTGCTGGCACGTATTTAGC

CGTCCCTTTCTGGTATGGTACCGTCAAACTAAAATCATTTCCTATTCTAGCTGTTCTTCC

CATACAACAGTGCTTTACGACCCGAAAGCCTTCATCACACACGCGGCGTTGCTCCATC

AGGCTTTCGCCCATTGTGGAAGATTCCCTACTGCAGCCTCCCGTAGGAGTTTGGGCCG

TGTCTCAGTCCCAATGTGGCCGATCAGTCTCTCAACTCGGCTATGCATCATTGTCTTGG

TAGGCCTTTACCCCACCAACTAACTAATGCACCGCGGATCCATCTCTAGGTGACGCCG

AAGCGCCTTTTAACTTTGTGTCATGCGACACTAAGTTTTATTCGGTATTAGCATCTGTTT

CCAAATGTTATCCCCAGCCTTGAGGCAGGTTGTCCACGTGTTACTCACCCGTTCGCCA

CTCACTTGAAAGGTGCAAGCACCTTTCGCTGTGCGTTCGACTTGCAT

The 16S rDNA sequences of strain MCW02 were aligned in NCBI (https:// www.ncbi.nlm.nih.gov /) using BLAST. The strain can be classified as Leuconostoc mesenteroides by combining the physiological and biochemical identification and the 16S rDNA homology comparison result, and a phylogenetic tree is constructed as shown in figure 2.

EXAMPLE 2 determination of bacterial strain fermentation broth antimicrobial Spectrum Activity

The leuconostoc mesenteroides MCW02 is inoculated into MRS liquid culture medium for culture, and after standing culture for 24 hours at 37 ℃, supernatant is extracted by centrifugation at 12000r/min for 5min for antibacterial activity measurement. Bacteria such as staphylococcus aureus, escherichia coli, salmonella, klebsiella pneumoniae, bacillus cereus, pseudomonas aeruginosa and the like and filamentous fungi such as penicillium, trichoderma, aspergillus niger, aspergillus oryzae and the like are respectively used as indicator bacteria. And (5) evaluating the antibacterial effect of the antibacterial agent on the indicator bacteria by adopting a perforation antibacterial method. Bacteria were inoculated into LB agar solid medium, uniformly perforated with a punch at a distance of 2cm from the colony, and 100. Mu.L of the prepared fermentation broth was added to each well, and used as a control with sterile water. After incubation at 37℃for 24 hours, the diameter of the zone of inhibition was observed and measured. After the mold is inoculated in PDA culture medium for 1-2 d, holes are punched at the position 2cm away from the colony, 100 mu L of prepared fermentation liquor is added into each hole, and sterile water is used as a control. After culturing at 28℃for 72 hours, the diameter of the zone of inhibition was observed and measured. As shown in Table 3, the fermentation supernatant of Leuconostoc mesenteroides MCW02 showed good antibacterial effect against 10 strains of bacteria indicator bacteria, indicating that the Leuconostoc mesenteroides MCW02 has a relatively broad-spectrum antibacterial activity.

TABLE 3 results of bacteriostatic Activity of Leuconostoc mesenteroides MCW02 fermentation broths

Sequence number	Indicator bacteria	Diameter of inhibition zone (mm)
			1	Staphylococcus aureus	25.1±0.9
2	Coli bacterium	22.3±0.7
			3	Salmonella bacteria	22.6±0.8
4	Klebsiella pneumoniae	15.8±0.5
			5	Bacillus cereus	19.8±0.4
6	Pseudomonas aeruginosa	18.2±0.6
			7	Penicillium penicillium	15.1±0.4
8	Trichoderma reesei	14.6±0.6
			9	Aspergillus niger	15.4±0.7
10	Aspergillus oryzae	13.8±0.5

Example 3 determination of antibacterial peptides

The antibacterial peptide is determined by the internationally accepted "protease sensitive method". After the fermentation broth obtained in example 2 was centrifuged at 12000r/min for 10min, the cells were removed, and the supernatant was retained. The pH of the fermentation supernatant was adjusted to about 7.5 to exclude the influence of organic acids or organic bases produced by the strain during fermentation on the antibacterial effect. Respectively preparing proteinase K, trypsin, pepsin, papain and proteinase E into 10mg/mL solutions, respectively taking 1mL of the solutions into a centrifuge tube, adding 1mL of the treated fermentation supernatant to ensure that the final concentration of the enzyme is 5mg/mL, simultaneously adding 1mL of double distilled water into 1mL of fermentation liquor as a control group, incubating for 4h at 37 ℃, boiling in a boiling water bath at 100 ℃ for inactivating the enzyme for 5min after incubation, measuring the diameter of a bacteriostasis ring by using an agar diffusion method, comparing with a blank control, and observing the change of the bacteriostasis activity. The results are shown in Table 4. The antibacterial substance is not very sensitive to proteinase E and papain, but is particularly sensitive to pepsin, proteinase K and trypsin, and the activity is almost completely lost. And comprehensively analyzing the test results to judge the antibacterial substance as the antibacterial peptide.

TABLE 4 influence of different protease treatments on antibacterial substances

Note that: compared to the control group, P <0.05 and P <0.01.

EXAMPLE 4 bacteriostatic Activity of different treatments of Strain fermentation broths

(1) Influence of different temperatures on antibacterial effect of antibacterial peptide of bacterial strain MCW02 fermentation liquor

The bacterial strain MCW02 fermentation broth antibacterial peptide is respectively placed at 0, 25, 50, 75 and 100 ℃ for 1h. The antibacterial activity of the antibacterial peptide fermentation broth is measured by a plate perforation method by taking staphylococcus aureus as an indicator strain. 80 mu L of antibacterial peptide fermentation liquor treated at different temperatures is added into each hole respectively. As shown in FIG. 3, the antibacterial activity of the antibacterial peptide fermentation broth after being treated for 1h at 0, 25, 50, 75 and 100 ℃ is reduced along with the temperature rise, but the antibacterial activity is still realized after being treated at high temperature. This indicates that the antibacterial peptide fermentation broth has better thermal stability.

(2) Influence of acid-base solutions with different pH values on antibacterial effect of antibacterial peptide of bacterial strain MCW02 fermentation liquor

The antibacterial peptide fermentation broth is respectively mixed with aqueous solutions with pH of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 (pH is adjusted by NaOH and HCl) in equal quantity, and acts for 1h at 37 ℃, staphylococcus aureus is used as an indicator strain, and the antibacterial activity of the antibacterial peptide fermentation broth is measured by a plate punching method. 80 mu L of antibacterial peptide fermentation liquor treated at different temperatures is added into each hole respectively. As shown in FIG. 4, the antibacterial activity of the antibacterial peptide fermentation broth is almost unchanged between pH 4 and 9, and the antibacterial activity is reduced between pH 2 and 4 and between pH 10 and 12, but the antibacterial activity is still maintained. This indicates a broader range of acid-base stability of the antimicrobial peptide broth.

Example 5 feed preservative experiment of Strain MCW02 fermentation broth

And (3) performing an antibacterial and mildew-removing experiment on the obtained bacterial strain MCW02 fermentation broth antibacterial peptide and the pig granular feed sold in the market in the storage process. (1) Uniformly spraying and mixing 5kg of pig pellet feed with 80mL of bacterial strain MCW02 fermentation liquor antibacterial peptide liquid, and sealing a bag mouth for storage at normal temperature; (2) sampling once every 10 days, sampling four times in the whole course. Taking 20g of feed each time, grinding, and mixing with 100mL of sterilized water to prepare a feed mixed bacteria leaching solution; (3) Placing the feed mixed bacteria leaching solution sampled each time and 100 mu L of bacterial strain MCW02 fermentation broth antibacterial peptide into a centrifuge tube, uniformly mixing, taking 20 mu L of the mixed solution, fully mixing the 20 mu L of the mixed solution with 80 mu L of sterilized water in an ultra-clean workbench, performing plating treatment on a solid LB culture medium, and culturing at a constant temperature of 37 ℃ for 12 hours. The next day, the colonies of the mixed bacteria on the solid LB medium were counted. PBS buffer sterilized at high temperature was also used as a control group. Each set of experiments was repeated three times and the presence of bacteria at different time points was analyzed.

The experimental results show that: the addition of the antimicrobial peptide from the MCW02 broth significantly reduced the number of infectious microbes in the granular feed for pigs during storage (table 5) compared to the 100uL sterilized PBS treated group.

Table 5 results of antibacterial and mildew-removing experiments of bacterial strain MCW02 fermentation broth antibacterial peptide on pig granular feed storage process

Note that: compared to PBS-treated group, x represents P <0.01.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples. Any changes, substitutions, modifications, combinations, simplifications, etc. that do not depart from the spirit and principles of the invention may be made by the equivalents and are included within the scope of the invention.

Claims (7)

1. Leuconostoc mesenteroides strain producing broad-spectrum high-efficiency antibacterial peptide, wherein the strain is specifically Leuconostoc mesenteroides (Leuconostoc mesenteroides) MCW02, and is preserved in China center for type culture Collection (China, with the preservation number: cctccc No. M20231423.

2. The preparation method of leuconostoc mesenteroides is characterized by comprising the following steps: the pickle is used as a bacterial source, and leuconostoc mesenteroides is cultivated in a culture medium.

3. The method of preparing as claimed in claim 2, wherein the kimchi is a pickled cabbage.

4. A broad-spectrum antimicrobial peptide-producing leuconostoc mesenteroides as claimed in claim 1, characterized in that: the amino acid sequence of the antibacterial peptide MCW02-AMP is as follows: LHRLCGSPSIPLSFNLAVVLPRRNT.

5. The use of the antimicrobial peptide MCW02-AMP of claim 4 for inhibiting growth of gram positive and gram negative bacteria and fungi.

6. Use according to claim 5, characterized in that the gram-positive bacterium is staphylococcus aureus, bacillus cereus; gram negative bacteria are Escherichia coli, salmonella, klebsiella pneumoniae and Pseudomonas aeruginosa; the fungus is filamentous fungus such as Penicillium, trichoderma, aspergillus niger, aspergillus oryzae, etc.

7. Use of the antibacterial peptide MCW02-AMP according to claim 4 for feed storage.