CN117143986A - Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis - Google Patents

Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis Download PDF

Info

Publication number
CN117143986A
CN117143986A CN202311113334.5A CN202311113334A CN117143986A CN 117143986 A CN117143986 A CN 117143986A CN 202311113334 A CN202311113334 A CN 202311113334A CN 117143986 A CN117143986 A CN 117143986A
Authority
CN
China
Prior art keywords
biomarker
multiple sclerosis
sez6l2
antibody
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311113334.5A
Other languages
Chinese (zh)
Inventor
王海虹
张国军
童勋章
李晓彤
柯起沈
李向云
王真
史一君
姜文灿
丁耀威
徐婷
宋浏伟
孙旭东
熊君辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiamen Innodx Biotech Co ltd
Xiamen Yingbomai Biotechnology Co ltd
Beijing Tiantan Hospital
Original Assignee
Xiamen Innodx Biotech Co ltd
Xiamen Yingbomai Biotechnology Co ltd
Beijing Tiantan Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiamen Innodx Biotech Co ltd, Xiamen Yingbomai Biotechnology Co ltd, Beijing Tiantan Hospital filed Critical Xiamen Innodx Biotech Co ltd
Priority to CN202311113334.5A priority Critical patent/CN117143986A/en
Publication of CN117143986A publication Critical patent/CN117143986A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/285—Demyelinating diseases; Multipel sclerosis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the use of SEZ6L2 as a biomarker in the diagnosis of multiple sclerosis; a kit or diagnostic reagent for detecting mRNA or encoded protein of the biomarker SEZ6L2 gene or fragment thereof in a biological sample. The method is used for predicting or diagnosing the multiple sclerosis, can be quantized, is more convenient to operate, has low professional requirements on operators, is more objective than the existing diagnosis method, is more beneficial to carrying out large-scale screening work, is more beneficial to the discovery and diagnosis of diseases, and provides a targeted personalized treatment scheme.

Description

Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis
Technical Field
The invention relates to the technical field of biological medicines, in particular to application of SEZ6L2 serving as a biomarker in diagnosis of multiple sclerosis, and a kit for screening Multiple Sclerosis (MS) and neuromyelitis optica (NMOSD). Further, the present invention also relates to a method of screening for agents that can be used to detect whether a subject has MS and/or can screen for NMOSD and MS.
Background
The neuromyelitis optica (neuromyelitis optica speetrum disorders, NMOSD) is an autoimmune mediated inflammatory demyelinating disease, mainly affecting young and elderly people, and is a typical clinical manifestation of neuromyelitis optica and acute transverse myelitis, with high recurrence rate and disability rate.
NMOSD was described and recorded by Devic in the early 19 th century and named Devic disease (Devic disease), an autoimmune disease, which involves the spinal cord and optic nerve and is a demyelinating disease of the central nervous system. Early researchers thought neuromyelitis optica (neuromyelitis optica, NMO) might be a subtype of multiple sclerosis (Multiple Sclerosis, MS), also known as neuromyelitis optica (MS) at the earliest, characterized by severe vision impairment and poor prognosis after spinal cord injury. With the intensive research, researchers confirmed that aquaporin 4-IgG (AQP 4-IgG) antibodies highly accumulated in astrocyte podites around the ventricles of the spinal grey matter, midbrain aqueduct directly participate in the onset of NMOSD. In 2015, neuromyelitis optica and the broader concept of NMOSD were defined by the international neuromyelitis diagnostic panel as an independent disease other than multiple sclerosis. NMOSD lesions involve sites including not only the optic nerve and spinal cord, but also the brain parenchyma. About half of NMOSD patients have serious walking difficulty, 60% -70% of patients are blind or unilateral vision is affected, and most patients remain serious dysuria, sleep disorder and the like. NMOSD is a disease with high recurrence and high disability, more than 90% of patients are in a multi-time disease course, about 60% of patients recur within 1 year, 90% of patients recur within 3 years, the life quality of the patients is seriously influenced, and simultaneously, great economic burden is caused to society.
The diagnosis of NMOSD is based on the medical history, core clinical symptoms and image characteristics, and makes diagnosis by referring to other subclinical and immunological evidences, and meanwhile, other diseases are required to be eliminated. The NMO diagnosis standard formulated by early Winger chuk et al takes optic neuritis and acute myelitis as necessary conditions, and the support conditions are 1) more than 3 vertebral body segments of spinal cord MRI abnormal lesions; 2) Skull MRI does not meet MS diagnostic criteria; 3) Serum NMO-IgG positive. NMO can be diagnosed if all the necessary conditions and 2 supporting conditions are provided. In 2004, the discovery of an IgG marker AQP4-IgG targeting aquaporin 4 changed the understanding of the pathogenesis of NMOSD and the development of diagnostics. NMOSD diagnostic standards established by the International NMO diagnostic group in 2015 are divided into AQP4-IgG positive and negative groups by taking the AQP4-IgG as a layering, 6 large core clinical characteristics are listed, consistency of imaging characteristics and clinical characteristics is emphasized, and stricter MRI additional conditions are provided for AQP4-IgG negative NMOSD.
Clinically, how to effectively screen MS and NMOSD is a problem that has always plagued clinicians. After AQP4-IgG was found as a serum biomarker for NMOSD, researchers thought that AQP4-IgG mediated aberrant immune response was a key factor in NMOSD development and was one of the important bases for diagnosis of NMOSD, but studies found that nearly 30% of NMOSD patients were still negative for AQP4-IgG and most MS patients were also negative for AQP4-IgG, which resulted in problems in clinical diagnosis for screening for NMOSD and MS, whereas in clinical diagnosis, differential diagnosis of the two diseases was critical because their corresponding treatment regimens were completely different: drugs with good therapeutic effects on MS (such as IFN-beta, nalaizumab, oral fingolimod, etc.) are not only ineffective on NMOSD but rather aggravate the condition of NMOSD, so that the MS and NMOSD are distinguished, and the method is critical for effective diagnosis and personalized treatment of diseases.
Therefore, there is a need to develop a new method and kit for detecting MS, and a method and kit for distinguishing MS from NMOSD.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides application of epileptic related protein 6-like protein 2 (SEZ 6L2 for short) as a biomarker in preparing a diagnosis product for multiple sclerosis, and mainly solves the problems that the existing MS diagnosis method is complicated in detection, high in cost, depends on experiences of related professionals, cannot be objectively quantified, cannot be screened in a large scale, cannot distinguish MS from NMOSD and the like.
In order to solve the above-mentioned industrial problems, the present invention adopts the following technical scheme:
it is a first object of the present invention to provide the use of an agent for detecting the expression level of a biomarker, SEZ6L2, in a biological sample from a subject in the manufacture of a product for predicting or diagnosing multiple sclerosis.
In the present invention, the biomarker SEZ6L2 includes mRNA of gene or fragment thereof or encoded protein and homologs, mutations, and isoforms thereof. The term encompasses full length, unprocessed biomarkers, as well as any form of biomarker derived from processing in a cell. The term encompasses naturally occurring variants (e.g., splice variants or allelic variants) of the biomarker.
The term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, horses, sheep, dogs, cows, pigs, chickens and other veterinary subjects. In a typical embodiment, the subject is a human.
The term "biological sample" includes, but is not limited to, tissue samples (e.g., tumor tissue samples), primary or cultured cells or cell lines, cell supernatants, cell lysates, blood, body fluids, lymph, synovial fluid, semen, amniotic fluid, milk, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysates, and tissue culture fluids, tissue extracts such as homogenized tissue, cell extracts, and combinations thereof.
Further, the product is useful for screening multiple sclerosis from neuromyelitis optica lineage disease.
Further, the reagent includes a reagent for detecting the mRNA expression level of the biomarker SEZ6L2 gene or a fragment thereof, or a reagent for detecting the expression level of the encoded protein of the biomarker SEZ6L2.
Further, the detection of the expression level of the mRNA of the biomarker SEZ6L2 gene or fragment thereof uses any one or more of a method selected from the group consisting of polymerase chain reaction, real-time fluorescent quantitative reverse transcription polymerase chain reaction, competitive polymerase chain reaction, nuclease protection assay, in situ hybridization method, nucleic acid microarray, northern blot, or DNA chip. The methods listed herein are limited, but are within the scope of protection of this patent as long as they are applicable to the prediction or diagnosis of multiple sclerosis by detecting mRNA of a biomarker gene or fragment thereof.
Further, the detection of the expression level of the encoded protein of biomarker SEZ6L2 uses any one or more selected from the group consisting of multiplex orthostretching assays, enzyme linked immunosorbent assays, radioimmunoassays, sandwich assays, western blots, immunoprecipitation, immunohistochemical staining, fluorescent immunoassays, enzyme substrate color development, antigen antibody aggregation, fluorescence activated cell sorting, mass spectrometry, assays employing a set of polyamine-specific stable isotope reagents, or protein chip measurements.
Further, the reagent comprises:
a primer or probe that specifically binds to mRNA of the biomarker SEZ6L2 gene or fragment thereof;
and/or an antibody, peptide, aptamer or compound that specifically binds to the biomarker SEZ6L2 protein.
The term "primer" refers to a nucleic acid sequence having a short free 3' -hydroxyl group, which is a short nucleic acid that can form base pairs with a complementary template and serve as an origin of replication for the template strand. The primer can prime DNA synthesis in the presence of reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates, in appropriate buffer solutions and temperatures. The PCR conditions and the length of the sense and antisense primers may be appropriately selected according to techniques known in the art.
The term "probe" refers to a nucleic acid fragment (e.g., RNA or DNA) corresponding to several bases to hundreds of bases that can specifically bind to mRNA, and the presence or absence of a particular mRNA and the level of expression can be confirmed by a tag. Probes may be prepared in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes or RNA probes. Suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.
The term "antibody" is well known in the art and refers to a specific immunoglobulin directed against an antigenic site. The antibody of the present invention refers to an antibody that specifically binds to the gene marker protein of the present invention, and the antibody can be produced according to a conventional method in the art. Forms of antibodies include polyclonal or monoclonal antibodies, antibody fragments (such as Fab, fab ', F (ab') 2, and Fv fragments), single chain Fv (scFv) antibodies, multispecific antibodies (such as bispecific antibodies), monospecific antibodies, monovalent antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen binding site of an antibody, and any other modified immunoglobulin molecule comprising an antigen binding site so long as the antibody exhibits the desired biological binding activity.
The term "peptide" has the ability to highly bind to a target substance and does not undergo denaturation during heat treatment/chemical treatment. Moreover, due to its small size, it can be used as a fusion protein by attaching it to other proteins. In particular, it can be specifically attached to a high molecular protein chain for use as a diagnostic kit and a drug delivery substance.
The term "aptamer" refers to a polynucleotide composed of a specific type of single-stranded nucleic acid (DNA, RNA or modified nucleic acid) which itself has a stable tertiary structure and has the property of being able to bind with high affinity and specificity to a target molecule. As described above, since an aptamer can specifically bind to an antigenic substance like an antibody, but is more stable than a protein and has a simple structure, and is composed of a polynucleotide that is easy to synthesize, it can be used instead of an antibody.
A second object of the present invention is to provide a kit for diagnosing multiple sclerosis, characterized in that it is used to detect in a biological sample one or more of the mRNA of the gene of the biomarker SEZ6L2 or a fragment thereof or its encoded protein.
It is a third object of the present invention to provide a diagnostic reagent for diagnosing multiple sclerosis for detecting the biomarker SEZ6L2, comprising a primer or probe that specifically binds to the mRNA of the biomarker gene or fragment thereof and/or an antibody that specifically binds to the protein-encoding marker of the biomarker.
Further, the antibody is a polyclonal antibody or a monoclonal antibody.
The diagnostic reagent for multiple sclerosis of the present invention can diagnose multiple sclerosis by quantitatively or qualitatively analyzing antigen of the antibody protein through antigen-antibody binding reaction. The antigen-antibody binding reaction can be detected by using a conventional enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), sandwich method, immunoblotting method, immunoprecipitation method, immunohistochemical staining method, fluorescent immunoassay method, enzyme-matrix staining method, antigen-antibody aggregation method, or the like. For example, the diagnostic kit is provided for performing ELISA by reacting a recombinant monoclonal antibody protein with a 96-well ELISA plate coated with a specimen and a control on the surface.
The polyclonal antibody is prepared by injecting the external host with a protein marker or fragment thereof as an antigen according to a common method known in the art. Such external hosts may include, for example, mammals such as mice, rats, sheep and rabbits. The antigen is typically administered by intramuscular, intraperitoneal or subcutaneous injection, together with an adjuvant to enhance antigenicity, to immunize an external host. Serum was collected periodically from the immunized external host. Subsequently, serum showing an increased titer and having specificity for antigen can be obtained, or antibodies can be isolated and purified from the serum, thereby preparing a polyclonal antibody specific for the marker protein.
The monoclonal antibodies may be prepared by the production process of fused immortalized cell lines known in the art (Kohler g.et al, nature,256:495-497, 1975). Briefly, the above procedure is described by first immunizing a mouse with the pure marker protein or fragment thereof. Alternatively, mice are immunized by synthesizing peptides of the marker proteins and binding them to bovine serum albumin. Antibody-producing B lymphocytes isolated from the immunized mice are fused with human or mouse myeloma cells to produce immortalized hybridoma cells. Subsequently, positive clones were selected by investigating the formation of monoclonal antibodies in the hybridoma cells by enzyme-linked immunosorbent assay (ELISA). Selected clones are cultured, and then antibodies are isolated and purified. Or injecting the clone into the abdominal cavity of a rat to collect ascites, thereby preparing a monoclonal antibody specific for the marker protein.
Antibodies for use in the detection of protein markers of the invention include intact forms having two full length light chains and two full length heavy chains, as well as functional fragments of antibody molecules. The functional fragment of the antibody molecule refers to a fragment having at least an antigen binding ability. Such as Fab, F (ab'), F (ab) 2, fv, and the like.
So far, many researches for diagnosing MS or screening MS and NMOSD by detecting specific biomarker levels are carried out in the industry, and the technologies or methods are complex in either process or operation or high in requirements on instrument and equipment configuration, are not beneficial to large-scale screening and clinical popularization; on the other hand, the screening effect is not obvious or ideal, and the clinical application value is low. In summary, there is currently no method for diagnosing MS and effectively distinguishing between MS and NMOSD through simple and effective detection of certain biomarker levels.
Aiming at the defects of the existing diagnostic method, the invention provides the biomarker which has simple process, is convenient and effective, is beneficial to large-scale screening, is convenient for clinical popularization of MS diagnosis and further can be used for screening MS and NMOSD and an application method of the biomarker.
According to the invention, through a large number of proteomic analysis works, the SEZ6L2 target is found to be possibly related to demyelinating diseases, the recombinant antigen is obtained through a genetic engineering technology, a monoclonal antibody which specifically recognizes the target is further developed by utilizing a monoclonal antibody technology, and after further analysis of blood samples and cerebrospinal fluid samples of related diseases, the marker is proved to have very high clinical value in MS diagnosis and further screening of MS and NMOSD diseases, and is beneficial to large-scale screening.
The invention has the advantages and beneficial effects that:
the invention provides a method for diagnosing MS by detecting the expression level of mRNA or coded protein of a biomarker SEZ6L2 gene or a fragment thereof in a human biological sample, which is quantized, convenient to operate, and has low professional requirements on operators, is more objective than the existing diagnosis method, is more beneficial to carrying out large-scale screening work, is more beneficial to finding and diagnosing diseases, and provides a targeted individual treatment scheme.
Drawings
The invention will be further described with reference to examples of embodiments with reference to the accompanying drawings.
FIG. 1 is a graph comparing the levels of biomarker SEZ6L 2-encoded protein in blood samples of patients with multiple sclerosis to normal persons.
FIG. 2 is a graph comparing the levels of biomarker SEZ6L 2-encoded protein in blood samples for multiple sclerosis and neuromyelitis optica lineage disease.
FIG. 3 is a graph comparing the levels of biomarker SEZ6L 2-encoded protein in blood samples of normal human, multiple sclerosis and neuromyelitis optica lineage disease.
FIG. 4 is a graph comparing biomarker SEZ6L2 encoded protein levels in cerebrospinal fluid of patients with multiple sclerosis and non-multiple sclerosis.
FIG. 5 is a graph comparing the levels of the biomarker SEZ6L 2-encoded protein in cerebrospinal fluid for non-demyelinating diseases, multiple sclerosis, and neuromyelitis optica lineage diseases.
FIG. 6 is a ROC graph of biomarker SEZ6L2 encoding protein levels in blood samples from patients with multiple sclerosis and normal humans.
FIG. 7 is a ROC graph of biomarker SEZ6L2 encoding protein levels in cerebrospinal fluid of patients with multiple sclerosis and non-multiple sclerosis.
FIG. 8 is a ROC graph of biomarker SEZ6L2 encoding protein levels in blood samples for multiple sclerosis and neuromyelitis optica spectrum disease.
FIG. 9 is a ROC graph of biomarker SEZ6L2 encoding protein levels in cerebrospinal fluid for multiple sclerosis and neuromyelitis optica lineage diseases.
Detailed Description
For a better understanding of the present invention, reference will now be made in detail to the following examples and accompanying drawings, which are included to provide a further understanding of the invention, and it is to be understood by those skilled in the art that the following examples are not intended to limit the scope of the invention.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
EXAMPLE 1 screening of Gene markers related to multiple sclerosis
The next generation of unlabeled quantitative proteomics technology is adopted to analyze the proteins differentially expressed by blood samples and cerebrospinal fluid samples of normal people and brain disease patients, and SEZ6L2 is selected as a study object.
EXAMPLE 2 monoclonal antibody for detecting multiple sclerosis and evaluation of Effect
1. Preparation of recombinant SEZ6L2 related protein
The amino acid sequence of the humanized full-length SEZ6L2 (Gene Bank: NM_ 001114100.3) is shown as SEQ ID NO. 1, the full-length nucleotide sequence is shown as SEQ ID NO. 2, the full-length Gene of the humanized SEZ6L2 is synthesized by general biological company and integrated in the pET-32a vector, and the PCR primer is completed by general biological company. And E.coli expression system is used for expression and purification to prepare pET-32a-SEZ6L2 full-length antigen (hereinafter referred to as antigen S1 for short).
Recovering a target fragment of the antigen S1 through enzyme digestion, connecting the target fragment with a pCold-TF expression vector, and further expressing and preparing a pCold-TF-SEZ6L2 full-length antigen (hereinafter simply referred to as an antigen S2); amplifying 1-395 fragment by using the plasmid as a template, cloning, and further expressing and preparing pCold-TF-SEZ6L2 1-395 fragment antigen (hereinafter abbreviated as antigen S3) in a pCold-TF vector; cloning the 1-395 fragment into a pTT5 vector, carrying out eukaryotic expression by using HEK293 cells to obtain a cell supernatant (hereinafter abbreviated as antigen S4) containing eukaryotic antigen pTT5-SEZ6L2-1-395, wherein the corresponding amino acid sequence is shown as SEQ ID NO. 3, and the nucleotide sequence is shown as SEQ ID NO. 4.
SEQ ID NO:1
MGTPRAQHPPPPQLLFLILLSCPWIQGLPLKEEEILPEPGSETPTVASEALAELLHGALLRRGPEMGYLPGSDPDPTLATPPAGQTLAVPSLPRATEPGTGPLTTAVTPNGVRGAGPTAPELLTPPPGTTAPPPPSPASPGPPLGPEGGEEETTTTIITTTTVTTTVTSPAYLLSCGFPPRPAHGDVSVTDLHPGGTATFHCDSGYQLQGEETLICLNGTRPSWNGETPSCMASCGGTIHNATLGRIVSPEPGGAVGPNLTCRWVIEAAEGRRLHLHFERVSLDEDNDRLMVRSGGSPLSPVIYDSDMDDVPERGLISDAQSLYVELLSETPANPLLLSLRFEAFEEDRCFAPFLAHGNVTTTDPEYRPGALATFSCLPGYALEPPGPPNAIECVDPTEPHWNDTEPACKAMCGGELSEPAGVVLSPDWPQSYSPGQDCVWGVHVQEEKRILLQVEILNVREGDMLTLFDGDGPSARVLAQLRGPQPRRRLLSSGPDLTLQFQAPPGPPNPGLGQGFVLHFKEVPRNDTCPELPPPEWGWRTASHGDLIRGTVLTYQCEPGYELLGSDILTCQWDLSWSAAPPACQKIMTCADPGEIANGHRTASDAGFPVGSHVQYRCLPGYSLEGAAMLTCYSRDTGTPKWSDRVPKCALKYEPCLNPGVPENGYQTLYKHHYQAGESLRFFCYEGFELIGEVTITCVPGHPSQWTSQPPLCKVAYEELLDNRKLEVTQTTDPSRQLEGGNYYTKLQGKSLFGFSGSHSYSPITVESDFSNPLYEAGDTREYEVSISEQ ID NO:2
ATGGGTACACCGCGCGCACAGCATCCGCCGCCTCCTCAACTGCTGTTTCTGATTCTGCTGAGTTGTCCGTGGATTCAGGGTCTGCCGCTGAAAGAAGAAGAAATTCTGCCGGAACCGGGTAGTGAAACCCCGACCGTGGCAAGTGAAGCCCTGGCCGAACTGCTGCATGGCGCCCTGCTGCGTCGCGGTCCTGAAATGGGCTATCTGCCGGGCAGTGATCCGGACCCTACCCTGGCAACCCCGCCGGCAGGTCAGACCCTGGCAGTTCCGAGTCTGCCGCGCGCCACCGAACCGGGTACAGGTCCTCTGACCACCGCAGTGACCCCGAATGGTGTGCGCGGCGCAGGCCCTACCGCCCCTGAGTTACTGACCCCGCCGCCGGGTACAACCGCACCTCCTCCTCCGAGTCCGGCCAGTCCGGGTCCTCCTCTGGGCCCTGAAGGTGGCGAAGAAGAAACCACCACCACCATTATTACCACCACCACAGTTACCACCACCGTGACCAGCCCGGCCTATCTGCTGAGCTGTGGTTTTCCGCCGCGCCCGGCCCACGGTGACGTTAGCGTTACCGATCTGCATCCGGGCGGTACAGCCACCTTTCATTGTGATAGCGGCTATCAGCTGCAGGGCGAAGAAACCCTGATTTGCCTGAATGGTACACGTCCGAGCTGGAATGGTGAAACCCCGAGCTGTATGGCCAGTTGCGGCGGCACCATTCATAATGCAACCCTGGGCCGCATTGTGAGCCCGGAACCGGGCGGTGCCGTTGGTCCTAATCTGACCTGCCGTTGGGTTATTGAAGCCGCCGAAGGCCGCCGCCTGCATCTGCATTTTGAACGCGTTAGTCTGGATGAAGATAATGATCGTCTGATGGTTCGTAGTGGTGGTAGTCCGCTGAGTCCGGTTATCTATGATAGTGATATGGATGATGTTCCGGAACGCGGTCTGATTAGCGATGCCCAGAGCCTGTATGTTGAACTGCTGAGTGAAACCCCTGCCAATCCGCTGCTGCTGAGTCTGCGTTTTGAAGCATTTGAAGAAGATCGCTGTTTTGCACCGTTTCTGGCCCACGGTAATGTGACCACCACCGATCCGGAATATCGCCCGGGTGCACTGGCAACCTTTAGCTGTCTGCCGGGTTATGCCCTGGAACCGCCGGGCCCTCCGAATGCTATTGAATGCGTTGATCCGACCGAACCGCATTGGAATGATACCGAACCGGCATGTAAAGCCATGTGCGGTGGCGAACTGAGTGAACCGGCAGGCGTTGTTCTGAGCCCGGATTGGCCGCAGAGCTATAGTCCGGGCCAGGATTGCGTTTGGGGTGTTCATGTTCAGGAAGAAAAACGCATTCTGCTGCAGGTGGAAATTCTGAATGTTCGTGAAGGCGATATGCTGACCCTGTTTGATGGCGATGGTCCGAGTGCACGCGTGCTGGCCCAGCTGCGTGGTCCTCAGCCGCGTCGTCGCCTGCTGAGTAGTGGTCCGGATCTGACCCTGCAGTTTCAGGCCCCGCCGGGCCCACCTAATCCGGGTTTAGGCCAGGGTTTTGTTCTGCATTTTAAAGAAGTTCCGCGCAATGATACCTGTCCGGAACTGCCGCCGCCGGAATGGGGTTGGCGTACCGCAAGCCACGGTGACCTGATTCGCGGTACAGTGCTGACCTATCAGTGTGAACCGGGTTATGAACTGCTGGGTAGTGATATTCTGACCTGCCAGTGGGATCTGAGTTGGAGCGCAGCCCCGCCGGCATGTCAGAAAATTATGACCTGCGCCGATCCGGGCGAAATTGCCAATGGCCATCGCACCGCAAGTGATGCAGGTTTTCCGGTGGGCAGTCATGTTCAGTATCGCTGTCTGCCGGGCTATAGCCTGGAAGGCGCAGCAATGCTGACCTGCTATAGCCGTGATACCGGCACCCCGAAATGGAGCGATCGCGTGCCGAAATGTGCACTGAAATATGAACCGTGTCTGAATCCGGGTGTTCCGGAAAATGGCTATCAGACCCTGTATAAACATCATTATCAGGCAGGCGAAAGTCTGCGTTTCTTTTGCTATGAAGGTTTTGAACTGATTGGTGAAGTTACCATTACCTGTGTTCCGGGCCATCCGAGCCAGTGGACCAGTCAGCCGCCGCTGTGCAAAGTGGCCTATGAAGAACTGCTGGATAATCGCAAACTGGAAGTGACCCAGACCACCGATCCTAGTCGTCAGCTGGAAGGCGGTAATTATTATACCAAACTGCAGGGTAAAAGTCTGTTTGGCTTTAGTGGTAGCCATAGTTATAGTCCGATTACCGTGGAAAGTGATTTTAGCAATCCGCTGTATGAAGCCGGTGACACCCGCGAATATGAAGTGAGCATT
SEQ ID NO:3
MGTPRAQHPPPPQLLFLILLSCPWIQGLPLKEEEILPEPGSETPTVASEALAELLHGALLRRGPEMGYLPGSDPDPTLATPPAGQTLAVPSLPRATEPGTGPLTTAVTPNGVRGAGPTAPELLTPPPGTTAPPPPSPASPGPPLGPEGGEEETTTTIITTTTVTTTVTSPAYLLSCGFPPRPAHGDVSVTDLHPGGTATFHCDSGYQLQGEETLICLNGTRPSWNGETPSCMASCGGTIHNATLGRIVSPEPGGAVGPNLTCRWVIEAAEGRRLHLHFERVSLDEDNDRLMVRSGGSPLSPVIYDSDMDDVPERGLISDAQSLYVELLSETPANPLLLSLRFEAFEEDRCFAPFLAHGNVTTTDPEYRPGALATFSCLPGYALEPPGPPNAIECV
SEQ ID NO:4
ATGGGTACACCGCGCGCACAGCATCCGCCGCCTCCTCAACTGCTGTTTCTGATTCTGCTGAGTTGTCCGTGGATTCAGGGTCTGCCGCTGAAAGAAGAAGAAATTCTGCCGGAACCGGGTAGTGAAACCCCGACCGTGGCAAGTGAAGCCCTGGCCGAACTGCTGCATGGCGCCCTGCTGCGTCGCGGTCCTGAAATGGGCTATCTGCCGGGCAGTGATCCGGACCCTACCCTGGCAACCCCGCCGGCAGGTCAGACCCTGGCAGTTCCGAGTCTGCCGCGCGCCACCGAACCGGGTACAGGTCCTCTGACCACCGCAGTGACCCCGAATGGTGTGCGCGGCGCAGGCCCTACCGCCCCTGAGTTACTGACCCCGCCGCCGGGTACAACCGCACCTCCTCCTCCGAGTCCGGCCAGTCCGGGTCCTCCTCTGGGCCCTGAAGGTGGCGAAGAAGAAACCACCACCACCATTATTACCACCACCACAGTTACCACCACCGTGACCAGCCCGGCCTATCTGCTGAGCTGTGGTTTTCCGCCGCGCCCGGCCCACGGTGACGTTAGCGTTACCGATCTGCATCCGGGCGGTACAGCCACCTTTCATTGTGATAGCGGCTATCAGCTGCAGGGCGAAGAAACCCTGATTTGCCTGAATGGTACACGTCCGAGCTGGAATGGTGAAACCCCGAGCTGTATGGCCAGTTGCGGCGGCACCATTCATAATGCAACCCTGGGCCGCATTGTGAGCCCGGAACCGGGCGGTGCCGTTGGTCCTAATCTGACCTGCCGTTGGGTTATTGAAGCCGCCGAAGGCCGCCGCCTGCATCTGCATTTTGAACGCGTTAGTCTGGATGAAGATAATGATCGTCTGATGGTTCGTAGTGGTGGTAGTCCGCTGAGTCCGGTTATCTATGATAGTGATATGGATGATGTTCCGGAACGCGGTCTGATTAGCGATGCCCAGAGCCTGTATGTTGAACTGCTGAGTGAAACCCCTGCCAATCCGCTGCTGCTGAGTCTGCGTTTTGAAGCATTTGAAGAAGATCGCTGTTTTGCACCGTTTCTGGCCCACGGTAATGTGACCACCACCGATCCGGAATATCGCCCGGGTGCACTGGCAACCTTTAGCTGTCTGCCGGGTTATGCCCTGGAACCGCCGGGCCCTCCGAATGCTATTGAATGCGTT
2. Preparation of anti-SEZ 6L2 monoclonal antibody
1. Preparation of immunogen:
the antigen S1 was diluted to 0.2mg/mL with 10mmol/L PBS, and the corresponding antigen was mixed with Freund' S adjuvant in an equal volume at a final concentration of 100ug/mL to form a water-in-oil emulsion. Primary immunization used Freund's complete adjuvant, and booster immunization used Freund's incomplete adjuvant.
2. Basic immunization: the BALB/c female mice with the age of 6-8 weeks are selected for subcutaneous multipoint injection immunization, the injection dose of immunogen is 500 mu L/dose, the immunization interval is 2 weeks, the complete immunization program is 4 needles, the separated serum is collected by an orbit blood sampling method for indirect ELISA determination of the immunization titer in 2 weeks after the immunization of the 2 nd needle and the 4 th needle, and the immunogen is immunized with 100 ug/dose in spleen 72 hours before cell fusion after the serum titer of the mice reaches the plateau.
3. Hybridoma cell screening
3.1 preparation of macrophages from feeder cells:
(i) BALB/c mice with age of about 6 weeks are killed by cervical diversion, and soaked in 75% alcohol solution for 5 min; taking out, placing into a sterile plate placed on an ultra-clean workbench in advance, adjusting the posture of the mouse by using a hemostatic forceps, enabling the abdomen of the mouse to face upwards, enabling the whole mouse to be more stretched, placing the mouse horizontally, clamping the skin at the position, which is close to the abdomen of the mouse, of the mouse by using the hemostatic forceps, tearing the skin in the opposite direction due to sudden force, and fully exposing the abdomen.
(ii) The peritoneum is lifted by the sterile ophthalmic curved forceps, then a proper amount of culture medium is injected into the abdominal cavity by using a 5mL syringe, so that the abdominal part of the mouse is fully inflated, the syringe is put down, the opposite limbs of the mouse are lifted up and gently shaken by matching the two hand-held hemostats, and after the macrophages in the abdominal cavity are fully infiltrated, the macrophages are sucked out by using the same syringe and injected into the 1640HT culture medium which is prepared in advance and contains 20% fetal calf serum for standby.
3.2 preparation of thymocytes for feeder cells:
(i) The BALB/c mice with three weeks of age are killed by cervical diversion and soaked in 75% alcohol solution for 5 min; taking out, placing into a sterile plate placed on an ultra-clean workbench in advance, adjusting the posture of the mouse by using a hemostatic forceps, enabling the abdomen of the mouse to face upwards, enabling the whole mouse to be more stretched, placing the mouse horizontally, clamping the skin at the position close to the chest of the mouse by using the hemostatic forceps, tearing the skin in the opposite direction by sudden force, and fully exposing the chest and the abdomen.
(ii) The chest and abdomen skin is clamped by the aseptic forceps for the left hand to clamp the sternum tip, the chest and abdomen skin is cut along the outer edge of the sternum body, the chest diaphragm is fully exposed, and the state of clamping the sternum tip and exposing the chest as much as possible is always kept.
(iii) The right hand-held clean ophthalmology shears the thoracic diaphragm, fully exposes the thoracic cavity, uses the bent forceps to probe into the thoracic cavity, clamps the root of the thymus, completely takes out the thymus, puts the thymus into a 200-mesh screen which is placed in a plate in advance and is soaked by a culture medium for grinding, and obtains thymus feeder cell sap which is fully transferred into the 1640HT culture medium containing 20% fetal bovine serum for standby.
3.3 preparation of mouse myeloma cells: mouse myeloma cells are resuscitated 5 days before fusion, and about 6 bottles of 35cm are needed for each fusion 2 Mouse myeloma cells at 90% -100% density.
3.4 preparation of spleen cells:
(i) Taking BALB/C mice to be fused, taking blood from the eyesockets, stopping blood flow, killing the mice after neck breaking, soaking in 75% alcohol solution for 5min, and then placing the mice on a sterile plate in an ultra clean bench, and positioning on the right side.
(ii) The abdominal cavity was exposed as described in 3.1, the spleen was removed by opening the abdominal cavity and placed in a 200 mesh screen previously placed in a dish and infiltrated with medium for milling, and a spleen cell suspension was prepared and transferred to a 50mL sterile centrifuge tube.
(iii) Supplementing 30-35mL of an appropriate amount of RPMI-1640 culture solution, removing obvious fat aggregates and other impurities by using a bent pipe, centrifuging at 1500rpm/min for 5 min/time, collecting spleen cells, centrifuging to remove supernatant, supplementing 30-35mL of a new culture medium, and repeating the process for 2 times to clean the spleen cells.
(iv) Cells were resuspended in RPMI-1640 medium and counted.
3.5 cell fusion:
(i) 1mL of PEG-1450 and 35mL of RPMI-1640 serum-free medium and 200mL of pre-prepared HAT complete medium containing 20% fetal bovine serum were pre-warmed to 37℃prior to fusion.
(ii) The prepared myeloma cells and spleen cells are proportioned to be 1 multiplied by 10 8 Splenocyte +1×10 7 Myeloma cells were mixed in a 50mL centrifuge tube at about 10:1, centrifuged at 1500rpm X5 min, and after centrifugation, the supernatant was decanted as much as possible, and the bottom of the tube was gently flicked to loosen the cells into a paste.
(iii) 1mL of PEG is sucked by a 1mL pipette and added into a centrifuge tube, the mixture is gently blown and mixed by an elbow while the time is controlled to be about 60s, and then 35mL of pre-warmed RPMI-1640 complete culture solution is added to terminate the fusion reaction.
(iv) Standing for 1-5min, centrifuging at 1000rpm×5min, carefully discarding supernatant, gently flicking cells with finger, adding the above complete culture medium, fully suspending cells, transferring into complete culture medium with feeder cells, mixing, spreading into 96-well cell culture plate at 200 ul/well, and adding CO 2 Culturing in an incubator.
(v) After 7 days, 100% exchange of the cell supernatant in the wells was performed with 15% ht complete medium; after 7 days, the supernatant was aspirated for detection.
3.6 selection of hybridomas:
the antigen S1 is used for primary screening, 1 antigen which is fused with pET-32a is used for differential screening in an auxiliary mode, carrier antigens are from Inbocai (product number: E3211), self-made recombinant antigens S2 and S3 are used for identification, the screening method is indirect ELISA, the specific method is that 200ng/mL of the antigen is coated, 100ul of the antigen is coated on each hole, 50ul of cell supernatant is added, the cell supernatant is incubated at 37 ℃ for 30min, a plate washer is used for washing the plate 5 times, 100ul of GAM-HRP prepared by 1:5K is added, the plate washer is used for washing the plate 5 times after incubation for 30min at 37 ℃,100 ul/Kong Xianse of liquid is added, after incubation for 15min at 37 ℃, stop solution is used for stopping reaction, the signal value is read by double wavelengths in an enzyme-labeling instrument, and the corresponding positive hole cells are selected for next step work according to experimental results.
3.7 cloning of hybridoma cells: the limiting dilution method is adopted, the cells are subjected to gradient dilution according to a certain concentration, and then inoculated into each well of a 96-well cell culture plate, so that only one cell grows in the well as much as possible. The hybridoma monoclonal positive cell line was repeatedly cloned at least 3 times, and after the last round of 100% positive, it was confirmed as a stable clone line.
Antibodies were screened as shown in table 1:
TABLE 1SEZ6L2 fusion screening cell lines and antigen reactivity thereof
Cell strain S1 S2 S3 E3211
A1 3.5360 3.9490 3.7940 0.0120
A3 3.5200 3.6760 3.6430 0.0110
A10 3.5490 3.8410 3.6870 0.0130
B4 3.3050 3.6870 3.7300 0.0110
B8 2.9110 3.5750 3.6350 0.0060
F3 3.7220 3.9580 3.6720 0.0110
G2 2.6540 3.6030 3.5110 0.0180
G7 2.9440 3.5410 3.5580 0.0620
3.8 antibody typing:
50 ul/well of stable cell strain supernatant was added in parallel to the antigen S3 coated plate, the plate was washed 5 times after being placed in an incubator at 37 ℃ for 30min, 50 ul/well of IgG1, igG2a, igG2b, igG3 and IgM typing enzymes were added after beating, 100 ul/Kong Xianse solution was added after reaction for 30min, and reading plate was stopped with stop solution after 15min, and typing results are shown in Table 2.
TABLE 2 SE6L2 Screen to obtain cell line typing results
4. Monoclonal antibody preparation
4.1 production of monoclonal antibody ascites
Sensitized BALB/c mice, after 1 week, cells were collected by re-suspending the stationary hybridoma cells in logarithmic growth phase and centrifuging at 1500rpm for 5min, the precipitated cells were suspended in serum-free medium, and the cell number was adjusted to (1-2). Times.10 6 Per mL, each mouse was intraperitoneally injected with 0.5mL for ascites induction. After 7-10d, the abdominal distension of the mice is evident, and the ascites is collected. The collected ascites were centrifuged in a centrifuge tube at 12000rpm for 10min, and the supernatant was collected for use after centrifugation.
4.2 preparation of monoclonal antibody
The collected ascites is purified by ammonium sulfate precipitation and Protein A affinity chromatography (purchased from GE company in the United states), and the purity of the monoclonal antibody obtained by purification is above 90% by 12% SDS-PAGE running gel identification.
3. anti-SEZ 6L2 protein mouse monoclonal antibody enzyme-linked immunosorbent assay (EIA) paired screening
Coating the first antibody on a radiation plate according to 5ug/mL,100 ul/hole and 37 degrees for 2 hours by using 20mmol/L PB7.4 as a coating buffer solution; the secondary antibody was labeled with horseradish peroxidase HRP at a 1:1 ratio at a final concentration of 1mg/mL and a labeling concentration of 1:1000. The 8 antibodies obtained in example 2 were paired in sequence to perform 8 x 8 orthogonal pairing evaluation, the evaluation samples were 1000ng/mL antigen S1, 1000ng/mL S2 and 10mmol/L PBS, the evaluation results are shown in table 3, wherein the overall pairing activity of A1, a10, B4, B8, G2, G7 in the label was too low, the overall pairing activity of A1, A3, a10, B8, G2, G7 in the coating was too low, the labels A3 and F3 were retained, and the coatings B4 and F3 were retained for further pairing screening.
TABLE 3 SEZ6L2 antibody orthogonal pairing results
/>
/>
The 2 markers and 2 coatings obtained in the results are further used for detecting section identification and pairing detection sensitivity comparison by using S1, S3 antigens and S4 expression supernatant, the S4 cell supernatant with the antigen concentration of 1000ng/ml is used for original times, the coating concentration is unchanged, the enzyme use concentration is increased to 1:100, the pairing result is shown in table 4, the results show that the 4 pairs all recognize the 1-395aa section of SEZ6L2, the overall detection sensitivity of the A3 marker is lower than that of the F3 marker, certain non-specificity exists, the overall detection sensitivity and the specificity of the B4-F3 pair are better, and further sample evaluation is carried out.
Table 4.Sez6l2 paired detection segment identification
Coating Marking S1 S3 S4 PBS
B4 A3 3.4990 3.4860 0.3670 0.1370
F3 A3 3.4110 3.4710 0.2160 0.0140
B4 F3 3.3530 3.2870 2.6480 0.0440
F3 F3 1.5830 3.2590 1.4090 0.0450
4. Analysis performance evaluation of SEZ6L2 antibody paired clinical samples
1. Serum sample evaluation
1.1MS vs normal human sample:
the detection effect on clinical samples was evaluated by collecting 33 MS sera and 60 normal sera and using the above pair B4-F3. The specific method comprises the following steps: all samples and the S1 antigen 100 ul/hole diluted in a gradient are added into an ELISA plate of the B4 coated antibody, incubation is carried out for 30min at 37 ℃, the plate is washed for 5 times, F3-HRP diluted by 100 ul/hole 1:200 is added, continuous reaction is carried out for 30min at 37 ℃, the plate is washed for 5 times, the developing solution of 100 ul/hole is added, the developing reaction is stopped after 15min at 37 ℃, the ELISA plate is read, the concentration of SEZ6L2 in the samples is calculated back by using an S1 standard curve, and the concentration result is subjected to statistical analysis of data by using Graphpad Prism 8.0. The results are shown in FIG. 1, where SEZ6L2 levels in normal human blood samples were significantly higher than in MS patients, suggesting that SEZ6L2 levels in blood samples may be used for MS diagnosis.
1.2NMOSD vs. MS samples
The detection effect on clinical samples was evaluated using the above pair B4-F3 by collecting 33 MS serum and 48 NMOSD serum. The specific method comprises the following steps: all samples and the S1 antigen 100 ul/hole diluted in a gradient are added into an ELISA plate of the B4 coated antibody, incubation is carried out for 30min at 37 ℃, the plate is washed for 5 times, F3-HRP diluted by 100 ul/hole 1:200 is added, continuous reaction is carried out for 30min at 37 ℃, the plate is washed for 5 times, the developing solution of 100 ul/hole is added, the developing reaction is stopped after 15min at 37 ℃, the ELISA plate is read, the concentration of SEZ6L2 in the samples is calculated back by using an S1 standard curve, and the concentration result is subjected to statistical analysis of data by using Graphpad Prism 8.0. The results are shown in fig. 2, where SEZ6L2 levels in the blood sample of the NMOSD patient were significantly higher than those of the MS patient, suggesting that SEZ6L2 levels in the blood sample may be used to discriminate MS from NMOSD patients.
1.3MS, NMOSD and normal human sample comparison results
The comparison of SEZ6L2 levels in blood samples of MS, NMOSD and normal persons is shown in fig. 3, suggesting that SEZ6L2 levels in blood samples may be used to diagnose MS, further screening NMOSD from MS patients.
2. Cerebrospinal fluid sample evaluation
2.1 comparison of MS with other non-MS disease cerebrospinal fluid samples
Samples of MS and NON-MS cerebrospinal fluid were collected in 33 and 30 cases, and the analysis results are shown in FIG. 4, in which SEZ6L2 levels in cerebrospinal fluid were significantly higher in patients with multiple sclerosis than in patients without multiple sclerosis.
2.2 comparison of samples of MS, NMOSD and cerebrospinal fluid for non-demyelinating diseases
The SEZ6L2 level pairs of 33, 30 and 48 samples of MS, NMOSD and non-demyelinating disease cerebrospinal fluid are shown in FIG. 5, and the SEZ6L2 level in cerebrospinal fluid of patients with neuromyelitis spectrum diseases is obviously higher than that of patients with multiple sclerosis and further higher than that of other patients with non-demyelinating diseases, so that the SEZ6L2 level of cerebrospinal fluid can be used for diagnosing multiple sclerosis and neuromyelitis spectrum diseases and further can be used for screening multiple sclerosis and neuromyelitis spectrum diseases.
3. SEZ6L2 body fluid level ROC Curve analysis
ROC curve analysis was performed with Graphpad Prism 8.0.
ROC Curve analysis of 3.1SEZ6L2 body fluid levels in diagnosis of multiple sclerosis
3.1.1 blood sample
The ROC curve of SEZ6L2 blood sample levels in the diagnosis of multiple sclerosis was analyzed separately using software as shown in fig. 6, and the results showed that SEZ6L2 in blood samples were of significant clinical value for the diagnosis of multiple sclerosis, respectively.
3.1.2 cerebrospinal fluid samples
The ROC curve of SEZ6L2 blood sample levels in the diagnosis of multiple sclerosis, respectively, was analyzed by software as shown in fig. 7, and the results showed that SEZ6L2 of cerebrospinal fluid was clinically valuable for diagnosis of multiple sclerosis, respectively, but not as significant as in blood samples.
ROC curve analysis of 3.2SEZ6L2 body fluid levels in screening for multiple sclerosis disease and neuromyelitis optica lineage disease
3.2.1 blood sample
The ROC curves of SEZ6L2 blood sample level in multiple sclerosis and neuromyelitis optica pedigree diseases are respectively analyzed by using software, the results are shown in fig. 8, and the results show that the SEZ6L2 level in the blood sample has obvious value in clinical screening of multiple sclerosis and neuromyelitis optica respectively.
3.2.2 cerebrospinal fluid samples
The ROC curves of SEZ6L2 cerebrospinal fluid sample level in multiple sclerosis and neuromyelitis optica pedigree diseases are respectively analyzed by software, the results are shown in fig. 9, and the results show that the SEZ6L2 level in the cerebrospinal fluid sample has obvious value for clinically discriminating multiple sclerosis and neuromyelitis optica respectively.
In summary, the invention provides a method for diagnosing MS by detecting the expression level of mRNA or encoded protein of a biomarker SEZ6L2 gene or fragments thereof in a human biological sample, which is quantized, more convenient to operate, less in professional requirements on operators, more objective than the existing diagnosis method, more beneficial to carrying out large-scale screening work, more beneficial to finding and confirming diseases and providing a targeted personalized treatment scheme.
While specific embodiments of the invention have been described above, it will be appreciated by those skilled in the art that the specific embodiments described are illustrative only and not intended to limit the scope of the invention, and that equivalent modifications and variations of the invention in light of the spirit of the invention will be covered by the claims of the present invention.

Claims (9)

1. Use of an agent for detecting the expression level of a biomarker in a biological sample from a subject in the manufacture of a product for predicting or diagnosing multiple sclerosis, wherein the biomarker is SEZ6L2.
2. The use according to claim 1, wherein the product is for screening multiple sclerosis from neuromyelitis optica lineage diseases.
3. The use of claim 1, wherein the reagent comprises a reagent for detecting the mRNA expression level of the biomarker gene or fragment thereof, or a reagent for detecting the expression level of the encoded protein of the biomarker.
4. The use according to claim 3, wherein the detection of the expression level of the mRNA of the biomarker gene or fragment thereof uses any one or more of the methods selected from the group consisting of polymerase chain reaction, real-time fluorescent quantitative reverse transcription polymerase chain reaction, competitive polymerase chain reaction, nuclease protection assay, in situ hybridization method, nucleic acid microarray, northern blot, and DNA chip.
5. The use of claim 3, wherein the detection of the expression level of the encoded protein of the biomarker uses any one or more selected from the group consisting of multiplex orthotopic extension assay, enzyme linked immunosorbent assay, radioimmunoassay, sandwich assay, western blot, immunoprecipitation, immunohistochemical staining, fluoroimmunoassay, enzyme substrate color development, antigen-antibody aggregation, fluorescence activated cell sorting, mass spectrometry, assay employing a set of polyamine-specific stable isotope reagents, or protein chip measurement.
6. The use according to any one of claims 1 to 5, wherein the agent comprises:
a primer or probe that specifically binds to mRNA of the biomarker gene or fragment thereof;
and/or an antibody, peptide, aptamer, or compound that specifically binds to the biomarker protein.
7. A kit for diagnosing multiple sclerosis, wherein the kit is used to detect one or more of the mRNA of the gene of the biomarker of claim 1 or a fragment thereof, or a protein encoding it, in a biological sample.
8. A diagnostic reagent for diagnosing multiple sclerosis, wherein the diagnostic reagent is used for detecting the biomarker of claim 1, the diagnostic reagent comprising a primer or probe that specifically binds to mRNA of the biomarker gene or fragment thereof and/or an antibody that specifically binds to a protein-encoding marker of the biomarker.
9. The diagnostic reagent for diagnosing multiple sclerosis according to claim 8, wherein the antibody is a polyclonal antibody or a monoclonal antibody.
CN202311113334.5A 2023-08-31 2023-08-31 Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis Pending CN117143986A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311113334.5A CN117143986A (en) 2023-08-31 2023-08-31 Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311113334.5A CN117143986A (en) 2023-08-31 2023-08-31 Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis

Publications (1)

Publication Number Publication Date
CN117143986A true CN117143986A (en) 2023-12-01

Family

ID=88886298

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311113334.5A Pending CN117143986A (en) 2023-08-31 2023-08-31 Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis

Country Status (1)

Country Link
CN (1) CN117143986A (en)

Similar Documents

Publication Publication Date Title
US20220153865A1 (en) Synthetic peptide, relative artificial antigen, relative anti-ehd2 antibody and preparation method thereof and use thereof
WO2012091465A2 (en) Monoclonal antibodies to serum amyloid a, and hybridoma cells producing same
CN107271680A (en) Method for detecting autoimmune antibody of human myelin oligodendrocyte glycoprotein
WO2007030890A1 (en) A marker for prolonged rupture of membranes
WO2018147679A1 (en) Kit for rapid diagnosis of asthma or allergy disease
JPH0614873B2 (en) Monoclonal antibody
CN117209609B (en) Monoclonal antibody of anti-human CD64 membrane protein and application thereof
US6071737A (en) Equine Neospora isolate and its uses
CN117143986A (en) Application of SEZ6L2 as biomarker in diagnosis of multiple sclerosis
CN109402063B (en) Porcine hemoglobin-resistant hybridoma cell strain, monoclonal antibody and application thereof
CN117210550A (en) Use of GPR37L1 as biomarker in diagnosis of multiple sclerosis
CN116143909B (en) anti-HIV-1P 24 antibody and preparation method and application thereof
CN111670201A (en) Her2 concomitant diagnosis immunohistochemical detection antibody and application thereof
CN117801104A (en) Antibodies that specifically bind GPR37 or fragments thereof and uses thereof
KR102168417B1 (en) Monoclonal antibody with specificity for the toxin of Corynebacterium diphtheriae, hybridoma cell line producing the same and use thereof
CN110865184B (en) Application of SRSP protein and SRSP epitope peptide and product for diagnosing and treating tumors
WO2023245800A1 (en) Anti-cryptococcus capsular polysaccharide monoclonal antibody and use thereof
CN117802214A (en) Marker for diagnosis of multiple sclerosis and application thereof
CN116120455B (en) Recombinant antibody for resisting CA15-3 protein
WO2023245801A1 (en) Anti-candida mannan monoclonal antibody and use thereof
CN116769040B (en) Mouse anti-GDH hybridoma cell strain, monoclonal antibody and application
CN116003567A (en) Immunogenic fragment peptides of EN2 protein or antibody compositions specifically recognizing same
TWI702400B (en) Method for detecting ovarian cancer, method for monitoring progression of ovarian cancer in an ovarian cancer patient, and use of a reagent that recognizes a cleaved c3 polypeptide
CN113087801B (en) Kit for jointly detecting lung cancer by using nucleic acid and antibody
CN113788892B (en) Rapid detection kit applying anti-herpes simplex virus monoclonal antibody

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination